This invention was made with Government support under Contract No. NACA-58-6062-6 awarded by the U.S. Department of Agriculture. The Government has certain rights in the invention.
The Sequence Listing for this application is labeled “Seq-List.txt” which was created on Oct. 29, 2019 and is 4 KB. The entire content of the sequence listing is incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION The present invention relates to a new and distinct cultivar of flowering dogwood tree with a mixture of both fully dark red and lighter red bracts. This new cultivar was the result of a controlled cross that produced a few seeds, which were planted in a greenhouse in Knoxville, Tenn. This new cultivar was discovered among the resulting seedlings. This dogwood tree is botanically known as Cornus florida L. and is hereinafter referred to by the following cultivar name: ‘Erica's Appalachian Sunrise’. Analysis has shown that this new dogwood cultivar is the result of self-pollination of the dogwood cultivar ‘Cherokee Brave’ (U.S. Plant Pat. No. 10,166). The seedling of ‘Erica's Appalachian Sunrise’ was harvested on its own rootstock. Results have shown that the unique features of this new dogwood cultivar are stable and reproduced true-to-type in successive vegetative generations.
BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1. Photograph of one type of bracts and flowers of the dogwood cultivar ‘Erica's Appalachian Sunrise’. This bract has fully dark red coloration and is less than about 5% of the bracts produced by the cultivar. Colors in the photograph may differ from actual colors due to lighting and light reflectance.
FIG. 2. Photograph of ‘Erica's Appalachian Sunrise’ dogwood cultivar showing the other type of bract and flowers produced more than about 95% of the time on the dogwood tree, which has lighter red or more pink bracts. Colors in the photograph may differ from actual colors due to lighting and light reflectance.
FIG. 3. Photograph of new leaf growth on ‘Erica's Appalachian Sunrise’. Colors in the photograph may differ from actual colors due to lighting and light reflectance.
FIG. 4. Photographs of the bracts and flowers of dogwood cultivars ‘Cherokee Brave’ and ‘Karen's Appalachian Blush’, (U.S. Plant Pat. No. 13,165), which were initially crossed. Results show that the resulting F1 cultivar, ‘Erica's Appalachian Sunrise’, is not, as was expected, related to ‘Karen's Appalachian Blush’, but is the result of self-pollination of ‘Cherokee Brave’ (U.S. Plant Pat. No. 10,166). It can be seen that the lighter red or pink bracts of ‘Erica's Appalachian Sunrise’ (shown in FIG. 2) closely resemble the bracts of the parent, ‘Cherokee Brave’.
FIG. 5. Photograph of the less commonly produced bracts and flowers, less than about 5%, of the dogwood cultivar ‘Erica's Appalachian Sunrise’ (top—fully dark, red bracts), and those of ‘Karen's Appalachian Blush’ (bottom left) and ‘Cherokee Brave’ (bottom right).
DETAILED DESCRIPTION OF THE NEW VARIETY A new and distinct cultivar of flowering dogwood tree producing both fully dark red bracts and lighter red or pink bracts. Both types of bracts are significantly smaller than the bracts of the parent cultivar, ‘Cherokee Brave’. This dogwood tree cultivar is botanically known as Cornus florida and referred to by the following cultivar name: ‘Erica's Appalachian Sunrise’. This cultivar appears to be highly resistant to powdery mildew caused by Erisphe pulchra.
This new and distinct dogwood tree cultivar is a product of self-pollination of the dogwood cultivar ‘Cherokee Brave’. The subject dogwood tree cultivar differs from ‘Cherokee Brave’ in that the instant cultivar produces significantly smaller and both fully dark red bracts and lighter red bracts and also exhibits greater resistance to powdery mildew.
DETAILED BOTANICAL DESCRIPTION The following observations, measurements and comparisons describe this cultivar grown in Maryville, Tenn. Trees used for this description were about ten (10) years old. Both the fully dark red bracts and lighter red to pink bracts are substantially the same size, though significantly smaller than the bracts produced by the parent cultivar. Plant hardiness is expected to be zones 4-9. The color characteristic descriptions use color references to The Royal Horticultural Society (R.H.S.) Colour Chart, The Royal Horticultural Society, London, UK, 4th Edition, 2001, except where general terms of ordinary dictionary significance are used.
A bee-mediated pollination between the dogwood cultivars ‘Cherokee Brave’ and ‘Karen's Appalachian Blush’ was conducted in April of 2009. Seeds were collected from both cultivars and planted in a greenhouse in Knoxville, Tenn. This new and distinct dogwood tree cultivar was discovered among the planting and germination of the seeds harvested from ‘Cherokee Brave’. The following Table 1 shows the alleles at nine (9) loci compared between the cultivars ‘Karen's Appalachian Blush’ (U.S. Plant Pat. No. 13,165), ‘Cherokee Brave’, and the new cultivar ‘Erica's Appalachian Sunrise’. As seen in Table 1, the alleles for ‘Erica's Appalachian Sunrise’ are identical at all nine (9) loci to those of ‘Cherokee Brave’ and have no alleles that match ‘Karen's Appalachian Blush’. This demonstrates conclusively that dogwood cultivar ‘Erica's Appalachian Sunrise’ was the result of self-pollination of ‘Cherokee Brave’. Asexual reproduction of ‘Erica's Appalachian Sunrise’ by grafting of axillary buds onto seedling rootstocks has shown that the unique features of this new dogwood cultivar are stable and reproduced true-to-type in successive vegetatively propagated generations.
TABLE 1
Allelic Comparisons at Nine (9) loci for dogwood cultivars
‘Karen's Appalachian Blush’ (KAB),‘Cherokee Brave’ (CB),
and ‘Erica's Appalachian Sunrise’ (EAS)
Loci/Primer
Cultivar CF213 CF191 CF273 CF322 CT585
KAB 270:270 132:169 140:144 137:173 167:187
(as base-
pair size)
CB 267:278 144:144 133:142 154:154 174:174
(as base-
pair size)
EAS 267:278 144:144 133:142 154:154 174:174
(F1)
(as base-
pair size)
Loci/Primer
Cultivar CF597 CF634 CF713 CF562
KAB 114:126 120:126 154:154 208:208
(as base-pair size)
CB 105:120 113:113 144:144 212:225
(as base-pair size)
EAS (F1) 105:120 113:113 144:144 212:225
(as base-pair size)
TABLE 2
Simple Sequence Repeats and Associated Primers
for Nine Loci shared by the Dogwood Cultivars
‘Erica's Appalachian Sunrise’ and ‘Cherokee Brave’
GenBank Re-
acces- Forward and Reverse Primer peated
sion no. Locus Sequences (5′-3′) Seq.
ED651856 CF191 F: AACCTGCATCTTCCCCAAGT (AG)20
(SEQ ID NO: 1) T(GA)12
R: CCTTTTACCAACCCAACACG (GAA)4
(SEQ ID NO: 2)
ED651874 CF213 F: TGCAAATGGTTATTGATTGCTCTC (CT)9
(SEQ ID NO: 3) (GT)12
R: ATTTGTTTCCCATGACCTGAAAGA
(SEQ ID NO: 4)
ED651920 CF273 F: TCATATTTATGCTTTCCTTGCCGT (AC)14
(SEQ ID NO: 5)
R: GTGATCCTCTCCTAAGGACTTCCA
(SEQ ID NO: 6)
ED651957 CF322 F: CTAACCTGCATCTTCCCCAAG (AG)20
(SEQ ID NO: 7) TG(AG)12
R: TTTACCAACCCAACACGACAC
(SEQ ID NO: 8)
ER870584 CF562 F: CCAGAGGTATGAATTCTGTGT (GT)16
(SEQ ID NO: 9)
R: CTTGCAAATTGTTGTAATGAA
(SEQ ID NO: 10)
ER870607 CF585 F: AACGAAGCAAGCAAAACAATC (AT)7
(SEQ ID NO: 11) (GT)11
R: ACCCCACCACTTCATCTCTC
(SEQ ID NO: 12)
ER870619 CF597 F: AAGTCAGATCATTTCAGATTAACA (AC)13
(SEQ ID NO: 13)
R: CGAATTGACGATAAATACAAAATA
(SEQ ID NO: 14)
ER870656 CF634 F: GAAATTCAAATTTTAAAGAAGTCC (AG)14
(SEQ ID NO: 15)
R: TTGTATAGTACTTCAAGGCCACT
(SEQ ID NO: 16)
ER870735 CF713 F: GATACTTATGCAATTAGGACACAA (TC)18
(SEQ ID NO: 17)
R: GTAACAATGGTGGAAGGAAG
(SEQ ID NO: 18)
The cultivar ‘Erica's Appalachian Sunrise’ has some phenotypic similarities to the cultivar ‘Cherokee Brave’, but also distinct differences. The following Table 3 provides a comparison of those characteristics for each cultivar that have been observed. Measurements are provided as averages (with ranges also provided as indicated):
TABLE 3
Comparison of Characteristics for Three Dogwood Tree Cultivars
‘Erica's
Appalachian
Character Sunrise’ ‘Cherokee Brave’
1 Tree Height 2 meters 2-3 meters
(observation) (at 8 years) (10-15 years)
2 Tree Form Branching/ Branching/
Spreading Spreading
3 Growth Rate Slow 16 cm/year Moderate 24 cm/year
4 Spread of 1.5 meters 2.0 meters
Tree
5 Trunk Diam. 6.5 cm 8 cm
at 1 meter
6 Trunk Texture Smooth Smooth
7 Primary 144A New 144A New
Trunk Growth Growth
Color/New Older Mature Older Mature
Branches/ 201B/196B 201B/196B
Texture Smooth Smooth
8 Presence of Red with Green Red with Green
anthocyanin Mainly 61B Mainly 61B
(observation) with some with some
Coloration by 143C 143C
anthocyanin
on the
immature leaf
upper side
9 Color of Green Green Group
mature leaf 143C and some 136C, with very
upper surface/ 61B More red little red
lower surface than ‘Cherokee (mostly Green
Brave’ and red 136C for the
is persistent growing
through growing season)
season/Green
143C
10 Color of Red-Purple 71A Red-Purple 71A
leaves in
autumn
(observation)
11 Leaf shape Ovate Ovate
12 Leaf Margin Entire Entire
13 Leaf Tip Cuspidate Cuspidate
14 Leaf Base Cuneate Cuneate
15 Leaf Palmate/Smooth Palmate/Smooth
Venation/ with hairs with hairs
Texture
16 Leaf Length 4.1-6.25 cm 5.0-7.2 cm
17 Leaf Width 0.8-1.2 cm 1.0-2.0 cm
18 Petiole Length <1 cm <1 cm
19 Petiole Color 134C 134C
20 Petiole Texture Smooth Smooth
21 Flower 6.5 mm open 6.5 mm open
diameter
(measurement)
22 Floret color Yellow Green Yellow Green
when open 150A-150B with 150A-150B with
(observation) some purple some purple
76A to 76B 76A to 76B
on top on top
23 Uniformity of See 24-29 See 24-29
bract size
(observation)
24 Bract over- Overlapping Slightly
lapping tips and edges overlap
(observation
for both types)
25 Whole shape Spade-shaped Tear-drop with
of bracts with point blunt tip
(observation) at the base
26 Inner Bract 23.1 mm 38.8 mm
length
(measure- (both types)
ment)
27 Inner Bract 16.8 mm 35.9 mm
width (both types)
(measure-
ment) -
modified cleft
28 Outer Bract 18.9 mm 38.5 mm
width (both types)
(measure)
29 Outer Bract 15.3 mm 30.3 mm
length (both types)
(measurement)
30 Number of 4 4
bracts
31 Bract color 63C - striated 63C - striated
(light red) red-veined, red-veined,
on white on white, pure
(95%) white base of
bract
32 Bract color 182A to 181B 63C striated
(dark red) (mostly solid red-veined,
color with some on white, pure
white striation white base
near the base of bract
(<5%))
33 Cleft in Bract Yellow Green Some are almost
145C (<5%) pure white,
others have same
color as the bracts
34 Bract duration Most bracts Most bracts
(both types) gone by mid- gone by mid-
late April late April
35 Pedicel Length 23.8 mm 25.2 mm
36 Bract None None
variegation
(observation)
37 Pistil color Yellow Green Yellow Green
(observation) 150A-150B 150A-150B
38 Fruit shape Broadly oval Broadly oval
(observation)
39 Fruit length About 1.5 cm About 1.5 cm
(measurement)
40 Fruit color Red when Red when
(observation) mature in fall mature in fall
45A to 45B 45A to 45B
41 Fragrance None None
(observation)
42 Flowering Spring Spring
season
(observation)
43 Flowering time April April
(observation)
44 Deciduous or Deciduous Deciduous
evergreen
(observation)
45 Disease Highly resistant Moderately
resistance to powdery resistance to
(observation) mildew caused powdery mildew
by Erisphe caused by
pulchra but some Erisphe pulchra
Spot Anthracnose but some Spot
spotting by Anthracnose by
Elsinoe cornii Elsinoe cornii
46 Bark color 144A (mottled) 144A (mottled)
(mature)
47 Flower/ 19.7 25.0
inflorescence
number
48 Anther color Purple 86A Purple 86A
49 Flower petal 3-5 mm 3-5 mm
length
50 Flower petal Purple 76A to Yellow Green
color (closed) 76B on top and group 149B
Yellow Green (no purple)
150A-150B
near bottom
51 Flower petal 150A to 150B 150A to 150B
color (open)
‘Karen's
Appalachian
Character Blush’
1 Tree Height 2-3 meters
(observation) (10-15 years)
2 Tree Form Narrow few
branches
3 Growth Rate Slow 12 cm/
year
4 Spread of Tree 0.8 meters
5 Trunk Diam. 5 cm
at 1 meter
6 Trunk Texture Smooth
7 Primary Trunk 144C New
Color/New Growth
Branches/ Older Mature
Texture 202A/196B
Smooth
8 Presence of Green 143B
anthocyanin (observation)
Coloration by
anthocyanin on the
immature leaf
upper side
9 Color of mature leaf 144C to 144B
upper surface/ Both surfaces
lower surface
10 Color of leaves in 71C to 71D
autumn (observation)
11 Leaf shape Ovate
12 Leaf Margin Entire
13 Leaf Tip Cuspidate
14 Leaf Base Cuneate
15 Leaf Venation/Texture Palmate/Smooth
with hairs
16 Leaf Length 5.0-8.0 cm
17 Leaf Width 2.0-2.5 cm
18 Petiole Length 1.0-1.3 cm
19 Petiole Color 149A
20 Petiole Texture Smooth
21 Flower diameter 6.5 mm open
(measurement)
22 Floret color Yellow Green
when open 150A-150B with
(observation) some purple
76A to 76B on top
23 Uniformity of bract See 24-29
size (observation)
24 Bract overlapping Very little overlap
(observation
for both types)
25 Whole shape of bracts Linear
(observation)
26 Inner Bract length 29.3 mm
(measurement)
27 Inner Bract width 20.4 mm
(measurement) -
modified cleft
28 Outer Bract width 23.8 mm
(measure)
29 Outer Bract length 31.8 mm
(measurement)
30 Number of bracts 4
31 Bract color White 155B
(light red)
32 Bract color Some pink 49D
(dark red) around margins
bleeding towards
center
33 Cleft in Bract Reduced and
Violet purple 93B
to Blush purple
group N74C or
creamy white with
purple/red 84D
34 Bract duration Most bract gone by
(both types) mid-late April
35 Pedicel Length 19.5 mm
36 Bract variegation None
(observation)
37 Pistil color Yellow Green
(observation) 150A-150B
38 Fruit shape Broadly oval
(observation)
39 Fruit length About 1.5 cm
(measurement)
40 Fruit color Red when
(observation) mature in fall
45A to 45B
41 Fragrance None
(observation)
42 Flowering season Spring
(observation)
43 Flowering time April
(observation)
44 Deciduous or evergreen Deciduous
(observation)
45 Disease resistance Highly resistant
to powdery
(observation) mildew caused
by Erisphe
pulchra but
some Spot
Anthracnose
Elsinoe cornii
46 Bark color (mature) 144C
47 Flower/inflorescence 16.4
number
48 Anther color Purple 86A
49 Flower petal length 3-5 mm
50 Flower petal Purple 76A to
color (closed) 76B on top and
Yellow Green
150A-150B
near bottom
51 Flower petal 150C
color (open)
- Botanical classification: Cornus florida ‘Erica's Appalachian Sunrise’.
- Unique features: A mixture of two types of bracts, a first one being less than about 5% of the bracts produced that is fully dark red and a second type being more than about 95% of the bracts produced that is similar in color to the bracts produced by the parent ‘Cherokee Brave’. Both types of bracts on ‘Erica's Appalachian Sunset’ are similar in size and significantly smaller than the bracts produced by the parent ‘Cherokee Brave’. Fewer flowers per inflorescence of ‘Erica's Appalachian Sunset’ than on ‘Cherokee Brave’.
- Disease susceptibility: ‘Erica's Appalachian Sunrise’ has a strong resistance to Powdery mildew caused by Erisphe pulchra and only some spotting caused by Elsinoe corni, a cosmetic disease with little damage.
- Insect damage: None noted.
