Abstract: The present invention provides for a compound having the structure: (AA1)n-Cys-(AA2)m wherein n=0, 1, 2, 3, 4 or 5 and m=0, 1, 2, 3, 4 or 5, provided the sum of (n+m) is greater than or equal to two and less than or equal to five, if n=1, (AA1)n=Ala-, if n=2, (AA1)n=Gln-Ala-, if n≧3, (AA1)n=(Xaa)p-Gln-Ala-, and Xaa=any amino acid and wherein if n=n3, p=1, if n=4, p=2, if n=5, p=3, if m=1, (AA2)m=-Arg, if m=2, (AA2)m=-Arg-Gly, if m≧3, (AA2)m=-Arg-Gly-(Xaa)q, wherein if m=3, q=1, if m=4, q=2, if m=5, q=3. The present invention provides for a method of inhibiting cell death and a method for alleviating symptoms of a neurodegenerative disorder in a subject.

Abstract: The present invention provides for an antisense oligonucleotide having the sequence 5'GCTCGGCGCCGCCATTTCCAG3'(SEQ ID NO:1). The invention also provides for an antisense oligonucleotide having the sequence 5'GTCAGCGGCCATCAGCTT3'(SEQ ID NO:2). The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5'GCTCGGCGCCGCCATTTCCAG3' (SEQ ID NO:1) and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5'GCTCGGCGCCGCCATTTCCAG3' (SEQ ID NO:1) effective to inhibit death of the cell.