Abstract: This disclosure relates to a therapeutic combination of drugs for the treatment or management of a neurodegenerative disease, the combination comprising: a first conjugate comprising an RNA silencing agent and a first targeting agent that targets the first conjugate to the central nervous system, and a second conjugate comprising an antagonist of the RNA silencing agent and a second targeting agent that targets the second conjugate to a off-target tissue.
Abstract: Embodiments of the disclosure include methods and compositions for in situ cardiac cell regeneration, including transdifferentiation of cardiac cells to cardiomyocytes. In particular embodiments, in situ cardiac cell regeneration encompasses delivery of p63 shRNA and one or both of Hand2 and myocardin, and in specific embodiments further includes one or more of Gata4, Mef2c, and Tbx5. In specific aspects of the disclosure, adult cardiac fibroblasts are reprogrammed into cardiomyocytes using viral vectors that harbor p63 shRNA and one or both of the transcription factors Hand2 and myocardin.
Type:
Grant
Filed:
July 19, 2022
Date of Patent:
July 9, 2024
Assignee:
Baylor College of Medicine
Inventors:
Vivekkumar B. Patel, Hongran Wang, Vivek P. Singh, Erin Lynn Reineke, Megumi Mathison, Austin J. Cooney, Todd Rosengart
Abstract: Disclosed are novel compositions and methods for treating systemic lupus erythematosus (SLE) as well as a model for measuring the efficacy of said treatments. Specifically, the disclosure provides a non-human animal model for SLE comprising a severe combined immunodeficient non-human animal comprising exogenous cells from a human subject with SLE, wherein the cells from the human subject are peripheral blood mononuclear cells. Further disclosed is a method of screening for a drug candidate that inhibits or reduces SLE using a severe combined immunodeficient non-human animal.
Type:
Grant
Filed:
September 10, 2018
Date of Patent:
June 25, 2024
Assignee:
Ohio State Innovation Foundation
Inventors:
Wael N. Jarjour, Giancarlo Valiente, Nicholas Young
Abstract: Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of FXII RNA in a cell or subject, and in certain instances reducing the amount of FXII protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful to prevent, treat, or ameliorate at least one symptom of a thromboembolic condition. Such thromboembolic conditions include deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, and stroke. Such symptoms include pain, shortness of breath, heart burn, cold sweat, fatigue, lightheadedness, dizziness, swelling, cramping, and death. Such compounds, methods, and pharmaceutical compositions are useful to prevent, treat, or ameliorate at least one symptom of hereditary angioedema.
Type:
Grant
Filed:
December 17, 2021
Date of Patent:
June 25, 2024
Assignee:
Ionis Pharmaceuticals, Inc.
Inventors:
Huynh-Hoa Bui, Chenguang Zhao, Jeffrey R. Crosby
Abstract: In the present specification, on the basis of the correlation between prospero homeobox protein 1 (PROX1) and telomerase reverse transcriptase (TERT), a composition for regulating expression of TERT, a method for screening a TERT expression regulator, a composition for diagnosing a TERT expression status, a diagnostic kit, a method for providing information for diagnosis, or a method for providing information for cancer diagnosis are disclosed. Specifically, in one aspect, the PROX1 of the present disclosure may bind to a TERT promoter, in particular a mutant TERT promoter in which base substitution occurs at the ?124 or ?146 bp position to regulate the expression of TERT, and the expression of TERT in non-hepatitis B virus-associated liver cancer can be inhibited specifically among liver cancers.
Type:
Grant
Filed:
October 19, 2018
Date of Patent:
June 11, 2024
Assignees:
KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY, INDUSTRY-ACADEMIC COOPERATION FOUNDATION, YONSEI UNIVERSITY
Inventors:
Sang Hoon Jung, Young-Joo Kim, Dae-geun Song, Young Nyun Park, Jeong Eun Yoo, Hyung Jin Rhee, Youngsic Jeon
Abstract: Disclosed herein are programmable, conditionally activated small interfering RNA constructs (Cond-siRNAs) and methods of making and using the same as therapeutic agents. The Cond-siRNA comprises a sensor strand, a core strand, and a guide strand, which crossover to form a sensor duplex and a RNAi duplex attached to each other to form a single structure. Upon binding an input strand to the sensor strand, the Cond-siRNA is activated and releases RNAi targeting a desired gene.
Type:
Grant
Filed:
February 10, 2021
Date of Patent:
June 4, 2024
Assignees:
Clty of Hope, California Institute of Technology
Inventors:
Si-ping Han, William A. Goddard, III, Marwa Ben Haj Salah, Lisa Scherer, John J. Rossi
Abstract: The invention includes compositions and methods useful for the diagnosis, assessment, and characterization of endometriosis in a subject in need thereof, based upon the expression level of at least one miRNA that is associated with endometriosis.
Abstract: A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO 4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO 5). The passenger RNA strand includes a 2?-O-methylation modification to increase stability. Cholesterol is conjugated to the 3?-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule.
Type:
Grant
Filed:
May 3, 2021
Date of Patent:
May 21, 2024
Assignees:
Washington University, Wisconsin Alumni Research Foundation
Inventors:
Jianghui Hou, Dale Bjorling, Zunyi Wang
Abstract: The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the LECT2 gene, and methods of using such dsRNA compositions to alter (e.g., inhibit) expression of LECT2.
Abstract: Embodiments of the disclosure include methods and compositions for the renewal of cardiomyocytes by targeting the Hippo pathway. In particular embodiments, an individual with a need for cardiomyocyte renewal is provided an effective amount of a shRNA molecule that targets the Sav1 gene. Particular shRNA sequences are disclosed.
Type:
Grant
Filed:
September 12, 2022
Date of Patent:
May 14, 2024
Assignee:
Baylor College of Medicine and Texas Heart Institute
Inventors:
James F. Martin, Yuka Morikawa, Todd Ryan Heallen, John Leach
Abstract: The present invention provides, inter alia, methods for treating, preventing, or ameliorating the effects of a lymphoid malignancy, such as those associated with a mutated phosphatase and tensin homolog (PTEN) gene, or T-cell acute lymphoblastic leukemia (T-ALL). These methods include administering to a subject an effective amount of a phosphoinositide 3-kinase-delta (PI3K?) inhibitor and a phosphoinositide 3-kinase-gamma (PI3K?) inhibitor. The present invention also provides pharmaceutical compositions for treating the effects of a lymphoid malignancy. This invention further provides a method for identifying a subject who may benefit from co-treatment with a PI3K? inhibitor and a PI3K? inhibitor. This method includes determining from a sample of the subject whether the subject has a mutated PTEN gene. Additionally, this invention provides methods for identifying a compound that has both PI3K? and PI3K? inhibitory activity.
Abstract: Compositions and methods for editing, e.g., introducing double-stranded breaks, within the TTR gene are provided. Compositions and methods for treating subjects having amyloidosis associated with transthyretin (ATTR), are provided.
Type:
Grant
Filed:
December 9, 2022
Date of Patent:
April 23, 2024
Assignee:
Intellia Therapeutics, Inc.
Inventors:
Arti Mahendra Prakash Kanjolia, Shobu Odate, Jessica Lynn Seitzer, Reynald Michael Lescarbeau, Walter Strapps
Abstract: Embodiments of the disclosure include methods and compositions related to treating or reducing the severity or delaying the onset of one or more cardiac conditions in a mammal. In particular embodiments, the compositions concern Park2 and its use for a cardiac medical condition. In specific cases, effective amounts of Park2 polynucleotide(s) and/or Park2 polypeptide(s) are provided to an individual in need thereof, including for heart failure, for example. The administration may be locally to the heart, for example.
Abstract: Provided are compositions and methods for altering gene expression in cells. The compositions and methods may utilize a nucleic acid sequence that has a genetically modified trans-activating crRNA (tracrRNA) sequence, where at least one uracil nucleotide of the tracrRNA sequence is replaced with a nucleotide other than uracil, and/or a nucleic acid sequence that has a guide RNA (gRNA) sequence wherein one or more cytosine nucleotides and/or one or more uracil nucleotides of said gRNA sequence are modified nucleotides. Also provided are methods of treating a disorder in a subject in need of the treatment. The method may involve administering to the subject the nucleic acid or a vector thereof in combination with an RNA-guided DNA endonuclease enzyme.
Abstract: Provided herein are methods for using RNAi molecules targeting a proteasome beta 5 (PSMB5) gene for controlling Coleopteran insects, methods for producing RNAi molecules targeting PSMB5, and compositions comprising RNAi molecules targeting PSMB5.
Abstract: Retrotransposons, operating though human-specific neurological pathways, can contribute to environment, lifestyle, and/or age-related neurodegeneration by disrupting functional mitochondrial populations within neurons. The mitochondrial disruption can occur through a number of retrotransposon-induced mechanisms that can influence the efficient and accurate transcription and/or translation of mitochondrial genes encoded in the nuclear genome, operating primarily through epigenetic processes. Alu element-related conformational changes (both subtle and major) of the outer and inner mitochondrial membrane pores can restrict or prevent the normal translocation of proteins (i.e., TOMM and TIMM complexes), ultimately contributing to mitochondrial stress, mitophagy, inflammation, and neuron and glial cell death.
Abstract: The present invention relates to RNAi agents, e.g., dsRNA agents, targeting the ketohexokinase (KHK) gene. The invention also relates to methods of using such RNAi agents to inhibit expression of a KHK gene and to methods of treating or preventing a KHK-associated disorder in a subject.
Type:
Grant
Filed:
December 2, 2022
Date of Patent:
March 12, 2024
Assignee:
Alnylam Pharmaceuticals, Inc.
Inventors:
Leila Noetzli, James D. McIninch, Frederic Tremblay, Mark K. Schlegel, Adam Castoreno
Abstract: This invention provides compounds, compositions and methods for modulating the expression of target genes using RNA interference. RNAi structures and molecules of this invention can be used for modulating or silencing the expression of genes, with high levels of RNAi activity and reduced off target actions. Advantageous structures include siRNAs targeted to any gene having one or more 2?-deoxy nucleotides located in the seed region. The RNA interference molecules can be used in methods for preventing or treating diseases.
Abstract: Described are RNAi agents, compositions that include RNAi agents, and methods for inhibition of a Superoxide Dismutase 1 (SOD1) gene. The SOD1 RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of an SOD1 gene. Pharmaceutical compositions that include one or more SOD1 RNAi agents, optionally with one or more additional therapeutics, are also described. Delivery of the described SOD1 RNAi agents to central nervous system (CNS) tissue, in vivo, provides for inhibition of SOD1 gene expression and a reduction in SOD1 activity, which can provide a therapeutic benefit to subjects, including human subjects, for the treatment of various diseases including amyotrophic lateral sclerosis (ALS.).
Type:
Grant
Filed:
June 14, 2023
Date of Patent:
February 27, 2024
Assignee:
Arrowhead Pharmaceuticals, Inc.
Inventors:
Christine Esau, Ji Young Suk, Tao Pei, Anthony Nicholas, Xiaokai Li, Jeffrey Carlson
Abstract: A method for in vitro transcription of a DNA template into RNA includes providing a mixture containing a buffer substance, ribonucleoside triphosphates (NTPs), one or more magnesium salts in a concentration of from about 2 mM to about 60 mM, the DNA template, and a recombinant RNA polymerase, and incubating the reaction mixture at from about 25° C. to about 40° C. for from about 1 hour to about 12 hours thereby producing the RNA. A method for in vitro transcription includes providing a DNA template and a cap analogue that binds to ?1 and/or +1 nucleotides of promoter for in vitro transcription, thus producing more full length mRNAs, allowing for more flexibility on the choice of first mRNA base, and providing +2 position open for custom sequence.