Abstract: The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua having high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.

Abstract: A pump for pumping sensitive fluids, such as blood, having no mechanical contact between the impeller and any other structure. The pump comprises a pump housing, an impeller disposed within the pump housing, a magnetic bearing system for supporting and stabilizing the impeller in five degrees of freedom, and a conformally shaped magnetically linked motor for rotating the impeller. The magnetic bearing system and motor advantageously comprise electromagnets and permanent magnets for stability and control of the impeller, and to reduce size, weight, and pump power consumption. Permanent and electromagnets are disposed on the pump housing and permanent magnets are disposed on the impeller such that by controlling electric current through the electromagnets on the housing, the magnetically suspended impeller functions as the rotor, and the housing as the stator of a D.C. motor.

Abstract: The present invention relates to a cultivar of Phyllanthus amarus ‘CIM-Jeevan’, producing high amount of herb, phyllanthin and hypophyllanthin, wherein said cultivar is developed through ?-irradiation of superior germplasm, the said plant produces high amount of herbage yield ranging between 1.0-1.15 kg per sqm fresh total plant herb, possesses high vegetative erect growth with a height ranging between 60 to 65 cm, produces phyllanthin ranging between 0.70-0.77% in dry herb, produces hypophyllanthin ranging between 0.32-0.37% in dry herb, and shows seed germination of about 90%.

Abstract: Indian basil, Ocimum basilicum, belongs to the family of Lamiaceae. The essential oil of Indian basil extracted via hydro or steam distillation from the leaves or whole plants is used to flavor foods, dental and oral products, in fragrances, and in traditional rituals and medicines. Extracted essential oil has also been shown to contain biologically active constituents that are insecticidal, nematicidal, fungistatic or which have antimicrobial properties. The present invention relates to the development of an early, short duration, dwarf, high essential oil, methy chavicol and linalool yielding variety of Indian basil (Ocimum basilicum). Family—Lamiaceae) named as ‘CIM-SAUMYA’. This new variety of Indian basil was developed through open pollination in the germplasm followed by half-sib progeny selection and evaluation for the yield characters of selected population for 3 years in field conditions.

Abstract: A pump for pumping sensitive fluids, such as blood, has no mechanical contact between the impeller and any other structure.

Abstract: Control techniques support low latency display operations on thin client devices. In response to a request to render a page in a user interface, the control may distinguish fields that likely have immediately displayable content from fields that are unlikely to have immediately displayable content. The control may retrieve data for those fields that are likely to have immediately displayable content and render them in an initial page. Content for the fields that are unlikely to have immediately displayable content may be generated as a background process and may be rendered in supplemental page(s) as they become available. The control permits quick rendering of basic pages, which may include navigation functionality, and therefore promote early navigation operations or quick review of data which can be made immediately available.

Abstract: A method and system for generating noise in a frequency synthesizer are provided. The method includes generating a noise portion of an input signal within the frequency synthesizer and appending the noise portion to a control portion of the input signal.

Abstract: A method and architecture for pulse shaping are provided. The architecture includes a pulse shaping filter having a plurality of memory elements and a plurality of taps connected to the plurality of memory elements wherein a total number of the plurality of taps is independent of a sampling rate. The pulse shaping filter further includes a selector configured to select outputs from the plurality of taps to define a pulse shaped output.

Abstract: A digital delay architecture and a digital delay method are provided. The digital delay architecture includes at least one shifter, at least one adder connected to the at least one shifter and a plurality of registers storing at least an output of the at least one adder and an original sampled signal. The plurality of registers are selectable to define a fractional delay value.

Abstract: A method for pre-distorting an input for a device is provided. A partial set of known data pairs is acquired during a closed-loop device calibration period. The partial set of known data pairs is searched for at least one missing data pair, and at least one data value is interpolated for the missing data pair. An augmented set of data pairs, including the known data pairs and the interpolated data value, is stored in a lookup table. During an open-loop operation period subsequent to the closed-loop device calibration period, the device input is pre-distorted based on the augmented set of data pairs stored in the lookup table.

Abstract: A digital polar transmitter includes a baseband processor configured to receive an input signal and to convert the input signal into a baseband amplitude component and a baseband phase component. The transmitter also includes a phase modulator in communication with the baseband processor. The phase modulator is configured to modulate an RF carrier signal based on the phase component and to generate a phase-modulated RF carrier signal. A power amplifier is provided in communication with the baseband processor and the phase modulator. The power amplifier is configured to amplify the phase-modulated RF carrier signal based on the baseband amplitude component and to generate an amplified RF signal. The transmitter also includes a digital feedback loop in communication with the power amplifier and the baseband processor. The digital feedback loop is configured to detect the amplified RF signal and to provide a digital amplitude feedback signal and a detected phase feedback signal to the baseband processor.

Abstract: A system is provided for processing a communication signal including a baseband amplitude component and a baseband phase component. The system includes an amplitude predictor configured for closed-loop pre-distortion of a baseband amplitude component, an amplitude lookup table configured for open-loop pre-distortion of the baseband amplitude component, and an amplitude interpolator configured to build up the amplitude lookup table during a closed-loop calibration period. The system also includes a phase predictor configured for closed-loop pre-distortion of a baseband phase component, a phase lookup table configured for open-loop pre-distortion of the baseband phase component, and a phase interpolator configured to build up the phase lookup table during a closed-loop calibration period.

Abstract: The present invention relates to a novel source of microorganism for production of Camptothecin and related camptothecinoids. The invention also discloses its isolation, screening for Camptothecin production, growth, fermentation requirements and chemical analysis of Camptothecin (camptothecinoids).

Abstract: The present invention is related to the development of a novel, distinct high herb and artemisinin yielding genotype of Artemisia annua obtained through systematic marker assisted breeding followed by selection of uniform population in a methodical way wherein the genotype is distinct, uniform and stably maintainable by continuous rouging of off types in the population using DNA marker at early seedling stage from nursery itself and suitable for commercial cultivation.

Abstract: The present invention provides an improved preparation based on the synergistic action of garlic extract and essential oil of M. spicata var. Ganga or cinnamon oil against dermatophytic fungus. More particularly, the present invention relates to the synergistic enhancement of activity of a combination by menthyl acetate or Geraniol. The invention also provides a method of preparation of the synergistic combination and the shelf life observed to be more than one year. The cream based preparation is a potent anti-dermatophytic as described and illustrated by in vitro and in vivo evaluations.

Abstract: The present invention relate to a novel synergistic composition of lignans exhibiting anticancer activities for breast, cervix, neuroblastoma, colon, liver, lung, mouth, ovary and prostate cancer obtained from the plant extract of Cedrus deodra, said composition comprising of (?)-Matairesinol in the range of 9 to 13% by weight, (?)-Wikstromol in the range of 75 to 79% by weight, Dibenzylbutyrolactol in the range of 7 to 11% by weight, and Unidentified material in the range of 2.6 to 3% by weight; further, the synergistic composition of lignan is used in combination with pharmaceutically acceptable carriers for inhibiting growth of various human cancer cell lines selected from breast, cervix, neuroblastoma, colon, liver, lung, mouth, ovary and prostate tissues.

Abstract: The present invention relates to a method of testing Bacopa monnieri response to abiotic stress factors and for testing bioactivity of natural, synthetic and semisynthetic compounds using Bacopa monnieri plant, which comprises growing the said plant and plant parts aseptically in MS 0 basal medium with agar in microcentrifuge tubes by adding the compounds to be tested either to the culture media or by spraying the said compounds on the plant or plant parts or on the said medium to detect the distinct morphological and cytological responses.

Abstract: An in vitro screening method for identifying insect tolerant genotypes or clones is described. The method comprises growing plantlets in an in vitro system, screening the plantlets for molecular variation of somaclones using RAPD analysis in vitro, selecting the somaclones having molecular variation, exposing the somaclones to insect larvae or nymphs and identifying the surviving somaclones.

Abstract: The invention relates to a novel pharmaceutical composition comprising an effective amount of bio-active fraction from cow urine distillate as a bioavailability facilitator and pharmaceutically acceptable additives selected from anticancer compounds, antibiotics, drugs, therapeutic and nutraceutic agents, ions and similar molecules which are targeted to the living systems.

Abstract: Security key distribution techniques using key rollover strategies for wireless networks are described. A number of keys are generated, usually by an access point. The present invention allows a standard mode and a mixed mode. In standard mode, each device on the network supports automatic key updates. In mixed mode, one or more devices on the wireless network require fixed keys. In both modes, a predetermined number of keys are determined and communicated to client devices that are accessing the wireless network. The predetermined number is determined so that a client device can miss a certain number of authentication periods without losing communication with the wireless network. Preferably, transmit keys used by an access point are different than the transmit keys used by the client devices that support automatic key updates.