CROSS-REFERENCE TO A RELATED APPLICATION This application claims the benefit of U.S. Provisional Application Ser. No. 62/830,688, filed Apr. 8, 2019, the disclosure of which is hereby incorporated by reference in its entirety, including all figures, tables and drawings.
This invention was made with Government support under Contract No. NACA-58-6062-6 awarded by the U.S. Department of Agriculture. The Government has certain rights in the invention.
BACKGROUND OF THE INVENTION The present invention relates to a new and distinct dogwood cultivar, which has fused bracts. This dogwood is botanically known as Cornus kousa and hereinafter referred to by the following cultivar name: ‘Melissa's Mountain Snowfall’.
This new dogwood cultivar was discovered in a planting of seedlings in the University of Tennessee Arboretum in Oak Ridge, Tenn. ‘Melissa's Mountain Snowfall’ is a half-sibling of ‘Pam's Mountain Bouquet’ (U.S. Plant Pat. No. 25,575; Wadl et al., 2014, HortScience 49(9):1230-1233). Asexual reproduction of ‘Melissa's Mountain Snowfall’ has shown that the unique features of this new dogwood cultivar are stable and reproduced true-to-type in successive vegetative generations.
BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1. Photograph of ‘Melissa's Mountain Snowfall’. Colors in the photograph may differ from actual colors due to lighting and light reflectance.
FIG. 2. Photograph of enlarged view of bracts on ‘Melissa's Mountain Snowfall’.
FIG. 3. Photograph of the unripe fruit of “Melissa's Mountain Snowfall.” Also shown are the paper collars of the dried bracts that remain on the petioles and around the fruit.
FIG. 4. Photograph of the ripe fruit of ‘Melissa's Mountain Snowfall’. FIG. 5. Photograph showing the exfoliating bark on the trunk of older specimens of ‘Melissa's Mountain Snowfall’.
DETAILED DESCRIPTION OF THE NEW VARIETY A new and distinct cultivar of flowering dogwood having fused bracts is provided. This dogwood tree cultivar is botanically known as Cornus kousa and referred to by the cultivar name: ‘Melissa's Mountain Snowfall’. This cultivar exhibits insect resistance and disease resistance, particularly to powdery mildew caused by Erisphe pulchra. Dogwood anthracnose caused by Discula destructiva has never been observed on ‘Melissa's Mountain Snowfall’.
This new and distinct dogwood tree cultivar was discovered in a planting of seedlings within the Arboretum at the University of Tennessee located in Oak Ridge, Tenn. The subject dogwood tree cultivar is a half-sibling of the Cornus kousa dogwood cultivar known as ‘Pam's Mountain Bouquet’. Table 1 shows the observed phenotypic similarities and differences between the two cultivars.
TABLE 1
General phenotypic differences between the dogwood cultivars ‘Melissa's
Mountain Snowfall’ and ‘Pam's Mountain Bouquet’. (** = Key differences)
‘Melissa's Mountain Snowfall’ ‘Pam's Mountain Bouquet’
About 80% of all bracts on About 82% of all bracts on
the cultivar exhibit some the cultivar exhibit some
degree of fusion degree of fusion
Resistance to Disease and Resistance to Disease and
Insect Damage Insect Damage
Exfoliating Bark in older specimens** No exfoliating bark
Inverted pyramidal growth habit** Spreading growth habit
Multiple leaders** Single leader
Six meters in height** 3-4 meters in height
In addition to the phenotypic differences listed above, it has also been observed that the alleles of the two cultivars differ at 5 of 8 selected loci. Asexual reproduction of ‘Melissa's Mountain Snowfall’ by grafting of axillary buds onto seedling rootstocks has shown that the unique features of this new dogwood cultivar are stable and reproduced true-to-type in successive generations.
DETAILED BOTANICAL DESCRIPTION The following observations, measurements and comparisons describe the cultivar ‘Melissa's Mountain Snowfall’ grown in Oak Ridge, Tenn. Trees used for this description were about thirty (30) years old. Plant hardiness is expected to be zones 3-9. The color characteristic descriptions use color references to The Royal Horticultural Society (R.H.S.) Colour Chart, The Royal Horticultural Society, London, UK, 4th Edition, 2001, except where general terms of ordinary dictionary significance are used. It has been determined that alleles differ at 5 of 8 loci shared by ‘Melissa's Mountain Snowfall’ and ‘Pam's Mountain Bouquet’, as shown in Table 2.
TABLE 2
Allelic Comparison of ‘Melissa's Mountain Snowfall’ and ‘Pam's
Mountain Bouquet’ at specified loci
‘Melissa's Mountain ‘Pam's Mountain
Snowfall’ (bp size Bouquet’ (bp size
Locus for each allele) for each allele)
CK005* 228:228 222:247
CK072* 113:122 113:117
CK058* 152:152 148:148
CK031 140:140 140:140
CK040* 102:102 94:94
CK029 90:102 90:102
CK015* 119:122 130:136
CK047 128:128 128:128
Table 3 indicates the primer sequences and microsatellite markers (or single sequence repeats—SSR) in ‘Melissa's Mountain Snowfall’ compared with the same microsatellite markers (SSR) in ‘Pam's Mountain Bouquet.’ Those loci indicated with an asterisk (*) differ between the two cultivars:
TABLE 3
Primer Sequences and Microsatellite markers
compared between ‘Melissa's Mountain Snowfall’
and ‘Pam's Mountain Bouquet’
GenBank Microsatellite Repeat Sequences
Acces- Repeat
sion No. Locus Primer Sequence (5′-3′) Motif
EU544308 CK005* F: GCATTTGTCCTTTGTTTGACAT (AC)20
(SEQ ID 1)
R: TTTTTCGCGAAGTGTTCTCTAC
(SEQ ID 2)
EU125523 CK015* F: GTCAAATTTTTGATCTTTCTCTCT (CT)10
(SEQ ID 3)
R: GGAGAGACAGAGTACAGTAGAGGT
(SEQ ID 4)
EU125524 CK029 F: AATTTAGGTTAAGGTTTTGATTTG (TC)8
(SEQ ID 5)
R: AGAGAGAATAGGTTACAGCATCAT
(SEQ ID 6)
EU125525 CK031 F: TGTCACTGCTTACAGAAACAAT (CT)7
(SEQ ID 7)
R: TATGACGAGATTGTATAAGTTGCT
(SEQ ID 8)
EU125526 CK040* F: CCAAGTCAGTTTGGTAGTAATTC (GT)16
(SEQ ID 9)
R: AGTGCAACTTTTACTTGCTATGT
(SEQ ID 10)
EU544309 CK058* F: CTTAAGTCACAAAGACAATGAAAT (GT)10
(SEQ ID 11)
R: AAGAGAGTTCAGATTTATCTTTGC
(SEQ ID 12)
EU544312 CK072* F: AGCACTCATAGTCCTTGCAC (GT)10
(SEQ ID 13)
R: GTTAAAACGAAGAAGATACAACAA
(SEQ ID 14)
EU125528 CK047 F: GAAAGAGATAAAAGATGGTTCAAT (AC)6
(SEQ ID 15)
R: CTTATAGAGTAAGCCCACCATC
(SEQ ID 16)
The cultivar ‘Melissa's Mountain Snowfall’ has some similarity in phenotypic characteristics to the cultivar ‘Pam's Mountain Bouquet’ (Wadl et al., 2014). The following Table 4 provides a comparison of each cultivar for those characteristics that have been observed. Measurements are provided as an average (with ranges also provided as indicated):
TABLE 4
Characteristics of ‘Melissa's Mountain Snowfall’and
Pam's Mountain Bouquet′
Color Descriptions are based upon the
Royal Horticultural Society's (RHS) colour chart, 4th Edition 2001.
‘Melissa's Mountain ‘Pam's Mountain
Character Snowfall’ Bouquet’
1 Tree form Inverted pyramidal spreading
(observation)
2 Tree height 5-6 meters low
(observation) (about 3-4
meters; spread
about 4 -5
meters, and
dependent on age
and environment)
3 Branch thickness Not observed medium
(measurement) (age dependent)
Thickness in the
middle portion of
a plant
4 Color of current Not observed Green
Shoot 143B
(observation)
current shoot
color in the
middle portion of
a plant
5 Branch color Mixture of 156A, Greyed; Green
(observation) 197B, and 198B 198B
current branch
color in the
middle portion of
a plant second
year+
6 Dark spots on Not observed Absent
Branch
(observation)
presence of dark
spots on the
branch
7 Branching High High
(observation)
density of
branching
8 Internode length Not observed Short
(measurement)
Internode length
in the middle
portion of a plant
9 Whole shape of Obovate Obovate
leaves (observation)
see FIG. 1 whole
shape of a leaf in
the middle portion
of a plant
10 Shape of leaf Acuminate Acuminate
tip (observation)
see FIG. 2 Tip
shape of a leaf in
the middle portion
of a plant
11 Shape of leaf Truncate Truncate
Base (observation)
see FIG. 2
Base shape of a
leaf in the middle
portion of a plant
12 Shape of leaf Entire Entire
Margin (observation)
shape of a leaf
margin in the
middle portion of
a plant
13 Leaf rolling Not observed Rolling inward
(observation) see
FIG. 4
14 Leaf curvature Not observed Flat
(observation) see
FIG. 5
15 Leaf margin Not observed None
Undulation (observation)
16 Leaf length Averages 87.1 mm Long
(measurement) (about 100-140
Length from the m)
tip to the base of
mature leaf
17 Leaf width Averages 44.4 mm Narrow
(measurement) (about 40-50
The maximum mm)
width of mature
leaf
18 Leaf thickness Medium Medium
(observation)
Thickness of
mature leaf
19 Bud color (observation) 138B, unopened; Grayish green
Color of bud just 132D, opened 179A
after sprouting
20 Immature leaf Not observed Light Green
color (observation) 135B
21 Presence of Absent Absent
anthocyanin
(observation)
Coloration by
anthocyanin on
the immature leaf
upperside
22 Color of leaf 143A Green
upperside (observation) 143B
Color of mature
leaf upperside
23 Color of leaf 143C Light Green
lowerside (observation) 146B
Color of mature
leaf lowerside
24 Seasonal change Changed Changed
of a mature leaf
(observation)
25 Color of leaves in Red Red
autumn (observation) 10C −46A 10C −46A
26 Leaf variegation Not variegated Not variegated
(observation)Variegation
on
leaf upperside
27 Variegation Not observed NA
pattern (observation);
Pattern of
variegation on a
leaf upperside
28 Variegation color Not observed NA
(observation)
29 seasonal change Not observed NA
of variegation
color (observation)
30 Hair on leaf None None
upperside (observation)
hair density on a
mature leaf
upperside
31 Hair on leaf None None
lowerside (observation)
hair density on a
mature leaf
lowerside
32 Petiole length Average about 10.4 Short
(measurement) Length mm; unequal (about 15-25
from at base, about 5-7 mm)
the base of blade mm longer
to the base petiole on one side
33 Petiole width Medium (<7 mm) Medium
(measurement) (<8 mm)
The maximum
width of a mature
leaf petiole
34 Petiole color Green 143A Green
(observation) 143B
35 Inflorescence type Umbel Umbel
(observation)
36 Inflorescence Upright Upright
direction (observation)
37 Inflorescence Average about 31.7 Medium
diameter (observation) (diagonal mean
length = 74 mm.;
mean width =
53 mm)
38 Flower diameter Not observed Small
(measurement)
39 Floret diameter Not observed Small
(measurement)
40 Floret color Yellow Yellow
(observation) 150A 150C
41 Bract type (observation) 80% are fused, but 83% are fused,
variable (See Table) but variable
(See Table 3)
42 Uniformity of Not uniform Not uniform
bract size (observation)
43 Bract overlapping No overlap of No overlap of
(observation) unfused bracts unfused
bracts
44 Bract orientation Recurved, Reflexed, Recurved,
(observation) or Flat Reflexed, or Flat
45 Bract rolling Varies (may roll Varies (may roll
(observation) inward or outward inward or
outward
46 Degree of bract Medium strong
rolling (observation)
47 Bract curvature Varies Varies
(observation) (can be recurved, (can be recurved,
flat, or reflexed) flat, or reflexed)
48 Bract twisting None None
(observation)
49 Whole shape of Ovate Ovate
bracts (observation)
50 Shape of bract Acuminate Acuminate
apex (observation)
51 Unfused bract length Inner Bract Average Medium
(measurement) 48 mm; Outer Bract
Average 43 mm
52 Unfused Bract width Inner bract Average
(measurement) 27 mm; outer bract
average 28 mm.
53 Number of bracts 4 FUSED; Diameter FUSED, but 4
(measurement) average 89.5 mm
54 Bract color 157B 155A
(measurement) (immature:
157A)
55 Bract variegation Not variegated Not variegated
(observation)
56 Variegation NA NA
pattern (observation)
57 Variegation color NA NA
(measurement)
58 Pistil color (observation) Yellow green Not Yellow green
coded Not coded
59 Stigma color Dark Green Dark Green
(observation) (Not Coded) (Not Coded)
60 Peduncle Medium Medium
thickness
(measurement)
61 Peduncle length Average 69 mm Long
(measurement) (mean of 68 mm)
62 Peduncle color Yellow green 143C Yellow green
(observation) 144B
63 Fruit shape (observation) Globose Globose
64 Fruit length About 28.7-29.3 mm Medium
(measurement) (about 40 mm)
65 Fruit width About 28.7-29.3 Medium
(measurement) mm (about 4.0 mm)
66 Fruit color (observation) 134N, Fall; 60D- Unripe:143B;
61A, when ripe Ripe 33B to 43A.
Highly variable
depending on
ripeness
67 Fragrance (observation) Absent Absent
68 Seed fertility Not observed High
(observation)
69 Time to the first Medium Medium
flowering (observation) (April-mid-May) (April-mid-May)
70 Blooming habit Prolific Many
(observation)
71 Flowering season One season One season
(observation) flowering
72 Flowering time About 5-6 weeks About 5-6 weeks
(observation)
73 Deciduous or Deciduous Deciduous
evergreen (observation)
74 Cold hardiness To −20C Medium
(observation) (to −20° C.-no
effect)
75 Heat tolerance Strong Strong
(observation) (to 40° C.-no effect) (to 40° C.-no
effect)
76 Pest resistance No specific pests Strong
(observation) noted some spots of (no specific pests
brown anthracnose, noted;
160A
77 Disease resistance Strong resistant to Strong resistant
(observation) dogwood to dogwood
anthracnose and anthracnose and
powdery mildew: powdery mildew
some spot some spot
anthracnose anthracnose on
especially on bracts especially on
bracts
78 Bark color exfoliating bark Grayed-Green
177b and 143C; 198B
exfoliated areas
199C-D
79 Bark texture Exfoliating Smooth
80 Angle of emerging 20° C.-35° C.from 20° C.-30° C. from
branches vertical stem vertical stem
81 Time to first leaf bud Mid-to late-April Mid- to late-April
burst
82 Leaf Vein color (bottom 145B Green-Greyed
side) 192A
83 Immature Leaf color Similar to fully Similar to fully
expanded leaf color expanded leaf
color
84 Bract base Truncate Truncate
85 Bract margin Entire Entire
86 Vestiture Puberulous, Puberulous,
reticulate reticulate
87 Flower/ Mean =31 Mean = 34
inflorescensce number
88 Seed shape Flattened along Flattened along
length length
89 Seed color Greyed Yellow Greyed Yellow
162D 162D
90 Seed number 0-17 per fruit 0-17 per fruit
91 Bloom duration 3-5 weeks 3-5 weeks
(dried, dead bracts (dried, dead
are retained as a bracts are
“collar”on peduncle retained as a
until fruit fall in “collar”on
Autumn) peduncle until
fruit fall in
Autumn)
92 Time of fruit ripening Begins in mid- Begins mid-to
August and Ripe in late-August
October through October
93 Trunk diameter (at base) Multiple stem 18 cm at 15 years
variable. About 10- of age
14 cm; numerous
lenticles;
94 Anther color N79B Greyed-purple
N186
95 Flower petal color Yellow-green Yellow-green
145C 145C
96 Style/Stigma description Inconspicuous Inconspicuous
Botanical classification: Cornus kousa ‘Melissa's Mountain Snowfall’.
Unique Features: This tree features prolific flowering and exhibits fused bracts. About 80% of all bracts on the cultivar exhibit some degree of fusion (one side, two sides or three to four sides being fused), as shown in Table 5.
TABLE 5
Types of fused bracts observed on ‘Melissa's Mountain Bouquet’
Not Two sides 3 sides Fully
Year fused fused fused Fused
2016 29 23 17 32
(n = 101) (29%) (23%) (17%) (32%)
2017 39 28 33 45
(n = 145) (27%) (19%) (23%) (31%)
2019 7 12 14 90
(n = 123) (6%) (10%) (11%) (73%)
Mean 25 21 21 55.7
(20.7%) (17.3%) (17.0%) (45.3%)
Disease susceptibility: None noted. Powdery mildew caused by Erisphe pulchra was not observed. There was some minor occurrence of spot anthracnose caused by Elsinoe cornii observed in 2017-2019. Dogwood anthracnose caused by Discula destructiva has never been observed on ‘Melissa's Mountain Snowfall’.
Insect Damage: Minor insect damage on leaves.
REFERENCES
- Wadl, P. A., M. T. Windham, R. E. Evans, and R. N. Trigiano. 2014. Three new cultivars of Cornus kousa: Empire, Pam's Mountain Bouquet, and Red Steeple. HortScience 49(9):1230-1233.
