Abstract: The invention relates to a double-stranded compound, preferably an oligoribonucleotide, which down-regulates the expression of a human p53 gene. The invention also relates to a pharmaceutical composition comprising the compound, or a vector capable of expressing the oligoribonucleotide compound, and a pharmaceutically acceptable carrier. The present invention also contemplates a method of treating a patient suffering from alopecia or acute renal failure or other diseases comprising administering to the patient the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the patient. The alopecia may be induced by chemotherapy or radiotherapy, and the patient may be suffering from cancer, in particular breast cancer.

Abstract: A clock control circuit is provided. The clock control circuit includes a voltage supplier for supplying a first voltage in response to a first clock signal, a voltage booster for boosting the first voltage in response to the first clock signal input to the voltage booster, and a clock generator for generating a second clock signal having a voltage level equal to the boosted first voltage in response to the first clock signal.

Abstract: In DEXA (dual energy x-ray absorptiometry), a system for automatically or nearly so identifying a region of interest in an AP (anterior/posterior) spinal image by processing the pixel values within a global region to find the lateral extent of the vertebra and the spaces between vertebra, and further processing the pixel values within the region of interest to derive estimates of bone parameters. In addition, also in DEXA, a system for automatically locating regions of interest in the hip.

Abstract: A method and system for acquiring, processing, storing, and displaying x-ray mammograms Mp tomosynthesis images Tr representative of breast slices, and x-ray tomosynthesis projection images Tp taken at different angles to a breast, where the Tr images are reconstructed from Tp images.

Abstract: Ultrasound mammography in which an automated transducer scans the patient's breast to generate many images of thin slices that are processed into few images of thick slices that can be displayed simultaneously for practical rapid assessment of the breast. The thin-slice images can be acquired by a technician so that a physician need only spend time in assessing the few displayed thick-slice images and, possibly, only a few of the thin-slice images that might match a suspected anomaly indicated in the thick-slice images. Computer-aided detection or diagnosis (CAD) can be performed on the images and resulting mark and/or other information can be displayed as well. Vibration images can be obtained as well and similarly processed and displayed to highlight abnormalities or for other reasons.

Abstract: A constant voltage outputting apparatus includes an input terminal, an output terminal, a control unit, a plurality of output control transistors, and a switching unit. The input terminal receives an input voltage, and the output terminal outputs an output voltage. The control unit detects the output voltage and outputs a control signal equalizing the detected output voltage with a predetermined constant voltage. Each of the plurality of output control transistors receives the control signal and controls, according to the control signal, currents flowing from the input terminal to the output terminal. The switching unit switches the plurality of output control transistors to input the control signal thereto according to a predetermined setting. A constant voltage outputting method is also described.

Abstract: An underwater writing and drawing tablet that stretches a length of waterproof (plastic) vellum between two rollers over a flat surface thereby enabling the user to easily draw or write on said vellum and permanently save the drawing and writing.

Abstract: This recording-medium conveying device comprises a conveying belt, the conveying belt, a belt charging unit, and a pressing roller. The conveying belt is wound around a driving roller and a driven roller so as to convey a recording medium to an image recording part. The conveying belt includes an insulating layer formed at one side contacting the recording medium. The belt charging unit is provided in contact with the insulating layer so as to charge the insulating layer with a positive charge and a negative charge alternately in a moving direction of the conveying belt by applying an AC bias to the conveying belt. The pressing roller presses the conveying belt against the driving roller so as to prevent the conveying belt from slipping on the driving roller.

Abstract: A recording head is provided with a plurality of nozzles for ejecting a fluid, a plurality of pressure-applied chambers arranged in a predetermined direction and each communicating with a corresponding one of the nozzles, and a common chamber having a plurality of wall surfaces and configured to supply the fluid to the pressure-applied chambers. At least one of the wall surfaces of the common chamber, along the predetermined direction, has a pressure absorbing surface with a rigidity lower than those of other wall surfaces and configured to absorb a pressure change, and the pressure absorbing surface is formed by a pressure absorbing member having a non-uniform thickness.

Abstract: The present invention provides for an antisense oligonucleotide having the sequence 5?GCTCGGCGCCGCCATTTCCAG3?. The invention also provides for an antisense oligonucleotide having the sequence 5?GTCAGCGGCCATCAGCTT3?. The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5?GCTCGGCGCCGCCATTTCCAG3? and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5?GCTCGGCGCCGCCATTTCCAG3? effective to inhibit death of the cell.

Abstract: A write strategy circuit and a write strategy method for capturing data are disclosed. A strategy clock generator generates a strategy clock signal based on a channel clock signal. A phase controller produces a capturing channel clock signal by controlling a phase of the channel clock signal in synchronization with the strategy clock signal. A data capturing circuit captures the data in synchronization with the capturing channel clock signal. A phase determination circuit determines whether a length of the data corresponds to a predetermined value. A strategy correction circuit applies a predetermined strategy correction to the data based on the strategy clock signal. In this case, the phase controller controls the phase of the channel clock signal based on a determination result of the phase determination circuit. An optical disk apparatus using the write strategy circuit or the write strategy method is also disclosed.

Abstract: A forming metal mold for molding synthetic resin includes a base mold (4), a first forming mold (5) secured to the base mold (4) and having a molding recess (9), and a second forming mold (6) secured to the base mold (4) as it is combined with the first forming mold (5). The first forming mold (5) includes a transfer surface (9a) within the molding recess (9) in continuation to its opening edge for providing decoration to a molded product (17) on transcription to the surface of the molded product (17). The second forming mold (6) includes a charged opening (11) defining a cavity (14) along with the molding recess (9) and into which is charged a molding material. In this forming metal mold, the molding material is charged into the cavity (14) to transfer a pattern formed on the transfer surface (9a) to the molded article.

Abstract: An air purifier includes a housing having a purification chamber with an inlet to the housing for drawing in contaminated air and an outlet from the housing for releasing purified air. The air purifier also includes an inlet for introducing a fluid containing a source of antimicrobial ions into the purification chamber. The air purifier also includes at least one microwave radiation source and at least one ultraviolet radiation source which work in combination to increase the effectiveness of the antimicrobial ions. Also included are filters for removing airborne particulates and adsorbing antimicrobial ions from treated air.

Abstract: A method for retrofitting a window by combining the window with a switchable or non-switchable window enhancement. The method includes providing a window comprising at least one relatively transparent viewing pane with first and second opposed viewing surfaces, and optionally a frame portion adapted to support and position the viewing pane(s); providing at least one mounting means adapted for securing the enhancement to the window; and securing a window enhancement to the window with at least one mounting means so that the enhancement overlies at least a portion of the viewing pane, and wherein a gap is produced between the window and the enhancement equal in width to the thickness of the mounting means. The enhancement may be mounted on either the viewing pane itself, or alternately upon the frame portion of the window. If desired, the enhancement may be laminated to a relatively rigid substrate prior to application to the window.

Abstract: A myocardial analysis and monitoring method, comprising the steps of receiving a number of ECG signals relating to a heartbeat of at least one patient, converting the received number of ECG signals into three perpendicular ECG signals, determining an average heartbeat from the ECG signals, calculating a plurality of parameters related to a condition of each patient from the number of ECG signals, storing information representative of a value of the plurality of parameters related to the condition of each patient in storage, repeating the steps of determining the average heartbeat, calculating the plurality of parameters and storing the information for as long as ECG signals continue to be received or until the storage is full, displaying at least a portion of the stored information as a graphical display, the graphical display representing a trend of at least one of the plurality of parameters, analyzing the displayed trend of the at least one of the plurality of parameters, and displaying at least one result

Abstract: An architecture for facilitating Web-based client-side calendar event scheduling includes a Web Calendar scheduling tool which takes input via either a mouse and/or a keyboard to achieve a) an Internet personal organizer, b) multimedia effects associated with scheduled events, c) an Internet groupware that shares group members' individual schedules, d) an Internet transaction associated with scheduled events, and e) an open platform that supports any Java applet. Users of the Web Calendar can schedule events, associate a special purpose Capplet™ with scheduled events, and store them for future reference or public use. It features concurrent Capplet™ views running under one of four calendar grids: yearly, monthly, weekly, and daily. The architecture also supports multimedia animation in pop-up windows whose dimensions are defined dynamically by an invocation method. It is an open platform on which any user can create a special purpose applet and run it on the Web Calendar.

Abstract: A composition for the upregulation of expression of cell antigens, without inducing shedding, which comprises a protein kinase C activator is provided by this invention. Further provided by this invention is a method of detecting and treating tumor cells comprising contacting tumor cells with an effective amount of a protein kinase C activator for the upregulation of expression of antigens of tumor cells, without inducing antigen shedding, and detecting the presence of said antigen or then further contacting said tumor cells with an effective amount of an antibody directed to said antigen.

Abstract: An ankle-foot orthosis made of a carbon fiber reinforced material having low weight is carried on the front of the lower leg, extending over the lateral ankle and preventing plantar flexion. The orthosis may be worn under ordinary clothes and shoes and promotes a more natural gait pattern. The ankle-foot orthosis comprises a frame of thin flexible material extending over the front of the lower leg, anterior of the lateral ankle and beneath the sole of the foot and a supporting portion of rigid material extending over a narrow part of the front of the lower leg, anterior of the lateral ankle and beneath the part of the sole of the foot. The orthosis also comprises a fastening means for fastening the orthosis to the leg.

Abstract: In a color video signal processing method, color difference component signals are converted into RGB component signals by a digital to digital conversion so as to reduce a size of a processing unit used for the conversion. An analog composite signal is converted into analog color difference component signals. The analog color difference component signals are then converted into digital color difference component signals. The digital color difference component signals are converted into digital RGB component signals by a digital to digital conversion based on an approximation method. Finally, the digital RGB component signals are converted into analog RGB component signals. The digital-to-digital conversion may be performed in accordance with equations in which each factor is a fractional number having a denominator of a power of 2.