Abstract: A multiplex structure, such as a nucleic acid quadruplex, includes: a first strand containing a first sequence of nucleobases; a second strand containing a second sequence of nucleobases, wherein the second strand is associated with the first strand by Watson-Crick bonding; a third strand containing a third sequence of nucleobases; and a fourth strand containing a fourth sequence of nucleobases, wherein the fourth strand is associated with the second strand and the third strand by Watson-Crick bonding. Formation of the multiplex structure is promoted by monovalent cations (e.g., sodium and potassium), divalent cations, multivalent cations, intercalating agents and/or molecules known to bind within the minor grooves of nucleic acids. The multiplex structure and the process of forming it have diagnostic, therapeutic, prophylactic and nanoengineering applications.

Abstract: A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2?-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2?-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.

Abstract: Nucleotides and oligonucleosides functionalized to include alkylamino functionality, and derivatives thereof. In certain embodiments, the compounds of the invention further include steroids, reporter molecules, reporter enzymes, lipophilic molecules, peptides or proteins attached to the nucleotides through the alkylamino group.

Abstract: The present invention provides for the identification and cloning of functional plant centromeres in Arabidopsis. This will permit construction of stably inherited plant artificial chromosomes (PLACs) which can serve as vectors for the construction of transgenic plant and animal cells. In addition, information on the structure and function of these regions will prove valuable in isolating additional centromeric and centromere related genetic elements and polypeptides from other species.

Abstract: Method for splicing a target nucleic acid molecule with a separate nucleic acid molecule. Such splicing generally causes production of a chimeric protein with advantageous features over that protein naturally produced from the target nucleic acid prior to splicing. The method includes contacting the target nucleic acid molecule with a catalytic nucleic acid molecule including the separate nucleic acid molecule. Such contacting is performed under conditions in which at least a portion of the separate nucleic acid molecule is spliced with at least a portion of the target nucleic acid molecule to form a chimeric nucleic acid molecule. In this method, the catalytic nucleic molecule is chosen so that it is not naturally associated with the separate nucleic acid molecule.

Abstract: The present invention relates to a method for desalting nucleic acid samples. The method involves contacting a liquid sample comprising a nucleic acid and an ionic salt with an ion exchanger comprising an insoluble phosphate salt, removing said liquid, and eluting said nucleic acid from the ion exchanger. The desalted nucleic acids provided by the methods of the invention are suitable for a wide variety of analytic and diagnostic applications, including high-throughput assays.

Abstract: The present invention relates to capsules encapsulating cytochrome P450 producing cells and cytochrome P450 producing retroviral packaging cells. Furthermore, the present invention relates to the treatment of cancer or any other relevant disease with said capsules and to the use of said capsules for the preparation of a pharmaceutical composition for said treatment.

Abstract: This invention is in the field of lymphadenopathy virus which has been designated Human Immunodeficiency Virus Type 1 (HIV-1). This invention relates to a diagnostic means and method to detect the presence of DNA, RNA or antibodies of the lymphadenopathy retrovirus associated with the acquired immune deficiency syndrome or of the lymphadenopathy syndrome by the use of DNA fragments of the peptides encoded by said DNA fragments. The invention further relates to the DNA fragments, vectors comprising them and the proteins expressed.

Abstract: The invention provides novel methods for characterizing the function of nucleic acids and polypeptides. The invention provides a novel method for identifying a nucleic acid or a polypeptide sequence that may be a target for a drug. The invention provides a novel method for identifying a nucleic acid or a polypeptide sequence that may be essential for the growth or viability of an organism. The characterization is based on use of methods of the invention comprising algorithms that can identify functional relationships between diverse sets of non-homologous nucleic acid and polypeptide sequences. The invention provides a computer program product, stored on a computer-readable medium, for identifying a nucleic acid or a polypeptide sequence that may be essential for the growth or viability of an organism. The invention provides a computer program product, stored on a computer-readable medium, for identifying a nucleic acid or a polypeptide sequence that may be a target for a drug.

Abstract: Oligonucleotides useful in the detection of a nucleic acid target sequence in a sample.

Abstract: The invention relates to recombinant DNA constructs, a method for producing a recombinant biologically active protein in vivo in the urine of a non-human mammal using a kidney-specific promoter, such as the uromodulin promoter, and the transgenic non-human mammals that serve as urine-based bioreactors for protein production.

Abstract: The invention provides novel electrophoretic methods for high-resolution separation and high-sensitivity detection of nucleic acids. The methods involve the use of a high-resolution buffer and a counter-migrating high-affinity intercalating dye in an electrophoresis system to achieve superior separation and detection of nucleic acids. A kit for separation and detection of nucleic acids in a sample by electrophoresis is also provided. The kit comprises a gel buffer containing a high-resolution intercalating dye with a resolution of at least 2.0 between the 271-bp and 282-bp ?X 171 HAIII nucleic acid fragments nucleic acid fragments; and a high-affinity intercalating dye having a positive charge and DNA affinity constant of at least 106M?1.

Abstract: The invention relates to a process for the metallization of nucleic acids, comprising providing tris(hydroxymethyl)phosphine-Au (THP-Au) particles or derivatives thereof, binding said THP-Au particles to a nucleic acid to produce a metal nanoparticle-nucleic acid composite, and treatment of the metal nanoparticle-nucleic acid composite with an electroless plating solution. The invention further relates to a metallized nucleic acid obtainable according to such a method and a nanowire including a method for the manufacture of a nanowire.

Abstract: Isolated nucleic acid molecules are provided which encode Fkhsf, as well as mutant forms thereof. Also provided are expression vectors suitable for expressing such nucleic acid molecules, and host cells containing such expression vectors. Utilizing assays based upon the nucleic acid sequences disclosed herein (as well as mutant forms thereof), numerous molecules may be identified which modulate the immune system.

Abstract: The present invention provides an isolated or purified antibody or antigenically-reactive fragment thereof that specifically binds to a C-terminal phosphorylated serine in an H2A histone protein and a product comprising the same. The present invention further provides fusion proteins comprising the isolated or purified antibody or antigenically-reactive fragment thereof. Also provided by the present invention are a method and a kit for determining double-stranded breaks in DNA. The method comprises contacting a sample comprising H2A histone proteins with the isolated or purified antibody or antigenically-reactive fragment thereof and detecting binding of the antibody or fragment thereof to an H2A histone protein in the sample. The detection of the binding of the antibody or fragment thereof to the H2A histone protein indicates the presence of a DNA double-stranded break in DNA.

Abstract: A method is provided for genotyping a target sequence at at least two allelic sites by a 5? nuclease amplification reaction.

Abstract: The present invention relates to a method for detection of a molecular recognition reaction without labelling and a device for using this method. This invention concerns the general field of detection and analysis of molecular recognition between a first and a second molecule, for example a biological molecule. The method of the present invention consists of the detection of the molecular recognition by a photothermal method.

Abstract: Specific nucleic acid sequences, e.g., SEQ ID NOs:1-57, for simultaneous detection of seven most common viruses that cause respiratory infections in human, i.e., human parainfluenza virus 1, human parainfluenza virus 2, human parainfluenza virus 3, respiratory syncytial virus, influenza virus A, influenza virus B, and adenovirus. Also disclosed is a method of simultaneously detecting these viruses. The method includes providing a nucleic acid prepared from a sample suspected of containing a virus to be detected, amplifying the nucleic acid with a set of primers specific for one or more of the seven viruses, and detecting amplification products. Detection of an amplification product specific for any one of the seven viruses indicates the presence of that particular virus.

Abstract: The invention provides a diagnostics assay for measuring the responsiveness to a drug by comparing the mRNA levels of a gene that responds to the drug, such as a steroid, to the mRNA levels of a gene that does not respond to the drug. Methods according to the invention are useful for predicting the ability of a patient (or a tissue, body fluid or cell sample in vitro) to respond to a drug or steroid at any stage of their treatment (i.e., before, during or after), and to monitor the patient (or a tissue, body fluid or cell) over time to assess continued responsiveness to the drug or steroid.

Abstract: Thermostable DNA polymerases both in native form and having single amino acid substitutions and optionally N-terminal deletions are disclosed. These polymerases exhibit a substantial improvement of DNA sequencing performance compared to Taq DNA polymerase. The instant DNA polymerases also possess improved salt tolerance.