Abstract: Provided are a method for generating a summary and system therefor. The method according to some embodiments may include generating a first view sample corresponding to a local view of a reference sample. generating a second view sample corresponding to a view greater than the local view from the reference sample; generating a first output value by inputting the first view sample to a first embedding model. generating a second output value by inputting the second view sample to a second embedding model. and updating parameters of the first embedding model based on a difference between the first output value and the second output value.

Abstract: A method for fabricating a semiconductor memory device may include the steps of: forming a stacked body on a source layer by alternately stacking a plurality of interlayer dielectric layers and a plurality of gate sacrificial layers; forming a plurality of channel holes through the stacked body, the channel holes each having a lower end extended into the source layer; forming a channel layer along the surfaces of the channel holes, the channel layer including a first region formed in the stacked body and a second region formed in the source layer; and forming a channel passivation layer in the first region to scale down the thickness of the channel layer of the first region.

Abstract: A positive electrode according to one embodiment of the present technology is a positive electrode including a positive electrode active material layer disposed on at least one surface of a positive electrode current collector, the positive electrode active material layer includes a lithium transition metal phosphate and a fluorine-based binder, and, in a flexibility evaluation, in which the positive electrode is lifted after bringing measuring rods for each phi (?) into contact with the positive electrode active material layer, a ratio value (=P/D) of a porosity (P) of the positive electrode active material layer calculated by the disclosed Equation 1 to a maximum phi value (D) of the measuring rod at which a crack occurs is greater than or equal to 10.

Abstract: A display panel includes a light emitting element and a pixel circuit electrically connected to the light emitting element and includes a first transistor and a second transistor. The first transistor includes a first semiconductor pattern including a first source region, a first drain region, and a first channel region, a first gate electrode disposed over the first channel region, and a first conductive pattern disposed under the first channel region. The second transistor includes a second semiconductor pattern including a second source region, a second drain region, and a second channel region, a second gate electrode disposed over the second channel region, and a second conductive pattern disposed under the second channel region. A length of the first conductive pattern is longer than a length of the first gate electrode. The second conductive pattern is shorter than a length of the second gate electrode.

Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method, and a composition for treating an autoimmune disease, the composition comprising the regulatory T cells.

Abstract: Disclosed herein are active agents, compositions containing them, unit dosage forms containing them, and methods of their use, e.g., for treating a metabolic disorder or nonalcoholic fatty liver disease or for modulating a metabolic marker or nonalcoholic fatty liver disease marker.

Abstract: A sensor cleaning system for cleaning an environment sensor includes: an air cleaning system configured to clean an environment sensor by spraying compressed air; a washer fluid cleaning system configured to clean the environment sensor by spraying washer fluid onto the environment sensor; a suction cleaning system configured to suck around the environment sensor; and a controller configured to control the air cleaning system, the washer fluid cleaning system, and the suction cleaning system.

Abstract: A foreign matter removal device according to an embodiment of the present disclosure removes foreign matters on the surface of an electrode that is continuously transferred along one direction, and includes a blowing unit that blows air toward the electrode surface, a suction unit that sucks foreign matters separated from the electrode surface, and an extension unit extending between the blowing unit and the suction unit, wherein the extension unit is formed with an adjustment unit recessed in a direction away from the electrode surface.

Abstract: A sterilization module including a main body, a circuit board disposed in the main body, a light source disposed on the circuit board to emit sterilizing light, and a transparent unit to protect the light source from an outside and including a material that transmits the sterilizing light, in which the light source includes a mesa including a first semiconductor layer, an active layer, and a second semiconductor layer, a first electrode electrically connected to the first semiconductor layer, and a second electrode disposed on the second semiconductor layer and electrically connected to the second semiconductor layer, in which the first electrode includes a first contact region disposed on the outer area of the first semiconductor layer and a second contact region at least partially surrounded by the mesa, and a distance between the transparent unit and the circuit board is greater than a height of the light source.

Abstract: A deodorization module and a storage device including the deodorization module. A deodorization module includes: a housing; a suction opening formed on the lower surface of the housing to allow external air to be suctioned therethrough; a fan disposed at the suction opening to suction the air; a discharge opening for discharging the air, which has been suctioned by the fan, to the outside of the housing; a photocatalytic bar disposed between the fan and the discharge opening; and a light source module, which includes a light source substrate and an ultraviolet light source and irradiates an ultraviolet ray to the photocatalytic bar.

Abstract: A work table for laser processing include a lower plate including a first area and a second area surrounding at least a portion of the first area, a first plate disposed in the first area on the lower plate and having a polygonal shape in a plan view, and a second plate disposed in the second area on the lower plate and movable in the second area.

Abstract: Disclosed herein are nanoparticles comprising Pazopanib or a derivative thereof encapsulated by the copolymer poly(lactic-co-glycolic acid) (PLGA). Also disclosed herein are methods for treating osteoarthritis, inhibiting or preventing cartilage degeneration, and reducing or inhibiting pain-associated depression in subjects with joint pain with nanoparticles comprising Pazopanib or a derivative thereof.

Abstract: An embodiment of the present specification provides a method for preparing a carbon nanotube, comprising: (a) introducing a catalyst into a chemical vapor deposition reactor; and (b) injecting a carbon source gas to synthesize a carbon nanotube, wherein an input of the catalyst and a flow rate of the carbon source gas satisfy the following Formula 1: 0.1 L/g·min?a/b?1.1 L/g·min??[Formula 1] wherein a represents a flow rate (L/min) of the carbon source gas and b represents an input (g) of the catalyst.

Abstract: An organometallic compound represented by Formula 1-1 or 1-2: wherein, in Formulae 1-1 and 1-2, M is Pt or Pd; each of X1, X2, and X3 is carbon; X4 is nitrogen; T8 is O, S, N(R81), C(R81)(R82), or Si(R81)(R82); and the remaining substituent groups are as defined herein.

Abstract: The present disclosure relates to a vehicle airbag device, which includes a main cushion and an auxiliary cushion deploying from the main cushion and may more effectively protect both a passenger-seat passenger in a normal seating state and a passenger-seat passenger in a relaxed seating state even in the event of an oblique offset collision by differentiating the deployment of the auxiliary cushion by releasing or maintaining the connection of a tether connected to the auxiliary cushion during deployment of an airbag cushion.

Abstract: A control box for charging includes a second connector disposed at a first end of the control box and configured to be coupled to a first connector provided at a first end of a supply cable configured to be connected to an external power source. The control box includes a retainer configured to prevent separation of the first connector when the first connector and the second connector are completely coupled. A top of the control box is open at a position corresponding to the second connector and the retainer is inserted through the open top and moved up and down.

Abstract: A control box for charging includes: a first connector connected to a supply cable having a plug, which is connected to an external power source, at a first end, and having a plurality of connection pins; and a control board having a first switch mounted therein and configured to control the first switch in a first state such that an input signal is transmitted to an output terminal of the control box when power is supplied in a first mode in which a signal is input from the first connector. In particular, the control board is configured to control the first switch in a second state to transmit and receive signals to and from a vehicle connected to the output terminal when power is supplied in a second mode in which a signal is not input from the first connector.

Abstract: A cleaner is provided and includes a cleaner main body including a suction motor, a battery module and a control module configured to control an operation of the cleaner. The control module is mountable on and separable from the cleaner main body. The control module includes a main processor configured to communicate with the battery module at a preset interval in a state in which the control module is mounted on the cleaner main body. The battery module is configured to identify that the control module is separated from the cleaner main body and to stop a supply of power to the cleaner main body based on not receiving a communication signal from the control module for the preset first time period or longer.

Abstract: An embodiment heat pump system of a vehicle includes a first cooling device including an electrical component and a first line for circulating a coolant, a second cooling device including a battery module and a second line for circulating the coolant, a HVAC module connected through a refrigerant line and internally provided with an opening/closing door that adjusts a selective flow of ambient air according to a cooling, heating, or heating and dehumidifying mode of a vehicle interior, a heat-exchanger connected to the internal condenser through the refrigerant line, a first expansion valve on the refrigerant line and connecting the heat-exchanger and the evaporator, a compressor connected between the evaporator and the internal condenser through the refrigerant line, an accumulator on the refrigerant line between the evaporator and the compressor, a chiller, a second expansion valve, a third expansion valve, and a second connection line.

Abstract: A display panel includes a substrate, a first storage capacitor electrode disposed on the substrate, a buffer layer disposed on the first storage capacitor electrode, an active layer disposed on the buffer layer and including a first area, a second area, and a channel area disposed between the first area and the second area, a gate insulation film disposed on the active layer, a gate electrode disposed on the gate insulation film and overlapping with the channel area, an inter-layer insulation film disposed on the gate electrode, and a metal layer disposed on the inter-layer insulation film, wherein the first area and the second area of the active layer are conductive areas, and wherein a conductive auxiliary layer overlapping with at least a portion of each of the first area and the second area and not overlapping with the channel area is included on the substrate, thereby mitigating the step in the area where the storage capacitor electrodes are disposed to prevent a short circuit.