Abstract: A robotic device for providing vertical mobility has a payload is disposed inside a central compartment and supported by a skid. The skid can move up and down through latch and hook pairs to keep intimate contact with the surface and cross over bumps. The apparatus uses a flexible seal to create a reliable vacuum chamber. The flexible seal comprises a foam ring inside fabric pocket. A plurality of rod and spring strips are configured to apply a downward force to the flexible seal to conform with surface curvatures. The fabric pocket fills in the gaps or seams to maintain a vacuum. The air flows inside a manifold and passes through a filter to avoid debris from damaging the vacuum motor assembly.

Abstract: A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

Abstract: An injectable carboxymethylcellulose (CMC) and methylcellulose (MC) hydrogel derived from the plant-based polysaccharide, cellulose, is provided which gels in situ and repairs the intervertebral disc in the spinal column or other cartilaginous tissues. One specific application is for replacement of the nucleus pulposus (NP), the central gelatinous region of the intervertebral disc, following injury or degeneration.

Abstract: Improved neuromodulation control of neurological abnormalities associated with effector organs in vertebrate beings using direct current stimulation for modulating spinal cord excitability, having a peripheral-current supplying component for providing direct current peripheral nerve stimulation and a spinal-current supplying component providing direct current for spinal stimulation, and a controller managing such functions.

Abstract: This disclosure relates to compounds containing both an NO-releasing moiety and an H2S-releasing moiety and the use of such compounds in treating inflammatory diseases, including cancers.

Abstract: Described herein is a chelator for radiolabels (e.g., 89Zr) for targeted PET imaging that is an alternative to DFO. In certain embodiments, the chelator for 89Zr is the ligand, 3,4,3-(LI-1,2-HOPO) (“HOPO”), which exhibits equal or superior stability compared to DFO in chemical and biological assays across a period of several days in vivo. As shown in FIG. 1, the HOPO is an octadentate chelator that stabilizes chelation of radiolabels (e.g., 89Zr). A bifunctional ligand comprising p-SCN-Bn-HOPO is shown in FIG. 4 and FIG. 5. Such a bifunctional ligand can eliminate (e.g., 89Zr) loss from the chelate in vivo and reduce uptake in bone and non-target tissue. Therefore, the bifunctional HOPO ligand can facilitate safer and improved PET imaging with radiolabeled antibodies.

Abstract: A method is provided for deep tissue imaging using multi-photon excitation of a fluorescent agent. The fluorescent agent is irradiated with an ultrafast laser to produce an excited singlet state (Sn) which subsequently undergoes non-radiative relaxation to a first singlet state (S1). The S1 state undergoes fluorescence to the ground state S0 to produce an emission wavelength. Both the excitation and emission wavelengths are within the near infrared optical window, thereby permitting deep tissue penetration for both the incoming and outgoing signals.

Abstract: An impedance spectroscopy biosensor is provided that is fabricated on a stretchable substrate. The stretchable substrate is integrated with an impedance biosensor that undergoes cyclic strain without cracking. The biosensor is formed by curing an elastomer precursor while on a pre-tensioned membrane that includes a conductive electrode. The resulting elastomeric material is released from the support after curing which releases the pre-tensioned state to produce the biosensor.

Abstract: A system for producing a public ring that is fully homomorphically encrypted. The system comprises a processor which generates a first presentation G of a ring, wherein G=x, y|x2=0, y2=0, xy+(p+1)yx=1, where x and y are generators and p is a first private prime number. The system further generates a second presentation H of the ring. H is defined as follows: H=x, y, t|x2=0, y2=0, t=m1yx, xy+m2yx+t=1. In addition, m1 and m2 are positive integers and p+1=m1+m2, wherein t is a generator and the first presentation G and the second presentation H are isomorphic. The system further produces a public ring ? that is fully homomorphically encrypted, where: H ^ = ? x , y , t ? N · 1 = 1 , x 2 = 1 , y 2 = 0 , xyx = x , yxy = y , tx = 0 , yt = 0 , t 2 = t + m 2 2 - m 2 m 1 ? tyx ? , N=pq and further, q is a second private prime number, and the public ring ? is further, publically available. A corresponding method is also disclosed.

Abstract: A smart gun is provided that maintains a default locked state. The smart gun can be selectively unlocked for a predetermined period of time using a predetermined gesture that is detected by a gyrosensor locked in the smart gun.

Abstract: PVT1 exon 9 is overexpressed in aggressively tumorigenic prostate cancer cell lines and prostate tumor tissues. This exon provides a diagnostic tool for the detection and monitoring of aggressive prostate cancer. Several small interfering ribonucleic acids (siRNAs) are disclosed that are useful for treating prostate cancer.

Abstract: Methods, systems and devices are disclosed for treating a spinal disorder by applying a source of direct current to a spinal cord in animals, including humans. Trans-spinal direct current stimulation (tsDCS) uses direct current via cathodal and/or anodal stimulation to induce cell proliferation, cell differentiation, and/or cell migration at or near the area of the spinal cord being treated, and up-regulates or down-regulates protein expression by cells at or near the area of the spinal cord being treated.

Abstract: A method and apparatus for polarizing nuclear or electronic spins is disclosed. An analyte is passed near a surface that has a plurality of spin defect centers implanted within 10 nm of the surface. The spin defect centers are exposed to a magnetic field and illumination to produce polarized spins. The polarized spins then induce spin polarization in the analyte.

Abstract: A method for inhibiting metastasis of cancer cells is provided. Inhibitors of heparan sulfate (HS) or hyaluronic acid (HA) are applied to a tumor or a surgical location after removal of the bulk of the tumor. The inhibitors enzymatically cleave surface HS or HA; genetically modify cancer cells to decrease HS or HA production or interfere with the signaling pathway between HS or HA and a MMP or syndecan.

Abstract: An electroactive photonic polymer sensing device includes an imaging component that uses photonic energy to generate a photocurrent that represents a molecular parameter, wherein the imaging component includes a photosensitive material and at least one of a laser diode and/or photodiode; and a memory component that stores a representation of the molecular parameter, wherein the memory component includes at least one of a protein, vitamin, lipid, carbon allotrope, carbon tetra fluoride.

Abstract: A method to use high temperature thermal storage for integration into building heating/cooling systems and to meet building's peak power demand. The method can be used to store the thermal energy at any desirable rate and then discharge this stored energy to meet the demand for short or long time intervals. Input energy stored with this method is thermal energy, however, output can be thermal or electric based upon the requirement.

Abstract: A secondary alkaline battery using manganese dioxide is described. The battery includes a mixed cathode material with birnessite-phase manganese dioxide or electrolytic manganese dioxide (EMD), a bismuth compound and a copper compound selected from the group consisting of elemental copper and a copper salt. In some embodiments, a conductive carbon and/or a binder may also be included.

Abstract: A gel is disclosed that is formed from a hydrophobic liquid and a gelator. The gelator has a structure given by: formula (I) where (II) and (III) or (IV) or (V). The gelator is environmentally friendly and from a biomass source.

Abstract: A Ligand-guided-Selection (LIGS) method for identifying highly specific aptamers against a predetermined antigen of a target is provided. LIGS uses a stronger and highly specific bivalent binder (e.g. an antibody) interacting with its cognate antigen to displace specific aptamers from a partially enriched SELEX pool. Elution of the displaced aptamers provides aptamers that are specific to the predetermined antigen.

Abstract: The present disclosure provides compounds of the formula (I), (II), (III), wherein the variables are as defined herein for use in the treatment of fungal infections. In some embodiments, the fungal infection is an infection of Cryptococcus neojormans fungus. Also provided herein are compositions comprising a compound of formula I, II, or III and a second anti-fungal agent.