Abstract: A method for improving the light olefin yield in the process of preparation of a light olefin using an oxygen-containing compound, more specifically, in which, a multi-stage dense phase fluidized bed comprising k secondary pre-carbon deposition zones (k?1) and n secondary reaction zones (n?1) is used as a reactor, and a multi-stage dense phase fluidized bed regenerator comprising in secondary regeneration zones (m?2) is used as a main equipment, and by re-refining hydrocarbons with four or more carbons obtained in the separation section, or adding naphtha, gasoline, condensate oil, light diesel oil, hydrogenation tail oil or kerosene in the reaction zone, the method primarily solves the problems in the prior art of the uniformity of carbon deposition amount and the carbon content of the catalyst being difficult to control, and the light olefin yield being low.

Abstract: A natural gas hydrate drilling simulation device, includes a hydrate rock core simulation system, a drilling system, a drilling fluid injection system and a drilling fluid treatment system. The hydrate rock core simulation system includes a hydrate formation simulation wellbore, an artificial rock core, a water bath jacket and low temperature water bath. The drilling system includes a bracket, a high pressure rotary connecting device, a hydraulic device and a drilling device. The drilling fluid injection system includes a mud tank, a drilling fluid flowmeter, mud pumps and an overflow valve. The drilling fluid treatment system includes a high pressure sand remover, a back pressure and overflow control system, a gas-liquid separator, a dyer, a gas flowmeter, a liquid flowmeter and a mud treatment tank. This natural gas hydrate drilling simulation device performs simulation experiments under a variety of downhole working condition environments.

Abstract: The invention provides markers indicative of pre-cachexia, compositions and methods for identifying patients with a molecular signature indicative of pre-cachexia; a culture system that reproduces the cachetic process in cells in vitro, which facilitates the screening and identification of therapeutic agents useful for disrupting (slowing, reducing, reversing, or preventing) the progression of pre-cachexia to refractory cachexia; as well as therapeutic agents identified using the culture system of the invention.

Abstract: Disclosed is a polysiloxane being crosslinked from 0.05 to 20 parts by weight of a second silane and an oligomer of 1 part by weight of a first silane. The first silane is Si(R1)2(OR2)2, each R1 is independently acrylic group, epoxy group, vinyl group, amino group, aromatic group, or aliphatic group, and each R2 is independently aliphatic group. The second silane is Si(R3)(OR4)3, R3 is acrylic group, epoxy group, vinyl group, amino group, aromatic group, or aliphatic group, and each R4 is independently aliphatic group.

Abstract: A terminal is provided. The terminal includes a memory, and a processor for managing icons of programs installed in the memory. The processor determines a criterion for icon arrangement, arranges the icons according to the criterion for icon arrangement, and displays all or some of the arranged icons on a screen. The criterion for icon arrangement comprises at least one of most recently/frequently used, time, place, pattern of program use, and category.

Abstract: A luminescent nanocomposite comprising functionalized graphene and a luminescent moiety, its fabrication, and uses are described. The luminescent moiety is anchored non-covalently to the functionalized graphene. Luminescence properties of the nanocomposite may be modulated by choosing appropriate luminescent moieties such as native lactoferrin, native lactoferrin protected gold clusters, and so forth. Mechanical properties of the nanocomposite may be modulated by adding a biopolymer such as Chitosan. The nanocomposite may be used as a luminescent ink for encoding information, or a luminescent film for tagging articles of manufacture such as electronic waste components.

Abstract: The present inventions relates to isolated nucleic acid molecules comprising a nucleotide sequence coding for mi RNA-182 (uuuggcaaugguagaacucacacu or ugguucuagacuugccaacua), miRNA-96 (uuuggcacuagcacauuuuugcu or aaucaugugcagugccaauaug) and/or mi RNA-183 (uauggcacugguagaauucacu or gugaauuaccgaagggccauaa) for use in treating or ameliorating a ciliopathy and/or a photoreceptor dysfunction.

Abstract: The present disclosure provides a multi-metabolite platform using one or more metabolite selected from a group consisting of tryptophan, homoserine, fatty acid (16:1), fatty acid (18:0), fatty acid (18:1), fatty acid (18:2), fatty acid (22:6), phosphatidylcholine (PC) (34:2), PC (34:3), lysophosphatidylcholine (lysoPC) (16:0), lysoPC (18:0), lysoPC (20:3), lysoPC (20:4), lysoPC (22:6), monoglyceride (18:1/0:0/0:0) and sphingomyelin (d18:2/16:0) as a biomarker, which can diagnose acute coronary syndrome as well as the symptoms occurring prior to the onset of the disease simply and accurately through in-vivo level analysis.

Abstract: An apparatus and method of estimating an image optical flow are provided. The method includes receiving temporally-consecutive first and second images; calculating rates of change of brightness values of pixels in the received temporally-consecutive first and second images; calculating a first optical flow estimation result value of a first pixel within the first image and a second optical flow estimation result value of a second pixel within the second image by using the calculated rates of change; comparing the first optical flow estimation result value with the second optical flow estimation result value; and correcting the first optical flow estimation result value and the second optical flow estimation result value by using a result of the comparison.

Abstract: A thin film battery structure includes a substrate, a first current collector layer, a first electrode layer array, an electrolyte layer, a second electrode layer, and a second current collector layer. The first current collector layer is disposed on the substrate and has at least one first current collector bump. The first electrode layer array has at least one first electrode layer, where each first electrode layer is disposed on the first current collector layer, and at least one first current collector bump is embedded inside each first electrode layer. Each first electrode layer is embedded inside the electrolyte layer. The second electrode layer is disposed on the electrolyte layer. The second current collector layer is disposed on the second electrode layer.

Abstract: The disclosure provides a driving apparatus, a driving method thereof, and a scanning mirror. The scanning mirror includes an accumulator unit and a processor unit. The accumulator unit receives and adds up a frequency control word and a first accumulation value to generate a second accumulation value. The processor unit coupled to the accumulator unit receives the second accumulation value. The processor unit generates a driving signal according the second accumulation value and the preset value and adjusts the second accumulation value for outputting the first accumulation value.

Abstract: There is provided a suspended combustion type power steam generator capable of rapid and high-temperature pyrolysis using FRDF for extending residence time of high-temperature gas, and particularly the present invention improves the heating conditions of fluid in an arch water pipe, a heating water pipe and a down pipe by extending the residence time of high-temperature gas inside a combustion chamber. The present invention is an improvement of a power steam generator using fine refuse derived fuel (FRDF) which is an alternative energy source, and a flameless combustion device using fossil fuel capable of structuring a new additional facility so as to address the possibility of irregular raw material supply in the ethyl alcohol fuel operation for new renewable energy, that is, FRDF.

Abstract: A pharmaceutical composition for preventing or treating a degenerative brain disease, and a method of screening a material for preventing or treating a degenerative brain disease. The method may effectively screen a prophylactic or therapeutic candidate material for preventing or treating a degenerative brain disease. A variety of degenerative brain diseases may be effectively prevented or treated using the pharmaceutical composition including a screened material for preventing or treating a degenerative brain disease.

Abstract: Disclosed is a method of manufacturing a colorless transparent polyimide film having impregnated glass fabric, wherein the surface of the polyimide film substrate having impregnated glass fabric is flattened by two flattening steps using a roll-to-roll process, thereby solving problems with an increase in surface roughness of the polyimide substrate when manufacturing the polyimide film having impregnated glass fabric in order to enhance thermal and mechanical properties of a film for use in flexible display substrates and in cover windows for flat panel displays and mobile phones.

Abstract: In one embodiment of the disclosure, a composite material with conductive and ferromagnetic properties is provided. The composite material includes: 5 to 90 parts by weight of a conductive polymer matrix; and 0.1 to 40 parts by weight of iron oxide nanorods, wherein the iron oxide nanorods are ferromagnetic and have a length-to-diameter ratio of larger than 3. In another embodiment, a hybrid slurry is provided. The hybrid slurry includes a conductive polymer, and iron oxide nanorods, wherein the iron oxide nanorods are ferromagnetic and have a length-to-diameter ratio of larger than 3; and a solvent.

Abstract: Provided are methods for treating GLUT1 and related brain energy deficiencies comprising administering odd-carbon fatty acid sources, e.g., C5 or C7 fatty acid sources, and related compositions.

Abstract: A method and an apparatus for detecting and quantifying bacterial spores on a surface. In accordance with the method: bacterial spores are transferred from a place of origin to a test surface, the test surface comprises lanthanide ions. Aromatic molecules are released from the bacterial spores; a complex of the lanthanide ions and aromatic molecules is formed on the test surface, the complex is excited to generate a characteristic luminescence on the test surface; the luminescence on the test surface is detected and quantified.

Abstract: A compound for preparing a hole transport layer, an organic light-emitting device, and a flat display apparatus, the compound including a —N3 moiety.

Abstract: Inverted Nanocone Structures and Its Fabrication Process. The method of fabricating nanotextured structures includes making a master mold having an array of tapered structures to be replicated. The master mold is pressed into a curable polymer supported on a substrate and the polymer is cured. Thereafter, the mold is detached from the cured polymer to form the nanotextured structure.

Abstract: Provided is a control apparatus which may apply an electric signal to a specific point or area selected from a plane or may receive the signal from the specific point or area. The control apparatus includes an upper electrode and a lower electrode. When it is intended that an electric field is applied to a point in which the upper electrode and the lower electrode come in contact with each other, an electrical bias is applied to the lower electrode, and the upper electrode is maintained in a non-connected state. When it is intended that the bias is selectively applied, the upper electrode is maintained in a grounded state. Therefore, transferring of the field from the lower electrode to a ground electrode disposed at a bottom is shielded, and thus transferring of the electric signal is also blocked.