MITOCHONDRIAL DNA PROSTATE CANCER MARKER AND RELATED SYSTEMS AND METHODS

There is described herein a method of prognosing and/or predicting disease progression and/or in subject with prostate cancer, the method comprising: a) providing a sample containing mitochondrial genetic material from prostate cancer cells; b) sequencing the mitochondrial genetic material with respect to at least 1 patient biomarker selected from CSB1, OHR, ATP8 and HV1 (hypervariable region 1); c) comparing the sequence of said patient biomarkers to control or reference biomarkers to determine mitochondrial single nucleotide variations (mtSNVs); and d) determining the a prostate cancer prognosis; wherein a relatively worse outcome is associated with the presence of mtSNVs in CSB1, OHR, ATP8 and a relatively better outcome is associated with the presence of mtSNVs in HV1.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS REFERENCE TO RELATED APPLICATIONS

This application is a continuation of U.S. patent application Ser. No. 16/306,724 filed Dec. 3, 2018, which is a national phase application under 35 U.S.C. § 371 of International Application No. PCT/CA2017/000139 filed Jun. 2, 2017, which claims the benefit of priority of U.S. Provisional Patent Application No. 62/344,723 filed Jun. 2, 2016, the entire contents of which are incorporated herein by reference.

SEQUENCE LISTING

The application contains a Sequence Listing prepared in compliance with ST.26 format and is hereby incorporated by reference in its entirety. Said Sequence Listing, created on Oct. 3, 2022 is named UCLAP0101USC1_SL and is 54,363 bytes in size.

FIELD OF INVENTION

The present disclosure relates generally to a prostate cancer biomarker signature. More particularly, the present disclosure relates to a mitochondrial DNA for the prognosis of prostate cancer outcomes, which can inform treatment decisions and guide therapy.

BACKGROUND

Prostate cancer remains the most prevalent non-skin cancer in men1 and exhibits a remarkably quiet mutational profile2. Exome sequencing studies of localized tumours have revealed few recurrent somatic single nucleotide variants (SNVs)3,4, while whole-genome sequencing studies have not identified highly recurrent driver non-coding SNVs or genomic rearrangements (GRs)5-8. Although strong mutagenic field effects have been observed9,10, their underlying mechanisms and to what extent they drive tumour initiation or progression are unknown. Nevertheless, promising molecular diagnostics predictive of aggressive disease have been created using supervised machine-learning techniques, both from RNA abundance data11,12 and from DNA copy number data13, showing strong linkage between molecular features of prostate tumour cells and patient outcome.

Most studies of the prostate cancer genome have focused on mutations occurring in the nuclear genome, and have ignored the other genome of the cell: the mitochondrial genome. Mitochondria are maternally inherited and play critical roles in pathways dysregulated in cancer cells, including energy production, metabolism and apoptosis14. While mitochondrial mutations have been observed in several tumour types15-17, including prostate cancer18-22 their global frequency and clinical impact have not yet been comprehensively characterized. Previous studies have found that mitochondrial mutations are associated with increased serum prostate-specific antigen (PSA) levels21, have suggested that mtDNA mutations increase cancer cell tumourigenicity20, and indicate that overall mitochondrial mutation burden is correlated with higher Gleason Scores22.

SUMMARY OF INVENTION

In an aspect, there is provided a method of prognosing and/or predicting disease progression and/or in subject with prostate cancer, the method comprising: a) providing a sample containing mitochondrial genetic material from prostate cancer cells; b) sequencing the mitochondrial genetic material with respect to at least 1 patient biomarker selected from CSB1, OHR, ATP8 and HV1 (hypervariable region 1); c) comparing the sequence of said patient biomarkers to control or reference biomarkers to determine mitochondrial single nucleotide variations (mtSNVs); and d) determining the a prostate cancer prognosis; wherein a relatively worse outcome is associated with the presence of mtSNVs in CSB1, OHR, ATP8 and a relatively better outcome is associated with the presence of mtSNVs in HV1.

In an aspect, there is provided a computer-implemented method of prognosing or predicting disease progression in a patient with prostate cancer, the method comprising: a) receiving, at at least one processor, sequencing data of mitochondrial genetic material from prostate cancer cells of the patient, the sequencing data reflecting at least 1 patient biomarker selected from CSB1, OHR, ATP8 and HV1 (hypervariable region 1); b) comparing, at the at least one processor, said sequencing data to corresponding control or reference sequences to determine mitochondrial single nucleotide variations (mtSNVs); d) determining, at the at least one processor, a prostate cancer prognosis; wherein a relatively worse outcome is associated with the presence of mtSNVs in CSB1, OHR, ATP8 and a relatively better outcome is associated with the presence of mtSNVs in HV1.

In an aspect, there is provided a computer program product for use in conjunction with a general-purpose computer having a processor and a memory connected to the processor, the computer program product comprising a computer readable storage medium having a computer mechanism encoded thereon, wherein the computer program mechanism may be loaded into the memory of the computer and cause the computer to carry out the method described herein.

In an aspect, there is provided a computer readable medium having stored thereon a data structure for storing the computer program product described herein.

In an aspect, there is provided a device for prognosing or predicting disease progression in a patient with prostate cancer, the device comprising: at least one processor; and electronic memory in communication with the at one processor, the electronic memory storing processor-executable code that, when executed at the at least one processor, causes the at least one processor to: a) receive sequencing data of mitochondrial genetic material from prostate cancer cells of the patient, the sequencing data reflecting at least 1 patient biomarker selected from CSB1, OHR, ATP8 and HV1 (hypervariable region 1); b) compare said sequencing data to corresponding control or reference sequences to determine mitochondrial single nucleotide variations (mtSNVs); and c) determining, at the at least one processor, a prostate cancer prognosis; wherein a relatively worse outcome is associated with the presence of mtSNVs in CSB1, OHR, ATP8 and a relatively better outcome is associated with the presence of mtSNVs in HV1. In some embodiments, the processor further displays the prostate cancer prognosis on a user display.

In an aspect, there is provided a kit for prognosing or predicting disease progression in a patient with prostate cancer, the kit comprising primer sequences that permit the sequencing of a mitochondrial genome to determine mtSNVs in ATP8, OHR, ND4L and CSB1.

Other aspects and features of the present disclosure will become apparent to those ordinarily skilled in the art upon review of the following description of specific embodiments in conjunction with the accompanying figures.

BRIEF DESCRIPTION OF FIGURES

Embodiments of the present disclosure will now be described, by way of example only, with reference to the attached Figures and Tables.

FIG. 1 shows panorama of mitochondrial mutations in prostate cancer. (a) The top panel displays the number of mtSNVs per patient sorted first by T-Category and then by the number of mtSNVs; histogram bars are coloured by the average difference in the heteroplasmy fraction (ΔHF) between tumour and normal samples, light-blue 20-40%, medium-blue 40-60%, dark-blue ≥60%. A heatmap showing the location of each mtSNV on the mitochondrial genome (middle), where the colour of each dot represents ΔHF. The mitochondrial genome is represented on the left. The bottom panel shows the clinical covariates for all 384 patients: Age, Gleason Score, PSA and T-Category. Bottom right: Associations between the covariates and number of mtSNVs. (b) Frequency and distribution of single nucleotide variants (SNVs) within the mitochondrial genome. Mutation frequency normalized by dividing the number of mutations per locus of each patient by (length of the locus (kbp)×MCN). (c) Distribution of mtSNVs across the mitochondrial genome. mtSNVs were fairly evenly distributed across the genome (black bars) and recurrent mutation positions are indicated by the histogram.

FIG. 2 shows the difference in mitochondrial mutational frequency and copy number with age. (a) Association of nuclear (green) and mitochondrial (yellow) mutation SNV/Mbp rates with patient age. Mitochondrial mutation rate normalized by MCN. (b) Distribution of mtSNVs in EOPC (red) and LOPC (blue) patients. The histogram indicates presence and frequency of a mtSNV. The most recurrent mtSNV was at position 16093. (c) The fraction of patients by number of mtSNVs, EOPC (gray bars), LOPC (black bars). (d) Tumour mitochondrial copy number (MCN) for both patient age groups. EOPC: n=164; LOPC: n=220.

FIG. 3 shows associations between mitochondrial and nuclear genome mutations. (a) Correlations of mitochondrial features with nuclear genome features. The size and colour of the dot represents the Spearman correlation and the background shading represents the p-value. Nuclear features: SNVs, CTXs, INVs, kataegis data available for 172 patients; Chromothripsis: n=159; CNAs: MYC, NKX3-1 (n=203); CDH1, CDKN1B, CHD1, PTEN, RB1, TP53 (n=194); Methylation: n=104. Mitochondrial features: 216 patients. (b) Mutations in OHR are associated with CNAs in MYC. Heatmap showing those patients with CNA gains (red) in MYC and those with mtSNVs in OHR, CSB1, the control region and ATP6, mtSNV colour represents the ΔHF. Since CSB1 is a subregion within OHR, mutations in CSB1 are also considered as OHR mtSNVs, similarly, mtSNVs in OHR are also within the control region (n=203). The barplot on the right shows the fraction of patients with or without a MYC CNA that have a specific mtSNV. (c) Kaplan-Meier plot of 165 patients with OHR and MYC mutations. Patients were grouped according to whether they had neither MYC CNAs nor OHR SNVs (black line), a MYC CNA or an OHR mtSNV (blue) or had both (red line). The group that had a CNA gain in MYC and an mtSNV in the OHR region had significantly worse outcomes than those without the mutations. Biochemical RFR (Biochemical relapse-free rate).

FIG. 4 shows clinical impact of mitochondrial mutations in prostate cancer. (a) The associations of biochemical recurrence (BCR) and 21 mitochondrial features: 19 mitochondrial genes or regions, MCN (median-dichotomized), and mtSNV count (0 vs. 1+) were calculated using Cox models in 165 LOPC patients. Hazard ratios (HRs) are shown in the middle panel and p-values from the log-rank test in the right panel. The change in the 10 year survival for patients with mutations in each mitochondrial region is indicated (left panel). The colour of the bars indicate the average ΔHF for mtSNVs in that region; light-blue 20-40%, medium-blue 40-60%, dark-blue ≥60%. (b) Kaplan-Meier plots of mtSNVs occurring within HV1 and (c) OHR. (d) Kaplan-Meier plot of results of leave-one-out cross-validation predictions (p-value from log-rank test).

FIG. 5 shows the experimental design/experimental workflow for the project. Whole genome sequencing was performed on 333 CPC-GENE and EOPC samples. In addition, 51 publicly available samples with whole genome sequences were included in the dataset and realigned. Mitochondrial reads were extracted and the mitochondrial analysis tool MToolBox was run on the resulting BAM files. Heteroplasmic fractions (HF) were calculated for each nucleotide and only those positions that differed by 0.2 HF between the tumour and matched normal were included in the list of mtSNVs.

FIG. 6 shows MCN association with clinical variables. Tumour MCN categorized by age (a), T-category (b), and Gleason score (c). EOPC patients are indicated by red dots, LOPC by blue dots. (d) MCN of the matched normal samples show a significant difference between the two age groups.

FIG. 7 shows PCR validation confirms predicted mtSNVs. A comparison of chromatograms after PCR amplification and Sanger sequencing from (a) normal and (b) tumour samples from patient CPCG0196 for the mtDNA region: 187-208. Arrow indicates position 195 which has significant heteroplasmy in tumour.

FIG. 8 shows mtSNVs chosen for PCR validation. The 25 mtSNVs validated by PCR amplification and Sanger sequencing had varying levels in the difference in heteroplasmy (ΔHF) between tumour and normal samples. Light blue 20-40%, medium blue 40-60% and dark blue 60% ΔHF. mtDNA position on x-axis. Labels in red indicate those mtSNVs that failed PCR validation.

FIG. 9 shows frequency of mutations by patient and mitochondrial loci. Heatmap showing the distribution of mutations in the different mitochondrial regions (y-axis) by patients (x-axis). The difference in heteroplasmy fraction between tumour and normal sample (ΔHF) is indicated by colour, white: no mutation; light-blue: 20-40%; blue: 40-60% and dark blue ≥60%. Patients with more than one mtSNV in a particular mtDNA region are indicated by gray dots. Note: CSB1 and OHR are overlapping regions with the mtDNA Control region, mtSNVs in CSB1 are necessarily mtSNVs in OHR and both are mtSNVs within the Control region.

FIG. 10 shows distributions of mtSNV fractions by mitochondrial genome loci for EOPC and LOPC patients. The fraction of total mtSNVs per loci for EOPC and LOPC cohorts, those ≤50 years old (164 patients) and those >50 year old (220 patients) respectively.

FIG. 11 shows correlations between nuclear and mitochondrial features as a function of heteroplasmy fraction. Spearman's p (a) and p-values (b) were calculated using increasing ΔHF cutoffs for mtSNVs for several nuclear and mitochondrial features: MYC CNAs and OHR mtSNVs, the non-coding SNV chr4:39684557 and ND2 mtSNVs, TP53 SNVs and ND5 mtSNVs, and MYC CNAs and RNR2 mtSNVs. (c) The total number of mtSNVs for 384 patients at each ΔHF threshold (unadjusted).

FIG. 12 shows prognostic synergy between mitochondrial and nuclear mutations. Kaplan-Meier plots of patients with (a) methylation events in miR129-2 and mtSNVs in HV1 or (b) ND5; (c) NKX3-1 CNAs and OHR mtSNVs; (d) mtSNVs in HV1 and methylation events in TCERG1L-5′ or (e) TUBA3C; and (f) MYC CNAs and HV2 mtSNVs. Patients were grouped according to whether they had no mutations (black line), either a mtSNV or nuclear genomic mutation (blue) or had both (red line).

FIG. 13 shows signature flow chart and subset signature. (a) Flowchart showing details of the leave-one-out cross validation method. (b) Mitochondrial signature using three genes (HV1, OHR, CO3).

FIG. 14 shows mitochondrial signature in intermediate risk patients. Only patients classified as NCCN-intermediate risk were used with the mtSNV signature and were separated into three risk-prediction groups, ‘high’ (red line), ‘intermediate’ (black line), and ‘low’ (blue line).

FIG. 15 shows suitable configured computer device, and associated communications networks, devices, software and firmware to provide a platform for enabling one or more embodiments as described herein.

Table 1 shows results of PCR validation of 25 mtSNVs. The table includes the mtSNV position, which PCR primers were used to validate, the heteroplasmy fraction (adjusted by cellularity) of the major allele for both tumour and normal and the results of the PCR amplification and Sanger sequencing.

Table 2 shows results from univariate Cox proportional modeling. Hazard ratios were calculated for the different mitochondrial loci individually, the table includes the HR and 95% CI, p-values, the change in 10 year survival and the number of patients with a mtSNV in that loci.

Table 3 shows the sequence and mtDNA targeted region of 20 forward and reverse PCR primers.

Table 4 shows clinical and sequencing data per patient. The data includes patient age at treatment, Gleason Score, T-category, PSA (ng/mL) level, tumour cellularity, number of mtSNVs and the mean coverage depth, mitochondrial copy number for both normal and tumour sample and the aligner used for each wgs. The presence or absence of mutations in each of 20 mitochondrial regions and MYC and NKX3-1 copy number aberrations is indicated for each sample and the amount of DNA that was sent for sequencing for the CPC-GENE samples are included.

Table 5 shows 293 somatic mtSNVs. List of mtSNVs, including heteroplasmic fractions (HF), reference allele nucleotide, identity of tumour and normal major alleles and major allele heteroplasmy fractions (both adjusted and unadjusted by tumour cellularity), tumour and normal coverage at each position, the mtDNA gene or region and pathogenicity scores from MutPred and Polyphen2 obtained from MToolBox.

Table 6 shows mitochondrial mutation recurrence for 41 nuclear genomic features. The table includes the number of patients that had a specific nuclear genome CNA, GR, methylation event or SNV and of those patients the number that also harbours an mtSNV in any of 22 mtDNA features.

Table 7 shows mtSNVs with ΔHF values between 0.1 and 0.2. List of 265 mtSNVs, that had ΔHF values greater than 0.1, but less than 0.2. The table includes heteroplasmic frequencies, reference allele nucleotide, identity of tumour and normal major alleles and major allele heteroplasmy fractions, tumour and normal coverage at each position and the mtDNA gene or region.

DETAILED DESCRIPTION

Nuclear mutations are well-known to drive tumour incidence, aggression and response to therapy. By contrast, the frequency and roles of mutations in the maternally-inherited mitochondrial genome are poorly understood. To characterize the mitochondrial mutation landscape of prostate cancer, we analyzed the mitochondrial genomes of 384 adenocarcinomas of the prostate across all National Comprehensive Cancer Network (NCCN) defined risk categories, including 164 early-onset prostate cancers (EOPCs, age at diagnosis less than 50). We identified a median of one mitochondrial single nucleotide variant (mtSNV) per patient.

We identify recurrent mutational hotspots in the mitochondrial genome, which included recurrently mutated bases or recurrently mutated genes or regions. We also confirm increasing mutation burden with patient age23-26, identify interactions between nuclear and mitochondrial mutation profiles and reveal specific mitochondrial mutations enriched in aggressive prostate tumours. For example certain control region mtSNVs co-occur with gain of the MYC oncogene, and these mutations are jointly associated with patient survival.

These data demonstrate frequent mitochondrial mutation in prostate cancer, and suggest interplay between nuclear and mitochondrial mutational profiles in prostate cancer.

The methods described herein are useful for prognosing the outcome of a subject that has, or has had, a cancer associated with the prostate. The cancer may be prostate cancer or a cancer that has metastasized from a cancer of the prostate.

In an aspect, there is provided a method of prognosing and/or predicting disease progression and/or in subject with prostate cancer, the method comprising: a) providing a sample containing mitochondrial genetic material from prostate cancer cells; b) sequencing the mitochondrial genetic material with respect to at least 1 patient biomarker selected from CSB1, OHR, ATP8 and HV1 (hypervariable region 1); c) comparing the sequence of said patient biomarkers to control or reference biomarkers to determine mitochondrial single nucleotide variations (mtSNVs); and d) determining the a prostate cancer prognosis; wherein a relatively worse outcome is associated with the presence of mtSNVs in CSB1, OHR, ATP8 and a relatively better outcome is associated with the presence of mtSNVs in HV1.

The term “subject” as used herein refers to any member of the animal kingdom, preferably a human being and most preferably a human being that has, has had, or is suspected of having prostate cancer.

The term “sample” as used herein refers to any fluid (e.g. blood, urine, semen), cell, tumor or tissue sample from a subject which can be assayed for the biomarkers described herein.

The term “genetic material” used herein refers to materials found/originate in the nucleus, mitochondria and cytoplasm, which play a fundamental role in determining the structure and nature of cell substances, and capable of self-propagating and variation. In the context of the present methods, the genetic material is any material from which one can measure the biomakers described herein. The genetic material is preferably DNA.

The term “prognosis” as used herein refers to the prediction of a clinical outcome associated with a disease subtype which is reflected by a reference profile such as a biomarker reference profile. The prognosis provides an indication of disease progression and includes an indication of likelihood of death due to cancer. The prognosis may be a prediction of metastasis, or alternatively disease recurrence. In one embodiment the clinical outcome class includes a better survival group and a worse survival group. The term “prognosing or classifying” as used herein means predicting or identifying the clinical outcome of a subject according to the subject's similarity to a reference profile or biomarker associated with the prognosis. For example, prognosing or classifying comprises a method or process of determining whether an individual has a better or worse survival outcome, or grouping individuals into a better survival group or a worse survival group, or predicting whether or not an individual will respond to therapy.

The term “biomarker profile” as used herein refers to a dataset representing the state or expression level(s) of one or more biomarkers. A biomarker profile may represent one subject, or alternatively a consolidated dataset of a cohort of subjects, for example to establish a reference biomarker profile as a control.

As used herein, the term “control” refers to a specific value or dataset that can be used to prognose or classify the value e.g the measured biomarker or reference biomarker profile obtained from the test sample associated with an outcome. In one embodiment, a dataset may be obtained from samples from a group of subjects known to have cancer having different tumor states and/or healthy individuals. The state or expression data of the biomarkers in the dataset can be used to create a control value that is used in testing samples from new patients. In some embodiments, a cohort of subjects is used to obtain a control dataset. A control cohort patients may be a group of individuals with or without cancer. In a particularly embodiment, the control is a patient's own matched normal profile (e.g. from blood or normal tissue).

As used herein, “overall survival” refers to the percentage of or length of time that people in a study or treatment group are still alive following from either the date of diagnosis or the start of treatment for a disease, such as cancer. In a clinical trial, measuring the overall survival is one way to see how well a new treatment works.

As used herein, “relapse-free survival” refers to, in the case of caner, the percentage of or length of time that people in a study or treatment group survive without any signs or symptoms of that cancer after primary treatment for that cancer. In a clinical trial, measuring the relapse-free survival is one way to see how well a new treatment works. It is defined as any disease recurrence or relapse (local, regional, or distant).

The term “good survival” or “better survival” as used herein refers to an increased chance of survival as compared to patients in the “poor survival” group. For example, the biomarkers of the application can prognose or classify patients into a “good survival group”. These patients are at a lower risk of death after surgery and can also be categorized into a “low-risk group”.

The term “poor survival” or “worse survival” as used herein refers to an increased risk of disease progression or death as compared to patients in the “good survival” group. For example, biomarkers or genes of the application can prognose or classify patients into a “poor survival group”. These patients are at greater risk of death or adverse reaction from disease or surgery, treatment for the disease or other causes, and can also be categorized into a “high-risk group”.

A person skilled in the art would understand how to implement differing cut-offs for good survival vs. worse survival, depending on the clinical outcome one is predicting and the biomarkers being assayed.

In some embodiments, the at least 1 patient biomarker, is at least 2, 3 or 4 patient biomarkers.

In some embodiments, the prostate cancer is localized prostate cancer, preferably non-indolent localized prostate cancer.

In some embodiments, the method further comprises building a patient biomarker profile from the determined or measured patient biomarkers.

In some embodiments, the prostate cancer prognosis is the likelihood of disease recurrence, preferably measured by biochemical relapse.

In some embodiments, the method further comprises classifying the patient into a high risk group if the likelihood of disease recurrence is relatively high or a low risk group if the likelihood of disease recurrence is relatively low.

In some embodiments, the method further comprises treating the patient with more aggressive therapy if the patient is in the high risk group. Preferably, the more aggressive therapy comprises adjuvant therapy, preferably hormone therapy, chemotherapy or radiotherapy.

In some embodiments, the patient biomarkers further comprise CO2, CO3 and ND4L. Preferably, the at least 1 biomarker is at least 5, 6 or all 7 biomarkers. Further preferably, the at least 1 biomarker is all 7 biomarkers.

In some embodiments, the subject is classified as low risk if there exists mtSNVs in CO2, CO3, and HV1 and high risk if there exists mtSNVs in ATP8, OHR, ND4L and CSB1.

In some embodiments, the mtSNVs are the mtSNVs identified in Table 5. [NTD: Please confirm]

The present system and method may be practiced in various embodiments. A suitably configured computer device, and associated communications networks, devices, software and firmware may provide a platform for enabling one or more embodiments as described above. By way of example, FIG. 15 shows a generic computer device 100 that may include a central processing unit (“CPU”) 102 connected to a storage unit 104 and to a random access memory 106. The CPU 102 may process an operating system 101, application program 103, and data 123. The operating system 101, application program 103, and data 123 may be stored in storage unit 104 and loaded into memory 106, as may be required. Computer device 100 may further include a graphics processing unit (GPU) 122 which is operatively connected to CPU 102 and to memory 106 to offload intensive image processing calculations from CPU 102 and run these calculations in parallel with CPU 102. An operator 107 may interact with the computer device 100 using a video display 108 connected by a video interface 105, and various input/output devices such as a keyboard 115, mouse 112, and disk drive or solid state drive 114 connected by an I/O interface 109. In known manner, the mouse 112 may be configured to control movement of a cursor in the video display 108, and to operate various graphical user interface (GUI) controls appearing in the video display 108 with a mouse button. The disk drive or solid state drive 114 may be configured to accept computer readable media 116. The computer device 100 may form part of a network via a network interface 111, allowing the computer device 100 to communicate with other suitably configured data processing systems (not shown). One or more different types of sensors 135 may be used to receive input from various sources.

The present system and method may be practiced on virtually any manner of computer device including a desktop computer, laptop computer, tablet computer or wireless handheld. The present system and method may also be implemented as a computer-readable/useable medium that includes computer program code to enable one or more computer devices to implement each of the various process steps in a method in accordance with the present invention. In case of more than computer devices performing the entire operation, the computer devices are networked to distribute the various steps of the operation. It is understood that the terms computer-readable medium or computer useable medium comprises one or more of any type of physical embodiment of the program code. In particular, the computer-readable/useable medium can comprise program code embodied on one or more portable storage articles of manufacture (e.g. an optical disc, a magnetic disk, a tape, etc.), on one or more data storage portioned of a computing device, such as memory associated with a computer and/or a storage system.

In an aspect, there is provided a computer-implemented method of prognosing or predicting disease progression in a patient with prostate cancer, the method comprising: a) receiving, at at least one processor, sequencing data of mitochondrial genetic material from prostate cancer cells of the patient, the sequencing data reflecting at least 1 patient biomarker selected from CSB1, OHR, ATP8 and HV1 (hypervariable region 1); b) comparing, at the at least one processor, said sequencing data to corresponding control or reference sequences to determine mitochondrial single nucleotide variations (mtSNVs); d) determining, at the at least one processor, a prostate cancer prognosis; wherein a relatively worse outcome is associated with the presence of mtSNVs in CSB1, OHR, ATP8 and a relatively better outcome is associated with the presence of mtSNVs in HV1.

In some embodiments, the method further comprises displaying the prostate cancer prognosis on a user display.

In an aspect, there is provided a computer program product for use in conjunction with a general-purpose computer having a processor and a memory connected to the processor, the computer program product comprising a computer readable storage medium having a computer mechanism encoded thereon, wherein the computer program mechanism may be loaded into the memory of the computer and cause the computer to carry out the method described herein.

In an aspect, there is provided a computer readable medium having stored thereon a data structure for storing the computer program product described herein.

In an aspect, there is provided a device for prognosing or predicting disease progression in a patient with prostate cancer, the device comprising: at least one processor; and electronic memory in communication with the at one processor, the electronic memory storing processor-executable code that, when executed at the at least one processor, causes the at least one processor to: a) receive sequencing data of mitochondrial genetic material from prostate cancer cells of the patient, the sequencing data reflecting at least 1 patient biomarker selected from CSB1, OHR, ATP8 and HV1 (hypervariable region 1); b) compare said sequencing data to corresponding control or reference sequences to determine mitochondrial single nucleotide variations (mtSNVs); and c) determining, at the at least one processor, a prostate cancer prognosis; wherein a relatively worse outcome is associated with the presence of mtSNVs in CSB1, OHR, ATP8 and a relatively better outcome is associated with the presence of mtSNVs in HV1. In some embodiments, the processor further displays the prostate cancer prognosis on a user display.

As used herein, “processor” may be any type of processor, such as, for example, any type of general-purpose microprocessor or microcontroller (e.g., an Intel™ x86, PowerPC™, ARM™ processor, or the like), a digital signal processing (DSP) processor, an integrated circuit, a field programmable gate array (FPGA), or any combination thereof.

As used herein “memory” may include a suitable combination of any type of computer memory that is located either internally or externally such as, for example, random-access memory (RAM), read-only memory (ROM), compact disc read-only memory (CDROM), electro-optical memory, magneto-optical memory, erasable programmable read-only memory (EPROM), and electrically-erasable programmable read-only memory (EEPROM), or the like. Portions of memory 102 may be organized using a conventional filesystem, controlled and administered by an operating system governing overall operation of a device.

As used herein, “computer readable storage medium” (also referred to as a machine-readable medium, a processor-readable medium, or a computer usable medium having a computer-readable program code embodied therein) is a medium capable of storing data in a format readable by a computer or machine. The machine-readable medium can be any suitable tangible, non-transitory medium, including magnetic, optical, or electrical storage medium including a diskette, compact disk read only memory (CD-ROM), memory device (volatile or non-volatile), or similar storage mechanism. The computer readable storage medium can contain various sets of instructions, code sequences, configuration information, or other data, which, when executed, cause a processor to perform steps in a method according to an embodiment of the disclosure. Those of ordinary skill in the art will appreciate that other instructions and operations necessary to implement the described implementations can also be stored on the computer readable storage medium. The instructions stored on the computer readable storage medium can be executed by a processor or other suitable processing device, and can interface with circuitry to perform the described tasks.

As used herein, “data structure” a particular way of organizing data in a computer so that it can be used efficiently. Data structures can implement one or more particular abstract data types (ADT), which specify the operations that can be performed on a data structure and the computational complexity of those operations. In comparison, a data structure is a concrete implementation of the specification provided by an ADT.

In an aspect, there is provided a kit for prognosing or predicting disease progression in a patient with prostate cancer, the kit comprising primer sequences that permit the sequencing of a mitochondrial genome to determine mtSNVs in ATP8, OHR, ND4L and CSB1.

In some embodiments, the primers further permit sequencing of CO2, CO3 and ND4L.

The above listed aspects and/or embodiments may be combined in various combinations as appreciated by a person of skill in the art. The advantages of the present disclosure are further illustrated by the following examples. The examples and their particular details set forth herein are presented for illustration only and should not be construed as a limitation on the claims of the present invention.

Examples Methods/Materials Patient Cohort

We collected 384 prostate cancer tumour samples with matched normal samples (381 blood, 3 tissue-derived). The samples had Gleason Scores ranging from 3+3 to 5+4. The 165 patients from the Canadian Prostate Cancer Genome Network (CPC-GENE) underwent either radical prostatectomy or image-guided radiotherapy as detailed in Fraser et al. (2017)7. In addition, 51 samples from publicly available datasets were included in the somatic mutation analysis and correlations with clinical variables, age, Gleason Score and T-category4-6,8, three of TCGA samples had tissue-derived normal samples as opposed to blood-normals. All samples were manually macro-dissected and were assessed by an expert urological pathologist to have tumour cellularity >70%. All tumour specimens were taken from the index lesion. Publicly available tumour tissues were obtained and used following University Health Network Research Ethics Board (REB) approved study protocols (UHN 06-0822-CE, UHN 11-0024-CE, CHUQ 2012-913:H12-03-192). Local REB and ICGC guidelines were used to collect whole blood and informed consent from CPC-GENE patients at the time of clinical follow-up.

EOPC Patient Cohort and Sample Processing

We collected 168 tumour samples from EOPC patients. Informed consent and an ethical vote (institutional reviewing board) were obtained according to the current ICGC guidelines. The patients did not receive any neo-adjuvant radiotherapy, androgen deprivation therapy, or chemotherapy prior to the surgical removal of tumor tissue. Tumor samples and a normal blood control were frozen at −20° C. and subsequently stored at −80° C.

EOPC DNA Library Preparation, Sequencing and Alignment

DNA library preparation and whole-genome sequencmg was performed on Illumina sequencers with the raw length of the reads displaying a median of 101 bp. Reads were aligned to the hg19 reference genome using BWA-MEM version 0.7.8-r455 [arXiv: 1303.3997v2] and duplicates were removed using Picard (available on the World Wide Web at broadinstitute.github.io/picard). Mitochondrial reads were extracted using SAMtools39.

Nuclear Mutation Calling

Recurrent nuclear genomic features were obtained from Fraser et al. (2017)7, which included five recurrent coding SNVs from commonly mutated genes in prostate cancer; the six most recurrent noncoding SNVs; CNAs from eight commonly mutated prostate cancer genes; the 10 GRs included the five most recurrent translocations and the four most recurrent inversions plus a recurrent inversion containing the PTEN gene; the TMPRSS-ERG fusion; presence or absence of kataegis events; chromothripsis; 3 metrics of mutation density (median dichotomized PGA estimates, number of SNVs and number of GRs); six methylation events were identified through univariate CoxPH modelling as associated with disease progression. Nuclear somatic single nucleotide variants were predicted by SomaticSniper (v1.0.2)38, (n=172 samples) setting the mapping quality threshold to 1, otherwise with default parameters. Nuclear SNVs were filtered using SAMtools (v0.1.6)39 and SomaticSniper (v1.0.2) provided filters, as well as a mapping quality filter and false positive filter from bam-readcount (downloaded Jan. 10, 2014). Nuclear SNVs were then annotated by ANNOVAR (v2015-06-17)40. The nuclear mutation rate was obtained by dividing the number of SNVs after filtering by the number of callable loci. Copy number aberrations were analyzed by Affymetrix OncoScan microarrays (n=194) and methylation data was generated by Illumina Infinium Human Methylation 450k BeadChip kits (n=104). Genomic rearrangements were called using Delly (v0.5.5)41 (n=172). Chromothripsis scores (n=159) were calculated by ShatterProof (v0.14)42 and subsequently dichotomized with a 0.517 threshold. Sample processing, whole genome sequencing and whole genome sequencing data analysis are as described in detail by Fraser et al. (2017)7.

Mitochondrial SNV Calling

Reads mapped to the mitochondria during whole genome alignment were extracted using BAMQL (v1.1)43 using the command:

    • bamql -l -o out_mito_reads.bam -f input_wgs.bam ‘(chr(M) & mate_chr(M))|(chr(Y) & after(59000000) & mate_chr(M))’;

The second part of the query statement collects reads where one of the pair mapped to chrM and the other unmapped which in our data was also assigned to an unresolved region in chrY.

The output files from BAMQL were used as input barn files for the mitochondrial genome analysis program MToolBox (v0.2.2)44. The versions of the various system requirements were: Python v2.7.2; gmap v.2013-07-2045; samtools v0.1.1839; java v1.7.0_72; pi card v1.92 (available on the World Wide Web at broadinstitute.github.io/picard); muscle v3.8.3 l46. We used default parameters for MToolBox and used the default RSRS47 as the reference genome. The default parameters include a minimum base quality score of 25, samples that failed the MToolBox program using default parameters, but successfully completed at a lower base quality parameter setting of 20, were nonetheless removed from the analysis.

    • MToolBox_v0.2.2/MToolBox.sh -i bam -r RSRS -M -l -m ‘-D genome_index/-H hg19RSRS -M chrRSRS’ -a ‘-r genome_fasta/-F -P -C’.

The predicted mitochondrial genome for each tumour sample and the number of reads supporting each base were compared to the corresponding normal sample if available, from each patient. Positions where the absolute difference in heteroplasmy fraction (ΔHF) was greater than 0.2 were considered to be mitochondrial SNVs (mtSNVs). While this does not preclude the possibility of tissue-specific heteroplasmy being mislabeled as somatic mutations, this allowed us to identify somatic variants as well as ignore those positions that could be called population variants, reducing the number of potentially false positive variant calls.

Heteroplasmy fraction estimates were adjusted to account for tumour cellularity using cellularity values calculated by qpure48. Tumour HF values were adjusted with the following equation:


Tumour HFcellularity=(Tumour HFMToolBox−(1−cellularity)*Normal HFMToolBox)/cellularity

If there were no cellularity values available we assumed cellularity=1.0. Those values of Tumour HFcellularity that were less than zero or greater than one were rounded to zero and one respectively.

In the mitochondrial reference genome there are three positions encoded as ‘N’ to preserve historical numbering, (523, 524 and 3107), in addition position 310 is located within a homopolymer region and is a common variant28. These four positions can result in misalignments49, therefore they were filtered out of our analyses, as in previous studies50. We also filtered out those positions with relatively low coverage of less than 100 read depth. Positions of mitochondrial genes and subregions of the noncoding control region were obtained from the World Wide Web at mitomap.org. Pathogenicity scores from MutPred51, PolyPhen-252 and SiteVar53 were obtained from the MToolBox output. Mutations in tRNA genes were compared to the Mamit-tRNA database54.

In the mitochondrial reference genome there are three positions encoded as ‘N’ to preserve historical numbering, (523, 524 and 3107), in addition position 310 is located within a homopolymer region and is a common variant28. These four positions can result in misalignments49, therefore they were filtered out of our analyses, as in previous studies50. We also filtered out those positions with relatively low coverage of less than 100 read depth. Positions of mitochondrial genes and subregions of the noncoding control region were obtained from http://www.mitomap.org. Pathogenicity scores from MutPred51, PolyPhen-252 and SiteVar53 were obtained from the MToolBox output. Mutations in tRNA genes were compared to the Mamit-tRNA database54.

We chose to a threshold of 0.2 ΔHF in order to balance removing false positives without excluding a large number of mtSNVs unnecessarily (FIG. 11c). As part of this assessment, we looked at four correlations between different nuclear and mitochondrial features using mtSNVs assessed at increasing ΔHF cutoffs from 0.1-0.6 (FIG. 11, Table 7). In each of these four cases, raising ΔHF from 0.1 to 0.2 led to increasing correlation coefficients between the two features. Three of the correlations that were not significant at 0.1 ΔHF, became significant at higher ΔHF, suggesting that some mtSNVs with lower HF values may be either false positives or low-level tissue specific heteroplasmies. Any further increases in ΔHF had differing effects on the four correlations.

mtDNA Copy Number

Mitochondrial copy number per cell (MCN) was calculated using the equation: (mitochondrial coverage/nuclear coverage)×2, using nuclear coverage data from the whole genome alignment7 and mitochondrial coverage data calculated by bedtools genomecov (v2.24.0)55. The mitochondrial mutation rate per megabase DNA was calculated by dividing the number of mtSNVs by the tumour MCN multiplied by the number of callable bases, 16565, accounting for the 4 positions that were removed.

Survival and Statistical Analyses

The mtSNV data were compared to patient clinical features in the R statistical environment (v3.2.3). Binomial regression (age, PSA) and Chi-square tests (T-category, Gleason Score) were used to identify associations between the clinical variables and mtSNVs for all 384 patients. Survival analyses were performed on 165 patients due to survival data availability. Cox proportional hazards models were used to calculate HRs for mtSNVs in the different mitochondrial features such as genes or MCN, with verification of the proportional hazards assumption. The mitochondrial feature MT-ND4L was removed from this analysis as only one patient in the 165 cohort had a mtSNV in this gene. Change in 10 year percent survival was calculated using survival rates. Kaplan-Meier plots were created comparing biochemical recurrence with the presence or absence of mutations in certain mitochondrial loci, (genes or noncoding regions) or median-dichotomized tumour MCN. Nuclear genomic features were chosen based on recurrence in a previous prostate cancer study7. Data was visualized using the R-environment and lattice (v0.20-31), latticeExtra (v0.6-26) and circos (v0.67-4)56. Associations between nuclear and mitochondrial genome features were calculated using Spearman's correlation.

PCR Validation

Single nucleotide variants in mitochondrial DNA were validated by Sanger re-sequencing, as previously reported7. Briefly, 10 ng of total genomic DNA (including mitochondrial DNA) was subjected to PCR amplification using primer pairs flanking SNVs identified from whole-genome sequencing (Table 3). Sequence data surrounding the region of interest was obtained from the World Wide Web at mitomap.org/bin/view.pl/MITOMAP/HumanMitoSeq. The amplicon sequence generated by the in silico PCR was then entered into the NCBI genome BLAST search engine to identify non-mitochondrial sequences that were similar. This was done to ensure that there were some differences between the designed primers and nuclear sequences, as well as to identify any sequence regions that could confound downstream analyses. The genome used for the BLAST search was GRCh38.p2 reference assembly top-level. These web pages were used on Aug. 20 and 21, 2015 and verified on Sep. 13, 2016. PCR reactions were purified using the QiAquick PCR purification kit (Qiagen, Toronto, Canada). Sanger re-sequencing was performed using amplicon-specific primers on an ABI 3730XL capillary electrophoresis instrument (Thermo Fisher Scientific, Burlington, Canada) at The Centre for Applied Genomics, Hospital for Sick Children, Toronto, Canada.

Single nucleotide variants in mitochondrial DNA were validated by Sanger re-sequencing, as previously reported7. Briefly, 10 ng of total genomic DNA (including mitochondrial DNA) was subjected to PCR amplification using primer pairs flanking SNVs identified from whole-genome sequencing (Table 3). Sequence data surrounding the region of interest was obtained from http://www.mitomap.org/bin/view.pl/MITOMAP/HumanMitoSeq. The amplicon sequence generated by the in silico PCR was then entered into the NCBI genome BLAST search engine to identify non-mitochondrial sequences that were similar. This was done to ensure that there were some differences between the designed primers and nuclear sequences, as well as to identify any sequence regions that could confound downstream analyses. The genome used for the BLAST search was GRCh38.p2 reference assembly top-level. These web pages were used on Aug. 20 and 21, 2015 and verified on Sep. 13, 2016. PCR reactions were purified using the QiAquick PCR purification kit (Qiagen, Toronto, Canada). Sanger re-sequencing was performed using amplicon-specific primers on an ABI 3730XL capillary electrophoresis instrument (Thermo Fisher Scientific, Burlington, Canada) at The Centre for Applied Genomics, Hospital for Sick Children, Toronto, Canada.

Data Availability Statement

Sequencing data is available at the European Genotype-Phenotype Archive (EGA) repository under accession EGAS00001001782.

Results Mitochondrial Genome Sequence Analysis

We collected 384 tumours from patients with localized prostate cancer, comprising 164 EOPCs and 220 late-onset prostate cancers (LOPC; Table 4; FIG. 5). The LOPC patients represented the three NCCN risk groups: 19 low-risk, 151 intermediate-risk and 36 high-risk. The average sequencing depth of the mitochondrial genome was 13,577x, allowing extremely sensitive mutation detection. This cohort does not include any nuclear whole genome duplication events, as demonstrated by SNP microarray analysis7. We first evaluated the mitochondrial copy number (MCN) for each sample from the sequencing coverage of the mitochondrial and nuclear genomes. MCN ranged from 75 to 1405 (mean: 431) across the cohort, and was strongly associated with age (linear model, p=1.67×10−26), as well with clinical indices such as T-category (ANOVA, p=6.01×10−3) and Gleason Score (GS; ANOVA, p=6.46×10−3; FIG. 6).

We next conservatively identified mitochondrial SNVs (mtSNVs) as those positions that had an absolute difference in their heteroplasmy fraction (ΔHF) between purity-adjusted tumour and paired-normal samples of at least 0.20 (FIG. 5). Because the number of identified mtSNVs is dependent on the heteroplasmy fraction threshold, we chose to balance false positives and false negatives with an intermediate value. There were 293 mtSNVs across all patients, with 47.4% of tumours (182/384) harbouring at least one and 6.8% (26/384) harbouring three or more FIG. 1a; Table 5). Proportions of patients with 0, 1, 2, 3 mtSNVs are 202/384 (52.6%), 110/384 (28.6%), 46/384 (12.0%) and 26/384 (6.8%), respectively. The number of patients with no mtSNVs was greater than expected by chance, suggesting significant variability in mtSNV burden (permutation test; p=3.4×10−5). Tumours with a larger number of mitochondria were more likely to have an mtSNV (generalized linear model (GLM) family binomial; p=8.38×10−7). mtSNVs were associated with tumour size (T-category; χ2 test; p=2.47×10−4), but not other clinical prognostic indices like pre-treatment PSA and GS (FIG. 1a). PCR followed by Sanger sequencing validated 18/25 predicted mtSNVs (FIG. 7; FIG. 8; Table 1), suggesting precision of ˜75%, comparable to somatic indel detection accuracy27.

Frequently Mutated Mitochondrial Loci

The noncoding control region of the mitochondria (mtDNA positions: 1-576 and 16024-16569), was the most frequently mutated region with 15.4% (59/384) of tumours harbouring mutations in that region (Table 5; FIG. 9). The control region comprises several elements, including the heavy- and light-strand promoters, as well as the origins of replication for the heavy strand (OHR), two hypervariable regions (HV1, HV2) and three conserved sequence blocks (CSB1, CSB2, CSB3). All functional locations were defined from mitmap.org28. Of these regions, HV1 was the most frequently mutated (mtDNA positions: 16024-16383). Overall, mutation rates were generally consistent across regions of the mitochondrial genome (FIG. 1b).

There were 157 mtSNVs in the 13 protein coding genes, 82% (129/157) of which were nonsynonymous, including 6 premature stop codons and two mutated stop codons. The most frequently mutated protein coding gene was ND5 (30/157). We identified 21 specific positions mutated in at least two patients (FIG. 1c): ten within the control region, eight in protein-coding regions and three in rRNA subunits. Of the coding mutations, seven were non-synonymous and one introduced a premature stop codon. In the control region, position 16093—a common site of tissue specific heteroplasmy29,30—was the most frequently mutated position (nine patients; FIG. 1c). Of protein-coding genes, ND1 was frequently mutated, with two patients having G3946A mutations (ΔHF: 0.63, 0.24), leading to a structure-disrupting E214K amino acid change, resulting in a reduction of complex assembly31. A second mutation, G4142A was found in two patients (ΔHF: 1.0, 0.21; R279Q) and a third mutation, G3842A, in three patients (ΔHF: 0.45, 0.21, 0.95; premature stop codon).

There were 22 mutations within mitochondrial tRNA genes, and eight of these were located within anticodon stems. In CO1 there were non-synonymous mutations at G5910A (A2T in one patient; ΔHF: 0.84) and T6664C (1254T in one patient; ΔHF: 0.46), two amino acids previously observed to be mutated in prostate cancer cells20. Two patients with mutations at position 6419 were detected within the CO1 gene (ΔHF: 0.2, 0.23), although these two showed heteroplasmy within the normal samples and homoplasmy in the tumour suggesting that these mtSNVs represent either tissue-specific heteroplasmy32 or mutations that have gone to fixation in the tumour. Overall CO1 was mutated in 4.7% (18/384) of patients, markedly lower than the 11% rate previously reported20.

Age Effect on the Distribution of mtSNVs in Prostate Cancer

As expected, the occurrence of mitochondrial mutations was strongly associated with patient age (GLM family binomial; p=5.88×10−9; FIG. 1a)23-26. The mitochondrial mutation rate was significantly lower than that of the nuclear genome mutation rate (FIG. 2a; p=0.040, F-test), which may in part be explained by differential mutation detection accuracy in the two genomes. To further understand the association of mtSNVs with age, we separated patients into those 50 and under years of age (EOPC; n=164) and those over 50 (LOPC; n=220). The median ages of the EOPC and LOPC cohorts were 47 and 63.5 years old, respectively. Patients with EOPC were significantly more likely to have no mitochondrial mutations, 117/164 (71.3%), than those with LOPC (85/220, 38.6%; p=4.22×10−10, proportion test; FIG. 2b, c). Despite this difference in mutational load, the two groups have similar distributions of mtSNVs across the mitochondrial genome, with the highest fraction of mtSNVs within the control region (FIG. 10). EOPC patients had about 224 fewer copies of the mitochondria than LOPC patients (Mann-Whitney test; p=4.56×10−30; FIG. 2d). This effect was inverted in the normal samples with EOPC patients having 86 more copies (Mann-Whitney; p=1.54×10−14; FIG. 6d), consistent with the decline in lymphocyte MCN with age33.

Associations Between mtSNVs and Nuclear Genomic Mutations

Intriguingly, mutations in the large rRNA subunit (RNR2) were significantly correlated with mutations in the mitochondrial gene ND4 (Spearman's p=0.19; p=0.00015), suggesting to us an inter-play between different mutational types. To rigorously assess this phenomenon, we studied mutational associations between the nuclear and mitochondrial genomes. We exploited a set of 40 candidate nuclear somatic driver events recently identified through recurrence analyses, including five measures of mutation density, six methylation events, six non-coding SNVs, five coding SNVs, five measures of mutational density, ten genomic rearrangements and eight copy number aberrations (CNAs)7. The SNVs included recurrent coding SNVs in genes that are commonly mutated in prostate cancer, as well as the six most recurrent non-coding SNVs. To characterize per-region mtSNVs, we defined 22 mutational features representing the broad functional aspects of the mitochondria, 13 protein coding genes, 2 rRNAs, tRNAs (treated as one group), the control region and 3 subregions within the control region, along with mtSNV number and MCN. For each of the nuclear features, we evaluated their correlation to 22 mitochondrial mutational features in 194 LOPCs with nuclear mutational data (Table 6). We detected multiple nuclear-mitochondrial mutational associations (FIG. 3a). For example, SNVs in FOXA1 were significantly positively correlated with multiple mitochondrial features, as were SNVs in MED12. Nuclear-mitochondrial correlations were weakly dependent on the ΔHF threshold used to call mtSNVs (FIG. 11, Table 7).

One prominent nuclear-mitochondrial mutational interactions was co-occurrence of MYC copy number gain and mtSNVs within the OHR (FIG. 3b). Mutations within the OHR may dysregulate mtDNA replication, while MYC induces mitochondrial biogenesis by activating genes required for mitochondrial function34 and influences metabolic plasticity in cancer stem cells35. Risk of biochemical failure (BCR) after primary definitive treatment by radiotherapy or surgery was significantly higher for patients whose tumours harboured both MYC CNAs and OHR mtSNVs relative to those with neither or one of these two mutations, suggesting a synergistic mitochondrial-nuclear effect on disease aggression (FIG. 3c). Several other similar instances of apparent synergistic mitochondrial-nuclear effects on disease aggression were observed (FIG. 12a-e), suggesting that this is a common phenomenon in prostate cancer. While we have used the region defined as OHR (mtDNA positions: 110-441) as the mitochondrial feature, this subregion of the Control Region significantly overlaps with a region defined as HV2 (mtDNA positions: 57-372). We confirmed that HV2 mtSNVs show the same synergistic effect with MYC CNAs as mtSNVs defined as OHR (FIG. 12f). Interestingly, MYC CNAs were more common in LOPCs (14.5%; 29/200) than in EOPCs (8.4%; 10/119) making it impossible to assess if the same nuclear-mitochondrial interactions occur in both disease states. Further evaluation of changes in nuclear-mitochondrial associations across disease progression will be revealing.

Clinical Impact of mtSNVs in Prostate Cancer

The recurrence of mitochondrial mutations in specific regulatory regions and their association with prognostic nuclear mutations strongly suggested their ability to drive disease aggression. We therefore systematically evaluated the association of individual mitochondrial somatic mutational features with disease aggression in 165 patients with clinical follow-up using Cox proportional hazards modeling. Of our 22 mitochondrial mutational features (FIG. 3a), four were significantly associated with biochemical relapse rates (FIG. 4a; Table 2): mutations in CSB1, OHR, ATP8 and HV1. We should note that MT-ND4L was not included in this analysis as only one patient of the 165 had a mtSNV in this gene. To evaluate if these mutations were independent prognostic variables, we employed multivariable modeling to adjust for age, pre-treatment PSA, T-category and GS. After adjustment, mtSNVs in HV1 were associated with better patient outcome (FIG. 4b; Hazard Ratio, HR=0.28, 95% CI=0.08-0.9, p=0.032, Wald test), while mtSNVs in OHR were associated with significantly worse patient outcome (FIG. 4c; HR=2.47, 95% CI=1.13-5.38, p=0.023, Wald test).

These data suggested that mtSNVs might comprise a novel way to predict patient outcome. We therefore assessed the ability of a multi-mtSNV signature to identify patients at elevated risk for biochemical failure (who therefore might benefit from treatment intensification) and those at low risk (who might therefore be appropriate for surveillance protocols). Using leave-one-out cross-validation and univariate feature-selection, we created a three-class signature that separated patients into three distinct risk groups for biochemical failure (FIG. 13a). The signature identified both patients at elevated risk (FIG. 4d; HR=3.41, 95% CI=1.71-6.80, p=0.0005, Wald test) and patients at low-risk (HR=0.23, 95% CI=0.08-0.65, p=0.005, Wald test). These effects are independent of clinical features: when we considered only the clinically-homogeneous NCCN intermediate risk group, the same mtSNV signature again separated three groups with distinct risk profiles (FIG. 14). The cross-validation method identified seven genes (CO2, CO3, ATP8, HV1, OHR, CSB1, ND4L) as informative for classification. Patients with mtSNVs in (CO2, CO3, HV1) were classified as low-risk and patients with mtSNVs in (ATP8, OHR, ND4L, CSB1) were classified as high-risk. To show that this does not lead to over-fitting, we chose the three most frequently mutated regions of the seven (CO3, HV1, OHR) which also clearly separated patients into three groups (FIG. 13b).

Discussion

The mitochondrial mutational landscape of cancer has been relatively unexplored. Previous work has shown a large-scale mtDNA deletion has predictive value in the prostate biopsy outcomes36, suggesting the feasibility of mtDNA-based molecular tests. We identify a large number of mtSNVs in localized prostate cancer. These mutations show complex interplay with nuclear mutational characteristics, and appear to work together to drive tumour aggressiveness.

Mitochondrial mutations also show associations with risk of biochemical relapse. Interestingly, mtSNVs within the control region can have conflicting outcomes, however when separated into the different noncoding subregions (HV1, OHR) we found that certain loci were associated with better outcomes and others with worse outcomes. The overlap of the OHR and HV2 within the control region and their association with MYC CNAs highlight the need for better understanding of the functions of the control region37. In future, treating the control region as distinct regulatory regions may provide further insight into the roles of these regions, as well as any contribution they may make towards tumour aggression. We note that the number of pairs of nuclear-mitochondrial mutational features tested may elevate false-positive rates, and it will be key to perform validation studies in larger cohorts to verify their effect-sizes and biological significance.

The differences observed in the mitochondrial mutational profiles of EOPC and LOPC patients show a need to better understand the association between mtSNVs and aging and how this may relate to the development of prostate cancer. While the mitochondrial copy number of matched-normal samples decreases with patient age, a previously observed trend33, tumour MCN estimates were significantly higher in older patients which could account for the higher frequency of mtSNVs in these patients. However, since the majority of the samples of each age group come from different research centres, this striking difference in tumour MCN will require further investigation to exclude any confounding effects.

Further studies will be needed to assess when different mtSNVs occur during tumour evolution, their timing relative to common nuclear mutations and the effects of these mutations on mitochondrial function. This will more clearly identify the mitochondrial mutations that are important for mitochondrial-nuclear communication and how they may interact to drive tumour formation. Localized prostate cancer remains the most diagnosed non-skin cancer in men, and identification of aggressive disease remains an urgent clinical dilemma. Addition of mtSNVs to prognostic biomarkers may be an effective way of improving prediction of patient outcome, supporting triage of patients with low-risk disease to surveillance protocols and with high-risk disease to adjuvant therapy regimens.

All documents disclosed herein, including those in the following reference list, are incorporated by reference. Although preferred embodiments of the invention have been described herein, it will be understood by those skilled in the art that that the detailed description and the specific examples while indicating preferred embodiments of the invention are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

REFERENCES

  • 1. Lozano, R. et al. Global and regional mortality from 235 causes of death for 20 age groups in 1990 and 2010: a systematic analysis for the Global Burden of Disease Study 2010. Lancet 380, 2095-2128 (2012).
  • 2. Barbieri, C. E. et al. The mutational landscape of prostate cancer. Eur. Urol. 64, 567-576 (2013).
  • 3. Barbieri, C. E. et al. Exome sequencing identifies recurrent SPOP, FOXA1 and MED12 mutations in prostate cancer. Nat. Genet. 44, 685-689 (2012).
  • 4. Cancer Genome Atlas Research Network. The Molecular Taxonomy of Primary Prostate Cancer. Cell 163, 1011-1025 (2015).
  • 5. Baca, S. C. et al. Punctuated evolution of prostate cancer genomes. Cell 153, 666-677 (2013).
  • 6. Berger, M. F. et al. The genomic complexity of primary human prostate cancer. Nature 470, 214-220 (2011).
  • 7. Fraser, M. et al. Genomic hallmarks of localized, non-indolent prostate cancer. Nature 541, 359-364 (2017).
  • 8. Weischenfeldt, J. et al. Integrative genomic analyses reveal an androgen-driven somatic alteration landscape in early-onset prostate cancer. Cancer Cell 23, 159-170 (2013).
  • 9. Boutros, P. C. et al. Spatial genomic heterogeneity within localized, multifocal prostate cancer. Nat. Genet. 47, 736-745 (2015).
  • 10. Cooper, C. S. et al. Analysis of the genetic phylogeny of multifocal prostate cancer identifies multiple independent clonal expansions in neoplastic and morphologically normal prostate tissue. Nat. Genet. 47, 367-372 (2015).
  • 11. Erho, N. et al. Discovery and validation of a prostate cancer genomic classifier that predicts early metastasis following radical prostatectomy. PloS One 8, e66855 (2013).
  • 12. Wu, C.-L. et al. Development and validation of a 32-gene prognostic index for prostate cancer progression. Proc. Natl. Acad. Sci. U.S.A 110, 6121-6126 (2013).
  • 13. Lalonde, E. et al. Tumour genomic and microenvironmental heterogeneity for integrated prediction of 5-year biochemical recurrence of prostate cancer: a retrospective cohort study. Lancet Oncol. 15, 1521-1532 (2014).
  • 14. Wallace, D. C. Mitochondria and cancer. Nat. Rev. Cancer 12, 685-698 (2012).
  • 15. Kumimoto, H. et al. Frequent somatic mutations of mitochondrial DNA in esophageal squamous cell carcinoma. Int. J. Cancer 108, 228-231 (2004).
  • 16. Larman, T. C. et al. Spectrum of somatic mitochondrial mutations in five cancers. Proc. Natl. Acad. Sci. U.S.A 109, 14087-14091 (2012).
  • 17. McMahon, S. & LaFramboise, T. Mutational patterns in the breast cancer mitochondrial genome, with clinical correlates. Carcinogenesis 35, 1046-1054 (2014).
  • 18. Chen, J. Z., Gokden, N., Greene, G. F., Mukunyadzi, P. & Kadlubar, F. F. Extensive somatic mitochondrial mutations in primary prostate cancer using laser capture microdissection. Cancer Res. 62, 6470-6474 (2002).
  • 19. Gómez-Zaera, M. et al. Identification of somatic and germline mitochondrial DNA sequence variants in prostate cancer patients. Mutat. Res. 595, 42-51 (2006).
  • 20. Petros, J. A. et al. mtDNA mutations increase tumorigenicity in prostate cancer. Proc. Natl. Acad. Sci. U.S.A 102, 719-724 (2005).
  • 21. Kloss-Brandstätter, A. et al. Somatic mutations throughout the entire mitochondrial genome are associated with elevated PSA levels in prostate cancer patients. Am. J. Hum. Genet. 87, 802-812 (2010).
  • 22. McCrow, J. P. et al. Spectrum of mitochondrial genomic variation and associated clinical presentation of prostate cancer in South African men. Prostate 76, 349-358 (2016).
  • 23. Cortopassi, G. A. & Arnheim, N. Detection of a specific mitochondrial DNA deletion in tissues of older humans. Nucleic Acids Res. 18, 6927-6933 (1990).
  • 24. Corral-Debrinski, M., Shoffner, J. M., Lott, M. T. & Wallace, D. C. Association of mitochondrial DNA damage with aging and coronary atherosclerotic heart disease. Mutat. Res. 275, 169-180(1992).
  • 25. Zhang, C. et al. Differential occurrence of mutations in mitochondrial DNA of human skeletal muscle during aging. Hum. Mutat. 11, 360-371 (1998).
  • 26. Michikawa, Y., Mazzucchelli, F., Bresolin, N., Scarlato, G. & Attardi, G. Aging-dependent large accumulation of point mutations in the human mtDNA control region for replication. Science 286, 774-779 (1999).
  • 27. Alioto, T. S. et al. A comprehensive assessment of somatic mutation detection in cancer using whole-genome sequencing. Nat. Commun. 6, 10001 (2015).
  • 28. Lott, M. T. et al. mtDNA Variation and Analysis Using Mitomap and Mitomaster. Curr. Protoc. Bioinforma. 44, 1.23.1-26 (2013).
  • 29. Krjutškov, K. et al. Tissue-specific mitochondrial heteroplasmy at position 16,093 within the same individual. Curr. Genet. 60, 11-16 (2014).
  • 30. Samuels, D. C. et al. Recurrent tissue-specific mtDNA mutations are common in humans. PLoS Genet. 9, e1003929 (2013).
  • 31. Kervinen, M. et al. The MELAS mutations 3946 and 3949 perturb the critical structure in a conserved loop of the ND1 subunit of mitochondrial complex I. Hum. Mol. Genet. 15, 2543-2552 (2006).
  • 32. He, Y. et al. Heteroplasmic mitochondrial DNA mutations in normal and tumour cells. Nature 464, 610-614 (2010).
  • 33. Ding, J. et al. Assessing Mitochondrial DNA Variation and Copy Number in Lymphocytes of ˜2,000 Sardinians Using Tailored Sequencing Analysis Tools. PLoS Genet. 11, e1005306 (2015).
  • 34. Li, F. et al. Myc stimulates nuclearly encoded mitochondrial genes and mitochondrial biogenesis. Mol. Cell. Biol. 25, 6225-6234 (2005).
  • 35. Sancho, P. et al. MYC/PGC-1α Balance Determines the Metabolic Phenotype and Plasticity of Pancreatic Cancer Stem Cells. Cell Metab. 22, 590-605 (2015).
  • 36. Robinson, K. et al. Accurate prediction of repeat prostate biopsy outcomes by a mitochondrial DNA deletion assay. Prostate Cancer Prostatic Dis. 13, 126-131 (2010).
  • 37. Nicholls, T. J. & Minczuk, M. In D-loop: 40 years of mitochondrial 7S DNA. Exp. Gerontol. 56, 175-181 (2014).
  • 38. Larson, D. E. et al. SomaticSniper: identification of somatic point mutations in whole genome sequencing data. Bioinformatics 28, 311-317 (2012).
  • 39. Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078-2079 (2009).
  • 40. Wang, K., Li, M. & Hakonarson, H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res. 38, e164 (2010).
  • 41. Rausch, T. et al. DELLY: structural variant discovery by integrated paired-end and split-read analysis. Bioinformatics 28, i333-i339 (2012).
  • 42. Govind, S. K. et al. ShatterProof: operational detection and quantification of chromothripsis. BMC Bioinformatics 15, 78 (2014).
  • 43. Masella, A. P. et al. BAMQL: a query language for extracting reads from BAM files. BMC Bioinformatics 17, 305 (2016).
  • 44. Calabrese, C. et al. MToolBox: a highly automated pipeline for heteroplasmy annotation and prioritization analysis of human mitochondrial variants in high-throughput sequencing. Bioinformatics 30, 3115-3117 (2014).
  • 45. Wu, T. D. & Watanabe, C. K. GMAP: a genomic mapping and alignment program for mRNA and EST sequences. Bioinformatics 21, 1859-1875 (2005).
  • 46. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792-1797 (2004).
  • 47. Behar, D. M. et al. A ‘Copernican’ reassessment of the human mitochondrial DNA tree from its root. Am. J. Hum. Genet. 90, 675-684 (2012).
  • 48. Song, S. et al. qpure: A Tool to Estimate Tumor Cellularity from Genome-Wide Single-Nucleotide Polymorphism Profiles. PLOS ONE 7, e45835 (2012).
  • 49. Guo, Y. et al. The use of Next Generation Sequencing Technology to Study the Effect of Radiation Therapy on Mitochondrial DNA Mutation. Mutat. Res. 744, 154-160 (2012).
  • 50. Ju, Y. S. et al. Origins and functional consequences of somatic mitochondrial DNA mutations in human cancer. eLife 3, (2014).
  • 51. Li, B. et al. Automated inference of molecular mechanisms of disease from amino acid substitutions. Bioinformatics 25, 2744-2750 (2009).
  • 52. Adzhubei, I., Jordan, D. M. & Sunyaev, S. R. Predicting functional effect of human missense mutations using PolyPhen-2. Curr. Protoc. Hum. Genet. 7, Unit7.20 (2013).
  • 53. Rubino, F. et al. HmtDB, a genomic resource for mitochondrion-based human variability studies. Nucleic Acids Res. 40, D1150-1159 (2012).
  • 54. Pütz, J., Dupuis, B., Sissler, M. & Florentz, C. Mamit-tRNA, a database of mammalian mitochondrial tRNA primary and secondary structures. RNA 13, 1184-1190 (2007).
  • 55. Quinlan, A. R. & Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841-842 (2010).
  • 56. Krzywinski, M. I. et al. Circos: An information aesthetic for comparative genomics.

TABLE 1 Results of PCR validation of 25 mtSNVs Sample Posit bn Amplicon Validated? HF - Tumour HF - Normal CPCG0196 195 1 Y 0.58T 1.0T CPCG0242 234 1 Y 1.0G 1.0A CPCG0189 650 2 Y 0.69C 1.0T CPCG0248 988 3 N 0.64A 1.0G CPCG0324 3079 5 N 1.0A 1.0G CPCG0233 3946 6 N 0.63A 1.0G CPCG0407 4770 7 N 0.98A 1.0G CPCG0242 5511 9 Y 1.00 1.0T CPCG0189 6270 10 N 0.66G 1.0G CPCG0251 6276 10 Y 1.0A 0.55G CPCG0331 6856 11 Y 1.0C 1.0T CPCG0345 8391 12 N 0.59G 1.0G CPCG0196 8433 12 Y 0.58T 1.0T CPCG0340 10866 14 Y 1.0T 0.5C CPCG0410 11814 15 Y 1.0C 1.0T CPCG0352 12700 16 Y 0.87A 1.0C CPCG0236 12763 16 Y 1.0A 1.0G CPCG0217 13913 17 Y 1.0C 1.0T CPCG0410 13918 17 Y 1.0C 0.97T CPCG0340 14846 18 Y 1.0A 1.0G CPCG0412 15045 18 N 0.51G 1.0G CPCG0412 15708 19 Y 0.58A 1.0G CPCG0269 15731 19 Y 0.83A 1.0G CPCG0269 15817 19 Y 0.91G 0.83A CPCG0356 15884 19 Y 1.0A 0.84G

TABLE 2 Results from univariate Cox proportional modeling p-value p-value 10 year number lower upper (wald (logrank survival of patients Loci HR 95% Cl 95% Cl test) test) difference with mitoSNV 1 Control 0.79 0.429 1.45 0.447 0.446 0.01 35 Region 2 RNR1 1.48 0.671 3.28 0.329 0.326 −0.29 12 3 RNR2 1.25 0.538 2.91 0.603 0.602 −0.11 15 4 tRNAs 0.80 0.285 2.22 0.663 0.662 0.24 9 5 ND1 1.28 0.508 3.24 0.597 0.596 −0.03 10 6 ND2 1.27 0.507 3.16 0.613 0.613 0.18 12 7 ND3 1.24 0.171 9.02 0.832 0.831 0.11 3 8 ND4 1.19 0.476 2.98 0.709 0.709 0.02 12 9 ND5 1.74 0.825 3.67 0.145 0.140 −0.24 16 10 ND6 1.69 0.234 12.25 0.601 0.597 −0.06 2 11 CO1 0.66 0.239 1.82 0.422 0.419 −0.02 12 12 CO2 0.00 0.000 Inf 0.997 0.196 0.45 3 13 CO3 0.25 0.035 1.80 0.168 0.136 0.35 9 14 ATP6 0.57 0.079 4.11 0.577 0.572 0.11 4 15 ATP8 4.25 1.014 17.84 0.048 0.031 −0.23 3 16 CYB 0.44 0.132 1.47 0.181 0.172 0.24 11 17 HV1 0.26 0.080 0.82 0.022 0.013 0.32 18 18 CSB1 4.52 1.410 14.46 0.011 0.005 −0.57 3 19 OHR 2.73 1.294 5.74 0.008 0.006 −0.41 12 20 MCN 1.50 0.918 2.46 0.105 0.103 −0.15 165 21 mtSNV 0.87 0.525 1.43 0.574 0.574 −0.047 105

TABLE 3 PCR primers Primer Targets Region: 1F tctatcaccctat taaccactcacg  10-385 1R aggctggtgt tagggt tt tg 2F aaaaat tccaccaaaccccc 287-718 2R actggaacggggatgct tg 3F acgggaaacagcagtgat taac  809-1103 3R agggctaagcatagtggggt 4F cagcaaaccctgatgaaggc 1273-1710 4R tggtagtaaggtggagtgggt 5F taccctagggataacagcgca 2927-3171 5R gggaaggcgct tgtgaagt 6F tactcctgccatcatgaccct 3828-4067 6R gt taggggagagtgcgtc 7F ataccccgaaaatgt tggt tatac 4434-4927 7R ggct tacgt tagtgagggagag 8F ctgacatccggcctgct t 4840-5171 8R caggtgcgagatagtagtagggtc 9F catcgccct taccacgctac 5457-5742 9R cggcgggagaagtagat tga 10F cataaacaacataagct 6192-6586 tctgactct tacct 10R ggtctcctcctccggcg 11F tatcctaccaggct tcggaat 6642-6957 11R acctacggtgaaaagaaagatga 12F accacagt tcatgcccatc 8194-8482 12R ggtgagggaggtaggtggtag 13F caaaaaggcct tcgatacggg 9433-9876 13R tagt tggcggatgaagcagat 14F tgggcctagccctactagtctc 10688-10939 14R gggtcggaggaaaaggt tgg 15F tacgaacgcactcacagtcg 11760-11988 15R tgtagagggagtatagggctgt 16F atctcgaactgacactgagcc 12524-12894 16R aaggcgaggatgaaaccgat 17F ctaacaacat tcccccgcatc 13743-14056 17R ggtggagat tggtgctgtg 18F cccaccccatccaacatctc 14811-15111 18R caagcaggaggataatgccg 19F ggcgtcct tgccctat tact 15615-16051 19R acccaaatctgct tcccat 20F atggggaagcagat tgggt 16032-16298 20R gggtgggtaggt tgt tggt

TABLE 4 Clinical and sequencing data per patient Normal mitochondrial Normal Tumour mean mitochondrial mitochondrial Tumour Age At Gleason T PSA coverage copy mean mitochondrial Patient Treatment Score category (ng/ml) mitoSNVs d num coverage copy nu Baca-P03- 69 4 + 3 T2c 13.9 1 9973.43 528.32 9639.89 430.02 1426 Baca-P05- 47 3 + 4 T2b 9.3 1 5301.26 541.65 13952.8 455.87 1657 Baca-PR-05- 64 3 + 4 T2c 7.2 2 7848.46 366.84 13517.9 378.68 3595 Baca-P05- 62 4 + 3 T3a 12.5 2 9535.11 517.82 14571 483.77 3852 Baca-PR-06- 60 4 + 3 T2c 6.7 1 3687.29 518.5 22823.8 543.38 1749 Baca-PR-06- 54 4 + 3 T3a 25 1 7265.49 374.58 13011.3 320.31 3199 Baca-PR-07- 69 3 + 4 T3a 5.6 1 5986.71 206.44 6899.3 181.05 4610 Baca-P07- 57 3 + 3 T2c 4.1 1 9583.63 505.45 11448.7 231.43 4941 Baca-P07- 68 4 + 3 T3a 11 0 12286.3 703.49 12188.3 349.15 5037 Baca-PR-08- 58 3 + 4 T4 36 1 7155.13 381.71 13066.7 322.03 4154 Baca-P08- 59 3 + 4 T3a 4.1 0 13055.6 648.03 13959 466.2 716 Baca-P09- 76 3 + 4 T3b 9 1 5974.65 316.06 9801.68 388.03 37 Baca-PR- 60 3 + 3 T2c 4.5 0 808.985 48.58 17039.6 653.48 0410 Baca-PR- 62 3 + 4 T3a 6 1 2953.47 150.82 17440.3 452.67 STID000000 2872 Berger-PR- 57 3 + 4 T2c 7.8 3 2664.78 143.98 11557.9 601.49 0508 Berger-PR- 69 4 + 5 T3b 9.2 0 794.518 59.07 7999.43 460.05 0581 Berger-PR- 62 3 + 4 T3a 2.1 0 2023.96 94.9 9496.81 447.2 1701 Berger-PR- 66 4 + 4 T2c 9.8 0 1856 104.29 11199 634.19 1783 Berger-PR 66 3 + 4 T2c 6.6 0 1630.41 84.31 13476.4 682.17 2832 Berger-PR- 66 4 + 4 T3b 10.2 1 1624.68 97.23 5624.32 314.53 3027 Berger-PR- 69 3 + 4 T2c 7.2 3 1969.11 106.24 14276.4 776.69 3043 CPCG0001 69.4 3 + 4 T2b 7.7 1 2010.51 91.23 15343.8 536.19 CPCG0003 71.8 3 + 4 T2a 10 1 1592 98.23 16387.8 563.25 CPCG0004 76.5 4 + 4 T2b 14.1 0 2360.43 76.6 21736 504.1 CPCG0005 72.5 3 + 3 T2a 5.4 1 1954.36 105.73 14676.7 428.18 CPCG0006 73.5 4 + 3 T2b 8.4 0 11969.9 368.42 19269.2 631.66 CPCG0007 65.9 4 + 4 T1c 8.4 0 2622.67 107.85 19394.9 618.46 CPCG0008 74.3 3 + 4 T2a 4.7 0 8033.1 216.69 8220.56 487.07 CPCG0015 70 4 + 4 T2a 5.6 0 2445.52 123.29 11664.1 338.77 CPCG0019 71.4 4 + 5 T2a 7.3 1 1855.12 103.89 7508.09 235.48 CPCG0020 70.8 3 + 4 T1c 16 1 2152.74 102.61 15986.9 451.44 CPCG0022 70.3 3 + 3 T1c 12.6 0 6126.42 191.2 27763.9 427.62 CPCG0027 64.6 3 + 3 T1c 5 2 2309.34 124.47 18997.1 540.68 CPCG0030 73.1 4 + 4 T1c 8 2 1860.72 88.54 24737.1 435.4 CPCG0036 75.9 3 + 4 T2a 5.3 0 1546.25 83.47 21118.1 641.24 CPCG0040 71.5 3 + 4 T1c 9 3 2234.77 109.46 12738.2 385.35 CPCG0042 75.5 4 + 3 T2b 5.6 0 2661.75 127.13 12385.6 394.09 CPCG0046 79.4 4 + 3 T1c 5.1 5 1944.65 106.17 23558.9 1020.68 CPCG0047 71.9 4 + 3 T2c 13.2 0 1773.42 87.23 6868.3 181.08 CPCG0048 74.3 3 + 3 T2b 5.1 0 1965.81 100.43 18063.2 630.52 CPCG0050 75.8 3 + 3 T1c 7.7 1 2326.01 107.27 35390.2 922.94 CPCG0057 70.4 3 + 3 T2a 10 1 2814.45 142.84 7928.7 270.69 CPCG0063 68.6 4 + 3 T2a 3.8 2 2644.85 126.2 16387.6 538.02 CPCG0067 62 3 + 4 T2b 10 4 2540.37 113.15 26440.2 1255.88 CPCG0070 67.3 3 + 3 T2a 5.9 2 3288.57 130.51 23488.5 703.48 CPCG0071 74.9 4 + 3 T1c 14.7 2 2038.28 100.32 13083.5 407.14 CPCG0072 75.7 4 + 5 T2a 9.3 1 2087.05 114.92 18531.3 566.05 CPCG0073 71.6 4 + 3 T1c 10.3 2 2207.67 104.47 17129.6 500.64 CPCG0075 70.8 4 + 4 T2a 4.1 0 2219.17 110.59 11392.5 303.91 CPCG0076 76.6 3 + 3 T2a 12.7 1 1742.35 84.34 19549.5 531.43 CPCG0078 61 4 + 3 T2b 3.3 2 1105.04 49.32 14594.2 581.48 CPCG0081 75 4 + 3 T2a 17.8 2 2160.59 98.52 37008.6 1033.84 CPCG0082 70.3 4 + 3 T2a 7.8 1 1857.84 88.02 17730.5 440.85 CPCG0083 61.5 3 + 4 T2b 12.7 1 2672.43 109.97 13413.7 477.54 CPCG0084 70.8 3 + 3 T2b 7 1 2455.36 211.71 19898.8 557.13 CPCG0087 72.8 3 + 4 T1c 9.4 0 2124.21 90.43 10965.7 378.22 CPCG0089 73.9 4 + 4 T1c 4.8 1 6316.55 109.74 9884.38 579.96 CPCG0090 77.6 3 + 3 T1c 11.2 2 3146.06 107.25 26497.8 601.53 CPCG0094 77.6 4 + 3 T2b 16.41 0 1772.67 85.84 9333.85 270.47 CPCG0095 68.5 4 + 3 T2a 4 1 3226.28 116.97 9627.27 284.66 CPCG0096 71.2 3 + 3 T1c 6.1 1 2354.53 112.19 10526 336.77 CPCG0097 75.1 3 + 3 T1c 13.7 2 3186.24 114.53 15025 437.56 CPCG0098 80.7 4 + 3 T1c 7.5 4 3141.66 92.39 19866.5 675.49 CPCG0099 66.2 3 + 4 T2c 6.96 0 3088.28 123.68 20339.1 619.84 CPCG0100 55.3 4 + 5 T2c 5.56 2 1592.37 65.62 11999.8 325.79 CPCG0102 58.1 4 + 3 T3b 8.65 1 3756.32 117.24 19274.1 553.3 CPCG0103 65 3 + 4 T3b 5.2 2 3051.27 95.84 27103.1 669.18 CPCG0114 67.7 4 + 3 T2b 4.4 4 13818.6 425.97 3370.65 95.95 CPCG0117 71.3 3 + 4 T2a 10.1 1 2116.03 93.89 17318.3 1057.43 CPCG0120 73.1 4 + 5 T2a 14.79 1 4556 79.41 17038.8 1040.35 CPCG0121 63.5 3 + 4 T1c 7.2 0 1819.09 81.46 16843.6 507.7 CPCG0122 65.6 3 + 3 T1c 6.4 0 1587.25 73.44 26709.7 655.79 CPCG0123 70.7 3 + 4 T2a 8.8 1 2153.44 93.95 14680.6 408.31 CPCG0124 72 4 + 3 T2a 7.2 2 1693.03 103.91 16616.7 471.18 CPCG0126 70 3 + 3 T2a 6.1 0 2146.19 112.82 16857.3 511.86 CPCG0127 54.4 3 + 4 T2a 29.9 1 1410.98 82.03 22778.4 687.22 CPCG0128 70.2 3 + 4 T1c 30.3 2 1895.38 94.61 19629.6 527.03 CPCG0154 55.4 3 + 3 T2a 13.8 0 1661.73 94.48 12384.6 411.8 CPCG0158 70.3 3 + 4 T1c 10 1 1543.38 107.49 9261.13 444.37 CPCG0166 74 3 + 4 T2a 6.8 5 2756.4 101.74 15269.5 449.28 CPCG0182 57 4 + 3 T2c 7.64 0 2366.95 101.87 14861.1 429.06 CPCG0183 64.3 4 + 3 T3a 5.67 2 2002.32 89.43 24135.9 654.71 CPCG0184 51.8 4 + 3 T3a 5.53 0 2836.72 106.41 20155.2 504.67 CPCG0185 60 3 + 4 T3a 4.49 1 1921.47 79.18 15534.6 452.91 CPCG0187 72.4 4 + 4 T1c 13 1 2078.85 119.32 22991.9 828.01 CPCG0188 59 4 + 5 T2c 7.23 0 2202.35 89.99 25035.8 638.01 CPCG0189 57.4 3 + 4 T2b 6.52 5 2523.89 102.02 26654.4 775.6 CPCG0190 74.1 3 + 4 T3a 4.3 1 3002.16 117.98 23557.5 623.93 CPCG0191 60.7 4 + 3 T3a 11.1 0 1834.4 94.75 21490.7 646.17 CPCG0194 69.8 3 + 4 T1c 8.7 0 1901.55 196.32 7805.15 255.37 CPCG0196 52.5 4 + 3 T3b 4.88 2 3327.15 151.6 12536 343.95 CPCG0198 60.7 3 + 4 T2a 5.2 1 3099.65 146.67 29684.5 829.49 CPCG0199 74.2 4 + 3 T2a 6.3 0 2826.11 107.59 21647.3 676.99 CPCG0201 63.4 4 + 3 T1c 1.6 2 3002.98 97.47 39114.2 1120.3 CPCG0204 75.7 3 + 4 T1b 9.7 3 3464.6 105.94 10867.3 270.65 CPCG0205 65 3 + 4 T2a 20.4 1 1544.7 101.98 17086.3 532.21 CPCG0206 66.9 4 + 3 T1c 8 1 2110.22 103.11 19211.1 687.44 CPCG0208 60.4 3 + 4 T2c 5.7 0 2030.64 102.22 27846.3 833.35 CPCG0210 51.4 4 + 3 T2c 3.51 0 2301.46 125.14 13751.7 428.21 CPCG0211 75.2 3 + 4 T2a 4.5 3 1966.24 89.91 20019.9 601.45 CPCG0212 71.2 3 + 4 T1c 7 1 1851.09 99.03 9954.72 600.39 CPCG0213 67.2 3 + 4 T2a 9.3 3 2302.15 113.57 11806.2 356.88 CPCG0217 61.5 3 + 3 T3b 6.5 3 2862.32 126.84 22997.4 613.9 CPCG0232 71.6 3 + 4 T3a 8.15 1 1888.72 96.56 16843.7 497.16 CPCG0233 70.3 4 + 3 T3a 4.63 2 2754.55 124.79 31553 914.29 CPCG0234 70.1 3 + 4 T1c 5.7 2 2178.87 107.66 12593.3 446.63 CPCG0235 59.2 4 + 4 T3a 8.04 0 3220.53 123.34 37607.4 1206.8 CPCG0236 59.1 4 + 3 T3a 10.92 1 2509.78 114.9 30744.4 900.49 CPCG0237 60.4 3 + 3 T2a 10.7 1 1916.74 100.66 21603.4 479.47 CPCG0238 55.6 3 + 4 T3a 7.92 0 2171.64 86.06 14799.9 386.3 CPCG0241 66.6 3 + 4 T3a 5.64 0 1392.4 81.71 19837 522.61 CPCG0242 56 4 + 3 T3a 4 3 2229.79 104.54 21398 618.51 CPCG0243 63.7 3 + 3 T2b 13.6 0 2108.3 101.41 27303.7 705.69 CPCG0246 60.6 3 + 3 T2c 5.64 0 3078.8 106.59 21908.6 586.08 CPCG0248 54.2 3 + 4 T3a 5.1 1 2177.55 87.09 13487.4 357.01 CPCG0249 66.1 3 + 4 T3b 7.1 2 1341.68 70.87 23315.6 637.4 CPCG0250 62 3 + 3 T2c 4.23 1 2919.61 104.25 14478.6 435.33 CPCG0251 52.1 3 + 4 T2c 13.41 1 2438.75 116.04 26111.1 713.14 CPCG0255 72 3 + 3 T2c 6.9 0 1692.11 105.24 47617 1404.64 CPCG0256 63.9 3 + 4 T3a 7.32 3 2237.41 94.99 18998.2 574.56 CPCG0257 75.3 3 + 3 T2a 8 0 1875.56 96.61 30453.9 801.83 CPCG0258 49.2 3 + 3 T2c 5.13 0 2816.13 137.62 27975 645.84 CPCG0259 55.9 3 + 3 T3a 11.65 1 2343.37 112.81 25185.2 787.31 CPCG0260 65.3 4 + 3 T2b 6.59 0 2215.3 114.94 16393.6 439.11 CPCG0262 63 3 + 4 T2c 5.7 2 1748.24 96.8 22867 665.8 CPCG0263 66.4 3 + 3 T2a 13.9 1 2153.77 90.92 14025.9 376.94 CPCG0265 63.2 3 + 3 T3a 9.34 1 2865.36 125.95 24767.3 746.34 CPCG0266 66.1 3 + 4 T2c 1.74 1 1989.51 109.53 12392.6 357.7 CPCG0267 44.5 3 + 4 T2c 17.1 1 2632.29 102.84 12520.1 321.02 CPCG0268 59.3 3 + 3 T3a 12.35 1 1783.77 89.65 20844.9 632.34 CPCG0269 68.3 3 + 3 T2c 13.21 4 1862.44 75.85 20396.5 578.59 CPCG0324 64.7 3 + 4 T3a 12.1 2 1627.2 96.53 15641.5 461.67 CPCG0331 69.9 3 + 4 T3a 11.08 3 2214.28 118.64 22194.1 685.07 CPCG0334 53.7 3 + 4 T3a 7.41 0 2205.65 120.17 17649.3 526.22 CPCG0336 60.9 3 + 3 T3a 9.08 1 2531.23 122.84 22760.1 619.98 CPCG0339 57.7 3 + 4 T3a 14.29 2 2439.27 109.25 21027.2 575.8 CPCG0340 62 3 + 4 T2c 4.41 2 3925.02 145.3 28167.6 940.05 CPCG0341 56.8 4 + 3 T2c 11.3 0 1780 96.57 13179.1 450.01 CPCG0342 52.2 4 + 3 T3a 6.3 1 2051.9 102.5 42684.1 1317.94 CPCG0344 60.9 3 + 3 T2c 5.5 1 2169.22 107.1 21245.2 644.68 CPCG0345 60.4 3 + 4 T3b 6.6 1 2076.81 85.49 23445.5 669.58 CPCG0346 59.7 3 + 4 T3a 6.5 2 3160.71 122.58 17265.9 361.98 CPCG0348 57 3 + 4 T3a 4.22 0 2469.37 105.23 19175.6 627.9 CPCG0349 61.8 4 + 4 T2c 7.1 1 3936.14 141.05 29956.4 876.02 CPCG0350 53.2 4 + 3 T3b 39.47 1 3186.42 175.12 16436.5 553.25 CPCG0352 55.5 4 + 3 T2c 9.1 2 4267.8 210.29 21746 629.93 CPCG0353 65.6 3 + 4 T3b 9 0 5165.99 171.98 15483 445.09 CPCG0354 61.4 3 + 4 T2c 6.7 0 10612.5 369.9 15967.2 479.46 CPCG0355 55.5 3 + 3 T2c 6.7 2 10942.8 413.22 24203.7 722.52 CPCG0356 51.6 4 + 3 T2c 8.49 3 5522.17 183.24 24184.8 758.82 CPCG0357 59.1 3 + 4 T2c 3.11 0 2936.46 144.62 13756 432.86 CPCG0358 68.8 3 + 4 T2a 5.88 1 11783.1 558.8 19095.4 640.92 CPCG0360 66.2 3 + 4 T3b 14 0 2459.98 102.12 20880.2 626.95 CPCG0361 70.1 3 + 4 T3a 4.6 1 4085.15 171.45 23547.5 424.85 CPCG0362 57.6 3 + 4 T3b 8.77 0 5073.01 232.26 16830.4 543.17 CPCG0363 56.6 3 + 4 T2c 4.27 0 3803.3 134.64 22238.6 676.72 CPCG0364 63.2 3 + 3 T3a 8.11 0 2119.11 90.51 32021.9 585.73 CPCG0365 71.7 3 + 3 T2c 4.23 0 2595.34 108 20792.3 560.3 CPCG0366 60.5 3 + 4 T3a 15 0 2832.85 118.99 10542.6 284.93 CPCG0368 63.7 3 + 3 T2c 4.39 1 3212.27 136.26 26323.3 795.63 CPCG0369 63.7 3 + 4 T3a 7.18 0 4818.33 216.57 21784.1 636.84 CPCG0371 60.7 3 + 4 T3a 7.52 0 6744.86 304.1 15628.5 492.43 CPCG0372 60.2 3 + 4 T2c 4 1 3635.5 178.11 22791.2 726.25 CPCG0373 59.8 3 + 4 T2c 4.9 0 6165.27 290.47 15628.5 478.66 CPCG0374 63.6 3 + 3 T2c 4.7 1 5552.69 251.7 30129 839.05 CPCG0375 70.2 3 + 3 T2c 7.01 0 5556.59 228.69 30332 1023.21 CPCG0377 76.9 4 + 4 T2c 6.9 1 5674.91 238.24 24080.1 701.87 CPCG0378 69.1 3 + 4 T3b 8.7 1 6663.66 277.53 25862.6 756.27 CPCG0379 68.6 3 + 4 T3a 14.6 1 3991.82 194.66 16985.8 471.18 CPCG0380 58.1 3 + 4 T2c 6.29 1 3479.34 177.05 23339.2 716.88 CPCG0381 64.9 3 + 4 T2c 5.76 0 4173.25 180.55 18670.6 576.26 CPCG0382 71.1 4 + 4 T2c 6.8 0 3774.09 157.43 35627.8 1141.52 CPCG0387 67.1 4 + 3 T2c 4.52 2 6376.56 286.84 18213.4 529.95 CPCG0388 54.5 3 + 4 T3a 2.5 1 2485.18 106.06 22595.6 707.36 CPCG0391 60.8 3 + 3 T2c 5.3 0 6416.64 265.25 17324.3 438.19 CPCG0392 61.4 3 + 4 T3b 19.5 0 1868.71 87.57 18631.4 511.01 CPCG0401 58.1 3 + 4 T2c 3.6 0 4357.69 191.91 17145.6 532.82 CPCG0404 56.2 3 + 4 T2c 3.6 1 5948.57 243.78 40464.9 1098.8 CPCG0407 57.9 3 + 4 T2a 11.5 2 3378.68 206.76 17177.2 477.4 CPCG0408 67.9 4 + 4 T2c 3.47 0 6495.59 276.71 22309.9 641.83 CPCG0409 59.1 3 + 4 T3a 6.3 1 2922.04 173.92 28278 742.69 CPCG0410 62 3 + 4 T2c 5 3 5203.82 217.73 26133.8 741.72 CPCG0411 45.7 4 + 3 T2c 10.55 0 4019.65 163.77 14003 424.03 CPCG0412 58.7 4 + 3 T2a 3.36 3 2780.6 164.49 15645.1 479.17 CPCG0413 59.1 3 + 4 T2c 6.89 0 3915.74 186.91 21079.7 737.96 CPCG0414 43.8 4 + 3 T2c 5.4 0 3877.37 172.59 15891.4 508.01 Weischen- 46 3 + 4 T2c 6 2 3077.42 136 8577.51 368.3 feldt- EOPC- 010 Weischen- 48 3 + 4 T2c 4.8 0 1839.24 123 4632.61 299.45 feldt- EOPC- 011 Weischen- 51 3 + 4 T2c 23.8 0 3352.84 200.42 5115.26 370.21 feldt- EOPC-02 Weischen- 46 5 + 4 T3a 12 1 3258.08 237.37 17967.1 528.61 feldt- EOPC-03 Weischen- 51 4 + 3 T3b 72 2 5386.42 163.11 6291.77 427.88 feldt- EOPC-04 Weischen- 50 3 + 4 T3a 5 1 1840.62 119.72 4111.36 258.28 feldt- EOPC-05 Weischen- 38 3 + 4 T3b 18.2 0 2104.12 103.53 4020.19 193.78 feldt- EOPC-06 Weischen- 49 3 + 4 T2c 5.4 4 1995.09 130.76 5886.36 375.09 feldt- EOPC-07 Weischen- 44 3 + 4 T2c 7.8 0 3107.47 196.85 7331.15 347.3 feldt- EOPC-08 Weischen- 48 3 + 4 T2c 5.1 0 4594.3 228.69 6755.4 408.36 feldt- EOPC-09 ICGC_PC 45 3 + 4 T3a 30 0 2827.22 128.51 9654.26 459.73 A001 ICGC_PC 48 3 + 4 T2c 4.8 0 1901.03 126.74 4799.33 309.63 A012 ICGC_PC 45 3 + 4 T2c NA 1 4499.82 243.23 17577.1 491.46 A013 ICGC_PC 45 3 + 4 T2a NA 0 3804.42 234.55 11582.8 254.76 A014 ICGC_PC 48 3 + 4 T3b NA 1 4139.76 232.51 7798.35 183.08 A015 ICGC_PC 44 3 + 4 T2a NA 0 3967.64 227.96 7782.91 217.1 A016 ICGC_PC 48 3 + 4 T2c 13.2 0 4965.55 264.69 4464.28 233.37 A017 ICGC_PC 49 3 + 3 T2c 4.6 0 7169.97 300.19 3978.88 198.99 A018 ICGC_PC 46 3 + 4 T2c 6.74 0 4594.35 256.45 4238.89 224.99 A019 ICGC_PC 49 3 + 3 T3a NA 0 2643.11 166.23 11609.6 317.25 A020 ICGC_PC 45 3 + 4 T2c 5.35 0 4498.3 208.64 4629.81 208.88 A021 ICGC_PC 49 3 + 4 T2c 5.88 0 5958.51 222.46 4028.03 195.82 A022 ICGC_PC 50 3 + 4 T2c 2.56 1 7928.37 330.28 10306.4 373.49 A023 ICGC_PC 43 3 + 4 T2c 11.7 0 2382.34 115.03 4937.3 219.63 A024 ICGC_PC 47 3 + 4 T2c 9.79 0 1837.06 111.03 4018.61 211.56 A025 ICGC_PC 48 3 + 3 T2c 3.8 1 2183.34 127.53 5286.37 267.53 A026 ICGC_PC 49 3 + 4 T2c NA 0 3878.45 187.36 4240.61 224.61 A027 ICGC_PC 40 3 + 4 T2c NA 0 4063.62 213.65 4881.5 229.56 A028 ICGC_PC 48 4 + 3 T3b 15.5 3 4670.4 178.6 5589.59 213.38 A029 ICGC_PC 48 4 + 3 T3b 62.4 0 4655.41 178.99 9524.12 361.17 A030 ICGC_PC 48 3 + 4 T2c 22.5 1 5953.36 222.93 6554.49 230.1 A031 ICGC_PC 44 3 + 4 T2a 4.23 5 3258.41 177.67 3955.93 NA A032 ICGC_PC 43 3 + 4 T2c 5 0 2815.95 163.29 4980.66 NA A033 ICGC_PC 46 3 + 4 T2c 5.27 0 2350.99 119.31 6313.81 278.94 A034 ICGC_PC 49 4 + 3 T3b 70.43 0 4548.29 245.85 13510.3 773.12 A035 ICGC_PC 57 3 + 4 T3a 6.52 2 4422.45 175.49 9231.92 362.04 A036 ICGC_PC 50 3 + 4 T3a 6.98 0 3709.63 NA 15562.3 884.22 A037 ICGC_PC 49 3 + 4 T2c 3.99 0 6205.3 250.06 5214.15 244.34 A038 ICGC_PC 50 3 + 3 T2 6.13 0 6296.73 263.24 5967.76 246.35 A040 ICGC_PC 48 5 + 4 T4 58 1 4421.8 231.63 3387.42 149.19 A041 ICGC_PC 47 4 + 5 NA NA 0 2911.35 169.46 8698.75 373.5 A043 ICGC_PC 48 4 + 3 T2c 12 0 4142.43 244.97 9927.41 377.83 A044 ICGC_PC 47 3 + 4 T2c 7.65 0 4123.21 245.79 8784.67 374.29 A045 ICGC_PC 49 3 + 4 T2c 9.36 0 3982.15 229.12 6158.4 185.33 A046 ICGC_PC 50 3 + 3 T2a 8.2 1 5147.5 253.07 5545.16 212.13 A048 ICGC_PC 48 3 + 3 T2c 6.09 0 5441.71 196.27 7249.09 272.27 A049 ICGC_PC 48 3 + 4 T2c NA 0 3497.67 145.98 6475.02 261.19 A050 ICGC_PC 41 3 + 4 T2c NA 1 2606.4 108.46 5413.56 230.22 A051 ICGC_PC 40 3 + 4 T2c NA 0 6947.3 264.31 5799.31 233.8 A052 ICGC_PC 48 4 + 3 T2c 9.9 0 6203.75 230.88 6614 259.63 A053 ICGC_PC 50 3 + 4 T2c 6.4 0 4053.86 213.7 5865.11 232.88 A054 ICGC_PC 48 3 + 4 T2c 6.15 0 4154.49 242.1 6373.99 292.45 A055 ICGC_PC 47 3 + 4 T2c NA 0 4748.29 193.29 6807.71 319.99 A056 ICGC_PC 50 3 + 4 T2c 5.07 1 4296.18 220.09 6351.99 288.2 A057 ICGC_PC 47 3 + 4 T2c 5.4 0 4131.73 204.29 7484.18 298.12 A058 ICGC_PC 47 3 + 4 T2c 14.1 0 2733.23 113.62 5098.51 228.84 A059 ICGC_PC 41 3 + 3 T2c 5.74 1 7267.63 285.01 9625.05 360.89 A060 ICGC_PC 47 3 + 4 T2a 6.47 0 6088.55 256.58 5563.43 213.36 A061 ICGC_PC 45 3 + 4 T2c 8.21 0 5973.57 232.62 10047.6 405.8 A062 ICGC_PC 46 3 + 4 T2c 13 0 3077.46 177.38 8342.93 352.02 A063 ICGC_PC 47 3 + 3 T2a 5.3 0 6441.14 398.83 10255.3 420.64 A064 ICGC_PC 48 3 + 4 T2c 8.9 2 1325.05 75.46 11750 619.56 A065 ICGC_PC 50 3 + 4 T2c 12.9 1 5040.31 276.33 5742.06 236.93 A068 ICGC_PC 50 4 + 3 T3a 6.45 0 2451.17 143.26 5556.66 262.17 A069 ICGC_PC 47 3 + 4 T2c 5.2 1 3953.56 231.81 5395.4 260.33 A070 ICGC_PC 49 4 + 3 T2c 24.5 1 3776.54 223.33 6539.71 301.58 A071 ICGC_PC 49 3 + 4 T2c 11 0 4492.12 269.55 6647.67 314.24 A072 ICGC_PC 42 3 + 4 T2c 5.7 0 3321.15 251.03 5395.89 300.36 A074 ICGC_PC 40 3 + 3 T2a 5.4 2 5151.89 266.66 5965.86 338.87 A075 ICGC_PC 49 3 + 4 T2c NA 0 3491.55 192.11 3316.82 213.37 A076 ICGC_PC 44 4 + 3 T2a 5.48 0 7752.06 405.76 8308.19 337.25 A077 ICGC_PC 47 3 + 4 T2c 16 0 4355.82 237.7 3346.03 133.55 A078 ICGC_PC 46 3 + 4 T2c 6.3 0 6685.66 343.82 2601.73 105.83 A079 ICGC_PC 50 4 + 5 T3b 13 1 2714.44 116.32 4814.68 183.35 A081 ICGC_PC 41 5 + 4 T3b 7.5 0 6940.57 290.7 5926.09 232.03 A082 ICGC_PC 45 3 + 4 T2c 16 1 11499.2 500.95 3934.47 165.31 A083 ICGC_PC 45 5 + 4 T3b NA 0 5001.32 177.57 5497.65 205.17 A084 ICGC_PC 47 3 + 4 T2c NA 0 3163.24 117.88 5796.65 222.73 A085 ICGC_PC 50 4 + 3 T3b NA 1 2093.52 79.68 7527.37 284.86 A086 ICGC_PC 45 3 + 3 T2c NA 0 4426.2 173.41 6051.99 237.24 A087 ICGC_PC 43 3 + 3 T2c NA 0 4838.29 172.92 4928.1 189.51 A088 ICGC_PC 48 3 + 4 T2c NA 0 3071.35 125.49 5624.6 219.75 A089 ICGC_PC 40 3 + 4 T2c NA 0 3773.1 133.25 7026.47 285.17 A090 ICGC_PC 50 3 + 4 T2c NA 1 7940.39 357.03 6353.35 326.23 A091 ICGC_PC 45 3 + 4 T2c NA 0 1580.49 110.87 4981.62 249.77 A094 ICGC_PC 50 3 + 3 T2c NA 1 2460.92 179.24 5146.51 196.13 A095 ICGC_PC 49 3 + 3 T2a NA 0 2575.05 190.82 6107.44 232.27 A096 ICGC_PC 48 3 + 3 T2a 8.5 1 3853.91 280.28 8780.53 391.46 A097 ICGC_PC 45 4 + 5 T3a NA 3 4548.38 376.83 6023.84 308.36 A098 ICGC_PC 48 3 + 3 T2c NA 0 3897.72 304.27 6101.24 299.3 A102 ICGC_PC 48 3 + 3 T2c NA 1 3976.32 300.1 7233.16 338.95 A103 ICGC_PC 44 3 + 4 T2a NA 0 3427.5 247.03 5674.02 243.73 A104 ICGC_PC 49 3 + 4 T2c NA 0 4097.07 175.58 7762.64 289.33 A105 ICGC_PC 43 3 + 4 T2c NA 0 8923.14 375 5921.86 250.34 A106 ICGC_PC 47 3 + 3 T2c NA 0 4825.85 196.81 6644.75 252.32 A107 ICGC_PC 50 3 + 4 T3a NA 0 6116.57 213.75 8639.65 317.23 A108 ICGC_PC 48 3 + 3 T2c NA 0 5878.11 243.55 4948.4 329.78 A110 ICGC_PC 43 3 + 4 T2c NA 0 7863.32 459.98 7416.78 309.48 A111 ICGC_PC 47 4 + 3 T3b NA 0 2980.66 168.21 5585.02 262.95 A112 ICGC_PC 48 4 + 5 T3b NA 0 2915.6 229.57 4126.11 223.7 A113 ICGC_PC 46 3 + 4 T3a NA 0 4955.88 254.74 7505.96 283.24 A116 ICGC_PC 50 3 + 3 T2c NA 1 3994.34 192.73 8046.52 337.81 A118 ICGC_PC 44 3 + 4 T2c NA 0 5487.62 190.05 7985.31 261.26 A121 ICGC_PC 50 4 + 3 T3b NA 1 4089.29 139.16 16881.6 274.74 A122 ICGC_PC 46 3 + 4 T3a NA 1 6229.33 201.83 23838.9 390.26 A123 ICGC_PC 46 3 + 4 T3a NA 0 3088.17 103.27 18666.6 289.76 A124 ICGC_PC 44 5 + 4 T4 NA 3 6218.51 206.29 37206.4 513.19 A125 ICGC_PC 47 4 + 3 T3b NA 0 4562.1 264.16 18594.5 589.83 A126 ICGC_PC 49 3 + 4 T2c NA 0 3722.96 213.53 9790.9 314.37 A127 ICGC_PC 49 4 + 5 T2c NA 0 4966.04 279.15 13371.3 395.19 A129 ICGC_PC 46 3 + 4 T3a NA 0 1157.65 64.66 10770.6 318.28 A130 ICGC_PC 50 3 + 4 T2c NA 0 3322.29 180.76 9669.45 304.17 A131 ICGC_PC 48 3 + 4 T3b NA 0 2513.39 153.77 8557.46 261.06 A132 ICGC_PC 49 3 + 3 T2c NA 0 4382.32 287.84 11193.9 325.5 A133 ICGC_PC 48 3 + 4 T2c NA 0 3757.47 228.28 6793.07 225.09 A134 ICGC_PC 47 3 + 4 T2c NA 0 3768.45 222.46 13255.5 269.37 A135 ICGC_PC 47 3 + 4 T2c NA 0 2273.13 136.73 7783.32 234.65 A136 ICGC_PC 49 3 + 4 T2c NA 0 2698.04 168.42 9615.6 308.54 A137 ICGC_PC 48 3 + 4 T2c NA 0 2118.75 133.68 4218.26 91.54 A138 ICGC_PC 45 3 + 3 T2c NA 1 5669.67 169.93 8477.17 179.01 A140 ICGC_PC 49 3 + 4 T2c NA 0 3703.42 235.29 3519.06 75.73 A141 ICGC_PC 46 5 + 4 T4 NA 1 6249.11 397.65 14694.7 479.36 A142 ICGC_PC 48 3 + 4 T3a NA 0 4739.26 144.27 10439.3 324.05 A143 ICGC_PC 46 3 + 4 T2c NA 0 9066.31 138.77 6515.96 203.56 A144 ICGC_PC 32 3 + 3 T2a NA 0 2457.97 155.08 6448.05 207.27 A145 ICGC_PC 46 3 + 4 T3a NA 0 2547.86 139.34 7361.85 134.86 A148 ICGC_PC 45 4 + 3 T2c NA 0 2529.97 148.52 7028.07 222.41 A149 ICGC_PC 40 3 + 3 T2c NA 0 3151.92 193.85 8846 287.53 A150 ICGC_PC 49 3 + 4 T3a NA 0 2056.8 131.17 6984.15 214.76 A151 ICGC_PC 45 3 + 4 T2c NA 0 4032.42 251.71 9519.33 318 A152 ICGC_PC 50 3 + 4 T2c NA 0 2467.2 149.3 9858.98 310.71 A153 ICGC_PC 48 3 + 4 T2c NA 0 2957.33 171.59 9626.51 308.59 A154 ICGC_PC 45 3 + 4 T2a NA 1 917.007 53.64 9799.51 306.62 A155 ICGC_PC 45 3 + 4 T2c NA 1 4236.17 251.78 10226.1 408.15 A156 ICGC_PC 44 3 + 3 T2a NA 0 3006.29 197.59 9086.25 313.43 A157 ICGC_PC 45 4 + 3 T3a NA 0 4184.84 226.94 9004.93 281.4 A158 ICGC_PC 44 4 + 3 T2c NA 0 4889.47 341.56 10928.6 327.3 A159 ICGC_PC 50 4 + 3 T2c NA 0 2034.2 133.7 12007.2 363.41 A160 ICGC_PC 48 4 + 5 T3b NA 2 1916.61 124.46 5272.41 182.18 A161 ICGC_PC 50 3 + 4 T2c NA 0 3516.02 220.23 7845.21 239.88 A162 ICGC_PC 45 3 + 4 T2c NA 1 3013.52 175.46 8769.99 268.11 A163 ICGC_PC 50 3 + 4 T3a NA 0 4510.1 265.14 5838.26 354.37 A164 ICGC_PC 48 3 + 4 T2c NA 0 2058.3 125.77 12277.9 379.59 A165 ICGC_PC 47 4 + 3 T2a NA 2 2459.89 154.71 6601.8 206.31 A166 ICGC_PC 43 3 + 4 T2c NA 0 3481.01 216.01 11925.1 357.9 A167 ICGC_PC 50 3 + 4 T2a NA 1 4869.54 314.27 12045.6 279.19 A168 ICGC_PC 46 3 + 4 T3a NA 2 5858.35 390.95 17049.7 470.86 A169 ICGC_PC 51 4 + 3 T2c NA 2 3144.62 246.06 17963.1 324.48 A170 ICGC_PC 50 3 + 4 T2c NA 1 5702.95 322.93 12983.8 353.49 A171 ICGC_PC 43 3 + 3 T2c NA 0 6141.82 341.59 6015.86 166 A172 ICGC_PC 46 3 + 4 T2c NA 0 6063 355.91 17240.8 463.59 A173 ICGC_PC 51 3 + 4 T3b NA 1 4700.36 278.37 9175.36 260.85 A174 ICGC_PC 48 4 + 3 T3a NA 0 3023.26 179.85 8788.83 257.43 A175 ICGC_PC 47 5 + 5 T4 NA 0 5185.27 302.08 4916.06 139.5 A176 ICGC_PC 46 3 + 4 T3a NA 0 1713.44 98.87 6854.12 210.6 A177 ICGC_PC 51 3 + 3 T2a NA 0 1792.49 105.66 8523.97 279.43 A178 ICGC_PC 45 3 + 4 T2c NA 0 4142.21 236.83 9055.59 271.86 A179 ICGC_PC 51 3 + 4 T2c NA 2 2446.26 139.43 12616 389.92 A180 ICGC_PC 51 3 + 4 T2c NA 0 9884.16 557.48 7422.03 250.36 A181 ICGC_PC 51 3 + 4 T2c NA 1 3777.99 213.81 13779.1 421.64 A182 ICGC_PC 52 3 + 4 T3a NA 1 2994.8 167.45 5766.19 151.34 A183 ICGC_PC 51 3 + 4 T2c NA 2 4889.25 277.56 8793.69 249.22 A184 ICGC_PC 51 3 + 3 T2c NA 1 6046.69 350.23 10357 285.87 A185 ICGC_PC 51 3 + 4 T2c NA 0 8935.55 150.08 16333.1 498.49 A186 ICGC_PC 46 3 + 3 T2c NA 1 24761.9 420.19 8581.43 266.01 A187 ICGC_PC 48 3 + 4 T2c NA 0 6424.8 115.1 3947.88 116.18 A188 ICGC_PC 51 3 + 4 T2c NA 0 11625.9 211 9484.56 293.64 A189 ICGC_PC 51 4 + 3 T2c NA 0 10871.4 206.33 5180.94 169.2 A190 ICGC_PC 51 3 + 4 T2c NA 0 2626.94 150.24 7651.09 232.7 A191 ICGC_PC 52 4 + 4 T3b NA 1 3697.6 215.29 5591.91 171.06 A192 ICGC_PC 52 5 + 4 T3b NA 3 4695.07 262 8394.14 253.71 A193 ICGC_PC 52 3 + 4 T2c NA 0 5640.21 314.13 16449.8 482.61 A194 ICGC_PC 47 3 + 3 T2c NA 0 1946.43 109.94 6144.92 178.42 A195 ICGC_PC 52 4 + 5 T3b NA 1 2681.47 146.21 4994.05 137.48 A196 ICGC_PC 50 3 + 4 T3a NA 1 3413.79 183.69 10603.2 309.85 A197 ICGC_PC 52 4 + 5 T3b NA 2 3070.23 172.58 10961.7 304.15 A198 ICGC_PC 51 3 + 4 T2c NA 0 2438.98 141.68 13931.1 265.61 A199 ICGC_PC 47 3 + 4 T2c NA 0 2912.99 178.33 25583.2 277.99 A200 TCGA-CH- 72 3 + 4 T2c 13.2 2 4645.1 256.1 8771.03 332.78 5750 TCGA-CH- 66 3 + 4 T3a 14.8 0 4837.75 275.63 9349.95 321.39 5763 TCGA-CH- 63 4 + 3 T2c 8.1 0 4387.57 267.28 6988.53 222.02 5771 TCGA-CH- 69 4 + 3 T3b 19.4 1 5554.92 288.62 21678.6 606.25 5788 TCGA-CH- 61 3 + 4 T3a 5.7 0 7282.33 418.19 8021.94 306.89 5789 TCGA-EJ- 50 5 + 3 T3a 18.4 0 5531.64 289.41 7616.2 237.24 5503 TCGA-EJ- 67 5 + 3 T3b 7.2 2 4952.82 291.73 8754.14 336.74 5506 TCGA-EJ- 67 3 + 4 T2c 4.5 0 2665.12 159.65 7271.3 244.69 7791 TCGA-G9- 57 3 + 4 NA 10.6 2 2003.55 105.24 9463.51 334.99 6336 TCGA-G9- 71 3 + 4 T4 11.6 0 2230.56 107.99 9664.85 342.25 6365 TCGA-G9- 52 3 + 4 T3b 6.4 0 2373.22 120.83 8885.26 304.54 6370 TCGA-G9- 49 3 + 4 T2c 6.8 0 1974.77 115.85 5812.83 211.12 7522 TCGA-HC- 63 3 + 3 T2a 5.1 1 2362.13 136.21 8765.79 285.05 7075 TCGA-HC- 51 3 + 4 T3a 5.5 0 2660.98 143.62 4529.49 170.1 7079 TCGA-HC- 73 4 + 3 T2a 7.7 0 2402.06 119.2 6346.51 214.41 7233 TCGA-HC- 55 3 + 4 T2c 18.1 0 3231.25 180.11 7132.52 264.64 7737 TCGA-HC- 59 3 + 4 T2c 5.9 0 2747.27 170.09 6201.89 241.73 7740 TCGA-HC- 46 4 + 3 T3b 4.4 0 3770.56 211 9518.19 327.16 7744 TCGA-HC- 56 3 + 3 T2c 4.3 0 2585.8 143.5 9352.13 272.82 8258 TCGA-HI- 55 3 + 4 T3a 2.2 0 1802.28 99.46 8035.46 278.59 7169 mtSNVs/ MT- Mb DLOOP Baca-P03-1426 0.14 0 Baca-P05-1657 0.132 0 Baca-PR-05-3595 0.319 1 Baca-P05-3852 0.25 0 Baca-PR-06-1749 0.111 0 Baca-PR-06-3199 0.188 1 Baca-PR-07-4610 0.333 1 Baca-P07-4941 0.261 0 Baca-P07-5037 0 0 Baca-PR-08-4154 0.187 0 Baca-P08-716 0 0 Baca-P09-37 0.156 0 Baca-PR-0410 0 0 Baca-PR-STID0000002872 0.133 0 Berger-PR-0508 0.301 0 Berger-PR-0581 0 0 Berger-PR-1701 0 0 Berger-PR-1783 0 0 Berger-PR-2832 0 0 Berger-PR-3027 0.192 0 Berger-PR-3043 0.233 0 CPCG0001 0.113 1 CPCG0003 0.107 0 CPCG0004 0 0 CPCG0005 0.141 0 CPCG0006 0 0 CPCG0007 0 0 CPCG0008 0 0 CPCG0015 0 0 CPCG0019 0.256 0 CPCG0020 0.134 0 CPCG0022 0 0 CPCG0027 0.223 0 CPCG0030 0.277 0 CPCG0036 0 0 CPCG0040 0.47 1 CPCG0042 0 0 CPCG0046 0.296 1 CPCG0047 0 0 CPCG0048 0 0 CPCG0050 0.065 0 CPCG0057 0.223 0 CPCG0063 0.224 0 CPCG0067 0.192 0 CPCG0070 0.172 1 CPCG0071 0.297 0 CPCG0072 0.107 0 CPCG0073 0.241 1 CPCG0075 0 0 CPCG0076 0.114 0 CPCG0078 0.208 1 CPCG0081 0.117 1 CPCG0082 0.137 0 CPCG0083 0.126 0 CPCG0084 0.108 1 CPCG0087 0 0 CPCG0089 0.104 0 CPCG0090 0.201 0 CPCG0094 0 0 CPCG0095 0.212 0 CPCG0096 0.179 0 CPCG0097 0.276 1 CPCG0098 0.357 1 CPCG0099 0 0 CPCG0100 0.371 1 CPCG0102 0.109 0 CPCG0103 0.18 0 CPCG0114 2.517 1 CPCG0117 0.057 0 CPCG0120 0.058 0 CPCG0121 0 0 CPCG0122 0 0 CPCG0123 0.148 0 CPCG0124 0.256 0 CPCG0126 0 0 CPCG0127 0.088 0 CPCG0128 0.229 1 CPCG0154 0 0 CPCG0158 0.136 1 CPCG0166 0.672 1 CPCG0182 0 0 CPCG0183 0.184 1 CPCG0184 0 0 CPCG0185 0.133 0 CPCG0187 0.073 1 CPCG0188 0 0 CPCG0189 0.389 1 CPCG0190 0.097 0 CPCG0191 0 0 CPCG0194 0 0 CPCG0196 0.351 1 CPCG0198 0.073 1 CPCG0199 0 0 CPCG0201 0.108 0 CPCG0204 0.669 1 CPCG0205 0.113 1 CPCG0206 0.088 1 CPCG0208 0 0 CPCG0210 0 0 CPCG0211 0.301 0 CPCG0212 0.101 0 CPCG0213 0.507 0 CPCG0217 0.295 0 CPCG0232 0.121 0 CPCG0233 0.132 0 CPCG0234 0.27 0 CPCG0235 0 0 CPCG0236 0.067 0 CPCG0237 0.126 0 CPCG0238 0 0 CPCG0241 0 0 CPCG0242 0.293 1 CPCG0243 0 0 CPCG0246 0 0 CPCG0248 0.169 0 CPCG0249 0.189 0 CPCG0250 0.139 1 CPCG0251 0.085 0 CPCG0255 0 0 CPCG0256 0.315 1 CPCG0257 0 0 CPCG0258 0 0 CPCG0259 0.077 1 CPCG0260 0 0 CPCG0262 0.181 0 CPCG0263 0.16 1 CPCG0265 0.081 0 CPCG0266 0.169 0 CPCG0267 0.188 0 CPCG0268 0.095 0 CPCG0269 0.417 1 CPCG0324 0.262 0 CPCG0331 0.264 0 CPCG0334 0 0 CPCG0336 0.097 0 CPCG0339 0.21 0 CPCG0340 0.128 0 CPCG0341 0 0 CPCG0342 0.046 1 CPCG0344 0.094 1 CPCG0345 0.09 0 CPCG0346 0.334 0 CPCG0348 0 0 CPCG0349 0.069 0 CPCG0350 0.109 0 CPCG0352 0.192 1 CPCG0353 0 0 CPCG0354 0 0 CPCG0355 0.167 1 CPCG0356 0.239 0 CPCG0357 0 0 CPCG0358 0.094 0 CPCG0360 0 0 CPCG0361 0.142 0 CPCG0362 0 0 CPCG0363 0 0 CPCG0364 0 0 CPCG0365 0 0 CPCG0366 0 0 CPCG0368 0.076 1 CPCG0369 0 0 CPCG0371 0 0 CPCG0372 0.083 0 CPCG0373 0 0 CPCG0374 0.072 0 CPCG0375 0 0 CPCG0377 0.086 0 CPCG0378 0.08 0 CPCG0379 0.128 0 CPCG0380 0.084 0 CPCG0381 0 0 CPCG0382 0 0 CPCG0387 0.228 0 CPCG0388 0.085 0 CPCG0391 0 0 CPCG0392 0 0 CPCG0401 0 0 CPCG0404 0.055 1 CPCG0407 0.253 0 CPCG0408 0 0 CPCG0409 0.081 0 CPCG0410 0.244 0 CPCG0411 0 0 CPCG0412 0.378 0 CPCG0413 0 0 CPCG0414 0 0 Weischenfeldt-EOPC-010 0.328 0 Weischenfeldt-EOPC-011 0 0 Weischenfeldt-EOPC-02 0 0 Weischenfeldt-EOPC-03 0.114 0 Weischenfeldt-EOPC-04 0.282 1 Weischenfeldt-EOPC-05 0.234 1 Weischenfeldt-EOPC-06 0 0 Weischenfeldt-EOPC-07 0.644 0 Weischenfeldt-EOPC-08 0 0 Weischenfeldt-EOPC-09 0 0 ICGC_PC 0 0 A001 ICGC_PC 0 0 A012 ICGC_PC 0.123 0 A013 ICGC_PC 0 0 A014 ICGC_PC 0.33 1 A015 ICGC_PC 0 0 A016 ICGC_PC 0 0 A017 ICGC_PC 0 0 A018 ICGC_PC 0 0 A019 ICGC_PC 0 0 A020 ICGC_PC 0 0 A021 ICGC_PC 0 0 A022 ICGC_PC 0.162 0 A023 ICGC_PC 0 0 A024 ICGC_PC 0 0 A025 ICGC_PC 0.226 0 A026 ICGC_PC 0 0 A027 ICGC_PC 0 0 A028 ICGC_PC 0.849 0 A029 ICGC_PC 0 0 A030 ICGC_PC 0.262 1 A031 ICGC_PC NA 1 A032 ICGC_PC NA 0 A033 ICGC_PC 0 0 A034 ICGC_PC 0 0 A035 ICGC_PC 0.333 0 A036 ICGC_PC 0 0 A037 ICGC_PC 0 0 A038 ICGC_PC 0 0 A040 ICGC_PC 0.405 0 A041 ICGC_PC 0 0 A043 ICGC_PC 0 0 A044 ICGC_PC 0 0 A045 ICGC_PC 0 0 A046 ICGC_PC 0.285 0 A048 ICGC_PC 0 0 A049 ICGC_PC 0 0 A050 ICGC_PC 0.262 0 A051 ICGC_PC 0 0 A052 ICGC_PC 0 0 A053 ICGC_PC 0 0 A054 ICGC_PC 0 0 A055 ICGC_PC 0 0 A056 ICGC_PC 0.209 0 A057 ICGC_PC 0 0 A058 ICGC_PC 0 0 A059 ICGC_PC 0.167 0 A060 ICGC_PC 0 0 A061 ICGC_PC 0 0 A062 ICGC_PC 0 0 A063 ICGC_PC 0 0 A064 ICGC_PC 0.195 1 A065 ICGC_PC 0.255 0 A068 ICGC_PC 0 0 A069 ICGC_PC 0.232 0 A070 ICGC_PC 0.2 1 A071 ICGC_PC 0 0 A072 ICGC_PC 0 0 A074 ICGC_PC 0.356 0 A075 ICGC_PC 0 0 A076 ICGC_PC 0 0 A077 ICGC_PC 0 0 A078 ICGC_PC 0 0 A079 ICGC_PC 0.329 0 A081 ICGC_PC 0 0 A082 ICGC_PC 0.365 0 A083 ICGC_PC 0 0 A084 ICGC_PC 0 0 A085 ICGC_PC 0.212 0 A086 ICGC_PC 0 0 A087 ICGC_PC 0 0 A088 ICGC_PC 0 0 A089 ICGC_PC 0 0 A090 ICGC_PC 0.185 0 A091 ICGC_PC 0 0 A094 ICGC_PC 0.308 0 A095 ICGC_PC 0 0 A096 ICGC_PC 0.154 1 A097 ICGC_PC 0.587 1 A098 ICGC_PC 0 0 A102 ICGC_PC 0.178 0 A103 ICGC_PC 0 0 A104 ICGC_PC 0 0 A105 ICGC_PC 0 0 A106 ICGC_PC 0 0 A107 ICGC_PC 0 0 A108 ICGC_PC 0 0 A110 ICGC_PC 0 0 A111 ICGC_PC 0 0 A112 ICGC_PC 0 0 A113 ICGC_PC 0 0 A116 ICGC_PC 0.179 1 A118 ICGC_PC 0 0 A121 ICGC_PC 0.22 0 A122 ICGC_PC 0.155 0 A123 ICGC_PC 0 0 A124 ICGC_PC 0.353 1 A125 ICGC_PC 0 0 A126 ICGC_PC 0 0 A127 ICGC_PC 0 0 A129 ICGC_PC 0 0 A130 ICGC_PC 0 0 A131 ICGC_PC 0 0 A132 ICGC_PC 0 0 A133 ICGC_PC 0 0 A134 ICGC_PC 0 0 A135 ICGC_PC 0 0 A136 ICGC_PC 0 0 A137 ICGC_PC 0 0 A138 ICGC_PC 0.337 0 A140 ICGC_PC 0 0 A141 ICGC_PC 0.126 0 A142 ICGC_PC 0 0 A143 ICGC_PC 0 0 A144 ICGC_PC 0 0 A145 ICGC_PC 0 0 A148 ICGC_PC 0 0 A149 ICGC_PC 0 0 A150 ICGC_PC 0 0 A151 ICGC_PC 0 0 A152 ICGC_PC 0 0 A153 ICGC_PC 0 0 A154 ICGC_PC 0.197 0 A155 ICGC_PC 0.148 0 A156 ICGC_PC 0 0 A157 ICGC_PC 0 0 A158 ICGC_PC 0 0 A159 ICGC_PC 0 0 A160 ICGC_PC 0.663 0 A161 ICGC_PC 0 0 A162 ICGC_PC 0.225 0 A163 ICGC_PC 0 0 A164 ICGC_PC 0 0 A165 ICGC_PC 0.585 1 A166 ICGC_PC 0 0 A167 ICGC_PC 0.216 0 A168 ICGC_PC 0.256 1 A169 ICGC_PC 0.372 1 A170 ICGC_PC 0.171 0 A171 ICGC_PC 0 0 A172 ICGC_PC 0 0 A173 ICGC_PC 0.231 0 A174 ICGC_PC 0 0 A175 ICGC_PC 0 0 A176 ICGC_PC 0 0 A177 ICGC_PC 0 0 A178 ICGC_PC 0 0 A179 ICGC_PC 0.31 0 A180 ICGC_PC 0 0 A181 ICGC_PC 0.143 0 A182 ICGC_PC 0.399 1 A183 ICGC_PC 0.484 1 A184 ICGC_PC 0.211 0 A185 ICGC_PC 0 0 A186 ICGC_PC 0.227 0 A187 ICGC_PC 0 0 A188 ICGC_PC 0 0 A189 ICGC_PC 0 0 A190 ICGC_PC 0 0 A191 ICGC_PC 0.353 0 A192 ICGC_PC 0.714 0 A193 ICGC_PC 0 0 A194 ICGC_PC 0 0 A195 ICGC_PC 0.439 0 A196 ICGC_PC 0.195 1 A197 ICGC_PC 0.397 1 A198 ICGC_PC 0 0 A199 ICGC_PC 0 0 A200 TCGA-CH- 0.363 0 5750 TCGA-CH- 0 0 5763 TCGA-CH- 0 0 5771 TCGA-CH- 0.1 1 5788 TCGA-CH- 0 0 5789 TCGA-EJ- 0 0 5503 TCGA-EJ- 0.359 1 5506 TCGA-EJ- 0 0 7791 TCGA-G9- 0.36 0 6336 TCGA-G9- 0 0 6365 TCGA-G9- 0 0 6370 TCGA-G9- 0 0 7522 TCGA-HC- 0.212 1 7075 TCGA-HC- 0 0 7079 TCGA-HC- 0 0 7233 TCGA-HC- 0 0 7737 TCGA-HC- 0 0 7740 TCGA-HC- 0 0 7744 TCGA-HC- 0 0 8258 TCGA-HI- 0 0 7169 sample_size (Amt_ MT- MT- MT- MT- MT- MT- MT- MT- MT- MT- MT- MT- MT- MT- bwa DNA.sent.for.se- CYB RNR1 RNR2 ND1 MTND2 ND3 ND4 ND4L ND5 ND6 CO1 CO2 CO3 ATP6 ATP8 OHR CSB1 HV1 HV2 version quencing) 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 bwa/0.5.7 NA 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 bwa/0.5.7 NA 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 1 1 0 0 0 1 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa/0.5.7 356.5 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 226.2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 198 0.7.12 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 222.32 0.7.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 121.16 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 267.3 0.7.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 129 0.7.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 239.9 0.7.12 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 399.82 0.7.12 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 232.5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 295.2 0.7.12 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 259 0.7.12 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 232.2 0.7.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 227.34 0.7.12 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 bwa/0.5.7 392.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 391.89 0.7.12 0 0 0 0 1 0 1 0 1 0 0 0 0 0 0 0 0 1 0 bwa/0.5.7 228.64 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 424.02 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 512.4 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 bwa-mem/ 159.8 0.7.12 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 310.77 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 bwa/0.5.7 513.84 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 500 0.7.15 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 1 bwa-mem/ 270.96 0.7.12 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 308.14 0.7.12 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 bwa/0.5.7 663.36 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 bwa/0.5.7 500 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 242.19 0.7.12 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 408.2 0.7.12 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 bwa/0.5.7 252.59 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 bwa/0.5.7 675.13 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 bwa-mem/ 253.71 0.7.12 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 299.1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa-mem/ 664.9 0.7.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 275.1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 bwa-mem/ 250 0.7.12 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 bwa-mem/ 300 0.7.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 417.15 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 359.22 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 bwa-mem/ 100 0.7.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa-mem/ 186.62 0.7.12 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 bwa/0.5.7 250.29 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 1093.1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 bwa/0.5.7 318.32 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 bwa/0.5.7 642.75 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 bwa-mem/ 552.6 0.7.10 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 1 bwa/0.5.7 339.15 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 677.5 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 205.47 0.7.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 952.8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 937.68 0.7.12 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 bwa/0.5.7 242.5 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 bwa/0.5.7 980.4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 177.25 0.7.12 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 503.84 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa/0.5.7 1098.8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 950.96 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 bwa/0.5.7 848.68 0 0 1 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 1 bwa/0.5.7 150 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 501.12 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa/0.5.7 586.8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 774.52 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 2064 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 bwa/0.5.7 2901.4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 1510.3 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 bwa/0.5.7 2036.8 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 2020.4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 1722.2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 522.09 0.7.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 bwa/0.5.7 1513.8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa-mem/ 262.8 0.7.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 259.5 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 271.2 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 1 bwa-mem/ 991.44 0.7.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 bwa/0.5.7 203.44 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 bwa/0.5.7 335.52 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 2304.5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 1001.2 0 1 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 bwa/0.5.7 1000 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 1001.6 1 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 1515.8 0 0 1 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 bwa/0.5.7 1002.6 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 2006 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 2015.2 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 bwa/0.5.7 500 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 2000 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 388.8 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 635.75 0.7.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 2000 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 2000 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 1 1 0 1 bwa/0.5.7 618 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 1498 0.7.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 339 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 394.8 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 bwa/0.5.7 563.4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa/0.5.7 1500 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 bwa/0.5.7 1000 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 259.2 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 1 1 bwa/0.5.7 429 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ 1006.4 0.7.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 1500 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa/0.5.7 279 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 1500 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 bwa/0.5.7 253.2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 bwa/0.5.7 85.2 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 287.4 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 bwa/0.5.7 306.6 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 271.2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 268.4 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 bwa/0.5.7 110.4 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 416.5 0 0 1 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 bwa/0.5.7 312.2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 318.5 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 445.9 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 342 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 588 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 543.9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 310.1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 363.6 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 bwa/0.5.7 489 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 484.2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 246 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 bwa/0.5.7 253 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 bwa/0.5.7 297.6 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 bwa/0.5.7 271.2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 250.8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 298 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa/0.5.7 256 1 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 bwa/0.5.7 277.6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 346.2 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 265.5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 252.8 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 347.4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 330.4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 277.2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 237.2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 2361.7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 1542 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa/0.5.7 309.4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 294.6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 355.68 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 bwa/0.5.7 304 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 350.4 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 309.6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 428 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 315 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 bwa/0.5.7 288 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 536.2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 bwa/0.5.7 282.6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 280.8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 598 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 348 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 673 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 374.4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 1180 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 603 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa/0.5.7 754 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 588 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 326 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 399 0 0 1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 392 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 445.2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 422 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 442.4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 336 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 1 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 1 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 bwa-mem/ NA 0.7.8-r455 0 1 1 0 0 0 1 0 0 0 0 0 0 0 0 1 0 1 1 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 bwa-mem/ NA 0.7.8-r455 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa-mem/ NA 0.7.8-r455 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 1 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa-mem/ NA 0.7.8-r455 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa-mem/ NA 0.7.8-r455 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bwa/0.5.7 NA Myc CNA NKX3-1 CNA Cellularity 0 0 NA 0 0 NA 0 0 NA 0 −1 NA 0 −1 NA 0 0 NA 1 0 NA 0 0 NA 0 0 NA 1 −1 NA 0 0 NA 0 0 NA 0 0 NA 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 −1 0.9 1 −1 0.8 0 −1 0.8 0 0 0.8 1 −1 0.9 0 −1 0.7 1 0 0.9 0 −1 0.2 0 0 0.3 0 0 0.9 0 0 0.9 0 0 0.2 0 −1 0.9 0 0 NA 1 0 0.8 0 −1 0.9 0 0 0.9 0 0 0.9 0 0 0.7 0 0 0.9 0 −1 0.6 1 −1 0.2 0 0 NA 0 0 0.9 0 0 0.9 1 −1 0.8 1 −1 0.8 0 0 0.8 0 0 0.9 1 −1 0.6 1 −1 0.4 1 −1 0.9 1 −1 0.6 0 0 0.9 0 −1 1 0 0 0.8 0 0 0.8 0 0 0.5 0 0 0.9 0 0 0.9 0 0 0.8 1 −1 0.8 0 −1 0.8 1 −1 0.7 0 0 NA 0 0 NA 0 0 0.2 0 0 0.6 1 −1 0.8 0 −1 0.3 0 0 0.8 0 0 0.8 0 0 0.8 0 −1 0.9 0 0 0.9 0 −1 0.9 0 0 0.8 0 0 0.6 0 0 0.2 0 0 NA 0 −1 0.7 1 −1 0.7 0 −1 0.6 1 −1 0.9 0 −1 0.8 0 −1 0.7 0 0 0.4 0 −1 0.6 0 −1 0.9 0 0 0.9 0 0 0.9 0 0 0.4 0 −1 0.8 0 −1 0.9 0 −1 0.3 1 −1 0.2 0 −1 0.8 0 −1 0.3 0 −1 0.5 0 −1 0.9 0 −1 0.2 0 0 0.2 0 −1 0.8 0 −1 0.6 0 0 0.9 1 −1 0.8 1 −1 0.5 0 0 0.9 0 0 0.6 0 −1 1 1 −1 0.7 0 0 0.9 0 0 0.2 0 −1 0.7 0 −1 0.6 0 0 0.4 0 0 0.2 0 0 0.6 0 −1 0.2 0 −1 0.9 0 −1 0.3 0 0 0.2 0 0 0.6 0 −1 0.8 0 −1 0.3 0 −1 0.8 0 −1 0.2 0 0 0.3 0 0 0.2 0 −1 0.8 0 −1 0.3 0 −1 0.2 0 −1 0.7 0 0 0.2 1 0 0.2 0 −1 0.6 0 −1 0.5 0 0 0.3 0 0 0.3 1 1 0.8 0 0 0.3 0 −1 0.7 0 −1 0.6 0 −1 0.8 0 −1 0.6 0 0 0.5 0 −1 0.3 0 0 0.2 0 −1 0.6 0 0 0.7 0 0 0.3 0 −1 0.2 0 −1 0.3 0 0 0.4 0 0 0.3 0 0 0.7 0 0 0.1 0 −1 0.6 0 0 0.2 1 −1 0.7 0 −1 0.6 0 0 0.3 0 0 0.3 0 0 0.2 0 0 0.5 0 −1 0.3 0 −1 0.6 1 −1 0.8 1 −1 0.6 0 0 0.3 1 1 0.7 0 0 0.5 0 −1 0.7 0 0 0.2 0 0 0.7 0 0 0.2 0 0 0.7 0 −1 0.8 0 −1 0.1 0 −1 0.3 0 −1 0.3 0 0 0.1 0 −1 0.6 0 0 0.5 0 0 0.2 NA NA NA 0 0 NA 0 −1 NA 1 −1 NA 0 0 NA 0 0 NA 0 0 NA 0 −1 NA 0 0 NA 0 0 NA 0 −1 NA 0 −1 NA 0 0 NA 0 0 NA 0 −1 NA 0 −1 NA 0 0 NA 0 0 NA 0 0 NA NA NA NA 0 0 NA 0 0 NA 0 0 NA 0 0 NA 0 −1 NA 0 0 NA 0 −1 NA 0 0 NA 0 0 NA 1 −1 NA 0 −1 NA 0 1 NA 0 0 NA NA NA NA 0 −1 NA 0 0 NA 1 −1 NA NA NA NA NA NA NA 0 −1 NA 1 −1 NA 0 0 NA 0 0 NA NA NA NA 0 −1 NA 0 −1 NA 0 0 NA 0 0 NA NA NA NA NA NA NA 0 0 NA 0 0 NA 0 0 NA NA NA NA NA NA NA 0 −1 NA 0 −1 NA NA NA NA 0 0 NA NA NA NA 0 −1 NA 1 0 NA 0 0 NA 0 −1 NA 0 0 NA 0 −1 NA 0 −1 NA 0 0 NA NA NA NA NA NA NA 0 −1 NA 0 0 NA NA NA NA 0 −1 NA 0 0 NA 0 −1 NA 1 −1 NA 0 0 NA 0 −1 NA NA NA NA NA NA NA NA NA NA NA NA NA 1 0 NA NA NA NA 0 0 NA 0 −1 NA NA NA NA 0 −1 NA 0 0 NA NA NA NA 0 0 NA NA NA NA 0 0 NA 0 0 NA 1 0 NA 0 0 NA 0 0 NA 0 −1 NA 0 0 NA 0 0 NA 0 −1 NA NA NA NA 0 −1 NA 0 −1 NA 0 0 NA 1 0 NA 0 0 NA 0 0 NA 1 −1 NA 0 0 NA NA NA NA 0 −1 NA NA NA NA 0 −1 NA NA NA NA 0 0 NA NA NA NA 0 0 NA 0 0 NA 0 0 NA 0 −1 NA 0 0 NA 0 −1 NA NA NA NA 0 −1 NA 0 0 NA 0 0 NA 0 0 NA 0 0 NA 0 −1 NA NA NA NA 0 −1 NA 0 0 NA 0 0 NA NA NA NA 0 0 NA 0 −1 NA NA NA NA 0 0 NA 0 0 NA 0 −1 NA 0 −1 NA 0 −1 NA 0 0 NA 0 −1 NA 0 0 NA NA NA NA 0 0 NA 0 −1 NA 0 0 NA 0 −1 NA 0 −1 NA NA NA NA 0 0 NA NA NA NA 0 −1 NA 0 0 NA 0 0 NA 0 0 NA 0 −1 NA 0 0 NA NA NA NA 0 0 NA NA NA NA NA NA NA 0 0 NA 0 0 NA 0 0 NA NA NA NA 0 −1 NA 0 0 NA NA NA NA NA NA NA 0 0 NA NA NA NA NA NA NA NA NA NA 0 0 NA NA NA NA NA NA NA 0 −1 NA 0 0 NA NA NA NA NA NA NA 0 0 NA 0 0 NA 0 0 NA 0 0 NA 0 0 NA 0 0 NA 0 0 NA 0 0 NA NA NA NA 0 0 NA 0 0 NA 0 0 NA 0 0 NA

TABLE 5 Table of 293 somatic mtSNVs Position Tumour.H. Normal.HF. Normal.HF. Normal.HF. Patient Reference Tumour Tumour.HF. Tumour.HF Tumour.HF Normal A C G CPCG0187 60 T T 0 0.22 0 0.78 T 0 0 0 CPCG0078 72 T C 0 0.72 0 0.27 T 0 0 0 CPCG0114 72 T T 0 0 0 1 C 0 1 0 CPCG0263 72 T T 0 0.5 0 0.5 T 0 0 0 ICGC_PCA071 72 T C 0 0.89 0 0.11 T 0 0 0 CPCG0166 73 G A 0.75 0 0.25 0 A 0.99 0 0.01 CPCG0098 146 C C 0 0.7 0 0.3 T 0 0 0 CPCG0100 146 C T 0 0.42 0 0.58 T 0 0.01 0 ICGC_PCA169 146 C C 0 0.69 0 0.31 T 0 0.2 0 ICGC_PCA198 146 C T 0 0.18 0 0.82 C 0 0.83 0 CPCG0206 152 C C 0 0.84 0 0.16 T 0 0.18 0 Baca07-4610 152 C T 0 0.27 0 0.73 T 0 0 0 ICGC_PCA032 152 C C 0 0.99 0 0.01 T 0 0 0 CPCG0204 183 A G 0.49 0 0.51 0 A 1 0 0 CPCG0073 195 C T 0 0.26 0 0.74 T 0 0 0 CPCG0196 195 C T 0 0.37 0 0.63 T 0 0 0 ICGC_PCA118 195 C C 0 0.56 0 0.43 T 0 0.11 0 ICGC_PCA166 199 T C 0 0.86 0 0.14 T 0 0.15 0 ICGC_PCA015 207 G G 0.2 0 0.8 0 A 0.71 0 0.29 CPCG0098 215 A G 0.24 0 0.76 0 A 1 0 0 CPCG0205 227 A A 0.82 0 0.18 0 G 0.16 0 0.84 CPCG0242 234 A G 0.19 0 0.81 0 A 1 0 0 ICGC_PCA031 234 A G 0.16 0 0.84 0 A 0.93 0 0.07 CPCG0070 248 A A 0.99 0 0.01 0 A 0.74 0 0.26 CPCG0256 255 G G 0.44 0.01 0.55 0 G 0 0 1 CPCG0158 307 C C 0 0.64 0 0.36 C 0 1 0 CPCG0081 309 C C 0 0.62 0 0.38 C 0 1 0 Baca06-3199 309 C T 0 0.22 0 0.77 C 0 0.99 0 CPCG0344 499 G G 0.21 0 0.78 0 G 0 0 1 CPCG0046 564 G G 0.27 0.02 0.71 0 G 0 0 1 CPCG0342 564 G A 0.88 0 0.12 0 G 0 0 1 ICGC_PCA125 574 A A 0.83 0.17 0 0 A 0.62 0.38 0 CPCG0067 617 G G 0.49 0 0.51 0 G 0 0 1 CPCG0189 650 T T 0 0.5 0 0.5 T 0 0 0 CPCG0189 690 T T 0 0.27 0 0.73 T 0 0 0 CPCG0083 709 G A 0.56 0 0.44 0 G 0 0 1 ICGC_PCA196 709 G A 0.61 0 0.39 0 G 0.29 0 0.71 CPCG0073 719 G G 0.38 0 0.62 0 G 0 0 1 CPCG0019 933 G A 0.52 0 0.48 0 G 0 0 1 CPCG0248 988 G G 0.42 0 0.58 0 G 0 0 1 CPCG0346 988 G G 0.38 0 0.62 0 G 0 0 1 EOPC-07 988 G G 0.36 0 0.64 0 G 0 0 1 CPCG0204 991 G A 0.66 0 0.34 0 G 0 0 1 CPCG0211 1079 G G 0.26 0 0.74 0 G 0 0 0.99 ICGC_PCA057 1157 T C 0 0.53 0 0.47 T 0 0 0 EOPC-04 1193 T T 0 0.1 0 0.9 T 0 0.32 0 CPCG0090 1199 G A 0.7 0 0.3 0 G 0 0 1 ICGC_PCA192 1447 G G 0.32 0 0.68 0 G 0 0 1 ICGC_PCA032 1452 T T 0 0 0 1 C 0 1 0 CPCG0185 1456 T T 0 0.46 0 0.54 T 0 0 0 CPCG0412 1469 G A 0.51 0 0.49 0 G 0 0 1 CPCG0268 1552 G G 0.22 0 0.78 0 G 0 0 1 CPCG0097 1644 G G 0.25 0 0.74 0 G 0 0 1 ICGC_PCA103 1659 T T 0 0.46 0 0.54 T 0 0 0 ICGC_PCA032 1716 T T 0 0 0 1 C 0 1 0 ICGC_PCA161 1730 T C 0 0.73 0 0.27 T 0 0 0 ICGC_PCA075 1770 G G 0.44 0 0.56 0 G 0 0 1 CPCG0339 1906 G A 0.59 0 0.41 0 G 0 0 1 CPCG0098 1975 T C 0 0.77 0 0.23 T 0 0 0 CPCG0100 2074 A G 0.35 0 0.65 0 A 0.99 0 0 CPCG0027 2115 T T 0 0 0 1 T 0 0.25 0 ICGC_PCA083 2269 G A 0.6 0 0.4 0 G 0 0 1 Baca05-3852 2333 G A 0.91 0 0.09 0 G 0.03 0 0.97 CPCG0388 2478 G G 0.36 0 0.64 0 G 0 0 1 CPCG0183 2487 A A 0.99 0 0 0 A 0.77 0.2 0.01 CPCG0081 2519 G A 0.64 0 0.36 0 G 0 0 1 ICGC_PCA029 2571 G G 0.26 0 0.74 0 G 0 0 1 CPCG0040 2607 T T 0 0.26 0 0.74 T 0 0 0 CPCG0358 2634 T T 0 0.41 0 0.59 T 0 0 0 CPCG0005 2697 G G 0.48 0 0.52 0 G 0 0 1 ICGC_PCA182 2737 T C 0 0.72 0 0.28 T 0 0 0 TCGA-CH-5750 2817 G G 0.47 0 0.53 0 G 0 0 1 ICGC_PCA068 2844 G G 0.5 0 0.5 0 G 0 0 1 CPCG0217 2894 T T 0 0 0 1 T 0 0.24 0 ICGC_PCA070 2914 A A 0.69 0 0.31 0 G 0.22 0 0.78 ICGC_PCA051 2916 G G 0.32 0 0.68 0 G 0 0 1 ICGC_PCA163 2916 G G 0.44 0 0.56 0 G 0 0 1 CPCG0331 2941 G A 0.61 0 0.39 0 G 0 0 1 CPCG0410 3022 G G 0.25 0 0.75 0 G 0 0 1 ICGC_PCA125 3063 G A 0.69 0 0.31 0 G 0 0 1 CPCG0324 3079 G A 0.61 0 0.39 0 G 0 0 1 CPCG0166 3174 T T 0 0.28 0 0.72 T 0 0 0 CPCG0212 3297 T T 0 0.23 0 0.77 T 0 0 0 CPCG0071 3492 A A 0.75 0.24 0 0.01 A 0.97 0.03 0 CPCG0265 3496 G G 0.4 0 0.59 0 G 0 0 1 TCGA-CH-5750 3526 G G 0.23 0 0.77 0 G 0 0 1 CPCG0120 3697 G G 0.35 0 0.65 0 G 0 0 1 CPCG0063 3842 G G 0.22 0 0.77 0 G 0 0 1 ICGC_PCA122 3842 G G 0.45 0 0.55 0 G 0 0 1 ICGC_PCA187 3842 G G 0.21 0 0.79 0 G 0 0 1 CPCG0127 3946 G G 0.22 0 0.78 0 G 0 0 1 CPCG0233 3946 G G 0.4 0 0.6 0 G 0 0 1 ICGC_PCA125 3959 G G 0.36 0 0.63 0 G 0 0 1 CPCG0213 3982 G G 0.22 0 0.78 0 G 0 0 1 Baca05-3852 4053 A G 0.34 0 0.65 0 A 0.96 0 0.03 CPCG0027 4142 G A 0.59 0 0.41 0 G 0 0 1 TCGA-EJ-5506 4142 G G 0.21 0 0.79 0 G 0 0 0.99 CPCG0003 4201 G G 0.24 0 0.76 0 G 0 0 1 CPCG0067 4231 A G 0.58 0 0.42 0 A 1 0 0 ICGC_PCA098 4233 T C 0 0.53 0 0.47 T 0 0 0 CPCG0067 4407 G A 0.63 0 0.36 0 G 0 0 1 CPCG0387 4436 C C 0 0.56 0 0.44 C 0 1 0 CPCG0262 4482 G G 0.27 0 0.73 0 G 0 0 1 ICGC_PCA171 4491 G G 0.46 0 0.54 0 G 0 0 1 CPCG0204 4596 G A 0.68 0 0.32 0 G 0 0 1 CPCG0117 4648 T T 0 0.36 0 0.63 T 0 0 0 CPCG0407 4770 G A 0.75 0 0.25 0 G 0 0 1 EOPC-03 4831 G A 0.61 0 0.39 0 G 0 0 1 CPCG0409 4858 T C 0 0.6 0 0.4 T 0 0 0 CPCG0071 4887 T T 0 0.49 0 0.5 T 0 0 0 CPCG0339 4905 T C 0 0.67 0 0.33 T 0 0 0 CPCG0046 4920 G G 0.25 0 0.72 0.03 G 0 0 1 ICGC_PCA142 4958 A A 0.96 0 0.04 0 A 0.74 0 0.26 CPCG0201 5115 T C 0 0.9 0 0.1 T 0 0 0 CPCG0020 5195 C C 0.05 0.95 0 0 C 0.44 0.56 0 CPCG0267 5227 G G 0.28 0 0.72 0 G 0 0 1 ICGC_PCA185 5301 A A 0.66 0 0.34 0 G 0.41 0 0.59 CPCG0242 5511 T C 0 0.82 0 0.17 T 0 0 0 ICGC_PCA013 5521 G A 0.53 0 0.47 0 G 0 0 1 ICGC_PCA140 5774 T C 0 0.61 0 0.39 T 0 0 0 EOPC-07 5814 T C 0 0.86 0 0.14 T 0 0 0 CPCG0350 5910 G A 0.67 0 0.33 0 G 0 0 1 TCGA-G9-6336 5979 G G 0.48 0 0.52 0 G 0 0 1 CPCG0356 6020 C C 0 0.91 0 0.09 T 0 0.42 0 ICGC_PCA048 6046 T T 0 0.28 0 0.72 T 0 0 0 CPCG0050 6054 G G 0.21 0 0.79 0 A 0.87 0 0.13 CPCG0189 6270 G G 0.24 0 0.76 0 G 0 0 1 CPCG0251 6276 G A 0.87 0 0.13 0 G 0.45 0 0.55 TCGA-G9-6336 6321 G A 0.5 0 0.5 0 G 0 0 1 CPCG0123 6419 A A 1 0 0 0 A 0.8 0.18 0.01 CPCG0211 6419 A A 1 0 0 0 A 0.77 0.21 0.01 CPCG0102 6496 C T 0 0.42 0 0.58 C 0 1 0 CPCG0124 6664 T C 0 0.8 0 0.2 T 0 0.44 0 ICGC_PCA060 6718 G A 0.53 0 0.47 0 G 0 0 1 CPCG0096 6742 T C 0 0.66 0 0.34 T 0 0 0 CPCG0331 6856 T C 0 0.6 0 0.4 T 0 0 0 CPCG0090 6892 G A 0.51 0 0.49 0 G 0 0 1 CPCG0189 6944 T T 0 0.26 0 0.74 T 0 0 0 ICGC_PCA155 7026 G G 0.4 0 0.6 0 G 0 0 1 EOPC-010 7293 G G 0.25 0 0.75 0 G 0 0 1 ICGC_PCA029 7393 G G 0.24 0 0.76 0 G 0 0 1 EOPC-010 7554 G G 0.25 0 0.75 0 G 0 0 1 CPCG0124 7772 A G 0.19 0 0.81 0 A 0.55 0 0.45 ICGC_PCA156 7803 T T 0 0.37 0 0.63 T 0 0 0 CPCG0378 7919 G G 0.26 0 0.74 0 G 0 0 1 CPCG0266 7929 G G 0 0 0.98 0.02 G 0 0 0.75 ICGC_PCA123 7997 G A 0.59 0 0.41 0 G 0 0 1 ICGC_PCA023 8078 G G 0.24 0 0.76 0 G 0 0 1 ICGC_PCA174 8348 A G 0.14 0 0.86 0 G 0.35 0 0.65 CPCG0345 8391 G G 0.32 0 0.68 0 G 0 0 1 CPCG0103 8393 C T 0 0.2 0 0.8 C 0 0.99 0 CPCG0196 8433 T T 0 0.37 0 0.63 T 0 0 0 ICGC_PCA193 8547 T C 0 0.54 0 0.46 T 0 0 0 CPCG0063 8643 C T 0 0.1 0 0.9 C 0 0.63 0 ICGC_PCA029 8697 G G 0.32 0 0.68 0 G 0 0 1 CPCG0082 8705 T C 0 0.97 0 0.03 T 0 0.49 0 CPCG0217 8843 T T 0 0 0 1 T 0 0.25 0 Berger3043 8999 T C 0 0.9 0 0.1 T 0 0 0 CPCG0380 9182 G A 0.62 0 0.38 0 G 0 0 1 ICGC_PCA026 9185 T T 0 0.21 0 0.79 T 0 0 0 ICGC_PCA166 9378 T T 0 0.41 0 0.59 T 0 0 0 CPCG0349 9380 G A 0.8 0 0.2 0 G 0.19 0 0.81 CPCG0262 9504 G A 0.84 0 0.16 0 G 0 0 1 CPCG0234 9516 T T 0 0.34 0 0.66 T 0 0 0 CPCG0070 9628 G A 0.59 0 0.41 0 G 0 0 1 CPCG0089 9673 G G 0.12 0.09 0.79 0 G 0 0 1 CPCG0269 9786 G G 0.28 0 0.72 0 G 0 0 1 CPCG0356 9797 T T 0 0.22 0 0.78 C 0 0.59 0 CPCG0072 9804 G G 0.27 0 0.73 0 A 0.8 0 0.2 CPCG0249 9840 T C 0 0.78 0 0.22 T 0 0 0 ICGC_PCA086 9891 T T 0 0.38 0 0.62 T 0 0 0 ICGC_PCA095 9977 T T 0 0.4 0 0.6 T 0 0 0 ICGC_PCA193 10014 G A 0.53 0 0.47 0 G 0 0 1 CPCG0128 10029 A A 0.94 0 0.06 0 A 0.66 0 0.34 ICGC_PCA036 10182 G A 0.76 0 0.24 0 G 0 0 1 CPCG0114 10277 A A 0.97 0.03 0 0 A 0.69 0.3 0 CPCG0166 10277 A A 0.76 0.24 0 0 A 0.99 0.01 0 CPCG0211 10277 A A 0.99 0.01 0 0 A 0.78 0.2 0 EOPC-07 10558 T T 0 0.4 0 0.6 T 0 0 0 CPCG0407 10586 G A 0.77 0 0.23 0 G 0 0 1 CPCG0256 10790 T T 0 0.4 0 0.6 T 0 0 0 CPCG0331 10800 T T 0 0 0.26 0.74 T 0 0 0 CPCG0340 10866 T T 0 0 0 1 C 0 0.5 0 CPCG0324 11150 G G 0.24 0 0.76 0 G 0 0 1 CPCG0040 11343 T C 0 0.77 0 0.23 T 0 0 0 Berger0508 11493 G G 0.33 0 0.67 0 G 0 0 1 Berger0508 11592 G A 0.9 0 0.1 0 G 0 0 1 CPCG0046 11651 G A 0.85 0 0.15 0 G 0.16 0 0.84 CPCG0377 11711 G C 0 0.72 0.28 0 G 0 0 1 ICGC_PCA041 11711 G G 0.48 0 0.52 0 G 0 0 1 ICGC_PCA032 11788 C T 0 0 0 1 C 0 1 0 CPCG0410 11814 T C 0 0.54 0 0.46 T 0 0 0 CPCG0103 11852 G G 0.22 0 0.78 0 G 0 0 1 CPCG0374 11878 T C 0 0.57 0 0.43 T 0 0 0 ICGC_PCA081 11940 T C 0 0.54 0 0.46 T 0 0 0 CPCG0095 11949 G G 0.27 0 0.73 0 G 0 0 1 CPCG0076 12028 T T 0 0.29 0 0.71 C 0 0.7 0 Berger0508 12173 T C 0 0.86 0 0.14 T 0 0 0 CPCG0114 12276 G G 0 0 1 0 A 0.57 0 0.43 ICGC_PCA161 12291 T T 0 0.45 0 0.55 T 0 0.03 0 CPCG0201 12312 T C 0 0.68 0 0.32 T 0 0 0 CPCG0361 12501 G G 0.26 0 0.74 0 G 0 0 1 BacaSTID0000002872 12634 A A 0.84 0 0.16 0 G 0.01 0 0.99 ICGC_PCA065 12648 A C 0.3 0.7 0 0 A 0.65 0.35 0 CPCG0242 12651 G G 0.21 0 0.79 0 G 0 0 1 CPCG0030 12698 T T 0 0.24 0 0.76 T 0 0 0 CPCG0352 12700 C A 0.55 0.45 0 0 C 0 1 0 CPCG0336 12758 T C 0 0.54 0 0.46 T 0 0 0 CPCG0030 12758 T T 0 0.24 0 0.76 T 0 0 0 CPCG0236 12763 G A 0.75 0 0.25 0 G 0 0 1 Baca09-37 12769 G A 0.76 0 0.24 0 G 0.01 0 0.99 ICGC_PCA168 12818 G G 0.28 0 0.72 0 G 0 0 1 Berger3043 12980 G G 0.46 0 0.54 0 G 0 0 1 CPCG0232 13121 G A 0.58 0 0.42 0 G 0 0 1 CPCG0234 13143 T C 0 0.61 0 0.39 T 0 0 0 Baca06-1749 13227 C C 0 0.59 0 0.41 C 0 1 0 ICGC_PCA036 13289 G A 0.76 0 0.24 0 G 0 0 1 CPCG0379 13368 G A 0.86 0 0.14 0 A 0.5 0 0.5 ICGC_PCA180 13463 G A 0.77 0 0.23 0 G 0 0 1 Baca05-3595 13466 G A 0.55 0 0.44 0 G 0 0 1 CPCG0213 13484 T C 0 0.54 0 0.46 T 0 0 0 CPCG0166 13507 T T 0 0.22 0 0.78 T 0 0 0 CPCG0166 13543 T T 0 0.2 0 0.79 T 0 0 0 CPCG0046 13568 T T 0 0 0 1 T 0 0.35 0 ICGC_PCA075 13759 G A 0.75 0 0.25 0 G 0.5 0 0.5 ICGC_PCA170 13888 T T 0 0.23 0 0.77 T 0 0 0 CPCG0190 13895 T T 0 0.46 0 0.54 T 0 0 0 CPCG0217 13913 T T 0 0.3 0 0.7 T 0 0 0 CPCG0410 13918 T C 0 0.79 0 0.21 T 0 0.03 0 Baca05-1657 13928 G A 0.62 0 0.38 0 G 0 0 1 CPCG0237 14002 A A 1 0 0 0 A 0.78 0 0.22 Berger3043 14151 T C 0 0.88 0 0.12 T 0 0 0 CPCG0372 14172 T T 0 0.41 0 0.59 T 0 0 0 EOPC-07 14560 G G 0.1 0 0.9 0 A 0.7 0 0.3 CPCG0249 14638 T C 0 0.76 0 0.24 T 0 0 0 Baca07-4941 14831 G G 0.29 0 0.71 0 G 0 0 1 CPCG0340 14846 G A 0.88 0 0.12 0 G 0 0 1 CPCG0387 14889 G G 0.32 0 0.68 0 G 0 0 1 CPCG0346 14985 G G 0.25 0 0.75 0 G 0 0 1 CPCG0078 15039 T C 0 0.61 0 0.39 T 0 0 0 CPCG0355 15045 G G 0.25 0 0.75 0 G 0 0 1 CPCG0412 15045 G G 0.31 0 0.69 0 G 0 0 1 Baca08-4154 15229 T T 0 0.07 0 0.93 C 0 0.71 0 ICGC_PCA198 15323 G A 0.66 0 0.34 0 G 0.01 0 0.99 CPCG0067 15375 G G 0.24 0 0.76 0 G 0 0 1 Berger3027 15446 C T 0 0.13 0 0.87 C 0 0.52 0 Baca03-1426 15498 G G 0.25 0 0.75 0 G 0 0 1 CPCG0057 15661 C T 0 0.27 0 0.73 C 0 1 0 CPCG0412 15708 G G 0.37 0 0.63 0 G 0 0 1 CPCG0269 15731 G A 0.62 0 0.38 0 G 0 0 1 CPCG0213 15762 G G 0.28 0 0.72 0 G 0 0 1 CPCG0269 15817 A G 0.27 0 0.73 0 A 0.83 0 0.17 CPCG0356 15884 G A 0.7 0 0.3 0 G 0.16 0 0.84 CPCG0098 15924 A A 0.97 0 0.03 0 A 0.76 0 0.24 CPCG0233 15986 G A 0.81 0 0.19 0 G 0 0 1 ICGC_PCA180 16000 G G 0.07 0 0.93 0 G 0.34 0 0.66 ICGC_PCA091 16008 T T 0 0.28 0 0.72 T 0 0 0 ICGC_PCA193 16012 A G 0.39 0 0.61 0 A 1 0 0 CPCG0404 16027 T C 0 0.84 0 0.15 T 0 0 0 CPCG0001 16035 G G 0.23 0 0.77 0 G 0 0 1 ICGC_PCA098 16035 G G 0.22 0 0.78 0 G 0 0 1 CPCG0269 16048 G G 0.16 0 0.84 0 G 0.4 0 0.58 CPCG0250 16051 A G 0.44 0 0.56 0 A 0.77 0 0.23 CPCG0040 16086 T C 0 0.69 0 0.3 C 0 1 0 CPCG0128 16092 T T 0 0.17 0 0.83 C 0 0.96 0 CPCG0189 16093 T C 0 0.72 0 0.28 C 0 0.96 0 CPCG0368 16093 T C 0 0.72 0 0.28 C 0 0.99 0 CPCG0097 16093 T T 0 0.03 0 0.97 T 0 0.45 0 TCGA-CH-5788 16093 T T 0 0.16 0 0.84 C 0 0.93 0 TCGA-EJ-5506 16093 T C 0 0.69 0 0.31 C 0 0.96 0 TCGA-HC-7075 16093 T T 0 0.03 0 0.97 C 0 0.94 0 ICGC_PCA097 16093 T C 0 0.56 0 0.44 C 0 0.94 0 ICGC_PCA170 16093 T T 0 0.12 0 0.88 C 0 0.9 0 ICGC_PCA184 16093 T T 0 0.2 0 0.8 C 0 0.98 0 CPCG0183 16147 C C 0 0.77 0 0.23 C 0 0.99 0 EOPC-04 16148 C T 0 0.29 0 0.71 C 0 1 0 CPCG0046 16153 G A 0.84 0 0.16 0 G 0 0 1 CPCG0355 16162 A G 0.02 0 0.98 0 G 0.28 0 0.72 ICGC_PCA032 16169 C C 0 1 0 0 G 0 0 0.99 Baca05-3595 16182 A C 0.08 0.82 0.1 0 C 0.24 0.44 0.32 CPCG0256 16183 A A 0.59 0.41 0 0 A 0.95 0.05 0 CPCG0352 16184 C T 0 0.34 0 0.66 C 0 1 0 CPCG0084 16188 C C 0 0.77 0 0.23 C 0 1 0 CPCG0114 16189 C T 0 0.03 0 0.97 C 0 0.75 0 CPCG0259 16192 C C 0 0.78 0 0.22 C 0 1 0 CPCG0198 16192 C T 0 0.34 0 0.66 T 0 0.11 0 ICGC_PCA197 16192 C T 0 0.42 0 0.58 T 0 0.1 0 ICGC_PCA065 16213 G G 0.27 0 0.73 0 A 0.6 0 0.4 EOPC-05 16278 T T 0 0.5 0 0.5 C 0 1 0 ICGC_PCA169 16304 T T 0 0.34 0 0.66 C 0 1 0 ICGC_PCA098 16342 T C 0 0.85 0 0.15 C 0 0.57 0 ICGC_PCA183 16390 G A 0.86 0 0.14 0 G 0.23 0 0.76 ICGC_PCA184 16465 C C 0 0.89 0 0.11 C 0 0.55 0 Tumour Locus Normal.HF. Coverag Coveragemt Difference Patient H Normal DNA in H nucleotide.variability.sco CPCG0187 1 7399 1019 CR 0.22 0.00186 CPCG0078 1 6109 427 CR 0.73 0.0925 CPCG0114 0 1191 4684 CR 1 0.0925 CPCG0263 1 5744 867 CR 0.5 0.0925 ICGC_PCA071 1 3206 1797 CR 0.89 0.0925 CPCG0166 0 157 1517 CR 0.24 0.941 CPCG0098 1 7027 1946 CR 0.7 0.661 CPCG0100 0.99 6441 961 CR 0.41 0.661 ICGC_PCA169 0.8 7149 3256 CR 0.49 0.661 ICGC_PCA198 0.17 6081 1906 CR 0.66 0.661 CPCG0206 0.82 6953 1192 CR 0.66 0.841 Baca07-4610 1 1429 3202 CR 0.27 0.841 ICGC_PCA032 1 2545 1947 CR 0.99 0.841 CPCG0204 0 4619 2424 CR 0.51 0.0184 CPCG0073 1 7698 1420 CR 0.26 0.721 CPCG0196 1 7693 1938 CR 0.37 0.721 ICGC_PCA118 0.89 3858 1854 CR 0.46 0.721 ICGC_PCA166 0.85 3353 1316 CR 0.71 0.161 ICGC_PCA015 0 3875 2173 CR 0.51 0.15 CPCG0098 0 6941 1904 CR 0.76 0.0275 CPCG0205 0 7020 1057 CR 0.67 0.017 CPCG0242 0 5708 1313 CR 0.81 0.0218 ICGC_PCA031 0 3788 3533 CR 0.77 0.0218 CPCG0070 0 7301 1864 CR 0.24 0.00171 CPCG0256 0 5127 836 CR 0.45 0.00081 CPCG0158 0 3733 418 CR 0.36 0.00028 CPCG0081 0 4648 833 CR 0.38 0.00196 Baca06-3199 0 3321 2031 CR 0.77 0.00196 CPCG0344 0 5510 767 CR 0.22 0.129 CPCG0046 0 5136 1358 CR 0.29 0 CPCG0342 0 7015 1140 CR 0.88 0 ICGC_PCA125 0 2350 2351 CR 0.22 0.0064 CPCG0067 0 4991 1353 TF 0.49 0 CPCG0189 1 7069 1697 RNR1 0.5 0.00327 CPCG0189 1 7749 1636 RNR1 0.27 0 CPCG0083 0 7699 2079 RNR1 0.56 0.481 ICGC_PCA196 0 4203 2359 RNR1 0.32 0.481 CPCG0073 0 7538 1856 RNR1 0.38 0.0371 CPCG0019 0 6070 1334 RNR1 0.52 0 CPCG0248 0 7286 1825 RNR1 0.42 0.00217 CPCG0346 0 7487 2850 RNR1 0.38 0.00217 EOPC-07 0 2637 1193 RNR1 0.36 0.00217 CPCG0204 0 6944 3211 RNR1 0.66 0 CPCG0211 0 7251 955 RNR1 0.26 0 ICGC_PCA057 1 5267 3788 RNR1 0.53 0 EOPC-04 0.68 4416 5078 RNR1 0.22 0.0184 CPCG0090 0 7220 1809 RNR1 0.7 0 ICGC_PCA192 0 3833 3210 RNR1 0.32 0 ICGC_PCA032 0 3591 2798 RNR1 1 0.00255 CPCG0185 1 6988 1393 RNR1 0.45 0 CPCG0412 0 7430 2608 RNR1 0.51 0 CPCG0268 0 7268 1827 RNR1 0.22 0 CPCG0097 0 7544 1857 TV 0.25 0 ICGC_PCA103 1 5490 3077 TV 0.46 0 ICGC_PCA032 0 3512 2843 RNR2 1 0.00071 ICGC_PCA161 1 4449 1742 RNR2 0.73 0 ICGC_PCA075 0 5071 4007 RNR2 0.44 0.00024 CPCG0339 0 4152 2079 RNR2 0.59 0 CPCG0098 1 7264 3250 RNR2 0.77 0 CPCG0100 0 6650 1492 RNR2 0.64 0 CPCG0027 0.75 7869 2386 RNR2 0.25 0 ICGC_PCA083 0 3888 7545 RNR2 0.6 0 Baca05-3852 0 5544 535 RNR2 0.88 0 CPCG0388 0 6248 1625 RNR2 0.35 0 CPCG0183 0.01 6505 980 RNR2 0.22 0 CPCG0081 0 7720 2093 RNR2 0.63 0 ICGC_PCA029 0 4628 3828 RNR2 0.26 0 CPCG0040 1 7075 2426 RNR2 0.26 0.00021 CPCG0358 1 7226 6151 RNR2 0.41 0 CPCG0005 0 7295 1990 RNR2 0.48 0 ICGC_PCA182 1 7240 3411 RNR2 0.72 0 TCGA-CH-5750 0 7221 4353 RNR2 0.47 0 ICGC_PCA068 0 5749 5208 RNR2 0.5 0.00027 CPCG0217 0.76 7556 2046 RNR2 0.24 0 ICGC_PCA070 0 5262 3922 RNR2 0.48 0 ICGC_PCA051 0 5144 2334 RNR2 0.32 0 ICGC_PCA163 0 6634 2865 RNR2 0.44 0 CPCG0331 0 7516 2137 RNR2 0.61 0 CPCG0410 0 6485 4343 RNR2 0.25 0 ICGC_PCA125 0 7482 5738 RNR2 0.69 0 CPCG0324 0 7139 1352 RNR2 0.61 0 CPCG0166 1 367 1680 RNR2 0.28 0 CPCG0212 1 5513 1785 TL1 0.23 0 CPCG0071 0 4204 1332 ND1 0.23 0.00194 CPCG0265 0 5814 1482 ND1 0.41 0.00248 TCGA-CH-5750 0 6324 3582 ND1 0.23 0 CPCG0120 0 3441 2086 ND1 0.35 0 CPCG0063 0 6812 2780 ND1 0.23 0 ICGC_PCA122 0 6541 3027 ND1 0.45 0 ICGC_PCA187 0 5568 7177 ND1 0.21 0 CPCG0127 0 6769 1093 ND1 0.22 0.00011 CPCG0233 0 5649 2007 ND1 0.4 0.00011 ICGC_PCA125 0 6863 4509 ND1 0.36 0 CPCG0213 0 7271 1878 ND1 0.22 0 Baca05-3852 0 3456 1689 ND1 0.62 0.00103 CPCG0027 0 6519 580 ND1 0.59 0 TCGA-EJ-5506 0 4987 2746 ND1 0.21 0 CPCG0003 0 6785 632 ND1 0.24 0 CPCG0067 0 2905 1230 ND1 0.42 0.00257 ICGC_PCA098 1 3721 2957 ND1 0.53 0.00147 CPCG0067 0 6634 1169 TM 0.64 0 CPCG0387 0 7674 4629 TM 0.44 0 CPCG0262 0 7254 1360 ND2 0.27 0 ICGC_PCA171 0 7144 4922 ND2 0.46 0.0858 CPCG0204 0 4280 1516 ND2 0.68 0.00408 CPCG0117 1 7586 1489 ND2 0.36 0 CPCG0407 0 7113 2902 ND2 0.75 0 EOPC-03 0 7611 2736 ND2 0.61 0 CPCG0409 1 7397 2673 ND2 0.6 0 CPCG0071 1 6739 2006 ND2 0.5 0 CPCG0339 1 7113 1937 ND2 0.67 0 CPCG0046 0 288 1559 ND2 0.28 0 ICGC_PCA142 0 7261 4736 ND2 0.22 0.0118 CPCG0201 1 7055 3046 ND2 0.9 0 CPCG0020 0 7404 1841 ND2 0.39 0.00086 CPCG0267 0 6248 1665 ND2 0.28 0 ICGC_PCA185 0 7102 4152 ND2 0.24 0.0256 CPCG0242 1 7001 2241 ND2 0.83 0 ICGC_PCA013 0 7020 3818 TW 0.53 0 ICGC_PCA140 1 6911 4936 OLR/TC 0.61 0.0118 EOPC-07 1 4007 1500 TC 0.86 0.0097 CPCG0350 0 6052 1047 CO1 0.67 0.0058 TCGA-G9-6336 0 6381 1569 CO1 0.48 0.00634 CPCG0356 0.57 7024 4267 CO1 0.48 0.00462 ICGC_PCA048 1 5163 4643 CO1 0.28 0 CPCG0050 0 5512 1528 CO1 0.66 0.00066 CPCG0189 0 7176 1576 CO1 0.24 0 CPCG0251 0 7014 1437 CO1 0.42 0 TCGA-G9-6336 0 7462 1839 CO1 0.5 0 CPCG0123 0.0 6441 1175 CO1 0.2 0 CPCG0211 0 6273 552 CO1 0.23 0 CPCG0102 0 6397 3188 CO1 0.58 0 CPCG0124 0.56 7058 1440 CO1 0.36 0 ICGC_PCA060 0 7205 7567 CO1 0.53 0 CPCG0096 1 6034 2223 CO1 0.66 0 CPCG0331 1 7235 1771 CO1 0.6 0 CPCG0090 0 6649 1932 CO1 0.51 0 CPCG0189 1 7555 1925 CO1 0.25 0.00103 ICGC_PCA155 0 6855 819 CO1 0.4 0 EOPC-010 0 7413 2975 CO1 0.25 0 ICGC_PCA029 0 3325 2640 CO1 0.24 0 EOPC-010 0 4490 1572 TD 0.25 0 CPCG0124 0 6491 1205 CO2 0.36 0.0011 ICGC_PCA156 1 7302 3926 CO2 0.37 0 CPCG0378 0 6772 5709 CO2 0.26 0 CPCG0266 0.25 7012 1479 CO2 0.23 0 ICGC_PCA123 0 7456 5877 CO2 0.58 0 ICGC_PCA023 0 6794 6873 CO2 0.24 0.00189 ICGC_PCA174 0 6855 3534 TK 0.2 0.00857 CPCG0345 0 7322 1822 ATP8 0.32 0 CPCG0103 0 6860 2618 ATP8 0.79 0.0246 CPCG0196 1 6447 2231 ATP8 0.37 0.00559 ICGC_PCA193 1 5751 3664 ATP8/ATP6 0.54 0.00156 CPCG0063 0.37 6261 2790 ATP6 0.53 0 ICGC_PCA029 0 5997 5168 ATP6 0.32 0.201 CPCG0082 0.51 7435 1975 ATP6 0.47 0.0283 CPCG0217 0.75 7444 2102 ATP6 0.25 0.0274 Berger3043 1 5909 1314 ATP6 0.9 0.00083 CPCG0380 0 7258 3467 ATP6 0.62 0.00511 ICGC_PCA026 1 5862 2491 ATP6 0.21 0.00053 ICGC_PCA166 1 6300 2166 CO3 0.41 0 CPCG0349 0 7132 3251 CO3 0.61 0.0812 CPCG0262 0 7125 1416 CO3 0.84 0 CPCG0234 1 4614 1440 CO3 0.34 0 CPCG0070 0 7552 3285 CO3 0.59 0 CPCG0089 0 1850 3343 CO3 0.21 0 CPCG0269 0 4745 1771 CO3 0.28 0 CPCG0356 0.41 7503 4975 CO3 0.37 0.00103 CPCG0072 0 7079 2208 CO3 0.53 0.0198 CPCG0249 1 7215 1259 CO3 0.78 0.00141 ICGC_PCA086 1 7088 2008 CO3 0.38 0.00197 ICGC_PCA095 1 5302 2570 CO3 0.4 0.00221 ICGC_PCA193 0 6772 4094 TG 0.53 0 CPCG0128 0 7724 1809 TG 0.27 0.002 ICGC_PCA036 0 6512 3122 ND3 0.76 0 CPCG0114 0 2378 238 ND3 0.28 0 CPCG0166 0 153 980 ND3 0.22 0 CPCG0211 0.01 6462 499 ND3 0.22 0 EOPC-07 1 5874 1890 ND4L 0.4 0 CPCG0407 0 6878 3234 ND4L 0.77 0.0365 CPCG0256 1 7519 2396 ND4 0.4 0.00812 CPCG0331 1 7132 2482 ND4 0.26 0 CPCG0340 0.5 7598 3995 ND4 0.5 0 CPCG0324 0 7196 1616 ND4 0.24 0.0111 CPCG0040 1 7313 2729 ND4 0.77 0 Berger0508 0 4134 2002 ND4 0.33 0 Berger0508 0 6491 2191 ND4 0.89 0.00028 CPCG0046 0 6313 1618 ND4 0.69 0 CPCG0377 0 6420 4942 ND4 0.72 0.00031 ICGC_PCA041 0 2870 4121 ND4 0.48 0.00031 ICGC_PCA032 0 3705 3293 ND4 1 0.00765 CPCG0410 1 7377 4888 ND4 0.54 0 CPCG0103 0 4684 2047 ND4 0.21 0.00133 CPCG0374 1 7671 5544 ND4 0.57 0.00517 ICGC_PCA081 1 4677 2560 ND4 0.54 0.00031 CPCG0095 0 7450 2951 ND4 0.27 0 CPCG0076 0.3 4736 1587 ND4 0.4 0.00362 Berger0508 1 6497 2589 TH 0.86 0.00019 CPCG0114 0 3186 5946 TL2 0.57 0 ICGC_PCA161 0.97 4292 1590 TL2 0.43 0 CPCG0201 1 7591 2761 TL2 0.68 0.00029 CPCG0361 0 7551 4234 ND5 0.26 0.1 BacaSTID0000002872 0 183 1474 ND5 0.83 0.015 ICGC_PCA065 0 7408 1300 ND5 0.35 0.00279 CPCG0242 0 7601 2456 ND5 0.21 0.0141 CPCG0030 1 7622 1873 ND5 0.24 0 CPCG0352 0 7357 4405 ND5 0.55 0 CPCG0336 1 7419 2631 ND5 0.54 0 CPCG0030 1 7629 1932 ND5 0.24 0 CPCG0236 0 6877 2433 ND5 0.75 0 Baca09-37 0 6642 6007 ND5 0.75 0 ICGC_PCA168 0 6759 4656 ND5 0.28 0 Berger3043 0 5006 990 ND5 0.46 0 CPCG0232 0 6628 1541 ND5 0.58 0 CPCG0234 1 295 1454 ND5 0.61 0.00461 Baca06-1749 0 7251 3030 ND5 0.41 0.00031 ICGC_PCA036 0 6801 4156 ND5 0.76 0 CPCG0379 0 7201 3751 ND5 0.35 0.211 ICGC_PCA180 0 6979 2001 ND5 0.77 0 Baca05-3595 0 6961 2522 ND5 0.56 0.00236 CPCG0213 1 7171 2098 ND5 0.54 0 CPCG0166 1 7083 1554 ND5 0.22 0 CPCG0166 1 398 1424 ND5 0.21 0.0003 CPCG0046 0.65 6727 1402 ND5 0.35 0 ICGC_PCA075 0 3756 3035 ND5 0.25 0.114 ICGC_PCA170 1 7154 2599 ND5 0.23 0 CPCG0190 1 7560 2513 ND5 0.46 0.00027 CPCG0217 1 7275 1953 ND5 0.3 0 CPCG0410 0.97 7279 4769 ND5 0.76 0 Baca05-1657 0 6778 3786 ND5 0.62 0.186 CPCG0237 0 7437 1036 ND5 0.22 0.0164 Berger3043 1 6560 1893 ND6 0.88 0 CPCG0372 1 7566 3645 ND6 0.41 0 EOPC-07 0 4980 1721 ND6 0.6 0.0729 CPCG0249 1 7357 1129 ND6 0.76 0 Baca07-4941 0 3170 1959 CYB 0.29 0.0136 CPCG0340 0 7024 3083 CYB 0.88 0 CPCG0387 0 7477 5472 CYB 0.32 0 CPCG0346 0 4764 2409 CYB 0.25 0 CPCG0078 1 7038 1289 CYB 0.61 0.00033 CPCG0355 0 6335 1368 CYB 0.24 0.00031 CPCG0412 0 4519 2562 CYB 0.31 0.00031 Baca08-4154 0.28 221 5590 CYB 0.64 0.0067 ICGC_PCA198 0 7015 2528 CYB 0.65 0.0185 CPCG0067 0 4219 1679 CYB 0.24 0 Berger3027 0.48 4499 1352 CYB 0.39 0 Baca03-1426 0 6803 4209 CYB 0.25 0.00271 CPCG0057 0 7107 2735 CYB 0.73 0.003 CPCG0412 0 7517 2739 CYB 0.37 0 CPCG0269 0 7524 1818 CYB 0.62 0.00907 CPCG0213 0 7336 2332 CYB 0.28 0 CPCG0269 0 7399 1904 CYB 0.56 0.0137 CPCG0356 0 7391 5417 CYB 0.54 0.126 CPCG0098 0 7718 3054 TT 0.22 0.137 CPCG0233 0 7280 2657 TP 0.81 0 ICGC_PCA180 0 7261 2185 TP 0.28 0.00565 ICGC_PCA091 1 5566 6514 TP 0.28 0 ICGC_PCA193 0 5964 4106 TP 0.61 0 CPCG0404 1 6955 5096 CR 0.85 0 CPCG0001 0 5872 1725 CR 0.23 0 ICGC_PCA098 0 5399 4407 CR 0.22 0 CPCG0269 0 7225 1653 CR 0.25 0.0148 CPCG0250 0 6934 2719 CR 0.33 0.112 CPCG0040 0 7485 1734 CR 0.3 0.0679 CPCG0128 0.04 7595 1451 CR 0.79 0.0481 CPCG0189 0.04 7272 1972 CR 0.24 0.275 CPCG0368 0.01 7180 3200 CR 0.26 0.275 CPCG0097 0.55 6981 2403 CR 0.42 0.275 TCGA-CH-5788 0.07 7767 4952 CR 0.77 0.275 TCGA-EJ-5506 0.04 7178 4245 CR 0.27 0.275 TCGA-HC-7075 0.06 7451 2210 CR 0.91 0.275 ICGC_PCA097 0.06 7434 3754 CR 0.38 0.275 ICGC_PCA170 0.1 7134 2704 CR 0.79 0.275 ICGC_PCA184 0.02 7025 4272 CR 0.79 0.275 CPCG0183 0 6878 1782 CR 0.22 0.0331 EOPC-04 0 6318 6134 CR 0.71 0.0575 CPCG0046 0 5392 1447 CR 0.83 0.0425 CPCG0355 0 7034 2115 CR 0.26 0.0712 ICGC_PCA032 0 4047 3363 CR 0.99 0.0386 Baca05-3595 0 1937 421 CR 0.37 0.444 CPCG0256 0 4286 982 CR 0.36 0.831 CPCG0352 0 6912 3003 CR 0.66 0.0332 CPCG0084 0 6562 1739 CR 0.23 0.0562 CPCG0114 0.25 2572 6657 CR 0.72 0.756 CPCG0259 0 7485 2143 CR 0.22 0.185 CPCG0198 0.89 7328 3030 CR 0.23 0.185 ICGC_PCA197 0.9 6039 2439 CR 0.32 0.185 ICGC_PCA065 0 7620 1314 CR 0.33 0.0359 EOPC-05 0 4040 1831 CR 0.5 0.34 ICGC_PCA169 0 7178 3126 CR 0.66 0.264 ICGC_PCA098 0.43 4197 3207 CR 0.28 0.0315 ICGC_PCA183 0 3737 1891 CR 0.62 0.211 ICGC_PCA184 0.45 4483 2172 CR 0.34 0.0153 Tumour MutPred.patho- PolyPhen.2.HumDiv.Pro A HF change.in.AA genicity.sco PolyPhen.2.HumDiv.Pred adju NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0.563 0.38 benign 0.354 0 benign 0.618 0.879 possibly damaging 0.854 1 probably damaging Premature Stop NA Codon Premature Stop NA NA Codon Premature Stop NA NA Codon E214K 0.778 0.999 probably damaging E214K 0.778 0.999 probably damaging G218D 0.775 1 probably damaging A226T 0.616 0.995 probably damaging syn NA R279Q 0.879 0.974 probably damaging R279Q 0.879 0.974 probably damaging A299T 0.632 0.04 benign I309V 0.427 0 benign syn NA NA NA NA A5T 0.194 1 probably damaging V8I 0.439 0 benign V43I 0.366 0.006 benign F60S 0.796 1 probably damaging A101T 0.717 1 probably damaging G121D 0.809 1 probably damaging L130P 0.737 0.999 probably damaging S140P 0.875 0.997 probably damaging S146P 0.635 0.925 possibly damaging V151M 0.499 0.072 benign syn NA NA F216L 0.676 0.221 benign syn NA G253D 0.851 1 probably damaging I278V 0.311 0.005 benign Stop Codon−>Q NA NA NA NA NA NA A3T 0.239 0.012 benign A26T 0.769 0.998 probably damaging syn NA L48P 0.785 0.973 probably damaging D51N 0.715 0.998 probably damaging Premature Stop NA Codon G125S 0.926 1 probably damaging Premature Stop NA Codon K172N 0.701 1 probably damaging K172N 0.701 1 probably damaging S198F 0.672 1 probably damaging I254T 0.708 0.673 possibly damaging G272D 0.771 1 probably damaging I280T 0.69 0.997 probably damaging V318A 0.541 0.998 probably damaging S330N 0.519 0.001 benign syn NA A375T 0.675 1 probably damaging A464T 0.34 0.999 probably damaging G497E 0.356 1 probably damaging NA T63A 0.523 0.017 benign L73P 0.768 1 probably damaging D112N 0.634 1 probably damaging G115V 0.544 0.989 probably damaging V138I 0.609 0.798 possibly damaging V165I 0.616 0 benign NA NA Premature Stop NA Codon P10S 0.569 0.993 probably damaging I23T 0.735 0.005 benign L61P 0.304 0.988 probably damaging syn NA syn NA NA M60T 0.202 0 benign I106T 0.642 0.617 possibly damaging V158A 0.704 0 benign S219N 0.6 0.995 probably damaging L220P 0.751 0.999 probably damaging W58R 0.85 0.998 probably damaging syn NA A100T 0.674 0.999 probably damaging S104P 0.732 0.997 probably damaging G141E 0.872 1 probably damaging R156Q/R156P 0.69/ 0.999/ probably damaging/ 0.731 1.0 probably damaging G194S 0.893 1 probably damaging syn NA A200T 0.708 0.006 benign S212P 0.636 0.997 probably damaging S229P 0.606 0.003 benign syn NA NA NA NA NA D42N 0.742 0.999 probably damaging L73F 0.543 1 probably damaging L73F 0.543 1 probably damaging L73F 0.543 1 probably damaging L30P 0.874 1 probably damaging syn NA NA NA syn NA L14R 0.752 0.999 probably damaging I36T 0.558 0.015 benign A131T 0.65 0.035 benign M195T 0.684 0.949 possibly damaging R245H 0.822 0.999 probably damaging R278Q 0.885 0.995 probably damaging V298M 0.605 0.85 possibly damaging A318P 0.765 1 probably damaging A318T 0.602 0.999 probably damaging syn NA NA L352P 0.783 0.987 probably damaging A365T 0.57 0.004 benign syn NA L394P 0.669 0.403 benign G397E 0.87 1 probably damaging syn NA NA NA NA NA NA NA NA NA syn NA I100V 0.381 0.925 possibly damaging syn NA NA syn NA L121P 0.719 1 probably damaging L122I 0.6 0.996 probably damaging F141S 0.671 0.997 probably damaging F141S 0.671 0.997 probably damaging G143S 0.637 1 probably damaging E145K 0.813 0.996 probably damaging R161Q 0.801 0.997 probably damaging G215D 0.769 1 probably damaging R262H 0.77 0.999 probably damaging syn NA syn NA G318D 0.781 1 probably damaging syn NA G376D 0.82 0.994 probably damaging S377N 0.707 0.003 benign M383T 0.631 0.452 benign S391P 0.793 0.997 probably damaging Y403H 0.651 0.008 benign I411T 0.702 0.001 benign A475P 0.472 0.101 benign C518R 0.501 0.003 benign F520S 0.673 0.997 probably damaging L526P 0.836 1 probably damaging F528L 0.72 0.996 probably damaging S531N 0.298 0.002 benign T556P 0.556 0.901 possibly damaging Stop Codon−>G NA I168V 0.534 0.997 probably damaging syn NA syn NA A29T 0.391 0 benign G34S 0.846 1 probably damaging G48E 0.825 1 probably damaging R80H 0.833 1 probably damaging I98T 0.669 0.997 probably damaging R100Q 0.824 1 probably damaging R100Q 0.824 1 probably damaging syn NA A193T 0.517 0.001 benign G210E 0.68 1 probably damaging L234F 0.217 1 probably damaging G251D 0.502 0.972 probably damaging syn NA S321N 0.709 0.996 probably damaging A329T 0.323 0 benign G339E 0.87 1 probably damaging syn NA A380T 0.204 0 benign NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA Tumour (Difference Tumour Tumour Tumour in HF C HF G HF T HF adjusted by change.in.AA adju adjusted adju cellularity 0 0.247191011 0 0.752808989 T 0.247191011 0 1 0 0 C 1 0 0 0 1 T 1 0 1 0 0 C 1 0 0.89 0 0.11 C 0.89 0 0 1 0 G 0.99 0 0.897435897 0 0.102564103 C 0.897435897 0 0.612941176 0 0.387058824 C 0.602941176 0 0.69 0 0.31 C 0.49 0 0.18 0 0.82 T 0.65 0 1 0 0 C 0.82 0 0.27 0 0.73 T 0.27 0 0.99 0 0.01 C 0.99 0.420454545 0 0.579545455 0 G 0.579545455 0 0.346666667 0 0.653333333 T 0.346666667 0 0.415730337 0 0.584269663 T 0.415730337 0 0.56 0 0.43 C 0.46 0 0.86 0 0.14 C 0.71 0.2 0 0.8 0 G 0.51 0.025641026 0 0.974358974 0 G 0.974358974 1 0 0 0 A 0.84 0 0 1 0 G 1 0.16 0 0.84 0 G 0.77 1 0 0 0 A 0.26 1 0.05 0 0 A 1 0 0.419354839 0 0.580645161 T 0.580645161 0 0.073170732 0 0.926829268 T 0.926829268 0 0.22 0 0.77 T 0.77 0.75 0 0.214285714 0 A 0.785714286 0.303370787 0.02247191 0.674157303 0 G 0.325842697 1 0 0 0 A 1 0.83 0.17 0 0 A 0.21 0.49 0 0.51 0 G 0.49 0 0.694444444 0 0.305555556 C 0.694444444 0 0.375 0 0.625 T 0.375 0.933333333 0 0.066666667 0 A 0.933333333 0.61 0 0.39 0 A 0.32 0.506666667 0 0.493333333 0 A 0.506666667 1 0 0 0 A 1 0.646153846 0 0.353846154 0 A 0.646153846 1 0 0 0 A 1 0.36 0 0.64 0 G 0.36 0.75 0 0.25 0 A 0.75 0.490566038 0 0.518301887 0 G 0.471698113 0 0.53 0 0.47 C 0.53 0 0.1 0 0.9 T 0.22 0.875 0 0.125 0 A 0.875 0.32 0 0.68 0 G 0.32 0 0 0 1 T 1 0 0.779661017 0 0.220338983 C 0.779661017 0.80952381 0 0.19047619 0 A 0.80952381 1 0 0 0 A 1 0.320512821 0 0.666666667 0 G 0.333333333 0 0.46 0 0.54 T 0.46 0 0 0 1 T 1 0 0.73 0 0.27 C 0.73 0.44 0 0.56 0 G 0.44 1 0 0 0 A 1 0 0.987179487 0 0.012820513 C 0.987179487 0.048823529 0 0.955882353 0 G 0.941176471 0 0 0 1 T 0.25 0.4 0 A 0.6 0.91 0 0.09 0 A 0.88 0.486486486 0 0.513513514 0 G 0.486486486 1 0 0 0 A 0.23 1 0 0 0 A 1 0.26 0 0.74 0 G 0.26 0 0.313253012 0 0.686746988 T 0.313253012 0 1 0 0 C 1 0.615384615 0 0.384615385 0 A 0.615384615 0 0.72 0 0.28 C 0.72 0.47 0 0.53 0 G 0.47 0.5 0 0.5 0 G 0.5 0 0 0 1 T 0.24 0.69 0 0.31 0 A 0.47 0.32 0 0.68 0 G 0.32 0.44 0 0.56 0 G 0.44 1 0 0 0 A 1 0.925925926 0 0.074074074 0 A 0.925925926 0.69 0 0.31 0 A 0.69 1 0 0 0 A 1 0 1 0 0 C 1 0 0.270588235 0 0.729411765 T 0.270588235 0.711176471 0.277058824 0 0.011764706 A 0.258823529 0.526315789 0 0.460526316 0 A 0.539473684 0.23 0 0.77 0 G 0.23 0.443037975 0 0.556962025 0 G 0.443037975 Premature Stop 0.916666667 0 0.041666667 0 A 0.958333333 Codon Premature Stop 0.45 0 0.55 0 G 0.45 Codon Premature Stop 0.21 0 0.79 0 G 0.21 Codon E214K 0.239130435 0 0.760869565 0 G 0.239130435 E214K 0.634920635 0 0.365079365 0 A 0.634920635 G218D 0.36 0 0.63 0 G 0.37 A226T 0.956521739 0 0.043478261 0 A 0.956521739 syn 0.34 0 0.65 0 G 0.62 R279Q 1 0 0 0 A 1 R279Q 0.21 0 0.79 0 G 0.2 A299T 0.315789474 0 0.684210526 0 G 0.315789474 I309V 0.58 0 0.42 0 A 0.42 syn 0 0.53 0 0.47 C 0.53 0.63 0 0.36 0 A 0.64 0 0.102040816 0 0.897959184 T 0.897959184 A5T 0.333333333 0 0.666666667 0 G 0.333333333 V8I 0.46 0 0.54 0 G 0.46 V43I 0.772727273 0 0.227272727 0 A 0.772727273 F60S 0 0.580645161 0 0.403225806 C 0.596774194 A101T 0.974025974 0 0.025974026 0 A 0.974025974 G121D 0.61 0 0.39 0 A 0.61 L130P 0 1 0 0 C 1 S140P 0 0.576470588 0 0.411764706 C 0.588235294 S146P 0 1 0 0 C 1 V151M 0.280898876 0 0.685393258 0.033707865 G 0.314606742 syn 0.96 0 0.04 0 A 0.22 F216L 0 1 0 0 C 1 syn 0.001797753 0.998202247 0 0 C 0.438202247 G253D 0.933333333 0 0.066666667 0 A 0.933333333 I278V 0.66 0 0.34 0 A 0.25 Stop Codon−>Q 0 1 0 0 C 1 0.53 0 0.47 0 A 0.53 0 0.61 0 0.39 C 0.61 0 0.86 0 0.14 C 0.86 A3T 0.848101266 0 0.151898734 0 A 0.848101266 A26T 0.48 0 0.52 0 G 0.48 syn 0 1 0 0 C 0.57 L48P 0 0.28 0 0.72 T 0.28 D51N 0.152608696 0 0.847391304 0 G 0.717391304 Premature Stop 0.333333333 0 0.666666667 0 G 0.333333333 Codon G125S 1 0 0 0 A 0.55 Premature Stop 0.5 0 0.5 0 G 0.5 Codon K172N 1 0 0 0 A 0.2 K172N 1 0 0 0 A 0.23 S198F 0 0.42 0 0.58 T 0.58 I254T 0 0.89 0 0.11 C 0.45 G272D 0.53 0 0.47 0 A 0.53 I280T 0 0.76744186 0 0.23255814 C 0.76744186 V318A 0 1 0 0 C 1 S330N 0.6375 0 0.3625 0 A 0.6375 syn 0 0.361111111 0 0.638888889 T 0.361111111 A375T 0.4 0 0.6 0 G 0.4 A464T 0.25 0 0.75 0 G 0.25 G497E 0.24 0 0.76 0 G 0.24 0.25 0 0.75 0 G 0.25 T63A 0.1 0 0.9 0 G 0.45 L73P 0 0.37 0 0.63 T 0.37 D112N 0.412698413 0 0.587301587 0 G 0.412698413 G115V 0 0 1 0 G 0.25 V138I 0.59 0 0.41 0 A 0.59 V165I 0.24 0 0.76 0 G 0.24 0.14 0 0.86 0 G 0.21 Premature Stop 0.41025641 0 0.58974359 0 G 0.41025641 Codon P10S 0 0.2 0 0.8 T 0.79 I23T 0 0.415730337 0 0.584269663 T 0.415730337 L61P 0 0.54 0 0.46 C 0.54 syn 0 0 0 1 T 0.63 syn 0.32 0 0.68 0 G 0.32 M60T 0 1 0 0 C 0.51 I106T 0 0 0 1 T 0.25 V158A 0 0.9 0 0.1 C 0.9 S219N 1 0 0 0 A 1 L220P 0 0.21 0 0.79 T 0.21 W58R 0 0.41 0 0.59 T 0.41 syn 1 0 0 0 A 0.81 A100T 1 0 0 0 A 1 S104P 0 0.365591398 0 0.634408602 T 0.365591398 G141E 0.694117647 0 0.305882353 0 A 0.694117647 R156Q/R156P 0.144578313 0.108433735 0.746987952 0 G 0.253012048 G194S 0.373333333 0 0.626666667 0 G 0.373333333 syn 0 0 0 1 T 0.59 A200T 0.120512821 0 0.879487179 0 G 0.679487179 S212P 0 1 0 0 C 1 S229P 0 0.38 0 0.62 T 0.38 syn 0 0.4 0 0.6 T 0.4 0.53 0 0.47 0 A 0.53 0.964347826 0 0.035652174 0 A 0.304347826 D42N 0.76 0 0.24 0 A 0.76 L73F 1 0 0 0 A 0.31 L73F 0 1 0 0 C 0.99 L73F 1 0 0 0 A 0.22 L30P 0 0.4 0 0.6 T 0.4 syn 1 0 3.60462E-17 0 A 1 syn 0 1 0 0 C 1 L14R 0 0 1 0 G 1 I36T 0 0 0 1 T 0.5 A131T 0.774193548 0 0.225806452 0 A 0.774193548 M195T 0 0.927710843 0 0.072289157 C 0.927710843 R245H 0.33 0 0.67 0 G 0.33 R278Q 0.9 0 0.1 0 A 0.9 V298M 0.935280899 0 0.064719101 0 A 0.775280899 A318P 0 1 0 0 C 1 A318T 0.48 0 0.52 0 G 0.48 syn 0 0 0 1 T 1 L352P 0 1 0 0 C 1 A365T 0.22 0 0.78 0 G 0.22 syn 0 1 0 0 C 1 L394P 0 0.54 0 0.46 C 0.54 G397E 0.3 0 0.7 0 G 0.3 syn 0 0.217647059 0 0.782352941 T 0.482352941 0 0.86 0 0.14 C 0.86 NA 0 0 1 0 G 0.57 0 0.45 0 0.55 T 0.42 0 0.829268293 0 0.170731707 C 0.829268293 syn 0.838709677 0 0.161290323 0 A 0.838709677 I100V 0.84 0 0.16 0 A 0.83 syn 0.3 0.7 0 0 C 0.35 syn 0.304347826 0 0.695652174 0 G 0.304347826 L121P 0 0.272727273 0 0.727272727 T 0.272727273 L122I 0.873015873 0.126984127 0 0 A 0.873015873 F141S 0 1 0 0 C 1 F141S 0 0.272727273 0 0.727272727 T 0.272727273 G143S 1 0 0 0 A 1 E145K 0.76 0 0.24 0 A 0.75 R161Q 0.28 0 0.72 0 G 0.28 G215D 0.46 0 0.54 0 G 0.46 R262H 0.734177215 0 0.265822785 0 A 0.734177215 syn 0 0.655913978 0 0.344086022 C 0.655913978 syn 0 0.59 0 0.41 C 0.41 G318D 0.76 0 0.24 0 A 0.76 syn 0.967532468 0 0.032467532 0 A 0.467532468 G376D 0.77 0 0.23 0 A 0.77 S377N 0.55 0 0.44 0 A 0.56 M383T 0 1 0 0 C 1 S391P 0 0.956521739 0 0.043478261 C 0.956521739 Y403H 0 0.869565217 0 0.086956522 C 0.913043478 I411T 0 0 0 1 T 0.35 A475P 0.75 0 0.25 0 A 0.25 C518R 0 0.23 0 0.77 T 0.23 F520S 0 1 0 0 C 1 L526P 0 1 0 0 C 1 F528L 0 1 0 0 C 0.97 S531N 0.62 0 0.38 0 A 0.62 T556P 1 0 0 0 A 0.22 Stop Codon−>G 0 0.88 0 0.12 C 0.88 I168V 0 1 0 0 C 1 syn 0.1 0 0.9 0 G 0.6 syn 0 1 0 0 C 1 A29T 0.29 0 0.71 0 G 0.29 G34S 1 0 0 0 A 1 G48E 0.653061224 0 0.346938776 0 A 0.653061224 R80H 0.961538462 0 0.038461538 0 A 0.961538462 I98T 0 1 0 0 C 1 R100Q 1 0 0 0 A 1 R100Q 0.492063492 0 0.507936508 0 G 0.492063492 syn 0 0.07 0 0.93 T 0.64 A193T 0.66 0 0.34 0 A 0.65 G210E 0.24 0 0.76 0 G 0.24 L234F 0 0.13 0 0.87 T 0.39 G251D 0.25 0 0.75 0 G 0.25 syn 0 0 0 1 T 1 S321N 0.587301587 0 0.412698413 0 A 0.587301587 A329T 0.826666667 0 0.173333333 0 A 0.826666667 G339E 1 0 0 0 A 1 syn 0.083333333 0 0.916666667 0 G 0.746666667 A380T 1 0 0 0 A 0.84 1 0 0 0 A 0.24 1 0 0 0 A 1 0.07 0 0.93 0 G 0.27 0 0.28 0 0.72 T 0.28 0.39 0 0.61 0 G 0.61 0 1 0 0 C 1 0.270588235 0 0.729411765 0 G 0.270588235 0.22 0 0.78 0 G 0.22 0.076666667 0 0.926666667 0 G 0.346666667 0 0 1 0 G 0.77 0 0.626506024 0 0.361445783 C 0.373493976 0 0.101304348 0 0.898695652 T 0.858695652 0 0.626666667 0 0.373333333 C 0.333333333 0 0 0 1 T 0.99 0 0 0 1 T 0.45 0 0.16 0 0.84 T 0.77 0 0.69 0 0.31 C 0.27 0 0.03 0 0.97 T 0.91 0 0.56 0 0.44 C 0.38 0 0.12 0 0.88 T 0.78 0 0.2 0 0.8 T 0.78 0 0.675714286 0 0.328571429 C 0.314285714 0 0.29 0 0.71 T 0.71 0.943820225 0 0.056179775 0 A 0.943820225 0 0 1 0 G 0.28 0 1 0 0 C 0.99 0.08 0.82 0.1 0 C 0.38 0 1 0 0 C 0.95 0 0 0 1 T 1 0 0.735632184 0 0.264367816 C 0.264367816 0 0 0 1 T 0.75 0 0 0 1 T 1 0 0.371363636 0 0.628636364 T 0.261363636 0 0.42 0 0.58 T 0.32 0.27 0 0.73 0 G 0.33 0 0.5 0 0.5 T 0.5 0 0.34 0 0.66 T 0.66 0 0.85 0 0.15 C 0.28 0.86 0 0.14 0 A 0.62 0 0.89 0 0.11 C 0.34

TABLE 6 Mitochondrial mutation recurrence for 41 nuclear genomic features Patient Control id Region tRNA CYB RNR1 RNR2 ND1 VD2 ND3 ND4 ND4L ND5 ND6 CO1 CO2 CO3 ATP6 CPCG0001 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0003 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 CPCG0006 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0020 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 CPCG0040 1 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 CPCG0046 1 0 0 0 0 0 1 0 1 0 1 0 0 0 0 0 CPCG0047 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0048 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0057 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0063 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 CPCG0073 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0078 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0081 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 CPCG0083 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0087 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0094 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0095 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 CPCG0098 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 CPCG0099 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0102 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 CPCG0114 1 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 CPCG0117 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 CPCG0121 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0123 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 CPCG0124 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 CPCG0127 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 CPCG0128 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0154 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0158 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0166 1 0 0 0 1 0 0 1 0 0 1 0 0 0 0 0 CPCG0182 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0183 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 CPCG0184 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0185 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0189 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 CPCG0190 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 CPCG0191 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0196 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0199 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0201 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 CPCG0205 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0206 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0208 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0210 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0211 0 0 0 1 0 0 0 1 0 0 0 0 1 0 0 0 CPCG0212 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0213 0 0 1 0 0 1 0 0 0 0 1 0 0 0 0 0 CPCG0217 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 1 CPCG0232 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 CPCG0233 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 CPCG0234 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 CPCG0236 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 CPCG0238 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0241 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0242 1 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 CPCG0246 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0248 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0249 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 CPCG0250 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0251 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 CPCG0255 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0256 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 CPCG0258 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0259 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0260 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0262 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 CPCG0263 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0265 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 CPCG0266 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 CPCG0267 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 CPCG0268 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0269 1 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 CPCG0324 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 CPCG0331 0 0 0 0 1 0 0 0 1 0 0 0 1 0 0 0 CPCG0334 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0336 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 CPCG0339 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 CPCG0340 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 CPCG0341 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0342 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0344 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0345 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0346 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0348 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0350 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 CPCG0352 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 CPCG0353 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0354 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0355 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0356 0 0 1 0 0 0 0 0 0 0 0 0 1 0 1 0 CPCG0357 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0358 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 CPCG0360 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0361 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 CPCG0362 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0363 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0364 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0365 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0366 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0368 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0369 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0371 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0372 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 CPCG0373 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0374 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 CPCG0375 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0378 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 CPCG0379 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 CPCG0380 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 CPCG0381 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0387 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0388 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 CPCG0391 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0392 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0401 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0404 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0407 0 0 0 0 0 0 1 0 1 1 0 0 0 0 0 0 CPCG0409 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 CPCG0410 0 0 0 0 1 0 0 0 1 0 1 0 0 0 0 0 CPCG0411 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0412 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0413 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0414 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0004 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0005 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 CPCG0007 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0008 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0015 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0019 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0022 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0027 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 CPCG0030 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 CPCG0036 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0042 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0050 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 CPCG0070 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 CPCG0071 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 CPCG0075 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0076 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 CPCG0082 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 CPCG0084 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0089 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 CPCG0090 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 CPCG0096 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 CPCG0097 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0120 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 CPCG0122 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0126 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0194 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0198 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0204 1 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 CPCG0237 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 CPCG0243 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0257 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0067 0 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 CPCG0103 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 CPCG0072 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 CPCG0100 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 CPCG0187 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0188 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0235 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0349 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 CPCG0377 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 CPCG0382 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 CPCG0408 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Berger0508 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 Berger0581 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Berger1701 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Berger1783 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Berger2832 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Berger3027 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 Berger3043 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 1 EOPC-02 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 EOPC-03 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 EOPC-04 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 EOPC-05 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 EOPC-06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 EOPC-07 0 1 0 1 0 0 0 0 1 1 0 1 0 0 0 0 EOPC-08 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 EOPC-09 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 EOPC-010 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 EOPC-011 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Baca03-1426 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 Baca05-1657 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 Baca05-3595 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 Baca05-3852 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 Baca06-1749 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 Baca06-3199 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Baca07-4610 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Baca07-4941 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 Baca07-5037 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Baca08-4154 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 Baca08-716 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Baca09-37 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 BacaSTID0000000410 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 BacaSTID0000002872 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 TCGA-CH-5750 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 TCGA-CH-5763 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TCGA-CH-5771 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TCGA-CH-5788 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TCGA-CH-5789 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TCGA-EJ-5503 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TCGA-EJ-5506 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 TCGA-EJ-7791 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TCGA-G9-6336 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 TCGA-G9-6365 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TCGA-G9-6370 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TCGA-G9-7522 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TCGA-HC-7075 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TCGA-HC-7079 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TCGA-HC-7233 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TCGA-HC-7737 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TCGA-HC-7740 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TCGA-HC-7744 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TCGA-HC-8258 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TCGA-HI-7169 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 nuclearSNV count PGA(median (median Patient mito_SNV dichot- chromo- dichot- id ATP8 OHR CSB1 HV1 HV2 Count ETS omized) kataegis_ind thripsis_ind omized) CPCG0001 0 0 0 1 0 1 1 1 0 0 1 CPCG0003 0 0 0 0 0 1 0 1 0 0 1 CPCG0006 0 0 0 0 0 0 0 1 1 0 1 CPCG0020 0 0 0 0 0 1 0 0 0 0 1 CPCG0040 0 0 0 1 0 3 0 1 1 0 1 CPCG0046 0 0 0 1 0 5 0 0 0 0 0 CPCG0047 0 0 0 0 0 0 1 1 0 0 1 CPCG0048 0 0 0 0 0 0 1 0 0 0 0 CPCG0057 0 0 0 0 0 1 1 1 0 0 1 CPCG0063 0 0 0 0 0 2 0 1 0 0 1 CPCG0073 0 1 0 0 1 2 1 1 0 0 1 CPCG0078 0 0 0 0 1 2 0 1 0 0 1 CPCG0081 0 1 0 0 1 2 1 1 1 0 1 CPCG0083 0 0 0 0 0 1 1 1 0 0 1 CPCG0087 0 0 0 0 0 0 1 1 1 0 1 CPCG0094 0 0 0 0 0 0 1 1 1 0 1 CPCG0095 0 0 0 0 0 1 1 1 0 0 0 CPCG0098 0 1 1 0 1 4 0 1 1 1 1 CPCG0099 0 0 0 0 0 0 0 1 0 0 1 CPCG0102 0 0 0 0 0 1 0 0 0 0 0 CPCG0114 0 0 0 1 1 4 1 0 0 0 0 CPCG0117 0 0 0 0 0 1 0 1 0 1 0 CPCG0121 0 0 0 0 0 0 1 1 0 0 0 CPCG0123 0 0 0 0 0 1 1 0 0 0 1 CPCG0124 0 0 0 0 0 2 1 0 0 0 1 CPCG0127 0 0 0 0 0 1 0 0 0 0 0 CPCG0128 0 0 0 1 0 2 0 0 0 1 1 CPCG0154 0 0 0 0 0 0 1 0 0 0 0 CPCG0158 0 1 0 0 1 1 1 1 0 0 1 CPCG0166 0 0 0 0 1 5 0 0 0 0 0 CPCG0182 0 0 0 0 0 0 1 0 0 0 0 CPCG0183 0 0 0 1 0 2 0 1 0 0 1 CPCG0184 0 0 0 0 0 0 0 1 0 0 0 CPCG0185 0 0 0 0 0 1 1 1 0 0 1 CPCG0189 0 0 0 1 0 5 1 1 0 1 1 CPCG0190 0 0 0 0 0 1 0 1 0 0 0 CPCG0191 0 0 0 0 0 0 1 1 0 1 0 CPCG0196 1 1 0 0 1 2 1 1 0 0 0 CPCG0199 0 0 0 0 0 0 0 0 0 0 0 CPCG0201 0 0 0 0 0 2 1 1 1 1 1 CPCG0205 0 1 1 0 1 1 0 0 0 0 0 CPCG0206 0 1 0 0 1 1 0 1 0 0 0 CPCG0208 0 0 0 0 0 0 0 0 0 1 1 CPCG0210 0 0 0 0 0 0 0 1 0 0 0 CPCG0211 0 0 0 0 0 3 1 1 0 0 1 CPCG0212 0 0 0 0 0 1 0 1 0 0 1 CPCG0213 0 0 0 0 0 3 1 1 0 0 0 CPCG0217 0 0 0 0 0 3 0 0 0 1 0 CPCG0232 0 0 0 0 0 1 1 1 0 1 1 CPCG0233 0 0 0 0 0 2 0 1 1 1 1 CPCG0234 0 0 0 0 0 2 0 0 0 0 0 CPCG0236 0 0 0 0 0 1 0 1 1 1 1 CPCG0238 0 0 0 0 0 0 1 1 0 1 0 CPCG0241 0 0 0 0 0 0 1 1 0 0 1 CPCG0242 0 1 1 0 1 3 1 1 0 0 1 CPCG0246 0 0 0 0 0 0 0 0 0 0 0 CPCG0248 0 0 0 0 0 1 1 1 1 0 1 CPCG0249 0 0 0 0 0 2 0 1 1 1 1 CPCG0250 0 0 0 1 0 1 1 0 0 0 0 CPCG0251 0 0 0 0 0 1 0 0 1 0 0 CPCG0255 0 0 0 0 0 0 0 1 1 1 1 CPCG0256 0 1 0 1 1 3 1 0 1 0 0 CPCG0258 0 0 0 0 0 0 1 0 0 0 0 CPCG0259 0 0 0 1 0 1 0 0 0 0 1 CPCG0260 0 0 0 0 0 0 1 1 0 1 1 CPCG0262 0 0 0 0 0 2 1 1 1 0 1 CPCG0263 0 0 0 0 1 1 0 1 0 1 0 CPCG0265 0 0 0 0 0 1 1 0 1 0 1 CPCG0266 0 0 0 0 0 1 1 1 0 0 1 CPCG0267 0 0 0 0 0 1 0 0 0 0 0 CPCG0268 0 0 0 0 0 1 0 1 1 1 0 CPCG0269 0 0 0 1 0 4 0 0 0 0 1 CPCG0324 0 0 0 0 0 2 1 1 1 1 1 CPCG0331 0 0 0 0 0 3 1 1 0 0 1 CPCG0334 0 0 0 0 0 0 0 1 0 0 1 CPCG0336 0 0 0 0 0 1 1 0 1 0 0 CPCG0339 0 0 0 0 0 2 0 0 0 0 0 CPCG0340 0 0 0 0 0 2 1 1 1 1 1 CPCG0341 0 0 0 0 0 0 1 1 0 0 1 CPCG0342 0 0 0 0 0 1 1 0 0 0 1 CPCG0344 0 0 0 0 0 1 0 1 0 0 0 CPCG0345 1 0 0 0 0 1 0 1 0 0 1 CPCG0346 0 0 0 0 0 2 1 1 0 0 0 CPCG0348 0 0 0 0 0 0 0 0 0 0 0 CPCG0350 0 0 0 0 0 1 1 1 1 1 1 CPCG0352 0 0 0 1 0 2 1 1 0 0 0 CPCG0353 0 0 0 0 0 0 0 0 0 0 0 CPCG0354 0 0 0 0 0 0 1 0 1 0 1 CPCG0355 0 0 0 1 0 2 0 0 0 0 0 CPCG0356 0 0 0 0 0 3 1 1 1 0 0 CPCG0357 0 0 0 0 0 0 1 1 0 0 1 CPCG0358 0 0 0 0 0 1 1 1 0 0 0 CPCG0360 0 0 0 0 0 0 0 1 0 0 0 CPCG0361 0 0 0 0 0 1 1 0 0 0 0 CPCG0362 0 0 0 0 0 0 1 0 0 0 0 CPCG0363 0 0 0 0 0 0 0 0 0 0 0 CPCG0364 0 0 0 0 0 0 1 0 0 1 1 CPCG0365 0 0 0 0 0 0 0 0 0 0 0 CPCG0366 0 0 0 0 0 0 1 1 0 0 0 CPCG0368 0 0 0 1 0 1 0 0 0 0 0 CPCG0369 0 0 0 0 0 0 1 1 0 0 1 CPCG0371 0 0 0 0 0 0 1 1 1 0 1 CPCG0372 0 0 0 0 0 1 1 1 1 0 1 CPCG0373 0 0 0 0 0 0 0 0 0 0 0 CPCG0374 0 0 0 0 0 1 0 1 1 0 0 CPCG0375 0 0 0 0 0 0 0 1 0 0 1 CPCG0378 0 0 0 0 0 1 0 1 0 0 1 CPCG0379 0 0 0 0 0 1 1 1 0 1 1 CPCG0380 0 0 0 0 0 1 1 1 0 0 1 CPCG0381 0 0 0 0 0 0 0 0 0 0 0 CPCG0387 0 0 0 0 0 2 0 0 0 0 1 CPCG0388 0 0 0 0 0 1 0 1 0 1 1 CPCG0391 0 0 0 0 0 0 0 0 0 0 0 CPCG0392 0 0 0 0 0 0 1 1 0 1 1 CPCG0401 0 0 0 0 0 0 0 0 0 0 0 CPCG0404 0 0 0 1 0 1 0 1 1 0 1 CPCG0407 0 0 0 0 0 2 1 1 0 0 1 CPCG0409 0 0 0 0 0 1 1 0 0 0 1 CPCG0410 0 0 0 0 0 3 1 1 0 1 0 CPCG0411 0 0 0 0 0 0 0 0 0 0 0 CPCG0412 0 0 0 0 0 3 1 1 1 0 1 CPCG0413 0 0 0 0 0 0 0 0 0 0 0 CPCG0414 0 0 0 0 0 0 0 0 1 0 0 CPCG0004 0 0 0 0 0 0 NA NA NA NA NA CPCG0005 0 0 0 0 0 1 NA NA NA NA NA CPCG0007 0 0 0 0 0 0 NA NA NA NA NA CPCG0008 0 0 0 0 0 0 NA NA NA NA NA CPCG0015 0 0 0 0 0 0 NA NA NA NA NA CPCG0019 0 0 0 0 0 1 NA NA NA NA NA CPCG0022 0 0 0 0 0 0 0 0 0 0 0 CPCG0027 0 0 0 0 0 2 0 0 0 0 0 CPCG0030 0 0 0 0 0 2 NA NA NA NA NA CPCG0036 0 0 0 0 0 0 NA NA NA NA NA CPCG0042 0 0 0 0 0 0 NA NA NA NA NA CPCG0050 0 0 0 0 0 1 0 0 0 0 1 CPCG0070 0 1 0 0 1 2 NA NA NA NA NA CPCG0071 0 0 0 0 0 2 NA NA NA NA NA CPCG0075 0 0 0 0 0 0 NA NA NA NA NA CPCG0076 0 0 0 0 0 1 NA NA NA NA NA CPCG0082 0 0 0 0 0 1 NA NA NA NA NA CPCG0084 0 0 0 1 0 1 NA NA NA NA NA CPCG0089 0 0 0 0 0 1 NA NA NA NA NA CPCG0090 0 0 0 0 0 2 0 0 0 0 1 CPCG0096 0 0 0 0 0 1 NA NA NA NA NA CPCG0097 0 0 0 1 0 2 NA NA NA NA NA CPCG0120 0 0 0 0 0 1 NA NA NA NA NA CPCG0122 0 0 0 0 0 0 1 0 1 0 0 CPCG0126 0 0 0 0 0 0 NA NA NA NA NA CPCG0194 0 0 0 0 0 0 NA NA NA NA NA CPCG0198 0 0 0 1 0 1 NA NA NA NA NA CPCG0204 0 1 0 0 1 3 NA NA NA NA NA CPCG0237 0 0 0 0 0 1 0 0 0 0 0 CPCG0243 0 0 0 0 0 0 0 0 0 0 0 CPCG0257 0 0 0 0 0 0 NA NA NA NA NA CPCG0067 0 0 0 0 0 4 NA NA NA NA NA CPCG0103 1 0 0 0 0 2 NA NA NA NA NA CPCG0072 0 0 0 0 0 1 NA NA NA NA NA CPCG0100 0 1 0 0 1 2 NA NA NA NA NA CPCG0187 0 0 0 0 1 1 NA NA NA NA NA CPCG0188 0 0 0 0 0 0 NA NA NA NA NA CPCG0235 0 0 0 0 0 0 NA NA NA NA NA CPCG0349 0 0 0 0 0 1 NA NA NA NA NA CPCG0377 0 0 0 0 0 1 NA NA NA NA NA CPCG0382 0 0 0 0 0 0 NA NA NA NA NA CPCG0408 0 0 0 0 0 0 NA NA NA NA NA Berger0508 0 0 0 0 0 3 0 NA 1 NA 0 Berger0581 0 0 0 0 0 0 NA NA NA NA NA Berger1701 0 0 0 0 0 0 1 NA 0 NA 0 Berger1783 0 0 0 0 0 0 NA NA NA NA NA Berger2832 0 0 0 0 0 0 1 NA 0 NA 0 Berger3027 0 0 0 0 0 1 NA NA NA NA NA Berger3043 0 0 0 0 0 3 0 NA 0 NA 1 EOPC-02 0 0 0 0 0 0 0 NA 0 NA 0 EOPC-03 0 0 0 0 0 1 NA NA NA NA NA EOPC-04 0 0 0 1 0 2 0 NA 1 NA 1 EOPC-05 0 0 0 1 0 1 0 NA 0 NA 0 EOPC-06 0 0 0 0 0 0 0 NA 0 NA 0 EOPC-07 0 0 0 0 0 4 0 NA 0 NA 0 EOPC-08 0 0 0 0 0 0 0 NA 0 NA 0 EOPC-09 0 0 0 0 0 0 0 NA 0 NA 0 EOPC-010 0 0 0 0 0 2 0 NA 0 NA 0 EOPC-011 0 0 0 0 0 0 0 NA 0 NA 0 Baca03-1426 0 0 0 0 0 1 1 0 0 0 1 Baca05-1657 0 0 0 0 0 1 1 0 0 0 0 Baca05-3595 0 0 0 1 0 2 0 0 0 0 1 Baca05-3852 0 0 0 0 0 2 1 0 0 0 0 Baca06-1749 0 0 0 0 0 1 0 1 1 1 0 Baca06-3199 0 1 0 0 1 1 1 1 1 0 1 Baca07-4610 0 1 0 0 1 1 1 1 0 0 1 Baca07-4941 0 0 0 0 0 1 1 0 0 0 1 Baca07-5037 0 0 0 0 0 0 1 0 0 0 1 Baca08-4154 0 0 0 0 0 1 0 1 1 0 1 Baca08-716 0 0 0 0 0 0 0 0 1 0 1 Baca09-37 0 0 0 0 0 1 1 0 0 0 1 BacaSTID0000000410 0 0 0 0 0 0 0 0 0 0 0 BacaSTID0000002872 0 0 0 0 0 1 1 0 1 0 0 TCGA-CH-5750 0 0 0 0 0 2 0 0 1 0 1 TCGA-CH-5763 0 0 0 0 0 0 NA NA NA NA NA TCGA-CH-5771 0 0 0 0 0 0 NA NA NA NA NA TCGA-CH-5788 0 0 0 1 0 1 0 1 1 1 1 TCGA-CH-5789 0 0 0 0 0 0 0 0 0 0 0 TCGA-EJ-5503 0 0 0 0 0 0 NA NA NA NA NA TCGA-EJ-5506 0 0 0 1 0 2 NA NA NA NA NA TCGA-EJ-7791 0 0 0 0 0 0 0 0 0 0 0 TCGA-G9-6336 0 0 0 0 0 2 1 0 0 0 0 TCGA-G9-6365 0 0 0 0 0 0 1 0 0 0 1 TCGA-G9-6370 0 0 0 0 0 0 0 0 0 0 0 TCGA-G9-7522 0 0 0 0 0 0 0 0 0 0 0 TCGA-HC-7075 0 0 0 1 0 1 0 0 0 1 1 TCGA-HC-7079 0 0 0 0 0 0 0 0 0 0 0 TCGA-HC-7233 0 0 0 0 0 0 0 0 0 0 1 TCGA-HC-7737 0 0 0 0 0 0 NA NA NA NA NA TCGA-HC-7740 0 0 0 0 0 0 0 0 0 0 0 TCGA-HC-7744 0 0 0 0 0 0 1 0 1 1 1 TCGA-HC-8258 0 0 0 0 0 0 0 0 0 0 0 TCGA-HI-7169 0 0 0 0 0 0 0 0 0 0 1 GR (median dichot- chr7: omized) CDH1_CNA CDKN1B_CNA CHD1_CNA MYC_CNA NKX3-1_CNA PTEN_CNA RB1_CNA TP53_CNA 145019604 0 0 0 0 0 −1 0 0 0 0 0 0 0 0 1 −1 0 −1 0 0 0 −1 0 0 1 −1 0 0 0 0 0 0 0 −1 0 0 0 0 0 0 0 0 0 −1 1 0 −1 −1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 −1 0 0 0 1 −1 0 0 0 0 0 −1 0 0 0 0 0 0 0 −1 0 −1 −1 0 0 0 0 0 1 −1 0 −1 0 0 0 0 0 0 1 −1 0 0 0 1 0 0 −1 0 1 −1 0 −1 0 0 1 −1 0 0 1 −1 0 0 −1 0 0 −1 0 0 1 −1 0 0 −1 0 1 0 0 −1 0 −1 −1 0 0 0 0 0 0 0 0 0 −1 −1 −1 0 0 0 0 0 0 0 −1 0 0 0 1 0 −1 0 1 −1 0 −1 0 1 1 0 0 −1 0 −1 −1 −1 0 0 0 0 0 0 0 0 0 0 −1 0 0 0 0 −1 0 0 −1 −1 0 0 1 0 −1 −1 0 0 0 −1 0 0 0 −1 0 0 0 −1 0 0 −1 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 −1 −1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 −1 0 0 −1 0 −1 0 0 0 0 0 0 0 0 0 0 0 0 1 −1 0 −1 0 0 −1 0 −1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 −1 0 0 −1 0 0 0 1 −1 0 −1 0 −1 0 0 0 0 0 1 0 −1 1 −1 −1 −1 −1 0 1 0 0 0 0 −1 −1 0 0 0 1 0 0 0 0 −1 0 −1 −1 0 1 0 0 −1 0 0 −1 0 0 0 1 0 0 0 0 −1 −1 0 0 0 1 0 1 0 0 0 0 −1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 −1 0 −1 0 −1 0 0 0 0 0 0 0 −1 −1 0 0 0 1 0 0 0 1 −1 0 0 0 0 1 0 0 0 0 −1 0 0 0 0 1 0 0 0 0 −1 0 0 −1 0 1 0 −1 0 0 −1 −1 −1 0 0 0 0 −1 0 0 −1 0 0 1 0 0 0 0 0 0 −1 −1 0 −1 0 0 −1 −1 0 0 0 0 0 0 0 1 −1 −1 0 0 −1 −1 0 −1 0 1 0 −1 −1 0 −1 0 −1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 −1 1 −1 0 0 0 0 1 0 0 0 0 0 −1 −1 0 0 1 0 0 0 0 −1 −1 0 0 0 1 0 0 0 1 −1 −1 0 0 0 0 0 −1 0 0 0 0 0 0 0 1 0 −1 0 0 −1 −1 0 −1 0 1 0 −1 −1 0 −1 0 −1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 −1 0 0 0 0 0 0 0 −1 −1 0 0 0 0 0 0 0 0 −1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 −1 0 0 0 0 −1 0 −1 0 1 −1 0 0 0 −1 0 0 0 0 1 −1 0 0 0 −1 −1 0 0 0 0 0 −1 0 0 −1 0 0 0 0 0 0 −1 0 0 −1 −1 0 0 0 1 0 −1 0 0 0 0 0 0 0 1 0 0 −1 0 0 0 0 0 0 0 0 −1 0 0 −1 0 0 0 0 1 −1 0 0 0 −1 −1 0 −1 0 1 0 −1 0 0 −1 −1 0 0 0 1 0 −1 0 0 −1 0 −1 0 0 1 0 0 0 0 0 0 0 −1 0 1 0 0 0 1 0 0 0 0 0 1 0 −1 −1 0 −1 −1 −1 0 0 0 −1 0 0 0 −1 0 −1 0 0 1 0 0 0 0 0 −1 −1 −1 0 1 0 0 0 0 0 0 −1 0 0 0 0 1 0 1 1 0 −1 0 1 1 0 −1 0 0 0 −1 −1 0 0 0 −1 0 0 0 −1 0 −1 −1 0 1 0 −1 0 0 −1 −1 0 0 0 0 0 0 0 0 −1 −1 −1 0 0 0 0 0 0 0 0 −1 −1 0 0 1 0 −1 0 0 −1 −1 0 −1 0 1 0 0 0 0 0 0 0 −1 0 0 −1 0 0 0 −1 0 0 0 0 1 0 0 0 0 0 −1 −1 −1 0 0 −1 0 0 0 0 0 −1 −1 0 1 0 −1 −1 0 −1 0 0 0 1 0 0 0 0 0 −1 −1 0 −1 0 0 0 0 0 0 0 −1 0 −1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 −1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 −1 −1 0 1 −1 0 0 −1 0 1 −1 −1 0 0 −1 0 0 0 0 1 0 −1 0 0 0 −1 −1 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 −1 0 0 0 0 0 0 1 −1 −1 0 0 −1 −1 0 0 0 1 −1 0 0 1 −1 0 −1 −1 0 1 0 0 0 1 −1 −1 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 −1 0 0 0 1 0 −1 −1 0 −1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 −1 −1 0 0 −1 −1 −1 0 0 0 −1 0 0 0 −1 0 0 0 1 0 0 −1 0 0 0 0 0 0 1 0 0 −1 0 −1 0 −1 −1 0 1 0 0 0 0 −1 −1 0 0 0 1 0 −1 0 0 −1 −1 0 −1 0 0 0 0 0 0 0 −1 0 0 0 1 −1 0 0 0 −1 −1 −1 −1 0 0 0 −1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 NA 0 0 0 0 −1 0 0 −1 NA NA 0 0 0 0 0 0 0 0 NA NA 0 −1 0 0 −1 0 −1 0 NA NA −1 0 0 1 0 0 0 0 NA NA 0 0 0 0 −1 −1 0 0 NA NA 0 0 0 0 0 −1 −1 0 NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 NA 0 0 0 0 −1 0 0 1 NA NA 0 0 0 0 0 0 0 0 NA NA −1 0 −1 0 −1 −1 0 0 NA 0 0 0 0 0 0 0 0 0 0 NA 0 0 0 0 0 0 0 0 NA NA 0 0 0 0 0 0 0 0 NA NA −1 0 0 0 0 −1 0 0 NA NA 0 0 0 0 0 −1 0 0 NA NA −1 0 0 1 −1 0 0 0 NA NA 0 0 0 0 0 0 0 1 NA NA 0 0 0 0 0 0 0 0 NA 1 0 0 0 0 0 0 0 0 0 NA 0 0 0 0 0 −1 −1 0 NA NA 0 0 0 0 0 0 0 0 NA NA −1 0 0 1 −1 0 −1 0 NA 0 0 0 0 0 0 0 0 0 0 NA 0 1 0 0 −1 0 −1 0 NA NA −1 0 0 0 −1 0 0 0 NA NA 0 0 0 0 0 0 0 0 NA NA 0 0 0 0 −1 0 0 −1 NA 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 NA 0 0 0 0 −1 0 0 0 NA NA 0 0 0 0 0 0 0 0 NA NA 0 0 0 0 0 0 0 −1 NA NA 0 0 0 1 −1 0 0 0 NA NA −1 0 −1 1 −1 −1 0 −1 NA NA 1 0 0 1 −1 0 0 −1 NA NA 0 0 0 0 −1 0 −1 −1 NA NA −1 0 −1 1 −1 0 −1 0 NA NA 0 0 −1 0 −1 0 −1 0 NA NA 0 0 0 0 −1 0 0 0 NA NA −1 0 −1 1 1 0 −1 0 NA NA 0 −1 0 0 −1 −1 0 0 NA 1 NA NA NA NA NA NA NA NA 0 NA NA NA NA NA NA NA NA NA NA 1 NA NA NA NA NA NA NA NA 0 NA NA NA NA NA NA NA NA NA NA 0 NA NA NA NA NA NA NA NA 0 NA NA NA NA NA NA NA NA NA NA 1 NA NA NA NA NA NA NA NA 0 0 NA NA NA 0 −1 NA NA NA 0 NA NA NA 1 −1 NA NA NA NA NA 0 NA NA NA 0 0 NA NA NA 0 0 NA NA NA 0 0 NA NA NA 0 0 NA NA NA 0 0 NA NA NA 0 0 NA NA NA 0 −1 NA NA NA 0 0 NA NA NA 0 0 NA NA NA 0 0 NA NA NA 0 0 NA NA NA 0 0 NA NA NA NA NA NA NA NA 0 0 NA NA NA 0 0 NA NA NA 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 −1 −1 0 0 0 1 0 0 0 1 −1 0 0 −1 0 1 0 0 0 0 0 0 0 0 0 1 −1 0 0 1 0 −1 0 0 0 1 0 0 0 0 0 −1 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 1 −1 −1 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 1 −1 0 −1 0 −1 1 −1 0 0 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 −1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 GR (median dichot- chr16: chr13: chr2: chr22: chr4: omized) 64910033 58055742 131394079 31826396 39684557 ATM_SNV FOXA1_SNV MED12_SNV SPOP_SNV TP53_SN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 1 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 1 0 0 0 0 0 0 0 0 1 0 NA NA NA NA NA NA NA NA NA NA NA 1 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 chr3: chr3: chr3: chr10: chr21: chr4: chr6: chr7: chr17: 125 Mbp_Inv 129 Mbp_Inv 195 Mbp_Inv 89 Mbp_Inv 42 Mbp_Inv 148 Mbp_Ctx 97 Mbp_Ctx 61 Mbp_Ctx 25 Mbp_Ctx 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 1 1 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 1 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 1 1 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA 0 0 0 1 0 0 0 0 0 NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 NA NA NA NA NA NA NA NA NA 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 chr3: chr21: TCERG1L- TCERG1L- MIR129- 125 Mbp_Inv 42 Mbp_Ctx 5'_Meth 3′_Meth TUBA3C_Meth SOX14_Meth ACTL6B_Meth 2_Meth 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 0 1 0 0 1 1 0 0 NA NA NA NA NA NA 0 0 0 1 0 0 1 1 0 0 0 0 0 0 1 1 0 0 1 1 0 0 1 0 0 0 NA NA NA NA NA NA 0 1 0 0 1 1 1 0 0 0 1 1 0 1 1 1 0 1 NA NA NA NA NA NA 0 0 0 1 0 0 1 1 0 1 0 1 0 1 1 1 0 0 0 1 0 0 1 1 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 0 1 0 0 1 1 0 0 0 1 0 1 0 1 0 0 1 0 1 0 0 1 0 0 0 1 0 0 1 0 0 1 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 1 0 0 0 0 0 0 0 NA NA NA NA NA NA 0 0 1 0 1 1 0 1 0 0 1 0 0 0 1 1 0 0 NA NA NA NA NA NA 0 0 1 0 1 1 0 0 0 0 1 0 0 0 0 1 0 0 0 1 0 0 1 1 0 0 0 1 1 1 0 1 0 0 1 0 1 1 1 0 0 0 0 1 0 0 1 1 0 0 0 1 0 0 1 1 0 0 0 1 0 1 1 1 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 1 0 0 1 1 1 0 0 0 1 0 0 0 1 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 0 0 1 1 1 0 0 0 1 0 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 1 0 0 0 0 0 0 NA NA NA NA NA NA 0 0 1 1 0 0 1 1 0 0 0 1 0 0 1 1 0 0 0 1 0 0 1 1 0 0 0 0 0 0 1 1 0 0 0 1 1 0 0 1 0 1 1 0 1 1 1 1 0 0 0 1 0 0 1 0 0 0 1 0 1 1 1 0 0 1 1 0 1 0 1 0 0 0 0 1 1 1 1 1 0 1 0 1 0 1 0 1 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 0 0 1 0 1 1 0 0 0 0 1 1 0 1 1 1 1 0 1 1 0 1 1 1 1 0 0 0 0 1 1 0 0 0 0 1 1 1 1 1 0 0 0 0 1 0 0 1 1 0 0 1 0 0 1 0 1 1 0 0 0 0 1 1 1 1 0 1 0 1 0 0 1 0 0 0 1 1 1 1 0 0 0 1 0 0 1 0 0 0 0 1 0 1 1 1 0 0 0 0 1 0 1 0 0 0 0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 1 0 1 0 0 0 0 1 0 1 1 1 0 1 0 1 1 0 0 0 0 1 1 0 1 0 1 1 0 0 0 1 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 1 0 0 1 0 1 0 0 1 1 0 0 1 0 0 1 0 0 1 0 0 0 0 0 1 0 1 0 0 0 0 1 0 1 0 1 0 0 0 0 0 1 0 0 0 0 0 0 1 0 1 1 1 1 0 0 0 1 0 1 0 0 0 1 0 0 1 1 1 0 0 1 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 1 0 1 1 1 1 1 0 0 0 1 1 0 0 0 0 1 0 1 0 0 0 0 0 1 1 0 1 0 0 0 1 1 1 1 0 1 1 0 0 1 0 0 1 0 1 0 0 1 0 0 1 0 0 0 0 1 1 1 1 0 0 0 0 0 1 0 0 0 1 0 0 0 1 0 1 1 1 0 0 0 1 0 0 1 1 0 0 0 1 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 1 1 0 0 1 0 1 0 0 0 0 0 0 0 1 1 1 1 0 0 0 1 0 1 1 0 1 0 0 1 1 1 0 1 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 1 0 1 1 1 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 1 0 0 0 0 0 1 0 1 0 1 0 0 1 0 1 1 1 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 0 1 0 0 1 1 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 1 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 1 0 NA NA NA NA NA NA 0 0 1 1 1 1 1 1 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 1 NA NA NA NA NA NA 0 1 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 1 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 1 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA 0 0 NA NA NA NA NA NA

7: Table of mtSNVs with LHF values between 0.1 and 0.2 Ref- Tu- Nor- Locus erence Tu- Tu- Tu- Tumour Normal Normal Normal mour mal Dif- Tu- mour mour mour HF-T Tumour TUmour Tumour Cov- Cov- Coverage ference Patient Position mour HF-A HF-C HF-G Normal HF-A HF-C HF-T erage erage mtDNA in HF CPCG0120   61 C C 0 0.88 0.04 0.08 C 0 1 0 0 2414 1066 CR 0.12 ICGC_PCA087   72 T T 0 0.13 0 0.87 T 0 0 0 1 1733 1357 CR 0.13 ICGC_PCA161  146 C T 0 0.01 0 0.99 T 0 0.17 0 0.83 2239  839 CR 0.16 ICGC_PCA053  152 C T 0 0.13 0 0.87 T 0 0 0 1 3817 3423 CR 0.13 ICGC_PCA130  203 G G 0.14 0 0.86 0 G 0 0 1 0 5419  597 CR 0.14 CPCG0211  204 T C 0 0.99 0 0.01 C 0 0.85 0 0.15 6273  732 CR 0.14 CPCG0128  249 A A 1 0 0 0 A 0.89 0 0.11 0 6347  859 CR 0.11 CPCG0126  291 A A 0.88 0 0 0.12 A 1 0 0 0 6805 1010 CR 0.12 CPCG0126  294 T T 0 0.13 0 0.87 T 0 0 0 1 6536  916 CR 0.13 CPCG0126  296 C C 0 0.88 0.12 0 C 0 1 0 0 6269  678 CR 0.12 CPCG0126  297 A G 0 0.15 0.85 0 G 0 0 1 0 5914  543 CR 0.15 CPCG0126  299 C C 0.11 0.89 0 0 C 0 1 0 0 7035 1001 CR 0.11 CPCG0267  302 A A 0.99 0.01 0 0 A 0.86 0.14 0 0 2788  429 CR 0.13 CPCG0371  302 A A 0.99 0.01 0 0 A 0.89 0.11 0 0 3650 1316 CR 0.1 CPCG0071  302 A A 0.87 0.12 0.01 0 A 0.98 0.02 0 0 2725 1059 CR 0.1 CPCG0126  302 A A 0.84 0.16 0 0 A 0.98 0.01 0 0 5384  584 CR 0.15 Baca05-3595  303 C C 0.02 0.97 0 0 C 0.2 0.8 0 0 4713  210 CR 0.17 Baca05-3595  309 C T 0 0.24 0 0.76 T 0 0.12 0 0.88 3340 1188 CR 0.13 Baca05-3595  460 T T 0.11 0 0 0.88 T 0.27 0 0 0.73 6244 2829 CR 0.15 CPCG0204  529 G G 0 0 1 0 G 0.11 0 0.89 0 6579 2313 CR 0.11 CPCG0089  545 G G 0.12 0.01 0.87 0 G 0 0 1 0 1106 2018 CR 0.13 ICGC_PCA184  586 G G 0.19 0 0.81 0 G 0 0 1 0 6197 3270 TF 0.19 CPCG0096  653 G G 0 0 1 0 G 0.11 0 0.89 0 7418 1911 RNR1 0.1 CPCG0036  709 G G 0.19 0 0.81 0 G 0 0 1 0 7241  777 RNR1 0.19 ICGC_PCA053  827 A A 0.88 0 0.12 0 A 1 0 0 0 5176 5170 RNR1 0.12 ICGC_PCA094  953 T T 0 0.14 0 0.86 T 0 0 0 1 4544 1383 RNR1 0.14 CPCG0084  1072 G G 0.19 0 0.81 0 G 0 0 1 0 5886 1888 RNR1 0.19 ICGC_PCA064  1252 G G 0.19 0 0.81 0 G 0 0 1 0 7649 6466 RNR1 0.19 CPCG0070  1324 T T 0 0 0 1 T 0 0.16 0 0.84 7774 3376 RNR1 0.16 ICGC_PCA124  1454 G G 0.16 0 0.84 0 G 0 0 1 0 7325 2704 RNR1 0.16 ICGC_PCA132  1485 G G 0.13 0 0.87 0 G 0 0 1 0 6697 2019 RNR1 0.13 CPCG0005  1826 G G 0.15 0 0.85 0 G 0 0 1 0 7673 1994 RNR2 0.15 CPCG0089  1906 G G 0.07 0.04 0.88 0 G 0 0 1 0 2144 3082 RNR2 0.11 CPCG0067  2203 G G 0.04 0.01 0.9 0.06 G 0 0 1 0  213 1286 RNR2 0.1 CPCG0368  2233 T T 0 0 0 1 T 0 0.16 0 0.84 7765 3094 RNR2 0.15 ICGC_PCA197  2296 T T 0 0.19 0 0.81 T 0 0 0 1 7371 2948 RNR2 0.19 CPCG0413  2321 A G 0.04 0 0.96 0 G 0.2 0 0.8 0 7059 3641 RNR2 0.15 CPCG0408  2345 G G 0.14 0 0.86 0 G 0 0 1 0 7306 6130 RNR2 0.14 CPCG0114  2487 A A 0.99 0.01 0 0 A 0.84 0.15 0 0 1953  252 RNR2 0.15 CPCG0123  2487 A A 1 0 0 0 A 0.85 0.12 0.01 0.01 6361 1104 RNR2 0.14 CPCG0166  2487 A A 0.86 0.13 0.01 0 A 1 0 0 0  126 1065 RNR2 0.13 CPCG0211  2487 A A 1 0 0 0 A 0.81 0.17 0.01 0.01 6421  605 RNR2 0.19 Berger3027  2487 A A 0.95 0.05 0 0 A 0.8 0.2 0 0 2734  790 RNR2 0.15 CPCG0067  2536 G G 0.11 0 0.89 0 G 0 0 1 0 5891 2001 RNR2 0.11 Baca06-3199  2553 G G 0.12 0 0.88 0 G 0 0 1 0 6914 6249 RNR2 0.12 CPCG0361  2587 G G 0.15 0 0.85 0 G 0 0 1 0 7215 3708 RNR2 0.15 ICGC_PCA172  2609 T T 0 0.18 0 0.82 T 0 0 0 1 5372 5848 RNR2 0.18 Baca06-1749  2698 G G 0.15 0 0.85 0 G 0 0 1 0 6547 2793 RNR2 0.15 ICGC_PCA165  2698 G G 0.12 0 0.88 0 G 0 0 1 0 7239 1912 RNR2 0.12 CPCG0046  2700 G G 0.01 0 0.88 0.11 G 0 0 1 0  379 1626 RNR2 0.12 CPCG0201  2702 G G 0.13 0 0.87 0 G 0 0 1 0 7436 2468 RNR2 0.13 ICGC_PCA059  2916 G G 0.16 0 0.84 0 G 0 0 1 0 4442 2547 RNR2 0.16 TCGA-CH-5789  3243 A A 0.89 0 0.11 0 A 1 0 0 0 7105 6797 TL1 0.1 ICGC_PCA034  3358 G G 0.13 0 0.87 0 G 0 0 1 0 5359 2244 ND1 0.13 CPCG0094  3447 A A 0.88 0.1 0.01 0.01 A 1 0 0 0 4366  939 ND1 0.12 CPCG0123  3447 A A 1 0 0 0 A 0.84 0.12 0.02 0.02 5662 1018 ND1 0.16 CPCG0183  3447 A A 1 0 0 0 A 0.85 0.11 0.02 0.02 6238  951 ND1 0.15 CPCG0211  3447 A A 1 0 0 0 A 0.88 0.1 0.02 0 6535  637 ND1 0.12 CPCG0071  3447 A A 0.85 0.14 0.01 0.01 A 0.95 0.05 0 0 4372 1535 ND1 0.11 BacaSTID0000002872  3447 A A 1 0 0 0 A 0.88 0.1 0.01 0.01 4415 1634 ND1 0.12 Berger3043  3452 T T 0 0.19 0 0.81 T 0 0 0 1 4071  795 ND1 0.19 ICGC_PCA023  3457 G G 0.13 0 0.87 0 G 0 0 1 0 5304 5385 ND1 0.13 CPCG0089  3464 T T 0.07 0.06 0 0.87 T 0 0 0 1 4676 3687 ND1 0.13 CPCG0123  3468 A A 1 0 0 0 A 0.85 0.12 0.01 0.02 5725  954 ND1 0.14 CPCG0183  3468 A A 0.99 0.01 0 0 A 0.87 0.09 0.01 0.02 6470  924 ND1 0.12 CPCG0071  3468 A A 0.86 0.12 0 0.01 A 0.96 0.04 0 0 4425 1497 ND1 0.1 CPCG0123  3475 A A 1 0 0 0 A 0.88 0.11 0 0.01 5599  907 ND1 0.12 ICGC_PCA173  3483 G G 0 0 1 0 G 0.12 0 0.88 0 7586 4617 ND1 0.12 CPCG0089  3488 T T 0.06 0.07 0.01 0.87 T 0 0 0 1 3368 3131 ND1 0.13 CPCG0123  3492 A A 0.97 0.02 0 0 A 0.82 0.16 0.01 0 5220  813 ND1 0.15 CPCG0183  3492 A A 1 0 0 0 A 0.81 0.18 0.01 0 5640  720 ND1 0.19 CPCG0211  3492 A A 0.99 0.01 0 0 A 0.81 0.18 0 0 6252  475 ND1 0.18 CPCG0067  3531 G G 0.08 0.02 0.89 0 G 0 0 1 0 2461  766 ND1 0.1 Baca09-37  3567 C C 0 0.82 0 0.17 C 0 1 0 0 6043 4943 ND1 0.17 CPCG0127  3592 G G 0.1 0 0.9 0 G 0 0 1 0 6787 1064 ND1 0.1 CPCG0210  3614 T T 0 0.11 0 0.89 T 0 0 0 1 7477 1319 ND1 0.11 ICGC_PCA184  3715 G G 0.12 0 0.88 0 G 0 0 1 0 6406 3722 ND1 0.12 CPCG0189  3834 G G 0.2 0 0.8 0 G 0 0 1 0 7677 1734 ND1 0.2 ICGC_PCA048  4142 G G 0.2 0 0.8 0 G 0 0 1 0 3163 2816 ND1 0.2 CPCG0346  4153 G G 0.16 0 0.84 0 G 0 0 1 0 5516 1739 ND1 0.16 CPCG0267  4226 T T 0 0.04 0 0.96 T 0 0.17 0 0.83 6856 1733 ND1 0.13 ICGC_PCA192  4408 G G 0.1 0 0.9 0 G 0 0 1 0 3913 2915 TM 0.1 ICGC_PCA132  4412 G G 0.11 0 0.89 0 G 0 0 1 0 6704 2125 TM 0.11 CPCG0378  4428 G G 0.18 0 0.82 0 G 0 0 1 0 7468 4250 TM 0.18 Baca07-5037  4762 T T 0 0.17 0 0.83 T 0 0 0 1 7290 7502 ND2 0.17 CPCG0022  4848 G G 0 0 0.87 0.13 G 0 0 0.98 0.02 1236 3356 ND2 0.11 CPCG0126  4969 G G 0.19 0 0.81 0 G 0 0 1 0 7426 1891 ND2 0.19 CPCG0236  5177 G G 0.14 0 0.86 0 G 0 0 1 0 7524 2322 ND2 0.13 CPCG0123  5208 A A 1 0 0 0 A 0.88 0.09 0.01 0.02 5545 1037 ND2 0.12 CPCG0183  5208 A A 1 0 0 0 A 0.88 0.09 0.01 0.02 6415  831 ND2 0.12 CPCG0211  5208 A A 1 0 0 0 A 0.89 0.08 0.02 0 6277  413 ND2 0.11 CPCG0122  5208 A A 1 0 0 0 A 0.89 0.09 0.01 0.01 6710  621 ND2 0.11 ICGC_PCA184  5476 T T 0 0.19 0 0.81 T 0 0 0 1 7121 4051 ND2 0.19 CPCG0234  5511 T T 0.02 0.08 0 0.9 T 0 0 0 1  106 1613 ND2 0.1 CPCG0344  5511 T T 0 0.19 0 0.81 T 0 0 0 1 7434 2172 ND2 0.19 ICGC_PCA103  5521 G G 0.14 0 0.86 0 G 0 0 1 0 6905 3724 TW 0.14 CPCG0071  5734 T T 0 0.11 0 0.88 T 0 0 0 1 4363 1110 OLR 0.12 CPCG0346  5801 T T 0 0.12 0 0.88 T 0 0 0 1 7580 3087 TC 0.12 CPCG0089  6054 G G 0.08 0.03 0.88 0 G 0 0 1 0 3712 3366 CO1 0.12 ICGC_PCA131  6128 C C 0 0.6 0 0.4 T 0 0.4 0 0.6 7042 2821 CO1 0.2 ICGC_PCA069  6164 C C 0.13 0.87 0 0 C 0 1 0 0 5295 2424 CO1 0.13 ICGC_PCA001  6221 T C 0 1 0 0 C 0 0.89 0 0.11 4346 1283 CO1 0.11 ICGC_PCA017  6366 G G 0.13 0 0.87 0 G 0 0 1 0 3616 4404 CO1 0.13 CPCG0048  6419 A A 1 0 0 0 A 0.88 0.11 0 0 6135 1051 CO1 0.11 CPCG0005  6419 A A 0.99 0.01 0 0 A 0.86 0.14 0 0 6158 1041 CO1 0.13 CPCG0084  6419 A A 0.99 0.01 0 0 A 0.84 0.15 0 0 6190 1189 CO1 0.15 CPCG0100  6419 A A 0.98 0.01 0 0 A 0.88 0.11 0 0 5818  896 CO1 0.1 CPCG0089  6430 T T 0.06 0.04 0.01 0.9 T 0 0 0 1 3642 5059 CO1 0.1 CPCG0089  6438 T T 0.05 0.05 0 0.9 T 0 0 0 1 3156 4906 CO1 0.1 CPCG0166  6480 G G 0.24 0 0.76 0 G 0.43 0 0.57 0 6847 1518 CO1 0.19 CPCG0362  6532 T T 0 0.11 0 0.89 T 0 0 0 1 7341 3512 CO1 0.11 CPCG0122  6555 A A 1 0 0 0 A 0.9 0.07 0.03 0.01 7189  686 CO1 0.1 ICGC_PCA070  6627 G G 0.17 0 0.83 0 G 0 0 1 0 5014 3745 CO1 0.17 CPCG0183  6819 A A 1 0 0 0 A 0.89 0.08 0.01 0.01 6151  618 CO1 0.11 CPCG0122  6819 A A 1 0 0 0 A 0.87 0.1 0.02 0 5544  369 CO1 0.13 Berger1701  6819 A A 1 0 0 0 A 0.81 0.16 0.01 0.01 1949  371 CO1 0.18 Berger2832  6819 A A 0.87 0.12 0.01 0 A 0.99 0.01 0 0 2556  356 CO1 0.11 TCGA-CH-5763  6819 A A 1 0 0 0 A 0.88 0.1 0.01 0.01 2450 1031 CO1 0.12 ICGC_PCA189  6991 T T 0 0.12 0 0.88 T 0 0 0 1 7055 7399 CO1 0.12 CPCG0020  7020 G G 0.15 0 0.85 0 G 0 0 1 0 4448  711 CO1 0.15 CPCG0042  7102 T T 0 0 0 1 T 0 0.1 0 0.9 6816 1647 CO1 0.1 CPCG0211  7236 G G 0 0 1 0 G 0.12 0 0.88 0 6411  889 CO1 0.12 ICGC_PCA152  7391 T T 0 0.11 0 0.89 T 0 0 0 1 6554 3031 CO1 0.1 TCGA-EJ-5506  7566 G G 0.2 0 0.8 0 G 0 0 0.99 0 7401 4137 TD 0.19 ICGC_PCA129  7859 G G 0.04 0 0.96 0 G 0.22 0 0.78 0 7117 4475 CO2 0.18 ICGC_PCA132  7923 A A 0.88 0 0.12 0 A 1 0 0 0 6656 2270 CO2 0.12 CPCG0166  8088 T T 0 0.1 0 0.9 T 0 0 0 1  108 1604 CO2 0.1 CPCG0117  8403 T T 0 0.18 0 0.82 T 0 0 0 1 7413 1495 ATP8 0.18 CPCG0183  8577 A A 1 0 0 0 A 0.89 0.09 0.01 0.01 6412 1054 ATP6 0.11 ICGC_PCA145  8752 A A 0.87 0 0.13 0 A 1 0 0 0 5177 1819 ATP6 0.13 CPCG0089  8959 G G 0.07 0.03 0.89 0.01 G 0 0 1 0 3013 2740 ATP6 0.1 CPCG0243  8995 G G 0 0 1 0 G 0.12 0 0.88 0 7381 1823 ATP6 0.12 CPCG0081  9035 T T 0 0 0 1 T 0 0.16 0 0.84 7716 1845 ATP6 0.16 ICGC_PCA172  9165 T T 0 0.14 0 0.86 T 0 0 0 1 5046 5174 ATP6 0.14 CPCG0050  9276 G G 0.16 0 0.84 0 G 0 0 1 0 7018 1577 CO3 0.16 ICGC_PCA034  9552 T T 0 0.12 0 0.88 T 0 0 0 1 5171 2128 CO3 0.12 CPCG0123  9726 A A 1 0 0 0 A 0.88 0.08 0.01 0.02 6869 1607 CO3 0.12 CPCG0067  9744 G G 0.11 0 0.89 0 G 0 0 1 0 6386 2243 CO3 0.11 TCGA-HC-7740  9746 G G 0.46 0 0.54 0 G 0.27 0 0.73 0 6363 2884 CO3 0.19 ICGC_PCA174  9931 G G 0.17 0 0.83 0 G 0 0 1 0 7355 4095 CO3 0.17 ICGC_PCA170  9942 G G 0.1 0 0.9 0 G 0 0 1 0 7249 2955 CO3 0.1 CPCG0126 10197 G G 0.15 0 0.85 0 G 0 0 1 0 5271 1260 ND3 0.14 Baca05-3595 10203 G G 0 0 1 0 G 0.2 0 0.8 0 2812  112 ND3 0.19 CPCG0324 10237 T T 0 0 0 1 T 0 0.18 0 0.82 7346 1476 ND3 0.18 CPCG0123 10277 A A 1 0 0 0 A 0.88 0.11 0 0 6675 1499 ND3 0.12 CPCG0183 10277 A A 0.99 0 0 0 A 0.86 0.12 0.01 0.01 7016 1350 ND3 0.13 CPCG0184 10277 A A 1 0 0 0 A 0.9 0.09 0 0 6598 1654 ND3 0.1 CPCG0234 10277 A A 0.8 0.18 0.02 0 A 0.99 0.01 0 0  138  921 ND3 0.19 CPCG0097 10277 A A 0.87 0.12 0 0 A 0.99 0.01 0 0  583 1107 ND3 0.12 CPCG0100 10277 A A 0.99 0.01 0 0 A 0.89 0.1 0 0 6041 1016 ND3 0.1 CPCG0183 10283 A A 1 0 0 0 A 0.88 0.1 0.01 0.01 6903 1395 ND3 0.12 CPCG0211 10283 A A 1 0 0 0 A 0.89 0.1 0.01 0 6495  540 ND3 0.11 CPCG0048 10306 A A 0.99 0.01 0 0 A 0.86 0.13 0 0 6152 1091 ND3 0.13 CPCG0081 10306 A A 1 0 0 0 A 0.89 0.1 0 0 7641 1378 ND3 0.11 CPCG0123 10306 A A 1 0 0 0 A 0.83 0.16 0 0.01 6752 1535 ND3 0.17 CPCG0183 10306 A A 1 0 0 0 A 0.86 0.12 0.01 0 7275 1419 ND3 0.14 CPCG0211 10306 A A 0.99 0.01 0 0 A 0.87 0.12 0 0 6406  556 ND3 0.12 CPCG0015 10306 A A 0.99 0.01 0 0 A 0.88 0.12 0 0 5306 1884 ND3 0.11 Baca08-4154 10306 A A 0.84 0.16 0 0 A 0.95 0.05 0 0  249 3705 ND3 0.11 BacaSTID0000002872 10306 A A 1 0 0 0 A 0.86 0.13 0 0 4051 1542 ND3 0.13 CPCG0194 10326 T T 0 0 0 1 T 0 0.2 0 0.8 5883 1053 ND3 0.19 ICGC_PCA138 10373 G A 0.94 0 0.06 0 A 0.77 0 0.23 0 3764 1249 ND3 0.17 CPCG0212 10453 A A 0.84 0 0.16 0 A 1 0 0 0 6070 1936 TR 0.16 CPCG0234 10454 T T 0 0.16 0 0.84 T 0 0 0 1  148 1705 TR 0.16 CPCG0408 10591 T T 0 0 0 1 T 0 0.14 0 0.86 7721 6744 ND4L 0.14 EOPC-04 10603 C C 0.15 0.85 0 0 C 0 0.99 0 0 3530 5885 ND4L 0.14 CPCG0361 10677 G G 0.1 0 0.89 0 G 0 0 1 0 5789 3685 ND4L 0.11 CPCG0391 10686 G G 0.12 0 0.88 0 G 0 0 1 0 7276 6103 ND4L 0.12 ICGC_PCA053 10731 G G 0.11 0 0.89 0 G 0 0 1 0 6919 6480 ND4L 0.11 ICGC_PCA102 10768 A A 0.74 0 0.26 0 A 0.61 0 0.39 0 4758 2928 ND4 0.14 CPCG0089 10934 G G 0.07 0.03 0.89 0 G 0 0 1 0 2594 2217 ND4 0.11 CPCG0089 11031 G G 0.08 0.03 0.89 0 G 0 0 1 0 2913 3705 ND4 0.11 CPCG0257 11124 T T 0 0.18 0 0.82 T 0 0 0 1 7628 1926 ND4 0.18 ICGC_PCA192 11126 G G 0.12 0 0.88 0 G 0 0 1 0 3845 2760 ND4 0.12 ICGC_PCA040 11166 G G 0.03 0 0.97 0 G 0.14 0 0.86 0 5903 5831 ND4 0.1 CPCG0346 11223 T T 0 0.13 0 0.87 T 0 0 0 1 7478 2780 ND4 0.12 CPCG0067 11225 G G 0.11 0 0.89 0 G 0 0 1 0 6154 1591 ND4 0.11 CPCG0340 11250 T T 0 0.19 0 0.81 T 0 0 0 1 7525 3514 ND4 0.19 CPCG0078 11557 A A 0.94 0 0.06 0 A 0.82 0 0.18 0 7451 1000 ND4 0.12 CPCG0072 11914 A G 0.11 0 0.89 0 G 0 0 1 0 4976 1962 ND4 0.11 CPCG0046 12125 G G 0 0 0.88 0.11 G 0 0 1 0  389 1921 ND4 0.11 CPCG0392 12134 T T 0 0 0 1 T 0 0.14 0 0.86 7599 1948 ND4 0.14 CPCG0241 12235 T T 0 0.15 0 0.85 T 0 0 0 1 7385 1447 TS2 0.15 CPCG0084 12457 G G 0.13 0 0.87 0 G 0.01 0 0.99 0 3270 1337 ND5 0.12 CPCG0166 12471 T T 0 0.2 0 0.8 T 0 0 0 1  193 1606 ND5 0.2 CPCG0388 12541 G G 0.13 0 0.87 0 G 0 0 1 0 7537 2422 ND5 0.13 Baca05-3852 12631 T T 0 0.15 0 0.85 T 0 0 0 1 6577 1992 ND5 0.15 CPCG0187 12772 G G 0 0 1 0 G 0.17 0 0.83 0 7180  891 ND5 0.17 Berger1701 12775 G G 0.16 0 0.84 0 G 0 0 0.99 0 2788  841 ND5 0.15 ICGC_PCA156 12977 T T 0 0.18 0 0.82 T 0 0 0 1 6751 3729 ND5 0.18 ICGC_PCA127 13042 G G 0.17 0 0.83 0 G 0 0 1 0 6856 3318 ND5 0.17 CPCG0122 13094 T T 0 0.12 0 0.88 T 0 0 0 0.99 7441  983 ND5 0.11 ICGC_PCA172 13105 G G 0.09 0 0.91 0 G 0.23 0 0.77 0 5389 5714 ND5 0.14 TCGA-EJ-7791 13376 T T 0 0 0 0.99 T 0 0.14 0 0.86 6535 2460 ND5 0.13 Baca06-1749 13424 T T 0 0.16 0 0.84 T 0 0 0 1 7371 3119 ND5 0.15 ICGC_PCA031 13466 G G 0 0 1 0 G 0.17 0 0.83 0 5931 5521 ND5 0.17 CPCG0020 13590 G G 0.16 0 0.84 0 G 0 0 1 0 7611 1841 ND5 0.16 CPCG0089 13674 T T 0.05 0.07 0.01 0.87 T 0 0 0 1 3237 4163 ND5 0.13 CPCG0353 13708 G G 0.1 0 0.9 0 G 0 0 1 0 6663 3432 ND5 0.1 CPCG0046 13940 G G 0.06 0 0.89 0.05 G 0 0 1 0  318 1344 ND5 0.11 CPCG0123 14102 T T 0 0.19 0 0.81 T 0 0 0 0.99 7411 2392 ND5 0.18 ICGC_PCA024 14311 T T 0 0.14 0 0.86 T 0 0 0 1 4940 2480 ND6 0.14 CPCG0030 14423 G G 0.15 0 0.84 0 G 0.02 0 0.98 0 7206 1664 ND6 0.14 CPCG0072 14470 T T 0 0.12 0 0.88 T 0 0 0 1 6689 2084 ND6 0.12 CPCG0234 14560 G G 0 0 0.89 0.1 G 0 0 1 0  997 1290 ND6 0.11 CPCG0234 14698 G G 0 0 0.9 0.1 G 0 0 1 0 1360 1364 TE 0.1 ICGC_PCA143 14798 T C 0 0.85 0 0.15 C 0 0.7 0 0.3 7083 4223 CYB 0.15 CPCG0236 14859 G G 0.18 0 0.82 0 G 0 0 1 0 7208 2114 CYB 0.18 ICGC_PCA055 14985 G G 0.12 0 0.88 0 G 0 0 1 0 7069 4679 CYB 0.12 CPCG0046 15200 G G 0.01 0 0.9 0.09 G 0 0 1 0  424 1479 CYB 0.1 EOPC-07 15211 C T 0 0.01 0 0.99 T 0 0.11 0 0.89 5386 1718 CYB 0.11 CPCG0363 15216 G G 0.11 0 0.89 0.01 G 0 0 1 0 6276 3366 CYB 0.11 ICGC_PCA022 15228 T T 0 0.18 0 0.82 T 0 0 0 1 4273 6156 CYB 0.18 ICGC_PCA137 15255 T T 0 0.11 0 0.89 T 0 0 0 1 6969 2363 CYB 0.11 ICGC_PCA035 15356 G G 0.15 0 0.84 0 G 0 0 1 0 7076 4723 CYB 0.15 EOPC-02 15458 T C 0 0.71 0 0.28 C 0 0.91 0 0.09 4983 3285 CYB 0.19 CPCG0183 15536 A A 1 0 0 0 A 0.89 0.07 0.01 0.02 7009 1083 CYB 0.11 CPCG0211 15536 A A 1 0 0 0 A 0.89 0.08 0.02 0.01 6942  570 CYB 0.11 ICGC_PCA118 15614 G G 0.15 0 0.85 0 G 0 0 1 0 7135 3573 CYB 0.15 ICGC_PCA172 15825 C T 0 0.1 0 0.9 T 0 0.25 0 0.75 5181 5498 CYB 0.15 ICGC_PCA078 15900 T T 0 0.14 0 0.86 T 0 0 0 1 3010 3847 TT 0.14 CPCG0046 15927 G G 0.1 0 0.85 0.05 G 0 0 1 0  419 1717 TT 0.15 CPCG0235 15976 T T 0 0.2 0 0.8 T 0 0 0 1 7757 2096 TP 0.2 CPCG0048 16092 T C 0 0.85 0 0.15 C 0 0.96 0 0.04 7162 1622 CR 0.11 CPCG0057 16093 T C 0 0.87 0 0.13 C 0 0.97 0 0.03 7070 2406 CR 0.11 CPCG0199 16093 T C 0 0.8 0 0.2 C 0 0.94 0 0.06 7365 2534 CR 0.13 CPCG0250 16093 T C 0 0.84 0 0.16 C 0 0.96 0 0.04 7176 2788 CR 0.13 CPCG0259 16093 T C 0 0.85 0 0.15 C 0 0.97 0 0.03 7063 2312 CR 0.12 CPCG0354 16093 T C 0 0.87 0 0.13 C 0 0.98 0 0.02 7123 4981 CR 0.11 Baca08-4154 16093 T C 0 0.92 0 0.08 C 0 0.73 0 0.27  104 6163 CR 0.19 ICGC_PCA053 16093 T C 0 0.79 0 0.21 C 0 0.98 0 0.02 6911 7080 CR 0.19 ICGC_PCA095 16093 T C 0 0.81 0 0.19 C 0 0.97 0 0.03 4785 2264 CR 0.16 ICGC_PCA151 16093 T C 0 0.88 0 0.12 C 0 0.98 0 0.01 5414 1639 CR 0.11 CPCG0378 16117 T T 0 0.16 0 0.84 T 0 0 0 1 7660 7058 CR 0.16 CPCG0194 16129 A G 0 0 1 0 G 0.14 0 0.85 0 3933  498 CR 0.14 CPCG0346 16145 G G 0.12 0 0.88 0 G 0 0 1 0 7495 3317 CR 0.12 ICGC_PCA153 16147 C C 0 0.87 0 0.13 C 0 1 0 0 6929 2343 CR 0.13 CPCG0122 16175 A A 1 0 0 0 A 0.9 0.1 0.01 0 5458  475 CR 0.1 CPCG0194 16183 A C 0.17 0.83 0 0 C 0.27 0.73 0 0 1329  490 CR 0.1 ICGC_PCA127 16184 C C 0 0.89 0 0.11 C 0 1 0 0 6185 3060 CR 0.11 CPCG0007 16187 T T 0 0.02 0 0.98 T 0 0.14 0 0.86 6350 1529 CR 0.11 Baca05-3852 16187 T C 0 0.98 0 0.02 C 0 0.86 0 0.14 6536 1173 CR 0.12 CPCG0070 16189 C T 0 0.03 0 0.97 T 0.01 0.14 0 0.86 7212 2311 CR 0.11 CPCG0194 16189 C C 0 0.98 0 0.01 C 0 0.87 0 0.12 1847  550 CR 0.11 EOPC-02 16189 C T 0 0.16 0 0.84 T 0.01 0.03 0 0.96 2314 1217 CR 0.12 BacaSTID0000000410 16189 C T 0 0.28 0 0.72 T 0 0.12 0 0.87 6024  402 CR 0.16 BacaSTID0000002872 16189 C C 0 0.86 0 0.14 C 0 1 0 0 3393 2188 CR 0.13 CPCG0194 16223 T T 0 0.01 0 0.99 T 0 0.14 0 0.86 3820  597 CR 0.13 ICGC_PCA001 16223 T T 0 0 0 1 T 0 0.12 0 0.88 5297 1828 CR 0.12 EOPC-02 16231 T C 0 0.86 0 0.14 C 0 1 0 0 2802 1558 CR 0.14 ICGC_PCA171 16247 A A 0.96 0 0.04 0 A 0.86 0 0.14 0 4771 2537 CR 0.1 ICGC_PCA026 16258 A A 0.81 0 0.19 0 A 1 0 0 0 4236 1740 CR 0.19 EOPC-02 16261 C T 0 0.13 0 0.87 T 0 0.01 0 0.99 3465 2005 CR 0.12 EOPC-02 16265 A C 0.11 0.89 0 0 C 0 1 0 0 3807 2232 CR 0.1 CPCG0363 16266 C C 0 0.9 0 0.1 C 0 1 0 0 6878 2983 CR 0.1 CPCG0194 16266 C T 0 0.01 0 0.99 T 0 0.13 0 0.87 4844  875 CR 0.12 CPCG0194 16274 G A 1 0 0 0 A 0.89 0 0.11 0 5382  956 CR 0.1 CPCG0260 16278 T C 0 0.88 0 0.11 C 0 1 0 0 6258 1496 CR 0.11 CPCG0349 16296 C T 0 0.01 0 0.99 T 0 0.18 0 0.82 7025 3138 CR 0.16 TCGA-HC-7233 16311 C T 0 0.01 0 0.99 T 0 0.13 0 0.87 3246 1622 CR 0.12 CPCG0183 16318 A A 1 0 0 0 A 0.86 0 0.14 0 7392 1684 CR 0.14 CPCG0194 16390 G A 1 0 0 0 A 0.89 0 0.11 0 5047 1010 CR 0.1 CPCG0382 16519 C C 0 1 0 0 C 0 0.9 0 0.1 4052 1521 CR 0.1 CPCG0089 16522 T T 0.06 0.05 0 0.89 T 0 0 0 1 2521 2119 CR 0.11 CPCG0256 16527 C T 0 0.16 0 0.84 T 0 0.06 0 0.94 2232  692 CR 0.1

Claims

1. A method of prognosing and/or predicting disease progression and/or in subject with prostate cancer, the method comprising:

a) providing a sample containing mitochondrial genetic material from prostate cancer cells;
b) sequencing the mitochondrial genetic material with respect to at least 1 patient biomarker selected from CSB1, OHR, ATP8 and HV1 (hypervariable region 1);
c) comparing the sequence of said patient biomarkers to control or reference biomarkers, preferably from the subject's own matched normal tissue or blood, to determine mitochondrial single nucleotide variations (mtSNVs); and
d) determining the a prostate cancer prognosis;
wherein a relatively worse outcome is associated with the presence of mtSNVs in CSB1, OHR, ATP8 and a relatively better outcome is associated with the presence of mtSNVs in HV1.

2. The method according to claim 1, wherein the at least 1 patient biomarker, is at least 2, 3 or 4 patient biomarkers.

3. The method according to claim 1, wherein the prostate cancer is localized prostate cancer, preferably non-indolent localized prostate cancer.

4. The method according to claim 1, further comprising building a patient biomarker profile from the determined or measured patient biomarkers.

5. The method according to claim 1, wherein the prostate cancer prognosis is the likelihood of disease recurrence, preferably measured by biochemical relapse.

6. The method of claim 5, further comprising classifying the patient into a high risk group if the likelihood of disease recurrence is relatively high or a low risk group if the likelihood of disease recurrence is relatively low.

7. The method of claim 6, further comprising treating the patient with more aggressive therapy if the patient is in the high risk group.

8. The method of claim 7, wherein the more aggressive therapy comprises adjuvant therapy, preferably hormone therapy, chemotherapy or radiotherapy.

9. The method according to claim 1, wherein the patient biomarkers further comprises CO2, CO3 and ND4L.

10. The method of claim 9, wherein the at least 1 biomarker is at least 5, 6 or all 7 biomarkers.

11. The method of claim 10, wherein the at least 1 biomarker is all 7 biomarkers.

12. The method of claim 11, wherein the subject is classified as low risk if there exists mtSNVs in CO2, CO3, and HV1 and high risk if there exists mtSNVs in ATP8, OHR, ND4L and CSB1.

13. The method according to claim 1, wherein the mtSNVs are the mtSNVs identified in Table 5.

13.-14. (canceled)

15. A computer program product for use in conjunction with a general-purpose computer having a processor and a memory connected to the processor, the computer program product comprising a computer readable storage medium having a computer mechanism encoded thereon, wherein the computer program mechanism may be loaded into the memory of the computer and cause the computer to carry out the method of claim 1.

16. A computer readable medium having stored thereon a data structure for storing the computer program product according to claim 15.

17. A device for prognosing or predicting disease progression in a patient with prostate cancer, the device comprising:

at least one processor; and
electronic memory in communication with the at one processor, the electronic memory storing processor-executable code that, when executed at the at least one processor, causes the at least one processor to:
a) receive sequencing data of mitochondrial genetic material from prostate cancer cells of the patient, the sequencing data reflecting at least 1 patient biomarker selected from CSB1, OHR, ATP8 and HV1 (hypervariable region 1);
b) compare said sequencing data to corresponding control or reference sequences, preferably from the subject's own matched normal tissue or blood, to determine mitochondrial single nucleotide variations (mtSNVs); and
c) determining, at the at least one processor, a prostate cancer prognosis;
wherein a relatively worse outcome is associated with the presence of mtSNVs in CSB1, OHR, ATP8 and a relatively better outcome is associated with the presence of mtSNVs in HV1.

18. The device according to claim 17, wherein the processor further displays the prostate cancer prognosis on a user display.

19. A kit for prognosing or predicting disease progression in a patient with prostate cancer, the kit comprising primer sequences that permit the sequencing of a mitochondrial genome to determine mtSNVs in ATP8, OHR, ND4L and CSB1.

20. The kit of claim 19, wherein the primers further permit sequencing of CO2, CO3 and ND4L.

Patent History
Publication number: 20240018600
Type: Application
Filed: Nov 14, 2022
Publication Date: Jan 18, 2024
Applicants: Ontario Institute for Cancer Research (OICR) (Toronto), UNIVERSITY HEALTH NETWORK (Toronto)
Inventors: Julia A. HOPKINS (Toronto), Paul Boutros (Toronto), Robert G. BRISTOW (Toronto)
Application Number: 18/055,189
Classifications
International Classification: C12Q 1/6886 (20060101); G01N 33/574 (20060101); G16H 50/30 (20060101); G16H 50/20 (20060101); C12Q 1/6881 (20060101);