Patents by Inventor Jian Lin

Jian Lin has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20200017906
    Abstract: The present invention relates to a marker piRNA-54265 and a method in diagnosis, treatment, and prognostic evaluation of colorectal cancer. The marker piRNA-54265 is capable of being used for diagnosing and/or treating colorectal cancer, wherein the marker piRNA-54265 is selected from any of molecules as follows: (1) SEQ ID NO.29: tggaggtgatgaactgtctgagcctgacc; (2) SEQ ID NO.30: UGGAGGUGAUGAACUGUCUGAGCCUGACC; (3) SEQ ID NO.31: GGUCAGGCUCAGACAGUUCAUCACCUCCA; (4) a piR-54265 variant and a piR-54265 derivative modified from the molecule shown in (1), (2) or (3) with a same function; (5) a piR-54265 polynucleotide construct capable of down-regulating an amount of the piR-54265 in vivo after being introduced; and (6) an expression vector containing the polynucleotide construct of (5). The method is used for diagnosing/screening colorectal cancer, evaluating chemosensitivity of a colorectal cancer patient, evaluating a prognosis of a colorectal cancer patient or treating colorectal cancer.
    Type: Application
    Filed: September 19, 2019
    Publication date: January 16, 2020
    Applicants: SUN YAT-SEN UNIVERSITY, SUN YAT-SEN UNIVERSITY CANCER CENTER
    Inventors: Dongxin LIN, Jian ZHENG, Dongmei MAI, Liping TAN
  • Publication number: 20200010464
    Abstract: The invention relates to inhibitors of mutant isocitrate dehydrogenase (mt-IDH) proteins with neomorphic activity useful in the treatment of cell-proliferation disorders and cancers, having the Formula: where Y1, X1, X2, Y2, W1, W2, W3, and R1-R5 are described herein.
    Type: Application
    Filed: July 22, 2019
    Publication date: January 9, 2020
    Inventors: Jian Lin, Anna Ericsson, Ann-Marie Campbell, Gary Gustafson, Zhongguo Wang, R. Bruce Diebold, Susan Ashwell, David R. Lancia, JR., Justin Andrew Caravella, Wei Lu
  • Publication number: 20200001592
    Abstract: The present disclosure provides a light transmission processing system and method for a solar chip module. The light transmission processing system includes: an ink printing unit configured to print a preset pattern on an upper surface of the chip module with a UV ink so that a hollowed out region is formed on an area of the upper surface of the chip module not covered by the pattern, the chip module including a transparent substrate and a chip layer superposed on an upper surface of the transparent substrate; a curing unit configured to cure the UV ink printed on the chip module with UV light to form a UV ink protective film; and a layer removing unit configured to remove a portion of the chip layer corresponding to the hollowed out region to expose a portion of the transparent substrate corresponding to the hollowed out region.
    Type: Application
    Filed: August 31, 2018
    Publication date: January 2, 2020
    Inventors: Qingwen SHI, Junzhao GAO, Jian LIN, Qingfeng SU, Junrong LIN, Hong WANG, Wei JIANG, Hejiang LV, Zhenhua SHA, Yao WEI, Jun FENG
  • Publication number: 20200001554
    Abstract: The invention relates to a method for connecting a connection piece to a U-shaped ring anchor for a head module for rail vehicles, the head module consisting predominantly of fiber-reinforced plastic material and having an outer shell and the ring anchor consisting of fiber-reinforced plastic material and being arranged in the roof region of the outer shell as a stiffening means. According to the method, connecting elements are fed through the dry or matrix-material-impregnated, unconsolidated fiber reinforcement structure of the ring anchor.
    Type: Application
    Filed: February 5, 2018
    Publication date: January 2, 2020
    Applicants: CRRC QINGDAO SIFANG CO., LTD., CG RAIL - CHINESISCH-DEUTSCHES FORSCHUNGS-UND ENTWICKLUNGSZENTRUM FOR BAHN- UND VERKEHRSTECHNIK
    Inventors: Jian DU, Peng LIN, Dongfang CHEN, Zhengmin ZHANG, Yonggui ZHANG, Chunpeng CAO, Werner HUFENBACH, Andreas ULBRICHT
  • Patent number: 10523396
    Abstract: A method for sending a wireless local area network packet structure is provided, and the method comprises: determining a packet structure, where the packet structure comprises an HE-SIGA and an HE-SIGB, the HE-SIGA comprises an indication information, and if a current transmission mode is a full bandwidth MU-MIMO transmission, the indication information is used to indicate a number of scheduled users, or if the current transmission mode is other transmission mode, the indication information is used to indicate a number of symbols in the HE-SIGB; and sending the packet structure.
    Type: Grant
    Filed: March 22, 2019
    Date of Patent: December 31, 2019
    Assignee: HUAWEI TECHNOLOGIES CO., LTD.
    Inventors: Meilu Lin, Ming Gan, Le Liu, Jun Zhu, Jian Yu
  • Patent number: 10518354
    Abstract: An ultraviolet laser 3D printing device includes a thermostat, a laser head, a non-contact type temperature monitoring device, a scanning galvanometer, a processing platform, a powder laying device, a material to be processed, a computer control system. The device is configured to perform the following functions: presetting a processing temperature by the control system; during the processing procedure, the temperature rise condition of the processed object is monitored by the non-contact type temperature monitoring device and fed back in real time to the control system; and by recording the rise value of the temperature within a certain period, the system can obtain the absorption capability of the laser and the temperature rise degree of the processed material, so that the laser output power can be calculated according to the preset processing temperature value, and the laser power can be adjusted in real time to precisely control the processing temperature.
    Type: Grant
    Filed: April 24, 2015
    Date of Patent: December 31, 2019
    Assignees: INSTITUTE OF CHEMISTRY, CHINESE ACADEMY OF SCIENCES, INSTITUTE OF SEMICONDUCTORS, CHINESE ACADEMY OF SCIENCES
    Inventors: Xuechun Lin, Wenting Wang, Zhiyan Zhang, Shusen Zhao, Haijuan Yu, Yongmei Ma, Wenhua Sun, Jian Xu, Jinyong Dong, Chuncheng Li, Wenxin Fu
  • Patent number: 10518310
    Abstract: A bending mold device for bidirectional pipe bending includes a mounting base which is horizontally arranged on a rack in a sliding manner. The mounting base includes a translation lead screw driving the mounting base to slide. The rack includes a lead screw nut. A pipe bending spindle is rotatably disposed on the mounting base and a power mechanism is disposed on the mounting base. The upper end of the pipe bending spindle is movably connected to a lower rotating base. The lower rotating base includes a first pipe bending shaft and a second pipe bending shaft, which respectively include a first bending mold lower mold and a second bending mold lower mold. The rack includes a cylinder above the lower rotating base. The end part of a piston rod of the cylinder fixedly includes an upper limiting plate and a lower limiting plate in a sleeving manner.
    Type: Grant
    Filed: February 22, 2016
    Date of Patent: December 31, 2019
    Assignee: Jiangsu University of Science and Technology Industrial Technology Research Institute of Zhangjiagang
    Inventors: Wenxian Tang, Jian Zhang, Hui Zhu, Hongcai Lin, Qinfeng Li, Yang Zhang, Shijie Su
  • Publication number: 20190388405
    Abstract: The present invention relates to compounds and compositions for the inhibition of NAMPT, their synthesis, applications and antidotes.
    Type: Application
    Filed: August 12, 2019
    Publication date: December 26, 2019
    Inventors: Kenneth W. Bair, Timm R. Baumeister, Alexandre J. Buckmelter, Karl H. Clodfelter, Peter Dragovich, Francis Gosselin, Bingsong Han, Jian Lin, Dominic J. Reynolds, Bruce Roth, Chase C. Smith, Zhongguo Wang, Po-Wai Yuen, Xiaozhang Zheng
  • Patent number: 10516151
    Abstract: The present application provides a top cover of power battery, including top cover plate, first electrode unit and second electrode unit, the first electrode unit includes insulation piece, conductive plate, deformable plate and sealing piece, the top cover plate is provided with deformable plate connecting hole and fixing hole, the deformable plate seals the deformable plate connecting hole, the insulation piece is provided with top cover plate connecting portion and conductive plate connecting portion, the insulation piece is fixed underneath the top cover plate through cooperation of top cover plate connecting portion and fixing hole, the conductive plate is insulated from and fixed with the top cover plate through the conductive plate connecting portion, the conductive plate is electrically connected with the deformable plate, the sealing piece seals path from the fixing hole to interior of the power battery passing through gap between insulation piece and top cover plate.
    Type: Grant
    Filed: February 17, 2017
    Date of Patent: December 24, 2019
    Assignee: CONTEMPORARY AMPEREX TECHNOLOGY CO., LIMITED
    Inventors: Quankun Li, Pinghua Deng, Peng Wang, Jian Guo, Lingbo Zhu, Yongshou Lin
  • Patent number: 10505285
    Abstract: A multi-band antenna array includes a plurality of first antennas for resonating at a first band, and a plurality of second antennas for resonating at a second band. A frequency of the second band is higher than a frequency of the first band. Locations of the plurality of first antennas project to a plurality of grid-one positions on a surface; locations of the plurality of second antennas project to a plurality of grid-two positions on the surface. Among the grid-one positions, a second grid-one position is nearest to a first grid-one position by a first distance along a first direction. Among the grid-two positions, a first grid-two position and a second grid-two position are closest two to the first grid-one position. The first and second grid-two positions are separated by a second distance along a second direction; and, the first direction and the second direction are nonparallel.
    Type: Grant
    Filed: August 14, 2018
    Date of Patent: December 10, 2019
    Assignee: MEDIATEK INC.
    Inventors: Yeh-Chun Kao, Wun-Jian Lin, Chen-Fang Tai, Shao-Yu Huang, Shih-Huang Yeh
  • Patent number: 10505775
    Abstract: Embodiments of the present disclosure provide a physical layer protocol data unit PPDU transmission method and a corresponding PPDU transmission apparatus. Application of the method and apparatus in the embodiments of the present disclosure enables a receive end to quickly determine the starting position of the feature signal sequence by means of blind detection, and ensures that the receive end quickly completes data processing and status switching.
    Type: Grant
    Filed: November 3, 2017
    Date of Patent: December 10, 2019
    Assignee: Huawei Technologies Co., Ltd.
    Inventors: Meilu Lin, Sheng Liu, Wei Lin, Jian Yu, Le Liu, Xun Yang, Shimon Shilo, Doron Ezri, Genadiy Tsodik, Oded Redlich
  • Patent number: 10505193
    Abstract: In some embodiments, the present disclosure pertains to methods of producing a graphene material by exposing a polymer to a laser source. In some embodiments, the exposing results in formation of a graphene from the polymer. In some embodiments, the methods of the present disclosure also include a step of separating the formed graphene from the polymer to form an isolated graphene. In some embodiments, the methods of the present disclosure also include a step of incorporating the graphene material or the isolated graphene into an electronic device, such as an energy storage device. In some embodiments, the graphene is utilized as at least one of an electrode, current collector or additive in the electronic device. Additional embodiments of the present disclosure pertain to the graphene materials, isolated graphenes, and electronic devices that are formed by the methods of the present disclosure.
    Type: Grant
    Filed: February 17, 2015
    Date of Patent: December 10, 2019
    Assignee: WILLIAM MARSH RICE UNIVERSITY
    Inventors: James M. Tour, Jian Lin, Zhiwei Peng, Carter Kittrell
  • Patent number: 10498010
    Abstract: An antenna structure includes a metal housing, a first ground portion, a second ground portion, a first feed source, and a coupling portion. The metal housing includes a front frame, a backboard, and a side frame. The side frame defines a slot and the front frame defines a first groove and a first gap. The slot, the first groove, and the first gap separate a first antenna section from the metal housing. The first ground portion and the second ground portion are both electrically connected to the first antenna section and grounded. One end of the coupling portion is electrically connected to the first feed source. The coupling portion is spaced apart from the first antenna section and current from the first feed source is coupled to the first antenna section through the coupling portion.
    Type: Grant
    Filed: July 21, 2017
    Date of Patent: December 3, 2019
    Assignee: Chiun Mai Communication Systems, Inc.
    Inventors: Yen-Hui Lin, Yun-Jian Chang, Jung-Chin Lin
  • Patent number: 10489688
    Abstract: Techniques and systems are described to determine personalized digital image aesthetics in a digital medium environment. In one example, a personalized offset is generated to adapt a generic model for digital image aesthetics. A generic model, once trained, is used to generate training aesthetics scores from a personal training data set that corresponds to an entity, e.g., a particular user, group of users, and so on. The image aesthetics system then generates residual scores (e.g., offsets) as a difference between the training aesthetics score and the personal aesthetics score for the personal training digital images. The image aesthetics system then employs machine learning to train a personalized model to predict the residual scores as a personalized offset using the residual scores and personal training digital images.
    Type: Grant
    Filed: July 24, 2017
    Date of Patent: November 26, 2019
    Assignee: Adobe Inc.
    Inventors: Xiaohui Shen, Zhe Lin, Radomir Mech, Jian Ren
  • Patent number: 10488477
    Abstract: A gradient coil unit having a peripheral surface enclosing a magnetic gradient axis, and a middle plane substantially perpendicular to the magnetic gradient axis at a middle portion of the gradient coil unit, comprising at least one folded coil which comprises a first set of curved conductors disposed on a first curved surface; a second set of curved conductors disposed on a second curved surface outside the first curved surface and substantially overlapping the first set of curved conductors; and a set of connecting conductors connecting selected curved conductors in the first set with selected curved conductors in the second set; wherein the set of connecting conductors is located at a first side of the middle plane.
    Type: Grant
    Filed: April 28, 2016
    Date of Patent: November 26, 2019
    Assignee: General Electric Company
    Inventors: Jian Lin, Jean-Baptiste Mathieu, Yihe Hua, Seung-Kyun Lee, Dominic Michael Graziani
  • Publication number: 20190352589
    Abstract: An automated cell culture system includes a cell culture reactor including a housing; a fluidic circuit for cell culture media, the fluidic circuit disposed in an interior of the housing. The fluidic circuit includes a culture vessel for culturing cells in the cell culture media, a reservoir for the cell culture media, the reservoir fluidically connected to the culture vessel, and a pump configured to pump the cell culture media in the fluidic circuit. The automated cell culture system includes one or more sensors disposed in the interior of the housing, each sensor configured to detect a parameter of one or more of (1) the cell culture media in the fluidic circuit and (2) an environment in the interior of the housing; and a computing device configured to automatically control operation of the cell culture reactor based on one or more of the detected parameters.
    Type: Application
    Filed: December 21, 2018
    Publication date: November 21, 2019
    Inventors: Jie Jing, Kenneth A. Collins, Fang Yuan, Zhonghua Zhang, Lawrence St. George, Jeffery J. Driscoll, Weijia Tan, Hao Cai, Dongping Lin, Jian Cheng
  • Patent number: 10483108
    Abstract: A semiconductor device and method of manufacture are provided. After a patterning of a middle layer, the middle layer is removed. In order to reduce or prevent damage to other underlying layers exposed by the patterning of the middle layer and intervening layers, an inhibitor is included within an etching process in order to inhibit the amount of material removed from the underlying layers.
    Type: Grant
    Filed: October 3, 2017
    Date of Patent: November 19, 2019
    Assignee: Taiwan Semiconductor Manufacturing Company, Ltd.
    Inventors: Jian-Jou Lian, Yao-Wen Hsu, Neng-Jye Yang, Li-Min Chen, Chia-Wei Wu, Kuan-Lin Chen, Kuo Bin Huang
  • Publication number: 20190349391
    Abstract: A machine learning-based technique for user behavior analysis that detects when users deviate from expected behavior. In this approach, a set of user groups are provided, preferably based on information provided from a user registry. A set of training data for each of the set of user groups is then obtained, preferably by collecting security events generated for a collection of the users over a given time period (e.g., a last thirty (30) days). A machine learning system is then trained using the set of training data to produce a model that includes a set of clusters in user behavior model, wherein a cluster is a learned user group that corresponds to a defined user group. Once the model is built, it is used to identify users that deviate from their expected group behavior. In particular, the system compares a current behavior of a user against the model and flags anomalous behavior. The user behavior analysis may be implemented in a security platform, such as a SIEM.
    Type: Application
    Filed: May 10, 2018
    Publication date: November 14, 2019
    Applicant: International Business Machines Corporation
    Inventors: Matthew Elsner, Jian Lin, Ronald Williams, Ilgen Banu Yuceer
  • Publication number: 20190347578
    Abstract: A machine learning (ML)-based technique for user behavior analysis that detects when users deviate from expected behavior. A ML model is trained using training data derived from activity data from a first set of users. The model is refined in a computationally-efficient manner by identifying a second set of users that constitute a “watch list.” At a given time, a differential data ingestion operation is then performed to incorporate data for the second set of users into the training data, while also pruning at least a portion of the data set corresponding to data associated with any user included in the first set but not in the second set. These operations update the training data used for the machine learning. The machine learning model is then refined based on the updated training data that incorporates the activity data ingested from the users identified in the watch list.
    Type: Application
    Filed: May 10, 2018
    Publication date: November 14, 2019
    Applicant: International Business Machines Corporation
    Inventors: Michael Josiah Bolding, Matthew Elsner, Jian Lin, Matthew Paul Ouellette, Yun Pan
  • Patent number: 10477183
    Abstract: A method of three-dimensional video encoding and decoding that adaptively incorporates camera parameters in the video bitstream according to a control flag is disclosed. The control flag is derived based on a combination of individual control flags associated with multiple depth-oriented coding tools. Another control flag can be incorporated in the video bitstream to indicate whether there is a need for the camera parameters for the current layer. In another embodiment, a first flag and a second flag are used to adaptively control the presence and location of camera parameters for each layer or each view in the video bitstream. The first flag indicates whether camera parameters for each layer or view are present in the video bitstream. The second flag indicates camera parameter location for each layer or view in the video bitstream.
    Type: Grant
    Filed: July 18, 2014
    Date of Patent: November 12, 2019
    Assignee: HFI INNOVATION INC.
    Inventors: Yu-Lin Chang, Yi-Wen Chen, Jian-Liang Lin