Abstract: The non-invasive detection of fetal chromosomal aneuploidies is demonstrated. Alleles of fetal RNA-SNPs present in a biological sample (e.g. maternal blood) containing fetal RNA are detected and quantified in order to determine the ratio of the alleles. This ratio is compared to a standard control consisting of euploid fetuses. Deviation of allele ratio indicates the presence of chromosomal aneuploidy.

Abstract: Provided is a polynucleotide including at least 10 contiguous nucleotides of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOS: 1-12 and including a nucleotide at position 101 of the nucleotide sequence, or a complementary polynucleotide thereof.

Abstract: An isolated nucleic acid molecule comprising a nucleotide sequence encoding a transcriptional enhancer of cytochrome P450 (P450) CYP3A4 production or expression, and uses of the nucleic acid molecule for screening compounds for xenobiotic induction of CYP3A4 expression in cells and animals.

Abstract: The invention describes DNA copy number alterations (CNAs), identifiable by technologies such as array-based comparative genomic hybridization (array CGH) or fluorescence in situ hybridization (FISH), that define distinct genetic subtypes of prostate cancer, and are useful for improved prognostication and treatment stratification for patients with prostate cancer.

Abstract: The present invention is based on the discovery of genetic polymorphisms that are associated with coronary stenosis. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods of using the nucleic acid and proteins as well as methods of using reagents for their detection.

Abstract: The present invention relates to mutations in the gene coding for ferroportin 1 associated with hereditary haemochromatosis and methods for the diagnosis of hereditary haemochromatosis based on the identification of such mutations.

Abstract: A method of determining a potential of a diabetic patient to benefit from anti oxidant therapy for treatment of a vascular complication, the method comprising determining a haptoglobin phenotype of the diabetic patient and thereby determining the potential of the diabetic patient to benefit from said anti oxidant therapy, whereby a patient having a haptoglobin 2-2 phenotype benefits from anti oxidant therapy more than a patient having a haptoglobin 1-2 phenotype or a patient having a haptoglobin 1-1 phenotype.

Abstract: Polymorphic sites in the region surrounding the HH gene are provided. These polymorphisms are useful as surrogate markers in diagnostic assays for hemochromatosis.

Abstract: A deletion in the end region of the long arm of a Chromosome 9 is efficiently detected. A genetic testing kit of bladder cancer according to the present invention includes a primer allowing for efficient amplification of a region containing a site of genetic polymorphism present in the ABO blood group gene of Chromosome 9. In the site of genetic polymorphism present in the ABO blood group gene, the frequency of heterozygote (heterozygosity) in the population is extremely high. Therefore, by detecting LOH using a polymorphic site present in the ABO blood group gene, it is possible to reliably detect a deletion near the polymorphic site, in other words, a deletion near the end of the long arm of Chromosome 9.

Abstract: The autosomal dominant spinocerebellar ataxias (SCAs) represent a growing and heterogeneous clinical phenotype with ongoing discovery of causative etiologies. Methods: The authors collected DNA and clinically characterized a three-generation Filipino family segregating a dominant ataxia. Following elimination of several known SCA loci, a genome-wide linkage study was undertaken with additional fine mapping of 19q13. Results: Clinical characterization of affected family members revealed cerebellar signs including gait ataxia, limb ataxia/dysmetria, titubation, hypotonia, dysarthria, and nystagmus. Linkage was found in a ˜4 cM region of 19q13 bounded by markers D19S867 and D19S553, with a maximum LOD score of 3.89 at markers D19S904, D19S246, and D19S907. This region overlaps with, though markedly reduces the previously described SCA13 locus. Conclusion: An autosomal dominant cerebellar ataxia clinically distinguishable from SCA13 overlaps with the SCA13 locus on chromosome 19q13.3.

Abstract: An object of this invention is to provide a method for assaying, predicting or assessing drug metabolism by effectively detecting (a) mutation(s) in a gene coding for UGT. A gene coding for UGT comprises 5 exons, and since the regions of exons 2 through 5 are common to each isoform of UGT1, by assaying a mutation in the common regions, particularly a mutation in exon 5 region, and further adding the detection of (a) mutation(s) in a plurality of exon regions, mutations of UGT1 gene can effectively assayed. A nucleic acid chip using nucleic acid probes is used as a way of detecting (a) mutation(s).

Abstract: There is disclosed an improved high-throughput and quantitative process for determining methylation patterns in genomic DNA samples based on amplifying modified nucleic acid, and detecting methylated nucleic acid based on amplification-dependent displacement of specifically annealed hybridization probes. Specifically, the inventive process provides for treating genomic DNA samples with sodium bisulfite to create methylation-dependent sequence differences, followed by detection with fluorescence-based quantitative PCR techniques. The process is particularly well suited for the rapid analysis of a large number of nucleic acid samples, such as those from collections of tumor tissues.

Abstract: The present invention provides methods that include analyzing an SCA5 polynucleotide, and determining whether the SCA5 polynucleotide includes a mutation. The methods may be used to identify a subject that is at risk or not at risk for developing spinocerebellar ataxia type 5. The present invention also provides isolated polynucleotides having a mutation present in an SCA5 polynucleotide.

Abstract: Described is a method for detecting 5-methylcytosine in genomic DNA samples. First, a genomic DNA from a DNA sample is chemically converted with a reagent, 5-methylcytosine and cytosine reacting differently, and the pretreated DNA is subsequently amplified using a polymerase and at least one primer. In the next step, the amplified genomic DNA is hybridized to at least one oligonucleotide, forming a duplex, and said oligonucleotide is elongated by at least one nucleotide, the nucleotide carrying a detectable label, and the elongation depending on the methylation status of the specific cytosine in the genomic DNA sample. In the next step, the elongated oligonucleotides are analyzed for the presence of the label.

Abstract: A method of diagnosing breast cancer in an individual aged younger than 41 or older than 54 is provided. The method comprises obtaining a nucleic acid from the individual and determining a nucleotide at a polymorphic site of the nucleic acid. Polynucleotides specific to breast cancer, a microarray comprising the polynucleotides, and diagnostic kits are also provided.

Abstract: Linkage of Myocardial Infarction (MI) to a locus on chromosome 13q12-13 is disclosed. In particular, the FLAP gene within this locus is shown by association analysis to be a susceptibility gene for MI and stroke. Pathway targeting for drug delivery and diagnosis applications in identifying those at risk of developing MI or stroke, in particular are described.

Abstract: The invention concerns the genomic sequence of the FLAP gene. The invention also concerns biallelic markers of a FLAP gene and the association established between these markers and diseases involving the leukotriene pathway such as asthma. The invention provides means to determine the predisposition of individuals to diseases involving the leukotriene pathway as well as means for the diagnosis of such diseases and for the prognosis/detection of an eventual treatment response to agents acting on the leukotriene pathway.

Abstract: Methods and kits for diagnosing and prognosticating matrix metalloproteinase-1 related disease by detecting a single nucleotide polymorphism in the promoter of the gene are provided. Also provided are methods of identifying agents which inhibit binding of transcriptions factors to the Ets transcription factor binding site created by or resulting from this single nucleotide polymorphism and methods of using these agents to treat matrix metalloproteinase-1 related diseases.

Abstract: The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua having high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.

Abstract: The present invention provides methods of screening for the presence of premalignant melanocytes in a sample from a patient. The methods comprise contacting a nucleic acid sample from a biological sample from the patient with a probe which binds selectively to a target polynucleotide sequence on a chromosomal region which is amplified in melanoma cells.