Patents by Inventor B. Sharma

B. Sharma has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Patent number: 11519289
    Abstract: A hybrid electric gas turbine engine includes a fan section having a fan, a turbine section having a turbine drivably connected to the fan through a main shaft that extends along a central longitudinal axis, a gas generating core extending along a first axis that is radially offset from the central longitudinal axis, and an electric motor drivably connected to the main shaft, wherein the electric motor is colinear with the main shaft.
    Type: Grant
    Filed: December 6, 2019
    Date of Patent: December 6, 2022
    Assignee: Raytheon Technologies Corporation
    Inventors: Gabriel L. Suciu, Om P. Sharma, Joseph B. Staubach, Marc J. Muldoon, Jesse M. Chandler, David Lei Ma
  • Publication number: 20220333024
    Abstract: Systems and methods are provided for partial upgrading of heavy hydrocarbon feeds to meet transport specifications, such as pipeline transport specifications. The systems and methods can allow for one or more types of improvement in heavy hydrocarbon processing prior to transport. In some aspects, the systems and methods can produce a partially upgraded heavy hydrocarbon product that satisfies one or more transport specifications while incorporating an increased amount of vacuum gas oil and a reduced amount of pitch into the partially upgraded heavy hydrocarbon product. In other aspects, the systems and methods can allow for increased incorporation of hydrocarbons into the fraction upgraded for transport, thereby reducing or minimizing the amount of hydrocarbons requiring an alternative method of disposal or transport.
    Type: Application
    Filed: August 14, 2020
    Publication date: October 20, 2022
    Inventors: Eric B. SHEN, Anjaneya S. KOVVALI, Aruna RAMKRISHNAN, Arun K. SHARMA, Samuel J. CADY, Stephen H. BROWN, Rustom M. BILLIMORIA, Brenda A. RAICH, Bryan A. PATEL, Phillip K. SCHOCH, John DELLA MORA
  • Publication number: 20220325189
    Abstract: Systems and methods are provided for partial upgrading of heavy hydrocarbon feeds to meet transport specifications, such as pipeline transport specifications. The systems and methods can allow for one or more types of improvement in heavy hydrocarbon processing prior to transport. In some aspects, the systems and methods can produce a partially upgraded heavy hydrocarbon product that satisfies one or more transport specifications while incorporating an increased amount of vacuum gas oil and a reduced amount of pitch into the partially upgraded heavy hydrocarbon product. In other aspects, the systems and methods can allow for increased incorporation of hydrocarbons into the fraction upgraded for transport, thereby reducing or minimizing the amount of hydrocarbons requiring an alternative method of disposal or transport.
    Type: Application
    Filed: August 14, 2020
    Publication date: October 13, 2022
    Applicant: EXXONMOBIL TECHNOLOGY AND ENGINEERING COMPANY
    Inventors: Eric B. SHEN, Anjaneya S. KOVVALI, Aruna RAMKRISHNAN, Arun K. SHARMA, Samuel J. CADY, Stephen H. BROWN, Rustom M. BILLIMORIA, Brenda A. RAICH, Bryan A. PATEL, Phillip K. SCHOCH, John DELLA MORA
  • Publication number: 20220275293
    Abstract: Systems and methods are provided for partial upgrading of heavy hydrocarbon feeds to meet transport specifications, such as pipeline transport specifications. The systems and methods can allow for one or more types of improvement in heavy hydrocarbon processing prior to transport. In some aspects, the systems and methods can produce a partially upgraded heavy hydrocarbon product that satisfies one or more transport specifications while incorporating an increased amount of vacuum gas oil and a reduced amount of pitch into the partially upgraded heavy hydrocarbon product. In other aspects, the systems and methods can allow for increased incorporation of hydrocarbons into the fraction upgraded for transport, thereby reducing or minimizing the amount of hydrocarbons requiring an alternative method of disposal or transport.
    Type: Application
    Filed: August 14, 2020
    Publication date: September 1, 2022
    Inventors: Eric B. SHEN, Anjaneya S. KOVVALI, Aruna RAMKRISHNAN, Samuel J. CADY, Stephen H. BROWN, Rustom M. BILLIMORIA, Brenda A. RAICH, Bryan A. PATEL, Phillip K. SCHOCH, John DELLA MORA, Arun K. SHARMA
  • Patent number: 11376981
    Abstract: Systems and methods in accordance with embodiments of the invention impalement adaptive electric vehicle (EV) charging. One embodiment includes one or more electric vehicle supply equipment (EVSE); an adaptive EV charging platform, including a processor; a memory containing: an adaptive EV charging application; a plurality of EV charging parameters. In addition, the processor is configured by the adaptive EV charging application to: collect the plurality of EV charging parameters from one or more EVSEs, simulate EV charging control routines and push out updated EV charging control routines to the one or more EVSEs. Additionally, the adaptive EV charging platform is configured to control charging of EVs based upon the plurality of EV charging parameters collected from at least one EVSE.
    Type: Grant
    Filed: February 10, 2020
    Date of Patent: July 5, 2022
    Assignee: California Institute of Technology
    Inventors: Zachary J. Lee, Tongxin Li, Steven H. Low, Sunash B. Sharma
  • Patent number: 11292764
    Abstract: Novel photoacid generator compounds are provided. Compositions that include the novel photoacid generator compounds are also provided. The present disclosure further provides methods of making and using the photoacid generator compounds and compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.
    Type: Grant
    Filed: March 14, 2019
    Date of Patent: April 5, 2022
    Assignee: HERAEUS EPURIO LLC
    Inventors: Yongqiang Zhang, Ram B. Sharma
  • Publication number: 20210121413
    Abstract: Provided herein are immunomodulatory nanoparticles, compositions containing the same, and methods of use thereof, such as for the treatment of traumatic brain injury.
    Type: Application
    Filed: October 21, 2020
    Publication date: April 29, 2021
    Applicant: Northwestern University
    Inventors: John A. Kessler, Sripadh B. Sharma
  • Patent number: 10976658
    Abstract: Novel photoacid generator compounds are provided. Compositions that include the novel photoacid generator compounds are also provided. The present disclosure further provides methods of making and using the photoacid generator compounds and compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.
    Type: Grant
    Filed: August 11, 2016
    Date of Patent: April 13, 2021
    Assignee: HERAEUS EPURIO LLC
    Inventors: Yongqiang Zhang, Darin Campo, Ram B. Sharma, Martin Kunz
  • Publication number: 20210002213
    Abstract: Novel photoacid generator compounds are provided. Compositions that include the novel photoacid generator compounds are also provided. The present disclosure further provides methods of making and using the photoacid generator compounds and compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.
    Type: Application
    Filed: March 14, 2019
    Publication date: January 7, 2021
    Inventors: Yongqiang Zhang, Ram B. Sharma
  • Publication number: 20200254896
    Abstract: Systems and methods in accordance with embodiments of the invention impalement adaptive electric vehicle (EV) charging. One embodiment includes one or more electric vehicle supply equipment (EVSE); an adaptive EV charging platform, including a processor; a memory containing: an adaptive EV charging application; a plurality of EV charging parameters. In addition, the processor is configured by the adaptive EV charging application to: collect the plurality of EV charging parameters from one or more EVSEs, simulate EV charging control routines and push out updated EV charging control routines to the one or more EVSEs. Additionally, the adaptive EV charging platform is configured to control charging of EVs based upon the plurality of EV charging parameters collected from at least one EVSE.
    Type: Application
    Filed: February 10, 2020
    Publication date: August 13, 2020
    Applicant: California Institute of Technology
    Inventors: Zachary J. Lee, Tongxin Li, Steven H. Low, Sunash B. Sharma
  • Publication number: 20200089110
    Abstract: Novel photoacid generator compounds are provided. Compositions that include the novel photoacid generator compounds are also provided. The present disclosure further provides methods of making and using the photoacid generator compounds and compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.
    Type: Application
    Filed: August 11, 2016
    Publication date: March 19, 2020
    Inventors: Yongqiang Zhang, Darin Campo, Ram B. Sharma, Martin Kunz
  • Publication number: 20200017441
    Abstract: Novel photoacid generator compounds are provided. Compositions that include the novel photoacid generator compounds are also provided. The present disclosure further provides methods of making and using the photoacid generator compounds and compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.
    Type: Application
    Filed: March 14, 2019
    Publication date: January 16, 2020
    Inventors: Yongqiang Zhang, Ram B. Sharma
  • Patent number: 10221415
    Abstract: The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.
    Type: Grant
    Filed: August 31, 2016
    Date of Patent: March 5, 2019
    Assignee: West Virginia University
    Inventors: Sriganesh B. Sharma, Chen-Chung Lin, Mark K. Farrugia, J. Michael Ruppert
  • Patent number: 9709886
    Abstract: Novel photoacid generator compounds are provided. Photoresist compositions that include the novel photoacid generator compounds are also provided. The invention further provides methods of making and using the photoacid generator compounds and photoresist compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.
    Type: Grant
    Filed: September 14, 2016
    Date of Patent: July 18, 2017
    Assignee: HERAEUS PRECIOUS METALS NORTH AMERICA DAYCHEM LLC
    Inventors: Yongqiang Zhang, Daniel Greene, Ram B. Sharma
  • Publication number: 20170067049
    Abstract: The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.
    Type: Application
    Filed: August 31, 2016
    Publication date: March 9, 2017
    Inventors: Sriganesh B. Sharma, Chen-Chung Lin, Mark K. Farrugia, J. Michael Ruppert
  • Patent number: 9580523
    Abstract: Elastomeric polymers and compounded elastomers having reduced amounts of leachables and improved resistance to ?-irradiation sterilization suitable for pharmaceutical stopper and seal applications. These polymers and compounded elastomers maintain their physical performances upon being exposed to ?-irradiation over time and typical use conditions. The polymer is prepared by reacting a mixture of i) a C4 to C7 isoolefin monomer, ii) a styrene based monomer, and optionally iii) a C4 to C14 multiolefin monomer wherein the polymer contains 5 to 15 wt % of styrene derived units.
    Type: Grant
    Filed: August 9, 2012
    Date of Patent: February 28, 2017
    Assignee: ExxonMobil Chemical Patents Inc.
    Inventors: Wai K. Wong, Bharat B. Sharma, Bernard D'Cruz
  • Publication number: 20170003587
    Abstract: Novel photoacid generator compounds are provided. Photoresist compositions that include the novel photoacid generator compounds are also provided. The invention further provides methods of making and using the photoacid generator compounds and photoresist compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.
    Type: Application
    Filed: September 14, 2016
    Publication date: January 5, 2017
    Inventors: Yongqiang ZHANG, Daniel GREENE, Ram B. SHARMA
  • Patent number: 9477150
    Abstract: Novel photoacid generator compounds are provided. Photoresist compositions that include the novel photoacid generator compounds are also provided. The invention further provides methods of making and using the photoacid generator compounds and photoresist compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.
    Type: Grant
    Filed: March 13, 2015
    Date of Patent: October 25, 2016
    Assignee: HERAEUS PRECIOUS METALS NORTH AMERICA DAYCHEM LLC
    Inventors: Yongqiang Zhang, Daniel Greene, Ram B. Sharma
  • Publication number: 20160266487
    Abstract: Novel photoacid generator compounds are provided. Photoresist compositions that include the novel photoacid generator compounds are also provided. The invention further provides methods of making and using the photoacid generator compounds and photoresist compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.
    Type: Application
    Filed: March 13, 2015
    Publication date: September 15, 2016
    Inventors: Yongqiang ZHANG, Daniel GREENE, Ram B. SHARMA
  • Patent number: 9383644
    Abstract: Novel photoacid generator compounds are provided. Photoresist compositions that include the novel photoacid generator compounds are also provided. The invention further provides methods of making and using the photoacid generator compounds and photoresist compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.
    Type: Grant
    Filed: September 18, 2014
    Date of Patent: July 5, 2016
    Assignee: HERAEUS PRECIOUS METALS NORTH AMERICA DAYCHEM LLC
    Inventors: Yongqiang Zhang, Ram B. Sharma, Rachael Stuck, Daniel Greene, Rakesh Gupta, Jeffrey D. Fogle