Abstract: A method of leaching copper from copper sulphide-containing concentrates, such as chalcopyrite, includes using pyrite as a catalyst for ferric reduction in order to eliminate passivation of the chalcopyrite surface, the process being carried out under conditions whereby the pyrite is not materially oxidized, for example by maintaining the operating solution potential at a suitable level. The leaching is carried out in an acidic sulphate medium and may include oxidation by oxygen-containing gas. The leached copper is then recovered, for example by solvent extraction and electrowinning. The leaching process can result in the virtually complete extraction of copper at atmospheric pressure in as little as four hours.

Abstract: The invention provides a variety of therapeutic uses for CXCR4 antagonists. In various embodiments, CXCR4 antagonists may be used as therapeutically as follows, or to manufacture a medicament for such therapeutic treatments: reducing interferon gamma production by T-cells, treatment of an autoimmune disease, treatment multiple sclerosis, treatment of cancer, inhibition of angiogenesis. The invention provides corresponding methods of medical treatment, in which a therapeutic dose of a CXCR4 antagonist is administered in a pharmacologically acceptable formulation. Accordingly, the invention also provides therapeutic compositions comprising a CXCR4 antagonist and a pharmacologically acceptable excipient or carrier. The CXCR4 antagonists for use in the invention may be peptide compounds comprising a substantially purified peptide fragment, modified fragment, analogue or pharmacologically acceptable salt of SDF-1.

Abstract: A brightness enhancement film having a monolayer of approximately hemispherical, transparent, closely packed larger diameter hemi-beads. Due to the hemi-beads' hemispherical shape, gaps remain between adjacent ones of the larger diameter hemi-beads. A substantial number of the gaps are provided with at least one approximately hemispherical, transparent hemi-bead having a diameter substantially less than the diameter of the larger diameter hemi-beads. Provision of smaller diameter hemi-beads within the gaps increases the film's reflectance value, such that the film's apparent brightness declines as a relatively smooth, continuous function of viewing angle, for viewing angles ranging from 0° (normal incidence) to about 40°, which is the preferred angular viewing range.

Abstract: Steroid compounds having various oxygen substitution on the steroid nucleus are disclosed. A specific functionality present on many of the steroid compounds is oxygen substitution at both of positions 6 and 7. Thus, certain steroids have oxygen substitution at C6 and C7, and some have specific stereochemistries such as 6? and 7? oxygen substitution, and an alpha hydrogen at the 5 position in addition to having 6? and 7? oxygen substitution. Steroids having 3,4-epoxy functionality are also disclosed. In addition, steroids having C17 pyran and ?-lactone functionality, with oxygen substitution at C6 and C7, or at C15, of the steroid nucleus, are disclosed.

Abstract: The invention provides a variety of therapeutic uses for CXCR4 antagonists. In various embodiments. CXCR4 antagonsits may be used as therapeutically as follows, or to manufacture a medicament for such therapeutic treatments: reducing interferon gamma production by T-cells, treatment of an autoimmune disease, treatment multiple sclerosis, treatment of cancer, inhibition of angiogenesis. The invention provides corresponding methods of medical treatment, in which a therapeutic dose of a CXCR4 antagonist is administered in a pharmacologically acceptable formulation. Accordingly, the invention also provides therapeutic compositions comprising a CXCR4 antagonist and a pharmacologically acceptable excipient or carrier. The CXCR4 antagonists for use in the invention may be peptide compounds comprising a substantially purified peptide fragment, modified fragment, analogue or pharmacologically acceptable salt of SDF-1.

Abstract: Stent grafts are provided comprising an endoluminal stent and a graft, wherein the stent graft releases an agent which induces the in vivo adhesion of the stent graft to vessel walls, or, otherwise induces or accelerates an in vivo fibrotic reaction causing said stent graft to adhere to vessel wall. Also provided are methods for making and using such stent grafts.

Abstract: The invention provides a variety of therapeutic uses for CXCR4 antagonists. In various embodiments, CXCR4 antagonists may be used as therapeutically as follows, or to manufacture a medicament for such therapeutic treatments: reducing interferon gamma production by T-cells, treatment of an autoimmune disease, treatment of multiple sclerosis, treatment of cancer, inhibition of angiogenesis. The invention provides corresponding methods of medical treatment, in which a therapeutic dose of a CXCR4 antagonist is administered in a pharmacologically acceptable formulation. Accordingly, the invention also provides therapeutic compositions comprising a CXCR4 antagonist and a pharmacologically acceptable excipient or carrier. The CXCR4 antagonists for use in the invention may be peptide compounds comprising a substantially purified peptide fragment, modified fragment, analogue or pharmacologically acceptable salt of SDF-1.

Abstract: An antipodal antenna has an active member arranged between two diverging ground elements. The active member and ground elements are shaped to provide a tapered slot. The ground elements may be planar or may be curved outwardly. In some embodiments the ground elements follow semi-parabolic conical sections. The active and ground elements may be separated by air.

Abstract: A novel class of cationic peptides having antimicrobial activity is provided. Examples of such peptides include NH2-KWKSFIKKLTTAVKKVLTTGLPALIS-COOH (SEQ ID NO:1) and NH2-KWKSFIKKLTSAAKKVVTTAKPLISS-COOH (SEQ ID NO:2). Also provided are methods for inhibiting the growth of bacteria utilizing the peptides of the invention. The peptides are particularly useful for inhibiting endotoxemia in a subject.

Abstract: A method and system for recording and verifying three-dimensional dose distributions a film phantom uses a phantom which includes a cavity for receiving film sheets. A three-dimensional radiation dose described by a stereotactic radiosurgery plan can be delivered to the phantom while the cavity is loaded with film. The film can be developed to provide multiple dose images. Thereafter, based on the multiple dose images, a measured three-dimensional dose distribution map is obtained. The phantom may have a pattern of translucent areas which expose fiducial marks on the film. The fiducial marks may be used to determine a position and orientation of the film relative to the phantom.

Abstract: A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2?-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2?-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.

Abstract: A method and apparatus for manipulating ions using a two-dimensional substantially quadrupole field, and a method of manufacturing an apparatus for manipulating ions using a two-dimensional substantially quadrupole field are described. The field has a quadrupole harmonic with amplitude A2, an octopole harmonic with amplitude A4, and higher order harmonics with amplitudes A6 and A8. The amplitude A8 is less than A4. The A4 component of the field is selected to improve the performance of the field with respect to ion selection and ion fragmentation. The selected A4 component can be added by selecting a degree of asymmetry under a 90° rotation about a central axis of the quadrupole. The degree of asymmetry is selected to be sufficient to provide the selected A4 component.

Abstract: The present invention discloses novel photoactive compounds that may be crosslinked to target substrates. Methods for the preparation and use of the compounds, as well as compositions comprising them, are also disclosed.

Abstract: A display has a screen which incorporates a light modulator. The screen may be a front projection screen or a rear-projection screen. Elements of the light modulator may be controlled to adjust the intensity of light emanating from corresponding areas on the screen. The display may provide a high dynamic range.

Abstract: A reflective display having a plurality of approximately hemispherical high refractive index (?1) transparent hemi-beads substantially covering and protruding inwardly from a transparent sheet's inward surface. The transparent sheet, which has an outward viewing surface, has a refractive index (?2) which can be low (i.e. ?1?1.92 and ?2?1.59). A member is selectably moved into an intense evanescent wave region at the hemi-beads' inward side to selectably frustrate substantial total internal reflection of light rays. The member can be a plurality of light scattering particles suspended in a low refractive index (?3?1.27) electrophoresis medium and electrophoretically moved into or out of the intense evanescent wave region.

Abstract: A reflective display having a plurality of approximately hemispherical high refractive index (?1) transparent hemi-beads substantially covering and protruding inwardly from a transparent sheet's inward surface. The transparent sheet, which has an outward viewing surface, has a refractive index (?2) which can be low (i.e. ?1?1.92 and ?2?1.59). A member is selectably moved into an intense evanescent wave region at the hemi-beads' inward side to selectably frustrate substantial total internal reflection of light rays. The member can be a plurality of light scattering particles suspended in a low refractive index (?3?1.27) electrophoresis medium and electrophoretically moved into or out of the intense evanescent wave region.

Abstract: A the operation of pulp screening apparatus may be improved by employing a multi element foil having a leading foil section and a trailing foil section spaced from and trailing leading section so that adjacent surfaces of the sections one formed by a portion of a pressure side of the leading section and the other by the leading end of the trailing foil section define opposed walls of a passage for fluid directing fluid flow from the pressure side of the leading foil section to a cambered low pressure side of the trailing section. The angle of attack (?) of the complete multi element foil is set to be significantly less than the angle of attack (?) of the trailing foil section to increase the negative pressure pulse generated by the trailing section and thereby improve operation of the screening device.

Abstract: A method for the separation of benzoporphyrin derivative mono and diacid (BPD-MA, BPD-DA) enantiomers by Laser-Induced Fluorescence Capillary Electrophoresis has been developed. The limits of detection are 2.06×10?6 M, and the relative standard deviation for the separation was 2.90% to 4.64%. The BPD enantiomers can be quantitatively determined in the range of 10?2 to 10?5 mg mL?1. In comparison with HPLC, CE has better resolution and efficiency. This separation method was successfully applied to the BPD enantiomers obtained from a matrix of bovine serum and from liposomally formulated material as well as from studies with rat, dog and human microsomes.

Abstract: The invention provides a variety of therapeutic uses for CXCR4 antagonists. In various embodiments, CXCR4 antagonists may be used as therapeutically as follows, or to manufacture a medicament for such therapeutic treatments: reducing interferon gamma production by T-cells, treatment of an autoimmune disease, treatment of multiple sclerosis, treatment of cancer, inhibition of angiogenesis. The invention provides corresponding methods of medical treatment, in which a therapeutic dose of a CXCR4 antagonist is administered in a pharmacologically acceptable formulation. Accordingly, the invention also provides therapeutic compositions comprising a CXCR4 antagonist and a pharmacologically acceptable excipient or carrier. The CXCR4 antagonists for use in the invention may be peptide compounds comprising a substantially purified peptide fragment, modified fragment, analogue or pharmacologically acceptable salt of SDF-1.

Abstract: A method and apparatus for manipulating ions using a two-dimensional substantially quadrupole field, and a method of manufacturing and operating an apparatus for manipulating ions using a two-dimensional substantially quadrupole field are described. The field has a quadrupole harmonic with amplitude A2 and a hexapole harmonic with amplitude A3. The amplitude A3 of the hexapole component of the field is selected to improve the performance of the field with respect to ion selection and ion fragmentation.