Abstract: A method and apparatus for delivering one or more fluids. Fluids may be delivered from a common vessel to a chemical, biological or biochemical process.

Abstract: Arrays of single molecules and methods of producing an array of single molecules are described. Arrays with defined volumes between 10 attoliters and 50 picoliters enable single molecule detection and quantitation.

Abstract: Techniques for data synchronization between a first computing device coupled to at least one memory storing current data and a second computing device coupled to at least a second memory storing first encoded data and a copy of prior data. The first device may perform a method comprising: encoding the current data using a compressive sensing encoding technique to obtain second encoded data; and transmitting the second encoded data to the second computing device. The second device may perform a method comprising receiving second encoded data from the first computing device; decoding the second encoded data using a compressive sensing decoding technique to obtain decoded data; and obtaining a copy of the current data by using the decoded data and the copy of prior data.

Abstract: Compositions and methods for regulating CD154 gene expression are provided that rely on the interaction of hnRNP L with the CA-dinucleotide rich sequence of the 3?-untranslated region of CD154.

Abstract: An interconnect structure for integrated circuits for copper wires in integrated circuits and methods for making the same are provided. Mn, Cr, or V containing layer forms a barrier against copper diffusing out of the wires, thereby protecting the insulator from premature breakdown, and protecting transistors from degradation by copper. The Mn, Cr, or V containing layer also promotes strong adhesion between copper and insulators, thus preserving the mechanical integrity of the devices during manufacture and use, as well as protecting against failure by electromigration of the copper during use of the devices and protecting the copper from corrosion by oxygen or water from its surroundings. In forming such integrated circuits, certain embodiments of the invention provide methods to selectively deposit Mn, Cr, V, or Co on the copper surfaces while reducing or even preventing deposition of Mn, Cr, V, or Co on insulator surfaces.

Abstract: Compounds including various oligomers of piperlongumine and/or piperlongumine analogues as well as certain piperlongumine analogues that exhibit improved toxicity to cancer cells are disclosed. Also provided are compositions that comprise the compounds, methods of making compositions comprising the compounds, methods of making the compounds, and the use of compounds in methods for treating cancer.

Abstract: A focusing structure including an array of localized optical alterations that alter the propagation of light through the waveguide to diffractively focus the light as it exits the focusing structure. The array of optical alterations may be formed along either a straight or a curved line within a cross section of the focusing structure. In energy assisted magnetic recording apparatus a laser beam propagates through the waveguide to a near field transducer. The waveguide comprises a focusing element that includes an array of localized optical alterations that alter the propagation of the laser beam through the waveguide to diffractively focus the laser beam approximately at the near field transducer.

Abstract: A nanocoaxial sensor includes an outer conductor, an inner conductor, a dielectric material disposed between the outer and inner conductors, a nanocavity sized to allow target species to enter the nanocavity between the outer and inner conductors, and an active sensing element immobilized within the nanocavity on at least one of the inner or outer conductors. The active sensing element is adapted to selectively capture the at least one of the target species.

Abstract: Systems and methods are disclosed for directing magnetizable particles comprising therapeutic agents to a target volume, or for guiding magnetizable particles comprising therapeutic agents from a first target volume to a second target volume, at a distance using a magnetic field, to enable the treatment of diseased areas including areas deep inside a patient's body. The methods may be used to diagnose or treat diseased areas within a patient, for example tumors of the lungs, intestines, and liver, and is also useful in enhancing the permeability of solid tumors to chemotherapeutic agents.

Abstract: A compact and failsafe magnetorheological energy absorber design including both a light weight piston (LWP) embodiment in which linear motion is subjected to a linear damping force, and a light weight rotary vane (LWRV) embodiment in which linear motion is converted into rotary motion and is subjected to a rotary damping force. Both embodiments allow increased damper stroke within a compact mechanical profile. A new lightweight Magnetorheological energy attenuation system (LMEAS) for a vehicle seat is also disclosed using the new LMRW MREA.

Abstract: Disclosed herein are compositions and methods for lowering Apolipoprotein C-III (ApoC-III) in a subject in need thereof. Subjects in need of ApoC-III reduction include subjects with elevated ApoC-III levels, subjects with a condition associated with ApoC-III, subjects with diabetes, obese subjects and subjects with cardiovascular disease. Compositions to lower ApoC-III include compounds targeting Apolipoprotein B (ApoB) such as Mipomersen and other antisense compound targeting ApoB.

Abstract: A method for identifying bacteria in a sample is described which comprises amplifying a portion of the 23S rDNA present in the sample using, as one primer, a degenerate primer set comprising one or more DNA molecules consisting essentially of DNA having the sequence(s) 5?GCGATTTCYGAAYGGGGRAACCC (SEQ ID NO: 1), the other primer consisting of DNA having the sequence 5?TTCGCCTTTCCCTCACGGTACT (SEQ ID NO: 2) and testing the resulting amplicon by hybridization to one or more oligonucleotide probes designed to identify one or more bacteria likely to be present in the sample. The method allows for the identification of at least 8 and considerably more bacterial species in a single test, including Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococeus spp., Klebsiella spp., Enterobacter spp., Proteus spp., Pneumococci, and coagulase-negative Staphylococci.

Abstract: The invention features a series of heterocyclic derivatives that inhibit tumor necrosis factor alpha (TNF-?) induced necroptosis. The heterocyclic compounds of the invention are described by Formulas (I) and (Ia)-(Ie) and are shown to inhibit TNF-? induced necroptosis in FADD-deficient variant of human Jurkat T cells. The invention further features pharmaceutical compositions featuring the compounds of the invention. The compounds and compositions of the invention may also be used to treat disorders where necroptosis is likely to play a substantial role.

Abstract: Provided herein are stapled or stitched polypeptides comprising an alpha-helical segment, wherein the polypeptide binds to the insulin receptor, and wherein the polypeptide comprises at least two cross-linked amino acids as shown in Formula (iii), or at least three cross-linked amino acids as shown in Formula (iv). Further provided are pharmaceutical compositions comprising the stapled or stitched polypeptides, methods of use, e.g., methods of treating a diabetic condition or complications thereof. Precursor “unstapled” polypeptides useful in the preparation of stapled and stitched polypeptides are also described.

Abstract: 2-Cyano-3,12-dioxooleana-1,9(11)-dien-28-oic acid amino acid derivatives having antiinflammatory properties are provided. Pharmaceutical compositions and methods for preventing or treating inflammation or a disease or condition mediated by inflammation are described.

Abstract: The present invention relates to trioxacarcin compounds of the formula: (I) or pharmaceutically acceptable forms thereof; wherein R1, R2, R3, R4, R5, R6, R7, R8, and R9 are as defined herein. The present invention also provides processes for preparing such compounds and intermediates thereto; pharmaceutical compositions comprising such compounds; and methods of use and treatment.

Abstract: This invention relates to a lamellae tissue layer, comprising a grooved silk fibroin substrate comprising tissue-specific cells. The silk fibroin substrates provides an excellent means of controlling and culturing cell and extracellular matrix development. A multitude of lamellae tissue layers can be used to create a tissue-engineered organ, such as a tissue-engineered cornea. The tissue-engineered organ is non-immunogenic and biocompatible.

Abstract: The present invention relates to compositions of peptide and polypeptide analogs that are resistant to proteolysis, pharmaceutical uses thereof, and methods of preparation thereof.

Abstract: The current invention relates to the use of a bacterial species in the preparation of a composition adapted for oral administration for the delivery of an agent to a site in the body. The site in the body may be an organ or a tumour site. The bacterial species is a food grade, non-pathogenic, gram-positive bacteria capable of anaerobic growth.

Abstract: The present invention generally relates to nanoscale wire devices and methods for use in determining nucleic acids or other analytes suspected to be present in a sample. For example, a nanoscale wire device can be used to detect single base mismatches within a nucleic acid (e.g., by determining association and/or dissociation rates). In one aspect, dynamical information such as a binding constant, an association rate, and/or a dissociation rate, can be determined between an analyte and a binding partner immobilized relative to a nanoscale wire. In some cases, the nanoscale wire includes a first portion comprising a metal-semiconductor compound, and a second portion that does not include a metal-semiconductor compound. The binding partner, in some embodiments, is immobilized relative to at least the second portion of the nanoscale wire, and the size of the second portion of the nanoscale wire may be minimized and/or controlled in some instances.