This invention was made with Government support under Contract No. NACA-58-6062-6 awarded by the U.S. Department of Agriculture. The Government has certain rights in the invention.
Latin name of the genus and species: Cornus kousa.
Variety denomination: ‘Melissa's Mountain Snowfall’.
The Sequence Listing for this application is labeled “Seq-List.txt” which was created on Nov. 1, 2019 and is 4 KB. The entire content of the sequence listing is incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION The present invention relates to a new and distinct dogwood cultivar, which has fused bracts. This dogwood is botanically known as Cornus kousa ‘Melissa's Mountain Snowfall’, hereinafter referred to as ‘Melissa's Mountain Snowfall’. The unique characteristic of this variety is the non-overlapping fusion of the bracts, shape of the tree, and bark characteristics.
This new dogwood cultivar was discovered in a planting of seedlings in the University of Tennessee Arboretum in Oak Ridge, Tenn. ‘Melissa's Mountain Snowfall’ is a half-sibling of ‘Pam's Mountain Bouquet’ (U.S. Plant Pat. No. 25,575; Wadl et al., 2014, HortScience 49(9):1230-1233). Asexual reproduction of ‘Melissa's Mountain Snowfall’ in Belvidere, Tenn. was by axillary bud grafting onto a generic Cornus kousa seedling rootstock and has shown that the unique features of this new dogwood cultivar are stable and reproduced true-to-type in successive vegetative generations.
BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1. Photograph of a ‘Melissa's Mountain Snowfall’ tree that is approximately 30 years old. The spread of this tree is about 7 meters. Colors in the photograph may differ from actual colors due to lighting and light reflectance.
FIG. 2. Photograph of enlarged view of bracts on ‘Melissa's Mountain Snowfall’.
FIG. 3. Photograph of the unripe fruit of ‘Melissa's Mountain Snowfall’. Also shown are the paper collars of the dried bracts that remain on the petioles and around the fruit.
FIG. 4. Photograph of the ripe fruit of ‘Melissa's Mountain Snowfall’.
FIG. 5. Photograph showing the exfoliating bark on the trunk of older specimens of ‘Melissa's Mountain Snowfall’.
DETAILED DESCRIPTION OF THE NEW VARIETY A new and distinct cultivar of flowering dogwood having fused bracts is provided. This dogwood tree cultivar is botanically known as Cornus kousa and referred to by the cultivar name: ‘Melissa's Mountain Snowfall’. This cultivar exhibits insect resistance and disease resistance, particularly to powdery mildew caused by Erysiphe pulchra. Dogwood anthracnose caused by Discula destructiva has never been observed on ‘Melissa's Mountain Snowfall’.
The subject cultivar is different compared to the Cornus kousa varieties ‘Red Steeple’ and ‘Empire’. The following Table 1 sets forth the difference between these cultivars and ‘Melissa's Mountain Snowfall’:
TABLE 1
Characteristics of ‘Melissa's Mountain Snowfall’ compared
with two similar cultivars
‘Melissa's Mountain
Snowfall’ ‘Red Steeple’ ‘Empire’
Habit Spreading Narrow Linear - short Narrow linear Tall
columnar Columnar
Fused Bracts Non-fused bracts Non-fused bracts
Large Bracts white Small bracts - some pink Small bracts
margin
This new and distinct dogwood tree cultivar was discovered in a planting of seedlings within the Arboretum at the University of Tennessee located in Oak Ridge, Tenn. The subject dogwood tree cultivar is a half-sibling of the Cornus kousa dogwood cultivar known as ‘Pam's Mountain Bouquet’. Table 2 shows the observed phenotypic similarities and differences between the two cultivars.
TABLE 2
General phenotypic differences between the dogwood cultivars
‘Melissa's Mountain Snowfall’ and ‘Pam's Mountain Bouquet’.
‘Melissa's Mountain Snowfall’ ‘Pam's Mountain Bouquet’
About 80% of all bracts on the About 82% of all bracts on the
cultivar exhibit some degree of fusion cultivar exhibit some degree of
fusion
Resistance to Disease and Resistance to Disease and
Insect Damage Insect Damage
Exfoliating bark in older specimens** No exfoliating bark
Inverted pyramidal growth habit** Spreading growth habit
Multiple leaders** Single leader
Six meters in height** 3-4 meters in height
(** = Key differences)
In addition to the phenotypic differences listed above, it has also been observed that the alleles of the two cultivars differ at 5 of 8 selected loci. Asexual reproduction of ‘Melissa's Mountain Snowfall’ by grafting of axillary buds onto generic Cornus kousa seedling rootstocks has shown that the unique features of this new dogwood cultivar are stable and reproduced true-to-type in successive generations.
DETAILED BOTANICAL DESCRIPTION The following observations, measurements and comparisons describe the cultivar ‘Melissa's Mountain Snowfall’ grown in Oak Ridge, Tenn. Trees used for this description were about thirty (30) years old. Plant hardiness is expected to be zones 3-9. The color characteristic descriptions use color references to The Royal Horticultural Society (R.H.S.) Colour Chart, The Royal Horticultural Society, London, UK, 4th Edition, 2001, except where general terms of ordinary dictionary significance are used. It has been determined that alleles differ at 5 of 8 loci shared by ‘Melissa's Mountain Snowfall’ and ‘Pam's Mountain Bouquet’, as shown in Table 3.
TABLE 3
Allelic Comparison of ‘Melissa's Mountain Snowfall’ and
‘Pam's Mountain Bouquet’ at specified loci
‘Melissa's Mountain ‘Pam's Mountain
Snowfall’ Bouquet’
Locus (bp size for each allele) (bp size for each allele)
CK005* 228:228 222:247
CK072* 113:122 113:117
CK058* 152:152 148:148
CK031 140:140 140:140
CK040* 102:102 94:94
CK029 90:102 90:102
CK015* 119:122 130:136
CK047 128:128 128:128
Table 4 indicates the primer sequences and microsatellite markers (or single sequence repeats—SSR) in ‘Melissa's Mountain Snowfall’ compared with the same microsatellite markers (SSR) in ‘Pam's Mountain Bouquet.’ Those loci indicated with an asterisk (*) differ between the two cultivars.
TABLE 4
Primer Sequences and Microsatellite markers
compared between ‘Melissa's Mountain Snowfall’
and ‘Pam's Mountain Bouquet’
GenBank Microsatellite Repeat Sequences
Accession Repeat
No. Locus Primer Sequence (5′-3′) Motif
EU544308 CK005* F:GCATTTGTCCTTTGTTTGACAT (AC)20
(SEQ ID 1)
R:TTTTTCGCGAAGTGTTCTCTAC
(SEQ ID 2)
EU125523 CK015* F:GTCAAATTTTTGATCTTTCTCTCT (CT)10
(SEQ ID 3)
R:GGAGAGACAGAGTACAGTAGAGGT
(SEQ ID 4)
EU125524 CK029 F:AATTTAGGTTAAGGTTTTGATTTG (TC)8
(SEQ ID 5)
R:AGAGAGAATAGGTTACAGCATCAT
(SEQ ID 6)
EU125525 CK031 F:TGTCACTGCTTACAGAAACAAT (CT)7
(SEQ ID 7)
R:TATGACGAGATTGTATAAGTTGCT
(SEQ ID 8)
EU125526 CK040* F:CCAAGTCAGTTTGGTAGTAATTC (GT)16
(SEQ ID 9)
R:AGTGCAACTTTTACTTGCTATGT
(SEQ ID 10)
EU544309 CK058* F:CTTAAGTCACAAAGACAATGAAAT (GT)10
(SEQ ID 11)
R:AAGAGAGTTCAGATTTATCTTTGC
(SEQ ID 12)
EU544312 CK072* F:AGCACTCATAGTCCTTGCAC (GT)10
(SEQ ID 13)
R:GTTAAAACGAAGAAGATACAACAA
(SEQ ID 14)
EU125528 CK047 F:GAAAGAGATAAAAGATGGTTCAAT (AC)6
(SEQ ID 15)
R:CTTATAGAGTAAGCCCACCATC
(SEQ ID 16)
The cultivar ‘Melissa's Mountain Snowfall’ has some similarity in phenotypic characteristics to the cultivar ‘Pam's Mountain Bouquet’ (Wadl et al., 2014). The following Table 5 provides a comparison of each cultivar for those characteristics that have been observed. Measurements are provided as an average (with ranges also provided as indicated):
TABLE 5
Characteristics of ‘Melissa's Mountain Snowfall’ and Pam's
Mountain Bouquet’
Color Descriptions are based upon the Royal Horticultural Society's
(RHS) colour chart, 4th Edition 2001.
‘Melissa's Mountain ‘Pam's Mountain
Character Snowfall’ Bouquet’
1 Tree form Inverted pyramidal spreading
(observation)
2 Tree height 5-6 meters height low
(observation) and about a 7 meter (about 3-4
spread meters; spread
about 4-5 meters,
and dependent on
age and
environment)
3 Branch thickness Medium Variable, medium
(measurement) dependent on age (age dependent)
Thickness in the
middle portion of
a plant
4 Color of current Green 144A turning Green
Shoot Greyed-Green 197A 143B
(observation)
Current shoot
color in the
middle portion of
a plant
5 Branch color Mixture of 156A, Greyed-Green
(observation) 197B, 198B, 200C 198B
Current branch and 200D
color in the
middle portion of
a plant by second
year
6 Dark spots on Absent Absent
Branch
(observation)
Presence of dark
spots on the
branch
7 Branching High High
(observation)
Density of
branching
8 Internode length Mostly short, but Short
(measurement) some intermediate
Internode length (variable + 6-9 cm)
in the middle
portion of a plant
9 Whole shape of Obovate Obovate
leaves (observation)
see FIGS. 2, 3 and 4
Whole shape of a
leaf in the middle
portion of a plant
10 Shape of leaf Acuminate Acuminate
tip (observation)
see FIG. 2
Tip shape of a leaf in
the middle portion
of a plant
11 Shape of leaf Truncate Truncate
Base (observation)
see FIG. 2
Base shape of a
leaf in the middle
portion of a plant
12 Shape of leaf Entire Entire
Margin (observation)
Shape of a leaf
margin in the
middle portion of
a plant
13 Leaf rolling Typically none, but Rolling inward
(observation) see some inward
Fig. 4
14 Leaf curvature Mostly flat Flat
(observation)
15 Leaf margin Some leaves None
Undulation undulating
(observation)
16 Leaf length Averages 87.1 mm Long
(measurement) (about 100-400
Length from the mm)
tip to the base of
mature leaf
17 Leaf width Mean 44.4 mm Narrow
(measurement) (about 40-50
The maximum mm)
width of mature
leaf
18 Leaf thickness Medium Medium
(observation)
Thickness of
mature leaf
19 Bud color Green 138B, Greyed-red
(observation) unopened; 179A
Color of bud just Green 132D, opened;
after sprouting infrequently Yellow-
Green 151C
20 Immature leaf Not observed Green
color (observation) 135B
21 Presence of Absent Absent
anthocyanin
(observation)
Coloration by
anthocyanin on
the immature leaf
upperside
22 Color of leaf Green 143A Green
upperside 143B
(observation)
Color of mature
leaf upperside
23 Color of leaf Green 143B; Yellow-Green
Lower side Green 143C 146B
(observation)
Color of mature
leaf lower side
24 Seasonal change Changed Changed
of a mature leaf
(observation)
25 Color of leaves in Yellow to Red Red
autumn (observation) (Variable) Changes 10C-46A
in Leaf Fall Color
10C-46A
26 Leaf variegation Not variegated Not variegated
(observation)
Variegation on leaf
upper side
27 Variegation NA NA
pattern (observation)
Pattern of variegation
on a leaf upperside
28 Variegation color NA NA
(observation)
29 Seasonal change NA NA
of variegation
color (observation)
30 Hair on leaf None None
upperside (observation)
Hair density on a
mature leaf upperside
31 Hair on leaf None None
lowerside (observation)
Hair density on a
mature leaf lowerside
32 Petiole length Short about 10.4 Short
(measurement) mm; unequal at base, (about 15-25
Length from the base about 5-7 mm longer mm)
of blade to the on one side
base petiole
33 Petiole width Medium (<7 mm) Medium
(measurement) (<8 mm)
The maximum width
of a mature leaf petiole
34 Petiole color Green 143A-143C Green
(observation) 143B
35 Inflorescence type Umbel Umbel
(observation)
36 Inflorescence Upright Upright
direction (observation)
37 Inflorescence Average about 31.7 Medium
diameter mm (diagonal mean
(observation) length = 74 mm;
mean width = 53
mm)
38 Flower diameter Small; Each about 5- Small
(measurement) 7 mm
39 Floret color Yellow-Green 151A Yellow-Green
(observation) 150C
40 Bract type 80% are fused, but 83% are fused,
(observation) variable (See Table but variable
6) (See Table 2)
41 Uniformity of Not uniform Not uniform
bract size (observation)
42 Bract overlapping No overlap of No overlap of
(observation) unfused bracts unfused
bracts
43 Bract orientation Recurved, Reflexed, Recurved,
(observation) or Flat Reflexed, or Flat
44 Bract rolling Varies (may roll Varies (may roll
(observation) inward or outward) inward or
outward)
45 Degree of bract Medium Strong
rolling (observation)
46 Bract curvature Varies Varies
(observation) (can be recurved, (can be recurved,
flat, or reflexed) flat, or reflexed)
47 Bract twisting None None
(observation)
48 Whole shape of Ovate Ovate
bracts (observation)
49 Shape of bract Acuminate Acuminate
apex (observation)
50 Unfused bract length Inner Bract Average Medium
(measurement) 48 mm; Outer Bract
Average 43 mm
51 Unfused Bract width Inner Bract Average
(measurement) 27 mm; Outer Bract
Average 28 mm
52 Number of bracts 4 FUSED; Diameter FUSED, but 4
(measurement) average 89.5 mm, all
four bracts fused,
after flowering
remains as a papery
collar (Grey-Brown
199D) at base of the
petiole
53 Bract color Green-White 157B White 155A
(measurement) (immature: Green-
White 157A)
54 Bract variegation Not variegated Not variegated
(observation)
55 Variegation NA NA
pattern (observation)
56 Variegation color NA NA
(measurement)
57 Pistil color Yellow green 148C Yellow green
(observation) (Not coded)
58 Stigma color Green Dark Green
(observation) (N138B) (Not Coded)
59 Peduncle Medium Medium
thickness
(measurement)
60 Peduncle length Average 69 mm Long
(measurement) (mean of 68 mm)
61 Peduncle color Green 143C Yellow-Green
(observation) 144B
62 Fruit shape Globose Globose
(observation)
63 Fruit length About 28.7-29.3 mm Medium
(measurement) (about 40 mm)
64 Fruit width About 28.7-29.3 mm Medium
(measurement) (about 4.0 mm)
65 Fruit color Green 134N, Fall; Unripe: Green 143B;
(observation) Red- Ripe: Orange-Red
Purple 60D-61A, 33B to 43A. Highly
when ripe in variable depending
October on ripeness
66 Fragrance (observation) None Absent
67 Seed fertility Not observed High
(observation)
68 Time to the first Medium Medium
flowering (observation) (Mid-April-late (April-mid-May)
May)
69 Blooming habit Prolific Many
(observation)
70 Flowering season One season One season
(observation) flowering
71 Flowering time About 5-6 weeks About 5-6 weeks
(observation)
72 Deciduous or Deciduous Deciduous
evergreen (observation)
73 Cold hardiness To −20° C. Medium
(observation) (to −20° C.-no
effect)
74 Heat tolerance Strong Strong
(observation) (to 40° C.-no (to 40° C.-no
effect) effect)
75 Pest resistance No specific pests Strong
(observation) noted some leaf (no
spots of brown specific pests
anthracnose noted)
(Unidentified
etiology - no control
measures necessary)
Brown N200A
76 Disease resistance Strong resistant to Strong resistant
(observation) dogwood to dogwood
anthracnose and anthracnose and
powdery mildew; powdery mildew;
some spot some spot
anthracnose anthracnose
especially on bracts especially on
bracts
77 Bark color Exfoliating bark Greyed-Green
Greyed-Orange 198B
177B and Green
143C; exfoliating
areas Greyed-Brown
199C-199D
78 Bark texture Exfoliating Smooth
79 Angle of emerging 20°-35° from 20°-30° from
branches vertical stem vertical stem
80 Time to first leaf bud Mid- to late-April Mid- to late-April
burst
81 Leaf Vein color Yellow-Green 145B Greyed-Green
(bottom side) 192A
82 Immature Leaf color Similar to fully Similar to fully
expanded leaf color expanded leaf
color
83 Bract base Truncate Truncate
84 Bract margin Entire Entire
85 Vestiture Puberulous, Puberulous,
reticulate reticulate
86 Flower/ Mean = 31 Mean = 34
inflorescence number
87 Seed shape Flattened along Flattened along
length length
88 Seed color Greyed Yellow Greyed Yellow
162D 162D
89 Seed number 0-17 per fruit 0-17 per fruit
90 Bloom duration 3-5 weeks 3-5 weeks
(dried, dead bracts (dried, dead
are retained as a bracts are
“collar” on peduncle retained as a
until fruit fall in “ collar” on
Autumn) peduncle until
fruit fall in
Autumn)
91 Time of fruit ripening Begins mid-August Begins mid- to
and Ripe in October late-August
through October
92 Trunk diameter Multiple stem 18 cm at 15 years
(at base) variable. About 10- of age
14 cm; numerous
lenticels
93 Anther color Purple N79B Greyed-purple
N186A
94 Flower petal color Yellow-green Yellow-green
145C 145C
95 Style/Stigma Inconspicuous Inconspicuous
description
- Botanical classification: Cornus kousa ‘Melissa's Mountain Snowfall’.
- Unique features: This tree features prolific flowering and exhibits fused bracts. About 80% of all bracts on the cultivar exhibit some degree of fusion (one side, two sides or three to four sides being fused), as shown in Table 6.
TABLE 6
Types of fused bracts observed on ‘Melissa's Mountain Bouquet’
Year Not fused Two sides fused 3 sides fused Fully Fused
2016 (n = 29 (29%) 23 (23%) 17 (17%) 32 (32%)
101)
2017 (n = 39 (27%) 28 (19%) 33 (23%) 45 (31%)
145)
2019 (n = 7 (6%) 12 (10%) 14 (11%) 90 (73%)
123)
Mean 25 (20.7%) 21 (17.3%) 21 (17.0%) 55.7 (45.3%)
- Disease susceptibility: None noted. Powdery mildew caused by Erysiphe pulchra was not observed. There was some minor occurrence of spot anthracnose on bracts caused by Elsinoe cornii observed in 2017-2019. Most spots were discrete, less than 1 cm in diameter and various hues in the red-purple group N74C-D. Cold damage may also result in discoloration of bracts similar to spot anthracnose or over larger areas. Dogwood anthracnose caused by Discula destructiva has never been observed on ‘Melissa's Mountain Snowfall’.
- Insect damage: Minor insect damage on leaves.
REFERENCES
- Wadl, P. A., M. T. Windham, R. E. Evans, and R. N. Trigiano. 2014. Three new cultivars of Cornus kousa: Empire, Pam's Mountain Bouquet, and Red Steeple. HortScience 49(9):1230-1233.