Abstract: Provided are a siRNA for inhibiting the expression of hepatitis B virus gene, and a pharmaceutical composition and conjugate containing the siRNA. Each nucleotide in the siRNA is independently a modified nucleotide. The siRNA comprises a sense strand and an antisense strand. The sense strand of the siRNA comprises a nucleotide sequence 1 having the same length and no more than three nucleotides different from the nucleotide sequence shown in SEQ ID NO: 155, and the antisense strand of the siRNA comprises a nucleotide sequence 2 having the same length and no more than three nucleotides different from the nucleotide sequence shown in SEQ ID NO: 156.

Abstract: The invention provides nucleic acids encoding acid ?-glucosidase (GAA). In certain embodiments, nucleic acids have greater than about 86% sequence identity to a sequence selected from the group consisting of any of the sequences set forth as SEQ ID NOs:1-5. In certain embodiments, nucleic acids encoding acid ?-glucosidase (GAA) contain less than 127 CpG dinucleotides. Expression cassettes, vectors, cells and cell lines and methods of using such nucleic acids encoding acid ?-glucosidase (GAA) are also provided.

Abstract: The present disclosure generally relates to systems, methods and compositions for use in Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cpf1 genome editing systems. Disclosed herein are modified Cpf1 mRNAs, modified guide RNAs, and combinations thereof, that confer increased levels of genome editing.

Abstract: Provided is a drug that allows highly-efficient skipping of exon. The present invention provides an antisense oligomer wherein two or more unit oligomers targeting sequences that are neither consecutive nor overlap with each other in the same exon are connected.

Abstract: The present invention provides iRNA agents, e.g., double stranded iRNA agents, that target the transthyretin (TTR) gene and methods of using such iRNA agents for treating or preventing TTR-associated diseases.

Abstract: The present invention relates to RNAi agents, e.g., double stranded RNA (dsRNA) agents, targeting the Factor XII (F12) gene. The invention also relates to methods of using such RNAi agents to inhibit expression of an F12 gene and to methods of preventing and treating an F12-associated disorder, e.g., heredity angioedema (HAE), prekallikrein deficiency, malignant essential hypertension, hypertension, end stage renal disease, Fletcher Factor Deficiency, thromboembolic disease, inflammatory disease, or Alzheimer's Disease.

Abstract: This disclosure relates to a therapeutic combination of drugs for the treatment or management of a neurodegenerative disease, the combination comprising: a first conjugate comprising an RNA silencing agent and a first targeting agent that targets the first conjugate to the central nervous system, and a second conjugate comprising an antagonist of the RNA silencing agent and a second targeting agent that targets the second conjugate to a off-target tissue.

Abstract: Embodiments of the disclosure include methods and compositions for in situ cardiac cell regeneration, including transdifferentiation of cardiac cells to cardiomyocytes. In particular embodiments, in situ cardiac cell regeneration encompasses delivery of p63 shRNA and one or both of Hand2 and myocardin, and in specific embodiments further includes one or more of Gata4, Mef2c, and Tbx5. In specific aspects of the disclosure, adult cardiac fibroblasts are reprogrammed into cardiomyocytes using viral vectors that harbor p63 shRNA and one or both of the transcription factors Hand2 and myocardin.

Abstract: Disclosed are novel compositions and methods for treating systemic lupus erythematosus (SLE) as well as a model for measuring the efficacy of said treatments. Specifically, the disclosure provides a non-human animal model for SLE comprising a severe combined immunodeficient non-human animal comprising exogenous cells from a human subject with SLE, wherein the cells from the human subject are peripheral blood mononuclear cells. Further disclosed is a method of screening for a drug candidate that inhibits or reduces SLE using a severe combined immunodeficient non-human animal.

Abstract: Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of FXII RNA in a cell or subject, and in certain instances reducing the amount of FXII protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful to prevent, treat, or ameliorate at least one symptom of a thromboembolic condition. Such thromboembolic conditions include deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, and stroke. Such symptoms include pain, shortness of breath, heart burn, cold sweat, fatigue, lightheadedness, dizziness, swelling, cramping, and death. Such compounds, methods, and pharmaceutical compositions are useful to prevent, treat, or ameliorate at least one symptom of hereditary angioedema.

Abstract: In the present specification, on the basis of the correlation between prospero homeobox protein 1 (PROX1) and telomerase reverse transcriptase (TERT), a composition for regulating expression of TERT, a method for screening a TERT expression regulator, a composition for diagnosing a TERT expression status, a diagnostic kit, a method for providing information for diagnosis, or a method for providing information for cancer diagnosis are disclosed. Specifically, in one aspect, the PROX1 of the present disclosure may bind to a TERT promoter, in particular a mutant TERT promoter in which base substitution occurs at the ?124 or ?146 bp position to regulate the expression of TERT, and the expression of TERT in non-hepatitis B virus-associated liver cancer can be inhibited specifically among liver cancers.

Abstract: Disclosed herein are programmable, conditionally activated small interfering RNA constructs (Cond-siRNAs) and methods of making and using the same as therapeutic agents. The Cond-siRNA comprises a sensor strand, a core strand, and a guide strand, which crossover to form a sensor duplex and a RNAi duplex attached to each other to form a single structure. Upon binding an input strand to the sensor strand, the Cond-siRNA is activated and releases RNAi targeting a desired gene.

Abstract: The invention includes compositions and methods useful for the diagnosis, assessment, and characterization of endometriosis in a subject in need thereof, based upon the expression level of at least one miRNA that is associated with endometriosis.

Abstract: A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO 4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO 5). The passenger RNA strand includes a 2?-O-methylation modification to increase stability. Cholesterol is conjugated to the 3?-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule.

Abstract: The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the LECT2 gene, and methods of using such dsRNA compositions to alter (e.g., inhibit) expression of LECT2.

Abstract: Embodiments of the disclosure include methods and compositions for the renewal of cardiomyocytes by targeting the Hippo pathway. In particular embodiments, an individual with a need for cardiomyocyte renewal is provided an effective amount of a shRNA molecule that targets the Sav1 gene. Particular shRNA sequences are disclosed.

Abstract: The present invention provides, inter alia, methods for treating, preventing, or ameliorating the effects of a lymphoid malignancy, such as those associated with a mutated phosphatase and tensin homolog (PTEN) gene, or T-cell acute lymphoblastic leukemia (T-ALL). These methods include administering to a subject an effective amount of a phosphoinositide 3-kinase-delta (PI3K?) inhibitor and a phosphoinositide 3-kinase-gamma (PI3K?) inhibitor. The present invention also provides pharmaceutical compositions for treating the effects of a lymphoid malignancy. This invention further provides a method for identifying a subject who may benefit from co-treatment with a PI3K? inhibitor and a PI3K? inhibitor. This method includes determining from a sample of the subject whether the subject has a mutated PTEN gene. Additionally, this invention provides methods for identifying a compound that has both PI3K? and PI3K? inhibitory activity.

Abstract: Compositions and methods for editing, e.g., introducing double-stranded breaks, within the TTR gene are provided. Compositions and methods for treating subjects having amyloidosis associated with transthyretin (ATTR), are provided.

Abstract: Embodiments of the disclosure include methods and compositions related to treating or reducing the severity or delaying the onset of one or more cardiac conditions in a mammal. In particular embodiments, the compositions concern Park2 and its use for a cardiac medical condition. In specific cases, effective amounts of Park2 polynucleotide(s) and/or Park2 polypeptide(s) are provided to an individual in need thereof, including for heart failure, for example. The administration may be locally to the heart, for example.

Abstract: Provided are compositions and methods for altering gene expression in cells. The compositions and methods may utilize a nucleic acid sequence that has a genetically modified trans-activating crRNA (tracrRNA) sequence, where at least one uracil nucleotide of the tracrRNA sequence is replaced with a nucleotide other than uracil, and/or a nucleic acid sequence that has a guide RNA (gRNA) sequence wherein one or more cytosine nucleotides and/or one or more uracil nucleotides of said gRNA sequence are modified nucleotides. Also provided are methods of treating a disorder in a subject in need of the treatment. The method may involve administering to the subject the nucleic acid or a vector thereof in combination with an RNA-guided DNA endonuclease enzyme.