Abstract: Immunostimulatory oligoribonucleotides (ORN) featuring 5?-triphosphates and various 5?-triphosphate analogs are provided. Also provided are physiologically acceptable salts of the immunostimulatory ORN and pharmaceutical compositions containing the immunostimulatory ORN of the invention. ORN of the invention are useful as adjuvants and can be combined with an antigen to promote an antigen-specific immune response. ORN of the invention are also particularly useful for promoting a Th1-type immune response. Also provided are methods of use of the compounds and pharmaceutical compositions of the invention to enhance an immune response in a subject, as well to treat a number of conditions including cancer, infection, allergy, and asthma, and to vaccinate a subject against an antigen.

Abstract: The invention relates to a class of soft or semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response.

Abstract: The invention relates to a class of soft or semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response.

Abstract: The present invention relates to PNA derivatives which carry, at the C terminus, or at both the C and N termini of the PNA backbone, one or more phosphoryl radicals. The phosphoryl radicals carry, where appropriate, one or more labeling groups, groups for crosslinking, groups which promote intracellular uptake, or groups which increase the binding affinity of the PNA derivative for nucleic acids. The invention furthermore relates to a process for preparing the above-mentioned PNA derivatives and to their use as pharmaceuticals or diagnostic agents.

Abstract: Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5? TCGTCGTTTTCGGCGCGCGCCGT 3? (SEQ ID NO: 1), in which each C is unmethylated and 3? refers to the 3? end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-?. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.

Abstract: Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5? TCGTCGTTTTCGGCGCGCGCCGT 3? (SEQ ID NO: 1), in which each C is unmethylated and 3? refers to the 3? end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-?. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.

Abstract: The invention relates to a class of CpG immunostimulatory oligonucleotides containing a CpG immunostimulatory motif and a second motif which is capable of forming secondary structure, including duplex and higher order structures, in vitro and in vivo. The oligonucleotides of the invention are useful as adjuvants in vaccination. The oligonucleotides are also useful for inducing an immune response, inducing expression of a type I interferon (IFN), inducing expression of gamma interferon (IFN-?), and for treating a variety of conditions, including allergy, asthma, infection, and cancer.

Abstract: The invention provides immunostimulatory compositions and methods for their use. In particular, the immunostimulatory compositions of the invention include RNA-like polymers that incorporate an immunostimulatory sequence motif and at least one chemical modification to confer improved stability against nuclease degradation and improved activity. Specific modifications involving phosphate linkages, nucleotide analogs, and combinations thereof are provided. Compositions of the invention optionally include an antigen and can be used to stimulate an immune response. Also provided are compositions and methods useful for treating a subject having an infection, a cancer, an to allergic condition, or asthma. Modified oligoribonucleotide analogs of the invention are believed to stimulate Toll-like receptors TLR7 and TLR8.

Abstract: The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.

Abstract: The invention relates to a class of CpG immunostimulatory oligonucleotides containing a 5?TCG motif or a CG at or near the 5? end that are useful for stimulating an immune response.

Abstract: The present invention relates to PNA derivatives which carry, at the C terminus, or at both the C and N termini of the PNA backbone, one or more phosphoryl radicals. The phosphoryl radicals carry, where appropriate, one or more labeling groups, groups for crosslinking, groups which promote intracellular uptake, or groups which increase the binding affinity of the PNA derivative for nucleic acids. The invention furthermore relates to a process for preparing the above-mentioned PNA derivatives and to their use as pharmaceuticals or diagnostic agents.

Abstract: The invention relates to oligonucleotides including at least one FANA substituted nucleotide analog and a pyrimidine-purine dinucleotide. The invention also relates to pharmaceutical compositions and methods of use thereof.

Abstract: The present invention relates to PNA derivatives which carry, at the C terminus, or at both the C and N termini of the PNA backbone, one or more phosphoryl radicals. The phosphoryl radicals carry, where appropriate, one or more labeling groups, groups for crosslinking, groups which promote intracellular uptake, or groups which increase the binding affinity of the PNA derivative for nucleic acids. The invention furthermore relates to a process for preparing the above-mentioned PNA derivatives and to their use as pharmaceuticals or diagnostic agents.

Abstract: The present application relates to antisense oligonucleotides which inhibit expression of the OB-RGRP protein and to uses thereof for preventing and/or treating leptin-related pathological conditions. It also relates to a method for detecting compounds which modify the interaction between proteins of the OB-RGRP family and the leptin receptor. This detection may be carried out by measuring the energy transfer between fusion proteins composed of these proteins and of energy-donor and -acceptor proteins.

Abstract: The invention provides an immunostimulatory nucleic acid comprising CpG motifs, and methods of use thereof in stimulating immunity.

Abstract: Immunostimulatory oligoribonucleotides (ORN) featuring 5?-triphosphates and various 5?-triphosphate analogs are provided. Also provided are physiologically acceptable salts of the immunostimulatory ORN and pharmaceutical compositions containing the immunostimulatory ORN of the invention. ORN of the invention are useful as adjuvants and can be combined with an antigen to promote an antigen-specific immune response. ORN of the invention are also particularly useful for promoting a Th1-type immune response. Also provided are methods of use of the compounds and pharmaceutical compositions of the invention to enhance an immune response in a subject, as well to treat a number of conditions including cancer, infection, allergy, and asthma, and to vaccinate a subject against an antigen.

Abstract: The invention relates to oligonucleotides including at least one backbone modification and a pyrimidine-purine dinucleotide. The invention also relates to pharmaceutical compositions and methods of use thereof.

Abstract: The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.

Abstract: The invention relates to methods and products for the treatment of viral infection using a combination of anti-viral agents and TLR ligands. The invention also relates to screening assays, associated products, kits, and in vitro methods.

Abstract: The invention relates to a nucleic acid-lipophilic conjugates and methods for modulating an immune response using the conjugates. The lipophilic moiety associated with an immunostimulatory nucleic acid.