Abstract: An azimuthal acoustic LWD apparatus is sequentially provided with a centralizer, a transmitting circuit, transmitting transducers, an acoustic insulator, a receiving transducer array, ultrasonic transducers and a receiving circuit on a drill collar. The azimuthal acoustic LWD apparatus is capable of operating in a dipole mode or a unipole mode, to cover all the sectors around a wellbore by adopting a fixed time interval measurement mode or an alternating time interval measurement mode according to a relationship of an interval between measurement times and a rotation speed of the apparatus, thereby achieving azimuthal acoustic LWD. This apparatus overcomes problems that the fixed time interval measurement mode may not cover all the sectors and further may not achieve azimuthal acoustic imaging in a case where the rotation speed and the interval between measurement times are under certain conditions.

Abstract: An azimuthal acoustic LWD apparatus is sequentially provided with a centralizer, a transmitting circuit, transmitting transducers, an acoustic insulator, a receiving transducer array, ultrasonic transducers and a receiving circuit on a drill collar. The azimuthal acoustic LWD apparatus is capable of operating in a dipole mode or a unipole mode, to cover all the sectors around a wellbore by adopting a fixed time interval measurement mode or an alternating time interval measurement mode according to a relationship of an interval between measurement times and a rotation speed of the apparatus, thereby achieving azimuthal acoustic LWD. This apparatus overcomes problems that the fixed time interval measurement mode may not cover all the sectors and further may not achieve azimuthal acoustic imaging in a case where the rotation speed and the interval between measurement times are under certain conditions.

Abstract: In an apparatus for multi-pole acoustic logging while drilling, a N-cycle sinusoidal wave signal is generated by utilizing a signal processor, and amplified into a high-voltage sinusoidal excitation signal by utilizing a power amplifier, and output to a transmitting transducer. The signal processor simultaneously generates an enable signal. The enable signal includes a transient discharge enable signal. The power amplifier is connected with a transient discharge circuit. After the signal processor generates N cycles of a sinusoidal wave, the transient discharge enable signal enables the transient discharge circuit to discharge to release an energy storage current of a power transformer so as to eliminate a high-voltage ringing effect and improve an excitation efficiency of the transducer.

Abstract: The present invention relates to a marker piRNA-54265 and a method in diagnosis, treatment, and prognostic evaluation of colorectal cancer. The marker piRNA-54265 is capable of being used for diagnosing and/or treating colorectal cancer, wherein the marker piRNA-54265 is selected from any of molecules as follows: (1) SEQ ID NO.29: tggaggtgatgaactgtctgagcctgacc; (2) SEQ ID NO.30: UGGAGGUGAUGAACUGUCUGAGCCUGACC; (3) SEQ ID NO.31: GGUCAGGCUCAGACAGUUCAUCACCUCCA; (4) a piR-54265 variant and a piR-54265 derivative modified from the molecule shown in (1), (2) or (3) with a same function; (5) a piR-54265 polynucleotide construct capable of down-regulating an amount of the piR-54265 in vivo after being introduced; and (6) an expression vector containing the polynucleotide construct of (5). The method is used for diagnosing/screening colorectal cancer, evaluating chemosensitivity of a colorectal cancer patient, evaluating a prognosis of a colorectal cancer patient or treating colorectal cancer.

Abstract: A space vector pulse width modulation (SVPWM) method for suppressing a common-mode voltage of a multiphase motor includes the following steps: (1) dividing all basic vectors of the multiphase motor into q types, and selecting therefrom x types having equal common-mode voltage magnitude of which an absolute value is smallest; (2) for each type in the x types of basic vectors, structuring y classes of auxiliary vectors according to an optimization model; (3) synthesizing reference vectors by virtue of the auxiliary vectors to obtain functioning time of basic vectors functioning in each switching period; and (4) obtaining an optimal functioning sequence of the basic vectors functioning in each switching period with fewest switching operations of a converter as a purpose. The present invention may effectively suppress a magnitude and frequency of the common-mode voltage of the multiphase motor without increasing calculation complexity or reducing other performance indexes.

Abstract: A apparatus for downhole near-bit wireless transmission includes a bit connecting housing, a mud motor connecting housing, an insulating sub made of an insulating material. The insulating sub is serially connected between the bit connecting housing and the mud motor connecting housing to electrical insulate the bit connecting housing and the mud motor connecting housing from each other. The bit connecting housing and the mud motor connecting housing respectively form an electromagnetic transmitting positive pole and an electromagnetic transmitting negative pole. The mechanical apparatus further includes measurement units, which are configured to acquire parameters measured near the bit and a data transmitting unit, which is configured to realize wireless transmission; and the data transmitting unit is configured to receive and transmit the parameters measured near the bit.

Abstract: Modified hepatitis C virus polypeptides are described. The polypeptides include the HCV NS4a domain and modified NS3 domain. The polypeptides retain conformational epitopes. HCV immunoassays including the polypeptides are also described.

Abstract: A space vector pulse width modulation (SVPWM) method for suppressing a common-mode voltage of a multiphase motor includes the following steps: (1) dividing all basic vectors of the multiphase motor into q types, and selecting therefrom x types having equal common-mode voltage magnitude of which an absolute value is smallest; (2) for each type in the x types of basic vectors, structuring y classes of auxiliary vectors according to an optimization model; (3) synthesizing reference vectors by virtue of the auxiliary vectors to obtain functioning time of basic vectors functioning in each switching period; and (4) obtaining an optimal functioning sequence of the basic vectors functioning in each switching period with fewest switching operations of a converter as a purpose.

Abstract: The present disclosure relates to the technical field of acoustic logging while drilling, and provides an integral packaging device for acoustic receiving transducers while drilling, wherein, the receiving transducers are directly arranged in a signal processing circuit, which is installed in an internal supporting frame fitted in a rectangular bellow; one side of the bellow has a deformable surface that is of a corrugated structure, and oil is filled in the bellow; the receiving transducers are arranged on the side that has a deformable surface; a shock absorbing rubber piece is of a U-shaped structure; one end of a connecting unit is connected to the signal processing circuit, and the other end of the connecting unit is connected to a main control circuit in a logging while drilling instrument. The present disclosure employs an integral packaging structure, which is easy to install structurally.

Abstract: An azimuthally acoustic imaging logging while drilling (LWD) apparatus employs two sets of transmitting transducers to excite multipole mode waves. One set is high-frequency monopole and polarized pole transmitting transducers, and the other set is low-frequency dipole and quadrupole transmitting transducers. Separation of a high-frequency transmitting state from a low-frequency transmitting state is realized by using a dual-row transmission solution. Each set of transmitting transducers operates at transducer resonance points through a matching circuit, thereby greatly increasing the transmitted energy.

Abstract: An acoustic source testing apparatus of an azimuthally acoustic logging while drilling (LWD) instrument includes a water tank, a silicone oil, a drill collar, an azimuthally acoustic while drilling quadrupole transmitting apparatus and an acoustic signal reception apparatus. The bottom of the water tank is symmetrically provided with two supporting columns, the drill collar is disposed in U-shaped grooves on the supporting columns, the azimuthally acoustic quadrupole LWD transmitting apparatus and the acoustic signal reception apparatus are disposed on the drill collar, the silicone oil is filled in the water tank, and the drill collar, the azimuthally acoustic quadrupole LWD transmitting apparatus and the acoustic signal reception apparatus are completely covered in the silicone oil.

Abstract: A near-bit dynamic well deviation angle measurement apparatus includes a circuit board and 2n+1 accelerometers. One accelerometer is installed in an axial direction of a drilling tool and forms n sets of three-axis orthogonal installation together with other 2n accelerometers. The accelerometer installed in the axial direction measures Az?, and the remaining accelerometers respectively measure n X-axis radial components and n Y-axis radial components corresponding to the n X-axis radial components. A filter and a data processing unit are integrated on the circuit board. The circuit board acquires signals in which the components are eliminated by the accelerators in real time, and further high-frequency vibration and impact interference in the signals are filtered out by using the filter to obtain non-interference gravitational acceleration components Ax, Ay and Az, and further a well deviation angle is calculated.

Abstract: The present disclosure relates to a technical field of a security detection device, and particularly, to a security detection system, comprising one or more detection devices, wherein the detection device comprises a first ray emitter, a ray receiver, and a movable frame, wherein the first ray emitter comprises a first ray source for generating first detection rays and is provided at a bottom portion of the movable frame, so that the first detection rays can penetrate through a detected object from a bottom of the detected object; the ray receiver comprises a ray detector provided on the movable frame, for correspondingly receiving the first detection rays having penetrated through the detected object; and the movable frame is movable in a direction in which the first ray emitter and the ray receiver are capable of moving through a detection region for the detected object.

Abstract: The present disclosure relates to the technical field of acoustic logging while drilling, and provides an integral packaging device for acoustic receiving transducers while drilling, wherein, the receiving transducers are directly arranged in a signal processing circuit, which is installed in an internal supporting frame fitted in a rectangular bellow; one side of the bellow has a deformable surface that is of a corrugated structure, and oil is filled in the bellow; the receiving transducers are arranged on the side that has a deformable surface; a shock absorbing rubber piece is of a U-shaped structure; one end of a connecting unit is connected to the signal processing circuit, and the other end of the connecting unit is connected to a main control circuit in a logging while drilling instrument. The present disclosure employs an integral packaging structure, which is easy to install structurally.

Abstract: In a method for acquiring data of azimuthal acoustic LWD, when an acoustic LWD instrument rotates with a drilling tool at a certain depth, data is acquired by adopting an azimuthal equal-interval mode: a well circumference is divided into m sectors by azimuthal intervals ??, when a toolface angle of the acoustic LWD instrument is located in the kth sector, an acoustic transmitting source is controlled to transmit an acoustic signal, and an acoustic receiver measures the acoustic signal, digitizes it and then stores it as data in the kth sector; and the data is acquired for each sector in turn, and after the data is acquired in each sector for N times, the data acquisition at the current depth is completed. Meanwhile, as the drilling tool rotates and drills, the instrument acquires acoustic data at different depths and processes it to achieve azimuthal acoustic imaging.

Abstract: In an apparatus for multi-pole acoustic logging while drilling, a N-cycle sinusoidal wave signal is generated by utilizing a signal processor, and amplified into a high-voltage sinusoidal excitation signal by utilizing a power amplifier, and output to a transmitting transducer. The signal processor simultaneously generates an enable signal. The enable signal includes a transient discharge enable signal. The power amplifier is connected with a transient discharge circuit. After the signal processor generates N cycles of a sinusoidal wave, the transient discharge enable signal enables the transient discharge circuit to discharge to release an energy storage current of a power transformer so as to eliminate a high-voltage ringing effect and improve an excitation efficiency of the transducer.

Abstract: A casting method and cast article are provided. The casting method includes providing a casting furnace, the casting furnace including a withdrawal region in a lower end, positioning a mold within the casting furnace, positioning a molten material in the mold, partially withdrawing the mold a withdrawal distance through the withdrawal region in the casting furnace, the withdrawal distance providing a partially withdrawn portion, then reinserting at least a portion of the partially withdrawn portion into the casting furnace through the withdrawal region, and then completely withdrawing the mold from the casting furnace. The reinserting at least partially re-melts a solidified portion within the partially withdrawn portion to reduce or eliminate freckle grains. The cast article includes a microstructure and occurrence of freckle grains corresponding to being formed by a process comprising partially withdrawing, reinserting, and completely withdrawing of a mold from a casting furnace to form the cast article.

Abstract: Modified hepatitis C virus polypeptides are described. The polypeptides include the HCV NS4a domain and modified NS3 domain. The polypeptides retain conformational epitopes. HCV immunoassays including the polypeptides are also described.

Abstract: The disclosure relates to the field of drilling tool attitude measurement, and particularly to a dynamic testing device suitable for a drilling tool attitude measurement module. The dynamic testing device may comprise a test fixture for attitude measurement module, an azimuth rotation device for adjusting an azimuth angle, an inclination angle swing device for adjusting an inclination angle, and a toolface angle rotation device for driving the test fixture for attitude measurement module to rotate, and a rotation speed measurement device for measuring a rotation speed and a self-rotation angle of the test fixture for attitude measurement module in a rotating state. The testing device has characteristics of large bearing weight, high rotation speed which is measurable and controllable, convenient for mounting and fixing a tested module, etc. It can simulate conditions of downhole rotation of a drilling tool, and be used for dynamic testing of the attitude measurement module.

Abstract: The present invention belongs to the technical fields of macromolecular materials and batteries, and particularly relates to a non-porous separator and the use thereof, more particularly to a non-porous separator having a gelation function and the use thereof. This non-porous separator is composed of two or more macromolecular materials, wherein at least one of the macromolecular materials can be gelled by an organic solvent. This non-porous separator can be used in batteries having an organic solvent-based electrolyte and a high energy density, such that not only can a micro-short circuit, generated due to the introduction of foreign matters such as metals, be prevented, leading to an improved qualification rate for the product, but also the safety performance and the cycle life of such a battery can be improved significantly.