Patents Assigned to Research
  • Monomers from biomass
    Patent number: 10513482
    Abstract: Compounds derived from biomass, e.g., cellulose and lignins, methods of forming such compounds and polymers and products formed using such compounds.
    Type: Grant
    Filed: August 7, 2015
    Date of Patent: December 24, 2019
    Assignee: NDSU RESEARCH FOUNDATION
    Inventors: Mukund P. Sibi, Selvakumar Sermadurai, Nicolas Zimmermann, Eric Serum, Gaoyuan Ma, Ramkumar Moorthy, Krystal Kalliokoski
  • High probability of intercept radar detector
    Patent number: 10514441
    Abstract: A detector for detecting continuous wave police radar that includes an antenna configured to receive an input signal, a diplexer in communication with the antenna to separate the input signal into a high-band signal and a low-band signal, a local oscillator configured to sweep through a range of frequencies to produce FLO, and a frequency multiplier to generate a first mixing signal that is an integer multiple of FLO. The detector also includes a high-band intermediate-frequency signal and a low-band intermediate-frequency signal with a switch configured to select one of them as an output intermediate-frequency signal. A second-stage mixes the output intermediate-frequency signal with FLO to generate an output signal, and a determination is made whether the input signal includes a police radar signal.
    Type: Grant
    Filed: April 13, 2017
    Date of Patent: December 24, 2019
    Assignee: Valentine Research, Inc.
    Inventors: Michael D. Valentine, Stephen R. Scholl, Richard L. Dickerson, Michael Negussu
  • Wireless power transfer pad and ground assembly having the same
    Patent number: 10516297
    Abstract: A wireless power transmission pad for transmitting wireless power to a reception pad including a secondary coil includes: a rectangular-shaped primary coil having an X-width defined in an x-direction and a Y-width defined in a y-direction and having a central space; a ferrite coupled to the primary coil; and a housing supporting the primary coil and the ferrite. A first cross-sectional area of a first portion including the X-width of the primary coil is smaller than a second cross-sectional area of a second portion including the Y-width of the primary coil.
    Type: Grant
    Filed: March 7, 2017
    Date of Patent: December 24, 2019
    Assignees: Hyundai Motor Company, Kia Motors Corporation, Research & Business Foundation Sungkyunkwan University
    Inventors: Woo Young Lee, Gyu Yeong Choe, Byoung Kuk Lee, Min Kook Kim, Dong Myoung Joo, Jong Eun Byeon, Min Hyuck Kang, Dong Gyun Woo, Min Jung Kim
  • DNA sequence that increases odorant receptor representation in the olfactory system
    Patent number: 10512253
    Abstract: A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.
    Type: Grant
    Filed: August 3, 2016
    Date of Patent: December 24, 2019
    Assignee: Research Foundation of the City University of New York
    Inventors: Paul Feinstein, Charlotte D'Hulst
  • Overlay architecture for programming FPGAs
    Patent number: 10516396
    Abstract: An overlay architecture and an associated method that uses datapath merging to provide minimal-overhead support for multiple source netlists, and optionally provides an adjustable amount of flexibility through a secondary interconnect network is disclosed.
    Type: Grant
    Filed: April 28, 2017
    Date of Patent: December 24, 2019
    Assignee: University of Florida Research Foundation, Incorporated
    Inventors: James R. Coole, Gregory M. Stitt
  • Device localization using RSS based path loss exponent estimation
    Patent number: 10514437
    Abstract: A method for tracking a device determines correlations among locations of the device including a set of previous locations of the device and an initial estimate of a current location of the device, and determines, for each access point (AP), a current path loss exponent for the current location of the device using previous path loss exponents determined for the previous locations of the device and the correlations among the locations of the device. The method determines the current location of the device according to a path loss model using received signal strengths (RSS) of signals received from each AP at the current location and the current path loss exponent determined for each AP. The current path loss exponent for each AP are updated using the current location of the device and the RSS of signals received from the corresponding AP.
    Type: Grant
    Filed: September 22, 2015
    Date of Patent: December 24, 2019
    Assignee: Mitsubishi Electric Research Laboratories, Inc.
    Inventors: Milutin Pajovic, Philip Orlik
  • Voltage source converter based direct current deicer and controlling method thereof
    Patent number: 10516257
    Abstract: A voltage source converter based DC deicer and its control method are provided. The voltage source converter based DC deicer includes a connecting reactor, a modular multilevel voltage source converter based on a full H-bridge submodule, smoothing reactors, deicing disconnectors, a deicing bus, and a deicing AC line. The AC side of the modular multilevel voltage source converter is connected to an AC side bus through the connecting reactor, an isolation disconnector and a breaker. The DC side of the modular multilevel voltage source converter is connected to the deicing AC line through the smoothing reactors, the deicing disconnectors, and the deicing bus.
    Type: Grant
    Filed: November 16, 2015
    Date of Patent: December 24, 2019
    Assignee: CHINA SOUTHERN POWER GRID TECHNOLOGY RESEARCH INSTITUTE CO., LTD.
    Inventors: Chuang Fu, Hong Rao, Juanjuan Wang, Shukai Xu
  • High-speed, high-resolution, photonic-based analog-to-digital converter
    Patent number: 10516409
    Abstract: A photonic feedforward analog-to-digital converter (ADC) is provided. According to one aspect of the invention, the signal to be digitized is applied to only one electro-optic modulator. High speed is achieved by taking advantage of the fundamental property of a Pockels Cell to control wave polarization using the electro-optic effect. In a further aspect, once a bit is determined, its state is fed forward to the next least significant bit to aid in determination of the next lower bit. This nonlinear feedforward aspect of the ADC provides simplicity of its architecture.
    Type: Grant
    Filed: February 24, 2017
    Date of Patent: December 24, 2019
    Assignee: University of Florida Research Foundation, Incorporated
    Inventors: Henry Zmuda, Nickolas P. Dirocco
  • Flow through line charge volume
    Patent number: 10515783
    Abstract: A charge volume configuration for use in delivery of gas to a reactor for processing semiconductor wafers is provided. A charge volume includes a chamber that extends between a proximal end and a distal end. A base connected to the proximal end of the chamber, and the base includes an inlet port and an outlet port. A tube is disposed within the chamber. The tube has a tube diameter that is less than a chamber diameter. The tube has a connection end coupled to the inlet port at the proximal end of the chamber and an output end disposed at the distal end of the chamber.
    Type: Grant
    Filed: February 23, 2016
    Date of Patent: December 24, 2019
    Assignee: Lam Research Corporation
    Inventor: Karl Leeser
  • Polycations and methods of making and using thereof
    Patent number: 10513567
    Abstract: Disclosed are polycationic polymers. The polycationic polymers can include a plurality of positively charged centers, each of which is formed by condensation of cyclic bis-electrophile (e.g., a 9-thia/aza/selenabicyclo[3.3.1]nonyl electrophile) with a nucleophile. The resulting polycationic polymers can efficiently bind nucleic acids. The polycations can also exhibit properties of cytotoxicity and DNA transfection with interesting structure-activity characteristics.
    Type: Grant
    Filed: May 31, 2017
    Date of Patent: December 24, 2019
    Assignee: Georgia Tech Research Corporation
    Inventors: M. G. Finn, Jennifer Marie Beveridge, Allison Frances Geoghan, Zhishuai Geng
  • Method and system for determining 3D object poses and landmark points using surface patches
    Patent number: 10515259
    Abstract: A method and system determine a three-dimensional (3D) pose of an object and 3D locations of landmark points of the object by first obtaining a 3D point cloud of the object. 3D surface patches are extracted from the 3D point cloud, and a parametric model is fitted to each 3D surface patch to determine a set of descriptors. A set of correspondences between the set of descriptors and a set of descriptors of patches extracted from 3D point clouds of objects from the same object class with known 3D poses and known 3D locations of landmark points is determined. Then, the 3D pose of the object and 3D locations of the landmark points of the object are estimated from the set of correspondences.
    Type: Grant
    Filed: February 26, 2015
    Date of Patent: December 24, 2019
    Assignee: Mitsubishi Electric Research Laboratories, Inc.
    Inventors: Michael J Jones, Tim Marks, Chavdar Papazov
  • Collaborative 3D modeling system
    Patent number: 10515479
    Abstract: A collaborative 3D modeling system, comprising a computer processing unit, a digital memory, and an electronic display, the computer processing unit and the digital memory configured to provide 3D model representations of a first plurality of versions of an object component for a first user, the versions being selectable along a first axis, and using the electronic display, provide a plurality of user identifications which are selectable along a second axis, wherein selecting a subsequent user causes a second plurality of said versions of said object component to be displayed on the electronic display.
    Type: Grant
    Filed: November 23, 2017
    Date of Patent: December 24, 2019
    Assignee: Purdue Research Foundation
    Inventors: Cecil Piya, Vinayak Raman Krishnamurthy, Karthik Ramani
  • Modified crystalline aluminosilicate for dehydration of alcohols
    Patent number: 10512903
    Abstract: The present invention relates to a catalyst composition comprising a modified crystalline aluminosilicate of the Framework Type FER having Si/Al framework molar ratio greater than 20 characterized in that in said modified crystalline aluminosilicate the ratio between the strong acid sites and the weak acid sites, S/W, is lower than 1.0 and having the extra framework aluminum (EFAL) content lowered to less than 10 wt % preferably 5 wt % even more preferably less than 2 wt % measured by 27 Al MAS NMR. The present invention further relates to a process for producing olefins from alcohols in presence of said catalyst composition.
    Type: Grant
    Filed: September 24, 2015
    Date of Patent: December 24, 2019
    Assignees: TOTAL RESEARCH & TECHNOLOGY FELUY, IFP ENERGIES NOUVELLES
    Inventors: Nikolai Nesterenko, Delphine Minoux, Nadiya Danilina, Jean-Pierre Dath, Vincent Coupard, Sylvie Maury
  • Inductive link coil de-tuning compensation and control
    Patent number: 10512553
    Abstract: An inductive wireless power transfer and communication system includes an electrostatic shield for one of the coils. The electrostatic shield is inductively coupled with the coil and is configured as an open circuit. A signal processing element or elements, especially a modulator or a demodulator, are connected across the electrical discontinuity in the electrostatic shield. Because the electrostatic shield is inductively coupled to the coil, the modulator or demodulator can operate on the signal on the coil. A variable impedance element is connected across the electrical discontinuity in the electrostatic shield. Because the electrostatic shield is inductively coupled to the coil, the variable impedance element can tune the impedance of the system.
    Type: Grant
    Filed: February 3, 2016
    Date of Patent: December 24, 2019
    Assignee: The Alfred E. Mann Foundation for Scientific Research
    Inventor: Glen A. Griffith
  • Health assessment method and health assessment device for workpiece processing apparatus
    Patent number: 10515725
    Abstract: A health assessment method and a health assessment device of a workpiece processing apparatus are disclosed. The health assessment method includes the following steps. Acquire a first sensing data related to the workpiece processing apparatus at an operation stage of the workpiece processing apparatus. Set the first sensing data as a substitution of a first transform model to acquire a virtual workpiece quality. Set the virtual workpiece quality as a substitution of a second transform model to acquire a first virtual apparatus health index.
    Type: Grant
    Filed: December 29, 2015
    Date of Patent: December 24, 2019
    Assignee: INDUSTRIAL TECHNOLOGY RESEARCH INSTITUTE
    Inventors: Chung-Wei Lin, Te-Ming Chen, Chuang-Hua Chueh, Sen-Chia Chang
  • Methods and compositions related to inhibition of viral entry
    Patent number: 10512665
    Abstract: Disclosed are compositions and methods for inhibiting viral entry.
    Type: Grant
    Filed: June 2, 2016
    Date of Patent: December 24, 2019
    Assignee: UNIVERSITY OF UTAH RESEARCH FOUNDATION
    Inventors: Michael S. Kay, Brett D. Welch
  • Image encoding/decoding method using prediction block and apparatus for same
    Patent number: 10516897
    Abstract: According to the present invention, an image encoding/decoding method comprises the steps of: performing an intra prediction on a current block so as to generate a prediction block; performing filtering on a filtering target pixel in the prediction block on the basis of the intra prediction mode of the current block so as to generate a final prediction block; and generating a reconstructed block on the basis of a reconstructed differential block corresponding to the current block and on the final prediction block. According to the present invention, image encoding/decoding efficiency can be improved.
    Type: Grant
    Filed: November 30, 2018
    Date of Patent: December 24, 2019
    Assignee: Electronics and Telecommunications Research Institute
    Inventors: Jin Ho Lee, Hui Yong Kim, Sung Chang Lim, Jin Soo Choi, Jin Woong Kim
  • Methods and systems for converting hydrocarbons
    Patent number: 10513475
    Abstract: Methods and systems for converting hydrocarbons including exposing a portion of a hydroperoxide-containing feed including tert-butyl hydroperoxide to a solid deperoxidation catalyst under decomposition conditions to form an oxidation effluent comprising tert-butyl alcohol, wherein the solid deperoxidation catalyst comprises a manganese oxide octahedral molecular sieve, are provided herein. Further methods and systems for converting the oxidation effluent to an alkylation product are also provided herein.
    Type: Grant
    Filed: December 13, 2017
    Date of Patent: December 24, 2019
    Assignee: EXXONMOBIL RESEARCH AND ENGINEERING COMPANY
    Inventors: Sophie Liu, Jihad M. Dakka, Partha Nandi, Sara Yacob, Quddus A. Nizami, Chuansheng Bai
  • Internal combustion engine having dedicated EGR cylinder(s) with split intake and cylinder deactivation at low loads
    Patent number: 10513992
    Abstract: A method of operating a split intake D-EGR (dedicated exhaust gas recirculation) engine having at least one D-EGR cylinder and a number of non-EGR cylinders. If the engine is in a low load operating condition, either of two cylinder deactivation modes may be performed. In first cylinder deactivation mode, the D-EGR cylinder(s) are deactivated by disabling fuel delivery to the D-EGR cylinder(s), closing a D-EGR throttle, closing a D-EGR valve, and operating a three-way valve on the main exhaust line such that no exhaust from the D-EGR cylinder(s) is exhausted. In a second cylinder deactivation mode, the non-EGR cylinders are deactivated by disabling fuel delivery to the non-EGR cylinders, opening the D-EGR throttle, closing the D-EGR valve, and operating the three-way valve such that no exhaust from the main cylinders is exhausted.
    Type: Grant
    Filed: December 21, 2018
    Date of Patent: December 24, 2019
    Assignee: Southwest Research Institute
    Inventors: Raphael Gukelberger, Steven Almaraz, Forest C. Gibson
  • Coolant valve
    Patent number: D870776
    Type: Grant
    Filed: December 27, 2017
    Date of Patent: December 24, 2019
    Assignee: Hangzhou Sanhua Research Institute Co., Ltd.
    Inventors: Yaoyao Zhang, Zhi Wu, Huayuan Jiang, Huipeng Lv