Abstract: The present invention provides novel compounds of Formula 1 or Formula 2 and compositions thereof, methods of their use, and methods of their manufacture, wherein X, Y, Z, W, R1, R2 and R3 are defined more fully in the description. These compounds are useful in the treatment of type I diabetes, type II diabetes, impaired glucose tolerance, insulin resistance, obesity, and a number of other diseases.

Abstract: Pectin degrading enzymes derived from or endogeneous to Bacillus licheniformis or other Bacillus species which are at least 99% homologous to Bacillus licheniformis based on aligned 16S rDNA sequences have optimum activity at pH higher than 8. The pectin degrading enzymes belongs to the enzyme classes pectate lyases (EC 4.2.2.2), pectin lyases (EC 4.2.2.10) and polygalacturonases (EC 3.2.1.15) and are useful in industrial processes under alkaline conditions such as in textile processing and as an active ingredient eg in laundry detergents and hard surface cleaning products.

Abstract: The present invention relates to novel N-substituted azaheterocyclic carboxylic acids and esters thereof in which a substituted alkyl chain forms part of the N-substituent or salts thereof, to methods for their preparation, to compositions containing them, and to their use for the clinical treatment of painful, hyperalgesic and/or inflammatory conditions in which C-fibers play a pathophysiological role by eliciting neurogenic pain or inflammation.

Abstract: The present invention provides methods for single-bath biopreparation and dyeing of cellulosic fibers, which are carreid out by contacting the fibers simultaneously or sequentially with a pectin-degrading enzyme, preferably pectate lyase, and a dyeing system, under conditions that do not require emptying the bath or rinsing the fabric between biopreparation and dyeing steps.

Abstract: The inventors have modified the amino acid sequence of a maltogenic alpha-amylase to obtain variants with improved properties, based on the three-dimensional structure of the maltogenic alpha-amylase Novamyl. The variants have altered physicochemical properties, e.g. an altered pH optimum, improved thermostability, increased specific activity, an altered cleavage pattern or an increased ability to reduce retrogradation of starch or staling of bread.

Abstract: A method for the construction of a library of recombined polynucleotides from a number of different starting single or double stranded parental DNA templates is disclosed, wherein the starting single or double stranded parental DNA templates represent discrete points in a population of genes encoding evolutionary or synthetic homologues of a peptide having homologies ranging over a broad spectrum from less than 15% to more than 80%, said population exhibiting at least one identification sequence, and whereby said genes are subjected to a gene shuffling procedure to generate shuffled mutants of said population of genes representing additional discrete points between those of said starting templates.

Abstract: An enzyme exhibiting polygalacturonase activity, which enzyme is immunologically reactive with an antibody raised against a purified polygalacturonase derived from Aspergillus aculeatus, CBS 101.43. The enzyme may be produced by recombinant DNA techniques and may be used for degradation of plant cell walls, for instance in the wine and juice production.

Abstract: The invention relates to the use of a somatostatin receptor ligand of nonpeptide origin, e.g. of the general formula Ia or Ib ##STR1## or a pharmaceutically acceptable salt thereof, which has high and/or selective affinity to the somatostatin receptor protein designated SSTR4 and, for the preparation of a medicament for the treatment of a disease associated with an adverse condition in the retina and/or iris-ciliary body of a mammal. Such conditions are high intraocular pressure (IOP) and/or deep ocular infections. The diseases which may be treated are e.g. glaucoma, stromal keratitis, iritis, retinitis, cataract and conjunctivitis.

Abstract: The invention provides variant lipases with improved washing performance, including good performance in washing with a detergent having a high content of anionic surfactant at low washing temperature at a short washing time. More particularly, the invention relates to variants of the wild-type lipase from Pseudomonas sp. strain SD 705, deposited as FERM BP-4772.

Abstract: A dispenser for dispersing of a drug comprising a housing (1) forming a cylinder. The cylinder is at one end closed by an end wall (2) having an outlet pipe (3) and the other end is closed by a plunger (4) which is axially displaceable into the cylinder. The outer end of the plunger (4) is secured to the inner side of a cup shaped cap (13, 14) sliding over the outer side of the cylinder. When the plunger (4) is pressed into the cylinder, the upper edge of the housing (1) being provided with outwardly projecting hooks (15) sliding in corresponding grooves (16) in the inner side of the side wall (14) of the cap wall irreversibly engage windows (20) at the bottom (13) of the cap. The cap (13, 14) and the housing (1) is made from differently colored materials.

Abstract: Disclosed is a process for preparing cork articles, in particular cork stoppers for wine bottles, which involves treating cork with a phenol oxidizing enzyme. Preferred phenol oxidizing enzymes are laccase, peroxidase, catechol oxidase, and o-aminophenol oxidase. The treatment with a phenol oxidizing enzyme reduces the characteristic cork taint/astringency which is frequently imparted to the bottled wine.

Abstract: The present invention provides methods for meat tenderization that comprise a thermolabile protease derived from a Rhizomucor species. Preferably, the protease has limited substrate specificity and may be treated with peroxy acids. The invention also provides meat-tenderizing compositions, which comprise the protease in combination with nitrite and/or flavoring agents.

Abstract: A method of introducing into the surface of dyed denim fabric or garment, localized areas of variations in colour density, the method comprising contacting the fabric or garment with an aqueous composition comprising an effective amount of a pectolytic enzyme preferably selected from the group consisting of pectin lyases (EC 4.2.2.10), galactanases (EC 3.2.1.89), arabinanases (EC 3.2.1.99), pectin esterases (EC 3.1.1.11), mannanases (EC 3.2.1.78), polygalacturonases (EC 3.2.1.15) and pectate lyases (EC 4.2.2.2) at a pH of the aqueous composition between 3 and 11 and a temperature of or below 90.degree. C.

Abstract: The present invention relates to isolated nucleic acid sequences encoding polypeptides having pyranose oxidase activity. The invention also relates to nucleic acid constructs, vectors and host cells containing the nucleic acid sequences as well as recombinant methods for producing the polypeptides.

Abstract: Guanidine and diaminonitroethene derivatives represented by the formula ##STR1## wherein X, R.sup.1, R.sup.2, R.sup.3 and R.sup.4 are defined in the description, compositions thereof and methods for preparing the compounds are described. The se compounds are useful in the treatment of diseases of the central nervous system, cardiovascular system, pulmonary system, gastrointestinal system and endocrinologic system.

Abstract: The present invention relates to a method for reducing the content of phosphorous containing components in an edible oil comprising a high amount of non-hydratable phosphorus content, wherein said method comprises use of a phospholipase. Further the present invention relates to an enzyme with phospholipase activity, a cloned DNA sequence encoding the enzyme with phospholipase activity, a method of producing the enzyme, and the use of said enzyme for a number of industrial applications.

Abstract: The present invention relates to an enzyme exhibiting aminopeptidase activity, a method for producing said enzyme, an enzyme preparation containing said enzyme exhibiting aminopeptidase activity, and use of said enzyme for various industrial purposes.

Abstract: The invention relates to a variant of a parent Termamyl-like .alpha.-amylase, which variant has a-amylase activity and exhibits an alteration in at least one of the following properties relative to said parent a-amylase: substrate specificity, substrate binding, substrate cleavage pattern, thermal stability, pH/activity profile, pH/stability profile, stability towards oxidation, Ca.sup.2+ dependency and specific activity.

Abstract: A method of treating wool, wool fibers or animal hair with a haloperoxidase (together with a hydrogen peroxide source and a halide source), and a proteolytic enzyme. The described method results in improved shrink-resistance, handle, appearance, wettability, reduction of felting tendency, increased whiteness, reduction of pilling, improved softness, tensile strength retention, improved stretch, improved burst strength, and improved dyeing characteristics such as dye uptake and dye washfastness. Furthermore, relative to treatments with proteolytic enzymes alone (no haloperoxidase), the described method results in reduced weight loss, reduced fiber damage, and improved burst strength.

Abstract: An enzyme having endo-1,3(4)-.beta.-glucanase activity is described which is encoded by the DNA sequence ATGTGGTCTCCCAAGGTTGCTGCTGCCGTCCTCGCCTTTGTTGGTGCTACCAACGCCT GGCAGCCCCCGACCTACAGCGGCTTCAACTTGGTCTGGACTGACACCTTCGCTGGCAACGGTGGCACTTCTCCT A ACCAGAACAACTGGAACATCATCACCGGAAACTTGAACGTCAACGCCGAGCAGGAGACCTACTCCTCCAGCAC C GCCAATGTTCAGCTCAGTGGTGGCAGCACCCTTCAGCTGGTCCCCTGGAGAGACAGCAGCAAGGGAACCAGCA C CTTTGGTGGCTGGACCTCCGGTCGTCTTGAGTCCAAGTACACATTCACTCCCGCGGCCGGCAAGGTCACCCGT CTT GAAGCCGCCATCCGCTTCGGCAGCAACGCTCAGGCCAACAAGCAGGGTATCTGGCCTGCTTTCTGGATGCTGGG T GACTCCCTCCGTCAACCGGGCGGCAGCTGGCCCAACTGTGGTGAGATCGACATCATGGAGACTGTCGACGGCC A GGCTACCGGCCACGGTACCCTTCACTGCGACGTCTACCCCGGCGGTATCTGCAACGAGGGTAACGGTATTGGA GG CCCTGTCAACATCGCCAACGTCAACGACTGGCACGCTTGGCGTGTTGAGATCGACCGCACTCCCAGCAGCTGGC A ATCCGAGACCCTCACCTGGTCCCTCGACGGCACCATCTACTTCCAGATCACTGGCTCTCGCATTGGCAACCAG GG CGTCTGGAACAACATTGCTCACAGCCCCCTCTTCTTCATTCTTAACGTTGCTGTCGGTGGCAACTGGCCTGGCA AC CCCAACAGCGCTACCCTCGATGGCTACGGAAGCATGATGGAGGTTGGCTACGTCGCTCAGTACTCTACCTAA (SEQ ID NO:3).