Abstract: The invention provides in part dialkoxybenzene compounds for controlling infestation by a Trichoplusia ni, and methods thereof. The compounds include a compound of Formula I: where R1 may be methyl, ethyl, propyl, n-butyl, isopentyl(3-methylbutyl) or allyl; R2 may be at positions 2, 3 or 4 and may be H, methyl, ethyl, propyl, n-butyl, isopentyl(3-methylbutyl) or allyl; and R3 may be optionally present at positions 2, 3 and 4, and is allyl; except that when R2 is at position 2, R3 if present is at position 3, and when R2 is at position 3, R3 if present is at positions 2 or 4, and when R2 is at position 4, R3 if present is at position 2, and when R2 is at position 4 and R3, if present, has reacted with an OH group at position 1 in a Markovnikov sense, then R3 becomes R4, a dihydrofuran.

Abstract: Antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. Seq ID No. 4 (cagcagcagagtcttcatcat) is an antisense oligonucleotide which inhibits expression of TRPM-2 by tumor cells, and which can be combined with a pharmaceutically acceptable carrier suitable for human administration.

Abstract: An imaging system comprises a device to excite mechanical waves in elastic tissue, a device for measuring the resulting tissue motion at a plurality of locations interior to the tissue at a number of time instances, a computing device to calculate the mechanical properties of tissue from the measurements, and a display to show the properties according to their location. A parameter identification method for calculating the mechanical properties is based on fitting a lumped dynamic parametric model of the tissue dynamics to their measurements. Alternatively, the mechanical properties are calculated from transfer functions computed from measurements at adjacent locations in the tissue. The excitation can be produced by mechanical vibrators, medical needles or structures supporting the patient. The measurements may be performed by a conventional ultrasound imaging system and the resulting properties displayed as semi-transparent overlays on the ultrasound images.

Abstract: Methods for polymerization of phosphaalkenes using initiators are provided. Also provided are polymers and co-polymers in which the polymer backbone contains tracts of carbon and phosphorous atoms in approximately equimolar amounts. C—P bonds in the polymers of this invention may be predominantly in a head-to-tail arrangement or mixed arrangements. Co-polymers may comprise polyolefin monomer units.

Abstract: Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense oligonucleotide or RNAi nucleotide inhibitor with sequence specificity for hsp27 mRNA, for example human hsp27 mRNA, is administered to an individual suffering from prostate cancer or some other cancer expressing elevated levels of hsp 27 in a therapeutically effective amount. The therapeutic agent is suitably formulated into a pharmaceutical composition which includes a pharmaceutically acceptable carrier, and packaged in dosage unit form. A preferred dosage unit form is an injectable dosage unit form.

Abstract: A method of processing ions in a quadrupole rod set is provided, comprising a) establishing and maintaining a two-dimensional substantially quadrupole field having a quadrupole harmonic with amplitude A2 and a selected higher order harmonic with amplitude Am radially confining ions having Mathieu parameters a and q within a stability region defined in terms of the Mathieu parameters a and q; c) adding an auxiliary excitation field to transform the stability region into a plurality of smaller stability islands defined in terms of the Mathieu parameters a and q; and, d) adjusting the two-dimensional substantially quadrupole field to place ions within a selected range of mass-to-charge ratios within a selected stability island in the plurality of stability islands.

Abstract: A method of identifying a polynucleotide or pattern of polynucleotides regulated by one or more sepsis or inflammatory inducing agents and inhibited by a peptide is described. A method of identifying a pattern of polynucleotide expression for inhibition of an inflammatory or septic response. The method includes contacting cells with LPS, LTA, CpG DNA and/or intact microbe or microbial components in the presence or absence of a cationic peptide; detecting a pattern of polynucleotide expression for the cells in the presence and absence of the peptide, wherein the pattern in the presence of the peptide represents inhibition of an inflammatory or septic response. Also included are compounds and agents identified by the methods of the invention. In another aspect, the invention provides methods and compounds for enhancing innate immunity in a subject.

Abstract: A fluidized bed reactor (14) for removing phosphorus and nitrogen from wastewater has a column comprising a number of sections. (15A, 15B, 15C, 15D) The diameter of the column changes stepwise between the sections. A flow velocity in excess of 100 cm/min is maintained in a lowermost one of the sections and lower flow velocities are maintained in subsequent sections. A struvite supersaturation ratio is controlled in part by recycling wastewater from an outlet of the column. Struvite pellets are removed periodically from the bottom of the column.

Abstract: It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. In particular, such antisense therapy can be applied in treatment of prostate cancer and renal cell cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Thus, prostate cancer can be treated in an individual suffering from prostate cancer by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual, and administering to the individual a composition effective to inhibit expression of TRPM-2 by the tumor cells, thereby delaying the progression of prostatic tumor cells to an androgen-independent state in an individual Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer.

Abstract: The light emitting surface of an image display light box is formed of multi-layer optical film having a reflectance greater than 95% and preferably about 99% or greater. This more efficiently utilizes light rays emitted by the light box's internal light source, since the multi-layer optical film reflects the light rays many times before the rays are absorbed and lost. Consequently, the light emitting surface can have a light transmissivity characteristic which is macroscopically invariant as a function of position on the light emitting surface. Light boxes utilizing prior art reflective materials require cumbersome, time-consuming, iterative trial and error techniques which must be customized for each light box in order to compensate for light absorption losses by imparting a variable transmissivity characteristic to the reflective material.

Abstract: This invention provides analogs of hemiasterlin, methods of synthesis of the analogs and use of the analogs as cytotoxic and anti-mitotic agents.

Abstract: A diffraction grating for which the intensity and/or direction of the diffracted light is electronically modulated using the electrophoresis of an index-modifying species. Index-modifying dye ions are dissolved in an electrophoretic medium maintained adjacent the diffraction grating. Application of a voltage across the medium moves many of the ions into the region adjacent the grating such that the ions absorb the incident light or otherwise modify the local index of refraction so as to change the optical characteristics of the diffracted light. Application of an opposite voltage across the medium moves many of the ions away from the grating, allowing light rays to diffract in a different manner when encountering the grating.

Abstract: A compound capable of specifically binding to pathogen EF-1? but not host EF-1?, wherein the compound binds to any part of an amino acid sequence having at least 70% sequence identity to amino acids 240-230 of SEQ ID NO:22.

Abstract: Administration of antisense oligodeoxynucleotides (ODN) targeted against the testosterone-repressed prostate message-2 (TRPM-2) gene can reduce the amount of TRPM-2 in renal cell cancer (RCC) cells and other cancer cells, and as a result enhance chemosensitivity of these cells to chemotherapy agents and radiation. Thus, for example, the sensitivity of renal cell cancer cells to a chemotherapeutic agent can be increased by exposing renal cell cancer cells to a chemotherapeutic agent and an agent which reduces the amount of TRPM-2 in the renal cell cancer cells. This provides an improved method for treatment of renal cell cancer, which is generally resistant to treatment with known chemotherapy agents.

Abstract: The present invention utilizes three families of bacterial enzymes, which play a key role in mycothiol biosynthesis. The three families are bacterial cysteine:glucosaminyl inositol ligases (MshC) with catalytic ligase activity for ligation of glucosaminyl inositol and cysteine, bacterial acetyl-CoA:Cys-GlcN-Ins acetyltransferases (MshD) with catalytic activity for addition of an acetyl group to Cys-GlcN-Ins and bacterial MshA glycosyltransferase with catalytic activity for production of GlcNAc-Ins. The invention provides methods for using the mycothiol biosynthesis ligases, acetyltransferases or glycosyltransferases in drug screening assays to determine compounds that inhibit activity. The invention provides for treatment of actinomycete infections in mammals using antibiotics that inhibit production or activity of the enzymes of mycothiol biosynthesis, in particular MshC, MshD or MshA, and thereby reduce the production of mycothiol and the virulence of the infecting bacteria.

Abstract: Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense oligonucleotide or RNAi nucleotide inhibitor with sequence specificity for hsp27 mRNA, for example human hsp27 mRNA, is administered to an individual suffering from prostate cancer or some other cancer expressing elevated levels of hsp 27 in a therapeutically effective amount. The therapeutic agent is suitably formulated into a pharmaceutical composition which includes a pharmaceutically acceptable carrier, and packaged in dosage unit form. A preferred dosage unit form is an injectable dosage unit form.

Abstract: Compact fluorescent lamps (CFLs) are characterized by impaired colour rendering, due to their low illumination capability near the blood-red edge of the visible spectrum. Red light output by a light emitting diode (LED) has a relatively narrow spectral distribution, and LEDs are able to produce red light with reasonable efficiency. Blending the light output of a CFL with a small amount of blood-red light emitted by one or more inexpensive LEDs improves colour rendering, while reducing the overall energy cost of operating the CFL-LED hybrid lamp.

Abstract: A mass spectrometer and a method of operating and building same is provided in which a hexapole component is deliberately added to a substantially quadrupole field. This can result in unwanted octopole and dipole fields also being added to the substantially quadrupole field. Modifications to the mass spectrometer as well as ways of operating the mass spectrometer are provided for dealing with the unwanted octopole and dipole fields.

Abstract: Antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer for example prostate cancer and renal cell cancer. Antisense TRPM-2 ODN treatment of prostatic tumor cells in vivo is effective for delaying the onset of androgen independence and can be used in combination with androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual. Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN. Thus, the antisense TRPM-2 ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-2 has been observed.

Abstract: Particles of interest, such as DNA molecules, are injected into a medium by applying a first field. Once in the medium the particles are concentrated by applying one or more fields that cause mobilities of the particles in the medium to vary in a manner that is correlated with motions of the particles. Particle injection and particle concentration may be performed concurrently or in alternation.