Abstract: Various embodiments of the present invention use segment embeddings generated based at least in part on both intra-segment positional indicators for metadata labels within hierarchically-structured segments of a segment-ordered hierarchically-structured input data object as well as cross-segment position indicators for the noted hierarchically-structured segments.

Abstract: Provided herein are immunomodulatory nanoparticles, compositions containing the same, and methods of use thereof, such as for the treatment of traumatic brain injury.

Abstract: Systems and methods in accordance with embodiments of the invention impalement adaptive electric vehicle (EV) charging. One embodiment includes one or more electric vehicle supply equipment (EVSE); an adaptive EV charging platform, including a processor; a memory containing: an adaptive EV charging application; a plurality of EV charging parameters. In addition, the processor is configured by the adaptive EV charging application to: collect the plurality of EV charging parameters from one or more EVSEs, simulate EV charging control routines and push out updated EV charging control routines to the one or more EVSEs. Additionally, the adaptive EV charging platform is configured to control charging of EVs based upon the plurality of EV charging parameters collected from at least one EVSE.

Abstract: Novel photoacid generator compounds are provided. Compositions that include the novel photoacid generator compounds are also provided. The present disclosure further provides methods of making and using the photoacid generator compounds and compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.

Abstract: Provided herein are immunomodulatory nanoparticles, compositions containing the same, and methods of use thereof, such as for the treatment of traumatic brain injury.

Abstract: Novel photoacid generator compounds are provided. Compositions that include the novel photoacid generator compounds are also provided. The present disclosure further provides methods of making and using the photoacid generator compounds and compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.

Abstract: Novel photoacid generator compounds are provided. Compositions that include the novel photoacid generator compounds are also provided. The present disclosure further provides methods of making and using the photoacid generator compounds and compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.

Abstract: Systems and methods in accordance with embodiments of the invention impalement adaptive electric vehicle (EV) charging. One embodiment includes one or more electric vehicle supply equipment (EVSE); an adaptive EV charging platform, including a processor; a memory containing: an adaptive EV charging application; a plurality of EV charging parameters. In addition, the processor is configured by the adaptive EV charging application to: collect the plurality of EV charging parameters from one or more EVSEs, simulate EV charging control routines and push out updated EV charging control routines to the one or more EVSEs. Additionally, the adaptive EV charging platform is configured to control charging of EVs based upon the plurality of EV charging parameters collected from at least one EVSE.

Abstract: Novel photoacid generator compounds are provided. Compositions that include the novel photoacid generator compounds are also provided. The present disclosure further provides methods of making and using the photoacid generator compounds and compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.

Abstract: Novel photoacid generator compounds are provided. Compositions that include the novel photoacid generator compounds are also provided. The present disclosure further provides methods of making and using the photoacid generator compounds and compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.

Abstract: The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.

Abstract: Novel photoacid generator compounds are provided. Photoresist compositions that include the novel photoacid generator compounds are also provided. The invention further provides methods of making and using the photoacid generator compounds and photoresist compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.

Abstract: The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.

Abstract: Elastomeric polymers and compounded elastomers having reduced amounts of leachables and improved resistance to ?-irradiation sterilization suitable for pharmaceutical stopper and seal applications. These polymers and compounded elastomers maintain their physical performances upon being exposed to ?-irradiation over time and typical use conditions. The polymer is prepared by reacting a mixture of i) a C4 to C7 isoolefin monomer, ii) a styrene based monomer, and optionally iii) a C4 to C14 multiolefin monomer wherein the polymer contains 5 to 15 wt % of styrene derived units.

Abstract: Novel photoacid generator compounds are provided. Photoresist compositions that include the novel photoacid generator compounds are also provided. The invention further provides methods of making and using the photoacid generator compounds and photoresist compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.

Abstract: Novel photoacid generator compounds are provided. Photoresist compositions that include the novel photoacid generator compounds are also provided. The invention further provides methods of making and using the photoacid generator compounds and photoresist compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.

Abstract: Novel photoacid generator compounds are provided. Photoresist compositions that include the novel photoacid generator compounds are also provided. The invention further provides methods of making and using the photoacid generator compounds and photoresist compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.

Abstract: Novel photoacid generator compounds are provided. Photoresist compositions that include the novel photoacid generator compounds are also provided. The invention further provides methods of making and using the photoacid generator compounds and photoresist compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.

Abstract: Novel photoacid generator compounds are provided. Photoresist compositions that include the novel photoacid generator compounds are also provided. The invention further provides methods of making and using the photoacid generator compounds and photoresist compositions disclosed herein. The compounds and compositions are useful as photoactive components in chemically amplified resist compositions for various microfabrication applications.

Abstract: Disclosed are apparatus and devices for programming and operating a programmable memory array portion coupled with a leakage reduction circuit. At the leakage reduction circuit, a frame bias signal that indicates a majority state of the memory array portion can be received. During idle states of the programmable memory array portion, at least one shared bit line of the memory array portion can be selectively biased based on the received frame bias signal. In one aspect, a first one of two bit lines is biased to a first state, while the second one of the two bits lines is biased to a second state that is opposite the first state. In a further aspect, the first state is a same state as the majority state of the memory array portion.