Patents Assigned to The University
  • Publication number: 20210339054
    Abstract: An ultrasound therapy system and method is provided that provides directional, focused ultrasound to localized regions of tissue within body joints, such as spinal joints. An ultrasound emitter or transducer is delivered to a location within the body associated with the joint and heats the target region of tissue associated with the joint from the location. Such locations for ultrasound transducer placement may include for example in or around the intervertebral discs, or the bony structures such as vertebral bodies or posterior vertebral elements such as facet joints. Various modes of operation provide for selective, controlled heating at different temperature ranges to provide different intended results in the target tissue, which ranges are significantly affected by pre-stressed tissues such as in-vivo intervertebral discs. In particular, treatments above 70 degrees C., and in particular 75 degrees C.
    Type: Application
    Filed: June 3, 2021
    Publication date: November 4, 2021
    Applicant: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA
    Inventors: Chris J. Diederich, Jeffrey C. Lotz, Will Nau, David S. Bradford
  • Publication number: 20210343218
    Abstract: Systems and methods for a multi-primary color system for display. A multi-primary color system increases the number of primary colors available in a color system and color system equipment. Increasing the number of primary colors reduces metameric errors from viewer to viewer. One embodiment of the multi-primary color system includes Red, Green, Blue, Cyan, Yellow, and Magenta primaries. The systems of the present invention maintain compatibility with existing color systems and equipment and provide systems for backwards compatibility with older color systems.
    Type: Application
    Filed: July 15, 2021
    Publication date: November 4, 2021
    Applicant: Baylor University
    Inventors: Mitchell J. Bogdanowicz, Corey P. Carbonara, Michael F. Korpi, James M. DeFilippis, Gary B. Mandle
  • Publication number: 20210338801
    Abstract: An immunomodulatory delivery system includes a hydrogel, a first immunomodulatory cargo encapsulated in the cargo, and a second immunomodulatory cargo encapsulated in the hydrogel. The hydrogel includes a polymer non-covalently crossed-linked with a plurality of nanoparticles. The first immunomodulatory cargo is smaller than the second immunomodulatory cargo. A ratio of a diffusivity of the first immunomodulatory cargo through the hydrogel to a diffusivity of the second immunomodulatory cargo through the hydrogel is less than 3.
    Type: Application
    Filed: October 1, 2019
    Publication date: November 4, 2021
    Applicant: THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY
    Inventors: Gillie A. ROTH, Eric Andrew APPEL, Mark DAVIS, Emily C. GALE, Santiago CORREA
  • Publication number: 20210340420
    Abstract: The present invention relates in part to a lignin composition and a method of fabricating a lignin composition. The invention also relates in part to a method of using a lignin composition to adsorb onto a petrochemical oil comprising the steps of providing a solution of lignin in an alcohol, providing an oil on a liquid surface, contacting the oil with the solution of lignin in an alcohol, adsorbing the lignin to the oil, and removing the adsorbed oil from the surface of the liquid.
    Type: Application
    Filed: October 3, 2019
    Publication date: November 4, 2021
    Applicant: Board of Supervisors of Louisiana State University and Agricultural and Mechanical College
    Inventor: Bhuvnesh BHARTI
  • Publication number: 20210341488
    Abstract: A fluorescence polarization immunoassay that uses a fluorescent labeling substance in which a single domain antibody is labeled with a fluorescent dye. A fluorescent labeling substance obtained by labeling a single domain antibody, such as a VHH antibody or a vNAR antibody, having a binding ability to a target substance with a fluorescent dye is used. The fluorescence polarization immunoassay includes a binding step for binding the fluorescent labeling substance to a target substance; and a measuring step for measuring a change in the fluorescence polarization of the fluorescent labeling substance to which the target substance is bound.
    Type: Application
    Filed: April 27, 2021
    Publication date: November 4, 2021
    Applicants: TOHOKU UNIVERSITY, Tianma Japan, Ltd., NATIONAL UNIVERSITY CORPORATION HOKKAIDO UNIVERSITY
    Inventors: Mao Fukuyama, Akihide Hibara, Ayuko Imai, Koji Shigemura, Manabu Tokeshi
  • Publication number: 20210340538
    Abstract: A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO:4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO:5). The passenger RNA strand includes a 2?-O-methylation modification to increase stability. Cholesterol is conjugated to the 3?-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule.
    Type: Application
    Filed: May 3, 2021
    Publication date: November 4, 2021
    Applicants: Washington University, Wisconsin Alumni Research Foundation
    Inventors: Jianghui Hou, Dale Bjorling, Zun-Yi Wang
  • Publication number: 20210341658
    Abstract: An optical filter includes a near-infrared absorbing layer including a first material, the first material being configured to absorb light in a first wavelength spectrum belonging to a near-infrared wavelength spectrum. The optical filter includes a compensation layer adjacent to the near-infrared absorbing layer, the compensation layer including a second material different from the first material. The optical filter includes a metamaterial structure spaced apart from the near-infrared absorbing layer via the compensation layer, the metamaterial structure being configured to absorb or reflect light in a second wavelength spectrum at least partially overlapped with the first wavelength spectrum.
    Type: Application
    Filed: April 7, 2021
    Publication date: November 4, 2021
    Applicants: Samsung Electronics Co., Ltd., Industry-University Cooperation Foundation Korea Aerospace University
    Inventors: Mi Jeong KIM, Jinyoung HWANG, Chung Kun CHO, Hye Ran KIM
  • Publication number: 20210337743
    Abstract: The invention discloses a regulating system and method for multilayer shading film of plastic greenhouse with adjustable shading rate. The upper film of the sunshade is a fully transparent film, while the middle film and the lower film are printed with dots, which are interlaced. Through the measurement and comparison of the warm light in the greenhouse, the combined control of the sunshade film is realized. Not only can it adjust its light blocking rate, but it also has a heat insulating effect when there is a certain amount of air in the film.
    Type: Application
    Filed: September 7, 2018
    Publication date: November 4, 2021
    Applicant: JIANGSU UNIVERSITY
    Inventors: Xinzhong WANG, Liangliang LI
  • Publication number: 20210338723
    Abstract: Among the various aspects of the present disclosure are provisions for methods of, and compositions for, increasing NK cell anti-tumor response, screening donors, and predicting response to NK cell therapy.
    Type: Application
    Filed: January 21, 2021
    Publication date: November 4, 2021
    Applicant: Washington University
    Inventors: Todd Fehniger, Melissa Berrien-Elliott
  • Publication number: 20210338630
    Abstract: Disclosed are methods to treat a renal disorder in a mammal in need thereof by administering to the mammal in need of treatment an effective amount of a store operated calcium entry (SOCE) inhibitor or a pharmaceutically acceptable salt thereof.
    Type: Application
    Filed: October 4, 2019
    Publication date: November 4, 2021
    Applicant: The Trustees of Indiana University
    Inventors: David P. Basile, Purvi Mehrotra, Michael S. Sturek
  • Publication number: 20210338717
    Abstract: A composition including a mixture of: (a) first nanoparticle carrier vehicles loaded with an active ingredient for treating or preventing a disorder (therapeutic nanoparticles), and (b) second nanoparticle carrier vehicles without the active ingredient (decoy nanoparticles). Also method of treating or preventing a disease, disorder or condition comprising administering to a human subject in need a dose of a composition having nanoparticles containing an active ingredient effective to treat or prevent the disease, disorder or condition. The dose is in terms of number of nanoparticles, and the nanoparticles is one of gold nanoparticles, liposomes, silica nanoparticles, micelles, hydrogels or polymeric nanoparticles. The number of nanoparticles in the dose is of at least one and one-half (1.5) quadrillion (1015) nanoparticles.
    Type: Application
    Filed: April 29, 2021
    Publication date: November 4, 2021
    Applicant: THE GOVERNING COUNCIL OF THE UNIVERSITY OF TORONTO
    Inventors: Ben OUYANG, Yi-Nan ZHANG, Wilson POON, Warren Che War CHAN, Zachary P. LIN
  • Publication number: 20210341462
    Abstract: The presently disclosed subject matter provides a microfluidic device that can simulate the cross section of the large and small human airways, including the air-exposed epithelial layer, the adjacent surrounding stromal layer, and the blood-facing endothelial layer of near-by vessels in the circulatory system. The microfluidic device can reconstitute the air-liquid interface in the lung and molecular transport characteristics of bronchi and bronchioles in the human pulmonary airways, and provide a more realistic alternative to current in vitro models of airway structures. Additionally, the model can reconstitute the native response of airway tissues to infection by bacterial and viral agents, and also the extravasation of immune cells from the bloodstream and into the stromal and epithelial compartments of the lung in response to an infection.
    Type: Application
    Filed: October 7, 2019
    Publication date: November 4, 2021
    Applicant: THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIA
    Inventors: Dongeun Huh, Andrei Georgescu
  • Publication number: 20210341376
    Abstract: A system for deforming and analyzing a plurality of particles carried in a sample volume includes a substrate defining an inlet, configured to receive the sample volume, and an outlet; and a fluidic pathway fluidly coupled to the inlet and the outlet.
    Type: Application
    Filed: March 12, 2021
    Publication date: November 4, 2021
    Applicant: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA
    Inventors: Dino Di Carlo, Daniel R. Gossett, Henry T.K. Tse, Aram Chung
  • Publication number: 20210340122
    Abstract: This invention is directed to selective androgen receptor degrader (SARD) compounds including heterocyclic rings and pharmaceutical compositions and uses thereof in treating prostate cancer, advanced prostate cancer, castration resistant prostate cancer, triple negative breast cancer, other cancers expressing the androgen receptor, androgenic alopecia or other hyperandrogenic dermal diseases, Kennedys disease, amyotrophic lateral sclerosis (ALS), abdominal aortic aneurysm (AAA), and uterine fibroids, and to methods for reducing the levels of androgen receptor-full length (AR-FL) including pathogenic or resistance mutations, AR-splice variants (AR-SV), and pathogenic polyglutamine (polyQ) polymorphisms of AR in a subject.
    Type: Application
    Filed: September 5, 2019
    Publication date: November 4, 2021
    Applicant: University of Tennessee Research Foundation
    Inventors: Ramesh NARAYANAN, Duane D. MILLER, Yali HE, Dong-Jin HWANG, Thamarai PONNUSAMY
  • Publication number: 20210339222
    Abstract: Articles including a solid porous material having a selenium nanomaterial bound to a surface of and within the solid porous material. The article may be a include no polymeric stabilizer or proteinaceous stabilizer. The solid porous material may be a sponge, a film, a fabric, a non-woven material, or a metal-organic framework (MOF), or a combination thereof. The article may be produced by treating a solid porous material with an aqueous selenous acid solution and heating the solid porous material to form the selenium nanomaterial on the surface of and within the solid porous material.
    Type: Application
    Filed: July 8, 2021
    Publication date: November 4, 2021
    Applicant: Regents of the University of Minnesota
    Inventors: Abdennour Abbas, Snober Ahmed
  • Publication number: 20210340232
    Abstract: Provided herein are methods and reagents for increasing chemosensitivity to chemotherapy and immunotherapy in cancer patients. Methods of treating cancer are provided, comprising administering to a patient in need thereof an effective amount of an DKK3-neutralizing agent, such as a DKK3-neutralizing antibody provided herein. The methods can further include administering an effective amount of chemotherapy or immunotherapy to said patient.
    Type: Application
    Filed: October 15, 2019
    Publication date: November 4, 2021
    Applicant: Board of Regents, The University of Texas System
    Inventors: Rosa HWANG, Liran ZHOU, Mason LU, Hongmei HUSTER, Craig LOGSDON, Jeffrey E. LEE
  • Publication number: 20210343217
    Abstract: Systems and methods for a multi-primary color system for display. A multi-primary color system increases the number of primary colors available in a color system and color system equipment. Increasing the number of primary colors reduces metameric errors from viewer to viewer. One embodiment of the multi-primary color system includes Red, Green, Blue, Cyan, Yellow, and Magenta primaries. The systems of the present invention maintain compatibility with existing color systems and equipment and provide systems for backwards compatibility with older color systems.
    Type: Application
    Filed: July 8, 2021
    Publication date: November 4, 2021
    Applicant: Baylor University
    Inventors: Mitchell J. Bogdanowicz, Gary B. Mandle
  • Publication number: 20210341472
    Abstract: The present disclosure provides modes of relative motion between a solid surface and a solution, and the related motion apparatuses. In an interaction between the solid surface and a target object, the target object is dissolved or dispersed in the solution, and the solid surface and the solution make a relative motion, with the relative motion including a relative movement perpendicular to the solid surface, in order to improve at least one of the following: binding rate, dissociation rate, binding uniformity, binding directionality and binding density of the target object to the solid surface. Compared with the traditional modes of relative motion in which the relative motion is parallel to a sensor surface, the modes of relative motion of the present disclosure can effectively improve the binding efficiency and dissociation efficiency between a ligand and an analyte given the same relative motion velocity between the sensor and the solution.
    Type: Application
    Filed: May 6, 2019
    Publication date: November 4, 2021
    Applicant: Shanghai Jiao Tong University
    Inventors: Tian YANG, Xiaolong HE, Yalin WANG
  • Publication number: 20210340763
    Abstract: A morphing panel mechanism may include a central panel and a side panel, where a first edge of the side panel may be pivotally coupled to a first edge of the central panel. A morphing panel mechanism may further include a guide panel that may be coupled with a first corner of the central panel via a ball joint, where the guide panel may include a first slit. A morphing panel mechanism may further include a flexible panel, where a first edge of the flexible panel may be pivotally coupled with a second edge of the side panel, and a second edge of the flexible panel may be slidably disposed within the slit of the guide panel.
    Type: Application
    Filed: July 14, 2021
    Publication date: November 4, 2021
    Applicant: University of Tehran
    Inventors: Ali Golozar, Farzad Ayatollahzadeh Shirazi, Kambiz Ghaemi Osgouie, Fardad Nasrollahzadeh Khakiani, Shahin Siahpour
  • Publication number: 20210340540
    Abstract: A method of reducing the level of a transcription product in a cell comprising contacting with the cell a composition comprising a double-stranded nucleic acid complex comprising a first nucleic acid strand annealed to a second nucleic acid strand, wherein: (i) the first nucleic acid strand hybridizes to the transcription product and comprises (a) a region consisting of at least 4 consecutive nucleotides that are recognized by RNase H when the strand is hybridized to the transcription product, (b) one or more nucleotide analogs located on 5? terminal side of the region, (c) one or more nucleotide analogs located on 3? terminal side of the region and (d) a total number of nucleotides and nucleotide analogs ranging from 8 to 35 nucleotides and (ii) the second nucleic acid strand comprises (a) nucleotides and optionally nucleotide analogs and (b) at least 4 consecutive RNA nucleotides.
    Type: Application
    Filed: May 27, 2021
    Publication date: November 4, 2021
    Applicants: National University Corporation Tokyo Medical and Dental University, Osaka University
    Inventors: Takanori Yokota, Kazutaka Nishina, Satoshi Obika, Hidehiro Mizusawa