Patents Assigned to West Virginia University
  • Patent number: 10370689
    Abstract: The present invention provides a method of producing lysergic acid and other ergot alkaloids by genetic modification of a fungus. A strain of fungus comprising Aspergillus fumigatus (A. fumigatus) or any fungus having a pathway similar to Aspergillus fumigatus and expressing one or more genes of the ergot alkaloid biosynthesis pathway from one or more fungus selected from the group consisting of Epichloë festucae var. lolii×Epichloë typhina isolate Lp1 (E. sp. Lp1); Claviceps species; Claviceps africana (C. africana); Claviceps gigantea (C. gigantea); Epichloë coenophiala and Periglandula species, wherein gene easA or gene easM is inactivated in said A. fumigatus or said fungus having a pathway similar to Aspergillus fumigatus, is provided.
    Type: Grant
    Filed: September 11, 2017
    Date of Patent: August 6, 2019
    Assignee: West Virginia University
    Inventors: Daniel G. Panaccione, Sarah L. Robinson
  • Patent number: 10317396
    Abstract: The present disclosure relates to a peripheral diagnostic method for screening Alzheimer's disease in patients based on quantitatively measured complexity of skin-sampled fibroblast networks.
    Type: Grant
    Filed: May 11, 2012
    Date of Patent: June 11, 2019
    Assignee: West Virginia University
    Inventors: Florin V. Chirila, Tapan Kumar Khan, Daniel L. Alkon
  • Patent number: 10228471
    Abstract: This disclosure describes an imaging radiation detection module with novel configuration of the scintillator sensor allowing for simultaneous optimization of the two key parameters: detection efficiency and spatial resolution, that typically cannot be achieved. The disclosed device is also improving response uniformity across the whole detector module, and especially in the edge regions. This is achieved by constructing the scintillation modules as hybrid structures with continuous (also referred to as monolithic) scintillator plate(s) and pixelated scintillator array(s) that are optically coupled to each other and to the photodetector.
    Type: Grant
    Filed: May 4, 2017
    Date of Patent: March 12, 2019
    Assignees: General Equipment for Medical Imaging S.A., West Virginia University, Consejo Superior de Investigaciones Cientificas (CSIC), Universitat Politecnica de Valencia, Bruker BioSpin AG
    Inventors: Jose Maria Benlloch Baviera, Antonio Javier Gonzalez Martinez, Stan Majewski
  • Patent number: 10221415
    Abstract: The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.
    Type: Grant
    Filed: August 31, 2016
    Date of Patent: March 5, 2019
    Assignee: West Virginia University
    Inventors: Sriganesh B. Sharma, Chen-Chung Lin, Mark K. Farrugia, J. Michael Ruppert
  • Patent number: 10207922
    Abstract: A method for producing elemental carbon and hydrogen gas directly from a hydrocarbon (for example, natural gas or methane) using a chemical reaction or series of reactions. In an aspect, other materials involved such as, for example, elemental magnesium, remain unchanged and function as a catalyst.
    Type: Grant
    Filed: January 25, 2017
    Date of Patent: February 19, 2019
    Assignee: WEST VIRGINIA UNIVERSITY RESEARCH CORPORATION
    Inventor: Alfred H. Stiller
  • Patent number: 10178979
    Abstract: A dual modality probe is disclosed having both a gamma probe sensor and an ultrasound sensor. A dual imaging system is provided having the probe and at least one external gamma imaging detector and a data acquisition computer system for collecting data simultaneously from the gamma probe sensor, the gamma imaging detector, and the ultrasound sensor of the probe. A method for evaluating a target organ of a patient utilizing the probe and imaging system, and performing a biopsy of the organ is disclosed.
    Type: Grant
    Filed: January 21, 2016
    Date of Patent: January 15, 2019
    Assignee: West Virginia University
    Inventors: Stanislaw Majewski, Gary Marano, Alexander Stolin, James Proffitt
  • Patent number: 10144648
    Abstract: The disclosure provides for methods of oxidizing carbide anions, or negative ions, from salt like carbides at low temperatures below about 600° C. In another aspect, the disclosure provides for reactions with intermediate transition metal carbides. In yet another aspect, the disclosure provides for a system of reactions where salt-like carbide anions and intermediate carbide anions are oxidized to produce pure carbon of various allotropes.
    Type: Grant
    Filed: June 9, 2017
    Date of Patent: December 4, 2018
    Assignee: WEST VIRGINIA UNIVERSITY RESEARCH CORPORATION
    Inventor: Alfred H. Stiller
  • Patent number: 10106807
    Abstract: The invention provides plants having desirable levels of sugar release and/or lignin synthesis. The invention further provides methods of selecting plants with such desirable levels of sugar release and/or lignin synthesis; methods of genetically modifying plants to modulate lignin synthesis, sugar release, and modulating phenylalanine, tyrosine, tryptophan and flavonoid production; and uses of such plants.
    Type: Grant
    Filed: May 22, 2015
    Date of Patent: October 23, 2018
    Assignees: UT-BATTELLE, LLC, WEST VIRGINIA UNIVERSITY
    Inventors: Wellington Muchero, Jay Chen, Lee E. Gunter, Sara Jawdy, Gerald A. Tuskan, Anthony Christian Bryan, Stephen Difazio, Hao-Bo Guo
  • Patent number: 10100542
    Abstract: The disclosed technology is a system and a method for strengthening one or more joints of a structure having a plurality of structural members forming a vacuous area at each joint. The method includes computing limit load bearing capacity for the structure, at a joint, securing a filler module to the joint, at the vacuous area, the filler module having a plurality of surfaces so that when secured within the vacuous area, some of the surfaces are tangential to the members of the structure at its joint, and one or more of the surfaces are non-tangential to the members of the structure, and applying at least one layer of continuous fiber reinforced polymer wrap about the filler module and the members at the joint. The filler module of the disclosed technology is designed and configured to dissipate energy from a load applied to the structure, and at least doubling the load bearing capacity for the structure, at the joint.
    Type: Grant
    Filed: March 1, 2017
    Date of Patent: October 16, 2018
    Assignee: West Virginia University
    Inventors: Hota V. S. GangaRao, Praveen K. R. Majjigapu
  • Patent number: 10087531
    Abstract: A process for incorporating a nanocatalyst on the surface of and within the pores of an electrode comprising subjecting an electrode to a singular template impregnation to form a treated electrode having a bio-template layer; and then subjecting the treated electrode to a singular nano-catalyst impregnation for tethering the nano-catalyst to the treated electrode; and then removing the bio-template layer by performing thermolysis upon the treated electrode for forming a nano-catalyst bonded on the surface and within the pores of the electrode. A modified electrode or product made by this process is provided.
    Type: Grant
    Filed: December 9, 2015
    Date of Patent: October 2, 2018
    Assignee: West Virginia University
    Inventors: Edward M. Sabolsky, Ozcan Ozmen, John W. Zondlo
  • Patent number: 10058077
    Abstract: A system and method for quantitatively assessing the changes in control of asymmetric locomotor behavior of an animal comprising analyzing the phase modulation in response to imposed asymmetric stepping tasks for quantitatively assessing changes in control of asymmetric locomotor behavior. A walkway gait device is provided comprising an elevated grid having at least one platform having a face and at least two or more pegs located in front or back of said platform, wherein each peg has a pressure sensor or switch in communication with a detection unit for capturing the pressure detected by one or more of the pressure sensors or switches. Preferably, the grid of the walkway gait device has at least three platforms to form a closed path loop.
    Type: Grant
    Filed: December 8, 2017
    Date of Patent: August 28, 2018
    Assignee: West Virginia University
    Inventors: Sergiy Yakovenko, Matthew Boots, Ryan Ellison, Kiril Tuntevski
  • Patent number: 10035709
    Abstract: The disclosure provides for methods of oxidizing carbide anions, or negative ions, from salt like carbides at temperatures from about 150° C. to about 750° C. In another aspect, the disclosure provides for reactions with intermediate transition metal carbides. In yet another aspect, the disclosure provides for a system of reactions where salt-like carbide anions and intermediate carbide anions are oxidized to produce pure carbon of various allotropes.
    Type: Grant
    Filed: June 9, 2017
    Date of Patent: July 31, 2018
    Assignee: WEST VIRGINIA UNIVERSITY RESEARCH CORPORATION
    Inventor: Alfred H. Stiller
  • Patent number: 10010584
    Abstract: The invention provides for the use of carbonic anhydrase activators; protein kinase C activators and FGF-18 to treat depressive disorders. The invention also relates to improved animal models and methods for screening and identifying compounds to treat depressive disorders.
    Type: Grant
    Filed: November 5, 2012
    Date of Patent: July 3, 2018
    Assignee: West Virginia University
    Inventors: Miao-Kun Sun, Daniel L Alkon
  • Publication number: 20180171970
    Abstract: A wind turbine is disclosed. The wind turbine includes a shaft rotatable about an axis, a plurality of hubs fixedly attached to the shaft, and a plurality of vanes. The vanes are releasably engaged with each of the plurality of hubs. The vanes disengage from the hubs once the shaft rotates about the axis at a cut-out speed of the wind turbine. In another embodiment, the vanes are releasably engaged with the shaft.
    Type: Application
    Filed: December 15, 2016
    Publication date: June 21, 2018
    Applicant: West Virginia University
    Inventors: Justin R. Chambers, James E. Smith
  • Patent number: 10001105
    Abstract: A quarter wave coaxial cavity resonator for producing corona discharge plasma from is presented. The quarter wave coaxial cavity resonator has a folded cavity made of opposing concentric cavity members that are nested together to form a continuous cavity ending in a aperture. A center conductor with a tip is positioned in the cavity. The folded cavity advantageously permits the coaxial cavity resonator to resonate at a lower operating frequency than an unfolded quarter wave coaxial cavity resonator of the same length. Embodiments of the quarter wave coaxial cavity resonator use narrower apertures to reduce radiative losses, and include center conductors that are reactive load elements, such as helical coils. When a radio frequency (RF) oscillation is produced in the quarter wave coaxial cavity resonator, corona discharge plasma is formed at the tip of the center conductor. The corona discharge plasma can be used to ignite combustible materials in combustion chambers of combustion engines.
    Type: Grant
    Filed: March 9, 2017
    Date of Patent: June 19, 2018
    Assignee: West Virginia University
    Inventors: James E. Smith, Franz A. Pertl
  • Patent number: 9997342
    Abstract: Provided herein are devices, systems, and methods of CTD mass spectrometry analysis of biomolecules.
    Type: Grant
    Filed: September 19, 2016
    Date of Patent: June 12, 2018
    Assignee: West Virginia University
    Inventors: Glen P. Jackson, William D. Hoffmann
  • Patent number: 9977489
    Abstract: Aspects of a low power memory buffer are described. In one embodiment, a sampling rate of a signal is adjusted to identify extrema of a signal. An extrema pulse is generated and, in response to the extrema pulse, a time segment and potential value of the signal are stored in a memory. In other aspects, rising and falling slopes of the signal are tracked to identify a local maximum and a local minimum of the signal. In this scenario, an extrema pulse is generated for each of the local maximum and minimum, and time segment and potential values are stored for the local maximum and minimum. Generally, the storage of analog values of the signal at an adjusted sampling rate is achieved with low power, and the signal may be reconstructed at a later time.
    Type: Grant
    Filed: May 17, 2016
    Date of Patent: May 22, 2018
    Assignee: WEST VIRGINIA UNIVERSITY
    Inventors: Brandon Michael Kelly, Brandon David Rumberg, David W. Graham
  • Patent number: 9970781
    Abstract: Various methods and apparatuses are provided for calibrating a three-axis IMU sensor package using a single-axis rate table. In one embodiment, a method includes adjusting an x-axis position of a sensor by rotating an inner assembly along the circumference of the inner surface of the circular frame, adjusting a y-axis position of the sensor by rotating a portion of the inner assembly, spinning the single-axis rate table to generate z-axis rotation of the apparatus which results in simultaneous stimulation of all three axes of the sensor assembly, and obtaining measurements from the sensor corresponding to the x-axis position, the y-axis position, and the z-axis rotation of the apparatus.
    Type: Grant
    Filed: March 1, 2016
    Date of Patent: May 15, 2018
    Assignee: WEST VIRGINIA UNIVERSITY
    Inventors: John A. Christian, Drew E. Bittner
  • Patent number: 9962357
    Abstract: The present disclosure describes novel PKC-? activators chosen from halogenated esters of unsaturated fatty acids derivatives thereof, including halogenated esters of both polyunsaturated and monunsaturated fatty acids and derivatives thereof. The disclosure further relates to compositions, kits, and methods for treatment using the halogenated esters.
    Type: Grant
    Filed: October 20, 2014
    Date of Patent: May 8, 2018
    Assignee: West Virginia University
    Inventors: Thomas J. Nelson, Daniel L. Alkon
  • Patent number: 9950992
    Abstract: A compound that is selected from the group consisting of 3-(3,4-dichloroanilino)-3-oxopropanoic acid (hereinafter “DCOPA”); N-methyl-DCOPA; N,2-dimethyl-DCOPA; 2-methyl-DCOPA; isobutyl-DCOPA; N-methyl-isobutyl DCOPA; 3-(3,4-bibromoanilino)-3-oxopropanoic acid; and analogs of DCOPA; and analogs of 3-(3,4-bibromoanilino)-3-oxopropanoic acid; and pharmaceutically acceptable salts of these compounds, are disclosed. A method of controlling bone erosion in a patient comprising administering to the patient a therapeutically effective amount of at least one of these compounds, or a pharmaceutically acceptable salt of at least one of these compounds, is provided. A method of reducing inflammation in a patient having an inflammatory condition comprising administering to the patient a therapeutically effective amount of at least one of these compounds, or a pharmaceutically acceptable salt of at least one of these compounds is provided.
    Type: Grant
    Filed: March 13, 2017
    Date of Patent: April 24, 2018
    Assignee: West Virginia University
    Inventors: John B. Barnett, Bjorn C. Soderberg