Abstract: A system for determining a bacterial load of a target is provided. The system includes an adaptor for configuring a mobile communication device for tissue imaging and a mobile communication device. The adaptor includes a housing configured to be removably coupled to a mobile communication device and, an excitation light source for fluorescent imaging. The excitation light source is configured to emit light in one of ultraviolet, visible, near-infrared, and infrared ranges.

Abstract: Provided herein are methods of treating cancer using an effective amount of a compound represented by the formula (Formula (I)) or a pharmaceutically acceptable salt thereof and an effective amount of an immune checkpoint inhibitor. Also provided are compositions comprising the same compound represented by the formula shown above or a pharmaceutically acceptable salt thereof and an immune checkpoint inhibitor.

Abstract: Provided herein are perfusion fluids for enzymatically cleaving A-antigens from a donor organ, and methods. uses. associated therewith. In particular, the perfusion fluids comprise two enzymes. GalNAcDeacetylase and Galactosaminidase and the fluids may further comprise a buffered extracellular solution and/or a crowing agent. Furthermore. the compositions described herein were found to have activity at temperatures and ph levels suitable for cell viability.

Abstract: A method of visualizing bacteria in real time includes positioning a portable frame of a portable imaging system relative to a target, wherein the portable imaging system includes a camera and an excitation light source mounted on the portable frame, operating the portable imaging system in a hands-free manner to illuminate the target with excitation light having at least one wavelength to cause at least one biomarker associated with the target to fluoresce and to detect fluorescence of the at least one biomarker with the camera.

Abstract: There is described herein a method of detecting the presence of DNA from cancer cells in a subject comprising: providing a sample of cell-free DNA from a subject; subjecting the sample to library preparation to permit subsequent sequencing of the cell-free methylated DNA; adding a first amount of filler DNA to the sample, wherein at least a portion of the filler DNA is methylated, then optionally denaturing the sample; capturing cell-free methylated DNA using a binder selective for methylated polynucleotides; sequencing the captured cell-free methylated DNA; comparing the sequences of the captured cell-free methylated DNA to control cell-free methylated DNAs sequences from healthy and cancerous individuals and from individuals with distinct cancer types and subtypes; identifying the presence of DNA from cancer cells if there is a statistically significant similarity between one or more sequences of the captured cell-free methylated DNA and cell-free methylated DNAs sequences from cancerous individuals.

Abstract: There is described herein a method of predicting recurrence free survival in a patient with meningioma comprising: (a) determining a tumor DNA methylation profile from a tumor sample from the patient, the tumor DNA methylation profile comprising the methylation status of at least 200 loci represented by the probes set forth in Table 9; and (b) calculating a risk of meningioma recurrence based on comparing the tumor DNA methylation profile and a reference methylation profile comprising the extent to which the methylation status of the at least 200 loci is associated with a risk of recurrence.

Abstract: A method and device for determining the depth and fluorophore concentration of a fluorophore concentration below the surface of an optically absorbing and scattering medium suitable for use in fluorescence-based surgical guidance such as in tumor resection is described. Long-wavelength stimulus light us used to obtain deep tissue penetration. Recovery of depth is performed by fitting measured modulation amplitudes for each spatial frequency to precomputed modulation amplitudes in a table of modulation amplitudes indexed by optical parameters and depth.

Abstract: Systems and methods for determining bacterial load in targets are disclosed. An autofluorescence detection and collection device includes a light source configured to illuminate a target with excitation light causing at least one biomarker in the illuminated target to fluoresce. Bacterial autofluorescence data regarding the target is collected and analyzed to determine bacterial load the target. The autofluorescence data may be analyzed using pixel intensity.

Abstract: An adaptor for configuring a mobile communication device for tissue imaging is disclosed. The adaptor includes a housing configured to be removably coupled to a mobile communication device, at least one excitation light source for fluorescent imaging, a white light source for white light imaging, and a power source for powering the adaptor. The excitation light source is configured to emit light in one of ultraviolet, visible, near-infrared, and infrared ranges.

Abstract: A method for characterizing a brain electrical signal comprising forming a temporo-spectral decomposition of the signal to form a plurality of time resolved frequency signal values, associating each instance of the signal value with a predetermined function approximating a neurological signal to form a table of coefficients collectively representative of the brain electrical signal.

Abstract: The invention relates to modulating the SIRP?-CD47 interaction in order to treat hematological cancer and compounds therefor. In some embodiments, there is provided methods and uses of SIRP? polypeptides, fragments and fusion proteins for treating hematological cancer, preferably human acute myeloid leukemia.

Abstract: Treatments for therapy of a diabetic symmetrical polyneuropathy a subject in need thereof. The treatments includes administration of compositions comprising: an effective amount of a muscarinic acetylcholine receptor antagonist exemplified by pirenzepine, telenzepine, atropine, or derivatives thereof or salts thereof or analogs thereof or derivatives thereof, and a pharmacologically acceptable carrier. The composition may be injectable or alternatively, may be applied topically or alternatively, may be delivered orally. A suitable topical composition may comprise a lotion, a cream, a gel, or a viscous fluid. The muscarinic acetylcholine receptor antagonist may be a muscarinic acetylcholine receptor antagonist salt or a muscarinic acetylcholine receptor antagonist derivative or a muscarinic acetylcholine receptor antagonist analog.

Abstract: Various embodiments are described herein for a system and a method for assessing a risk of ventricular arrhythmias for a patient. For example, the method may comprise receiving ECG data obtained from the patient; analyzing the ECG data to detect abnormal QRS peaks; determining the risk of ventricular arrhythmias for the patient based on the detected abnormal QRS peaks; and providing an indication of the risk of ventricular arrhythmias for the patient. The system may be configured to perform this method.

Abstract: A method comprising obtaining a substantially cell-free sample of blood plasma or blood serum from a subject with osteoarthritis; and detecting a presence of or measuring a level of novel_miRNA_1 (gucuggcucaggguuggg) (SEQ ID NO: 1), novel_miRNA_2 (ucccuguucgggcgccacu) (SEQ ID NO: 2), novel_miRNA_3 (uguuuagcauccuguagccugc) (SEQ ID NO: 3), and novel_miRNA_4 (uaguggguuaucagaacu) (SEQ ID NO: 4). Also provided are methods where additional miRNAs are detected including novel miRNA 5 (SEQ ID NO: 5), novel miRNA 6 (SEQ ID NO: 6), novel miRNA 7 (SEQ ID NO: 7), novel miRNA 8 (SEQ ID NO: 8), novel miRNA 9 (SEQ ID NO: 9), novel miRNA 10 (SEQ ID NO: 10), novel miRNA 11 (SEQ ID NO: 11), novel miRNA 12 (SEQ ID NO: 12), novel miRNA 13 (SEQ ID NO: 13), hsa-miR-335-3p, hsa-miR-199a-5p, hsa-miR-671-3p, hsa-miR-1260b, hsa-miR-191-3p, hsa-miR-335-5p and/or hsa-miR-543.

Abstract: The invention provides antibodies that specifically bind transthyretin (TTR). The antibodies can be used for treating or effecting prophylaxis of diseases or disorders associated with TTR accumulation or accumulation of TTR deposits (e.g., TTR amyloidosis). The antibodies can also be used for diagnosing TTR amyloidosis and inhibiting or reducing aggregation of TTR, among other applications.

Abstract: The present disclosure relates to a method for patient-specific optimization of imaging protocols. According to an embodiment, the present disclosure relates to a method for generating a patient-specific imaging protocol, comprising acquiring scout scan data, the scout scan data including scout scan information and scout scan parameters, generating a simulated image based on the acquired scout scan data, deriving a simulated dose map from the generated simulated image, determining image quality of the generated simulated image by applying machine learning to the generated simulated image, the neural network being trained to generate at least one probabilistic quality representation corresponding to at least one region of the generated simulated image, evaluating the determined image quality relative to a image quality threshold and the derived simulated dose map relative to a dosage threshold, optimizing.

Abstract: The present invention relates to a novel co-crystal of the compound of formula (I): wherein the co-former molecule is bisphosphate hemihydrate, to processes for the preparation of the co-crystal, to pharmaceutical compositions containing the co-crystal, to the use of such a co-crystal in the manufacture of a medicament for use in the treatment of cancer and to methods of treating such diseases in the human or animal body by administering a therapeutically effective amount of such a co-crystal.

Abstract: There is described herein a method of prognosing and/or predicting disease progression and/or in subject with prostate cancer, the method comprising: a) providing a sample containing mitochondrial genetic material from prostate cancer cells; b) sequencing the mitochondrial genetic material with respect to at least 1 patient biomarker selected from CSB1, OHR, ATP8 and HV1 (hypervariable region 1); c) comparing the sequence of said patient biomarkers to control or reference biomarkers to determine mitochondrial single nucleotide variations (mtSNVs); and d) determining the a prostate cancer prognosis; wherein a relatively worse outcome is associated with the presence of mtSNVs in CSB1, OHR, ATP8 and a relatively better outcome is associated with the presence of mtSNVs in HV1.

Abstract: Provided herein are methods of producing spNPCs from iPSCs or NPCs, cell populations, compositions comprising cell populations, and uses of spNPCs made using the methods described. The method can comprise: a. obtaining unpatterned NPCs, the unpatterned NPCs expressing neuroectodermal markers including Pax6 and Sox1; b. priming the unpatterned NPCs of step a; and c. patterning the primed unpatterned NPCs to produce spNPCS.