Abstract: The present invention proposes a connection structure for a robot that operates inside pipes, as its small size allows high tractions in restricted spaces. It can be applied to form the connection structure of intervention robotic systems that operate under traction and can also be used to connect two umbilicals without using a large volume connector. Accordingly, the solution found by the present application solves the connection problems between two systems, the robot and the umbilical cable, and solves the problem of the state of the art, using a splice housing (1) that internally contains a splice hood (5).

Abstract: The present invention relates to a method for measuring the levels of Protein C (PROC), preferably Activated Protein C (APC), in a subject in need thereof, the method comprising a step of performing an enzymatic digestion of one or more biological samples isolated from the subject, and a step of measuring the levels of the peptide of SEQ ID NO 1 (LGEYDLR) and/or SEQ ID NO 2 (TFVL-NFIK), wherein the levels of SEQ ID NO 1 and/or SEQ ID NO 2 correspond to the levels of PROC, preferably APC, present in said one or more biological samples. Methods for classifying subjects and prognosticating the response to treatments are also included.

Abstract: The present invention relates to a process for the manufacture of microporous carbon materials to perform selective separations of nitrogen in gas mixtures such as hydrogen sulfide, carbon dioxide, methane and C2, C3 and C4+ hydrocarbons, with high efficiency, shaped of microspheres or cylinders from copolymers of poly (vinylidene chloride-co-methyl acrylate) with density of 1.3 to 1.85 g/cm.sup.3 or poly (vinylidene chloride-co-vinyl chloride) with density of 1.3 to 1.85 g/cm.sup.3, using two stages. The first stage consists of a surface passivation of the material by chemical attack in a highly alkaline alcohol solution, with the aim of effecting a precarbonization on the surface of the copolymer that during the pyrolysis process is not deformed and gradually develops microporosity. The material of the first stage presents, in the layer, percentages between 55% to 85% carbon, between 5% to 20% oxygen, and between 10% to 40% chlorine.

Abstract: Dual composition block copolymers made from conjugated diene and monovinyl aromatic monomers in batch organolithium initiated polymerization show advantageous performance in the production of crosslinked microcellular rubber compounds and pressure sensitive hot melt adhesives. The dual composition block copolymers are partially coupled with a coupling agent linking inner monovinyl aromatic blocks. Their un-coupled low molecular weight fraction has greater monovinyl aromatic repeating unit content than their coupled high molecular weight fraction. Crosslinked microcellular rubber articles made from the dual composition block copolymers exhibit lower density, smaller and more homogeneous cell size, higher softness and higher resiliency than prior art block copolymers. Rubber compounding of formulations comprising the dual composition block copolymers proceed at slightly lower torque and slightly lower temperature than with prior art block copolymers.

Abstract: Disclosed is an oligomeric compound comprising from 10 to 50 monomer subunits, at least part of the sequence of which is complementary to the following sequence: AAGGAAACUGCCAUCUCCAA (SEQ ID NO: 1 in the appended sequence listing). Also disclosed is a pharmaceutical composition comprising said oligomeric compound and use for treating Duchenne Muscular Dystrophy.

Abstract: A thermal radiation shield for blocking thermal radiation at a gas turbine piping connection joint is provided. The thermal radiation shield is configured to surround the gas turbine piping connection joint. The thermal radiation shield includes at least two shield portions in contact with one another at a pair of flanged ends. The at least two shield portions collectively define an opening. Each shield portion of the at least two shield portions includes an inner shell, an outer shell, and insulation disposed between the inner shell and the outer shell. One of the inner shell or the outer shell includes a pipe connection bracket that extends into the opening.

Abstract: A surgical robotic system including a surgical table, a surgical robotic manipulator coupled to the surgical table and comprising a plurality of links coupled together by a plurality of joints that are operable to move with respect to one another to move the surgical robotic manipulator, at least one of the plurality of links or the plurality of joints having a portion that faces another of the plurality of links or the plurality of joints, a proximity sensing assembly coupled to the portion of the at least one of the plurality of links or the plurality of joints, the proximity sensing assembly operable to detect an object prior to the surgical robotic manipulator colliding with the object and to output a corresponding detection signal, and a processor operable to receive the corresponding detecting signal and cause the manipulator or the object to engage in a collision avoidance operation.

Abstract: A tool driver for use in robotic surgery includes a base configured to couple to a distal end of a robotic arm, and a tool carriage slidingly engaged with the base and configured to receive a surgical tool. In one variation, the tool carriage may include a plurality of linear axis drives configured to actuate one or more articulated movements of the surgical tool. In another variation, the tool carriage may include a plurality of rotary axis drives configured to actuate one or more articulated movements of the surgical tool. Various sensors, such as a capacitive load cell for measuring axial load, a position sensor for measuring linear position of the guide based on the rotational positions of gears in a gear transmission, and/or a capacitive torque sensor based on differential capacitance, may be included in the tool driver.

Abstract: This disclosure includes techniques for controlling smart home devices upon entering a home with a fingerprint sensor in a doorbell device. After capturing a fingerprint of a digit of a guest and sending the fingerprint to a server device, the server device matches the fingerprint of the digit to an entry in a guest fingerprint database for a first user. The server device sends an operational command to a smart home device separate from the doorbell device and located at a same premises as the doorbell device. In response to receiving the operational command from the server device, the smart home device performs an action corresponding to the operational command.

Abstract: A random number generator comprising a light source (7) configured to emit photons (10) throughout a light emission time interval, a photosensor (12) configured to absorb photons emitted from the light source throughout a light absorption time interval concurrent with the light emission time interval thereby to generate a continuous electrical output signal (13) extending throughout the absorption time interval, and a processor (14) configured to determine temporal variations in the continuous electrical output signal and to generate therefrom one or more quantum random numbers (15).

Abstract: The present invention describes a wind turbine comprising a hub, at least one blade and at least one pitch bearing to connect the at least one blade to the hub, the at least one pitch bearing comprising at least an inner ring and an outer ring, and at least a rolling race, wherein the wind turbine further comprises at least a tensioning system configured to exert a radial compression force to at least a part of the outer ring of the at least one pitch bearing, thus increasing the resultant stiffness of the at least one pitch bearing.

Abstract: A cutting tool includes a supporting body and a cBN or PCD cutting edge tip attached to the supporting body via a 5-150 ?m braze joint. The supporting body is cemented carbide having 3-25 wt % of a metallic binder, optionally up to 25 wt % of carbides or carbonitrides of one or more elements of group 4, 5, or 6, and the rest WC. The metallic binder includes at least 40 wt % Ni, and the braze joint has, in the order from the supporting body, a first layer of TiC situated next thereto, with an average thickness of 10-400 nm, a second layer, with an average thickness of 0.5-8 ?m, having in average at least 5 wt % metallic Ni, in average 25-60 wt % metallic Cu and in average 15-45 wt % metallic Ti, and a third layer, with an average thickness of 4-145 ?m, having metallic Ag and metallic Cu.

Abstract: The invention relates to nucleic acids and methods for restoring acid alpha-glucosidase (GAA) activity in patients with Pompe disease using splice-switching technology.

Abstract: A system and method of detecting food intake events from wearable devices. The system comprises a signal bank to store physiological digital data signals collected via a wearable device comprising at least one sensor to sense at least one physiological parameter of a user. The system comprises a preprocessor module to process the physiological digital data signals stored on the data signal bank and to create a descriptive representation of the sensed at least one physiological parameter. The system also comprises a feature extractor module, with two parallel function modes, comprising features that are automatically learned while others are analytically derived from the descriptive representation. Thus, the feature extractor is configured to select at least one of the modes. The system also comprises a probability estimator module to determine whether a food intake event of the user occurs based on the extracted features.

Abstract: A sintered cemented carbide insert for mining or cutting applications includes a mean WC grain size of between 0.8-18 ?m, a binder phase in a weight between 4-18 wt %, a gamma phase with the cubic gamma phase precursors in a weight of between 0.8-10 wt %, and any unavoidable impurities and a balance of WC. A difference between the hardness at any point 0.3 mm from the surface of the insert and the hardness of the bulk is at least 25 HV3, wherein hardness is measured according to ISO EN6507. A method of producing the cemented carbide is also provided.

Abstract: Disclosed are systems and methods that provide a novel framework that automatically and dynamically adjusts and controls the real-world conditions of an environment within a location. Such adjustment can be based on characteristics of items and/or persons within a location, such that the integrity of the items are prevented from being compromised. The framework can function by determining and enforcing safe thresholds for environmental conditions (e.g., temperature and humidity, for example) using artificial intelligence and/or machine learning (AI/ML) techniques. Climate and environmental condition information within the location, as well as attributes/characteristics of the location and/or items therein can be accounted for, and leveraged in determining environmentally safe thresholds that can be utilized for monitoring the location. When real-world conditions in the environment approach and/or exceed the safe thresholds, a climate system (e.g.

Abstract: An anchoring system for floating platform which eliminates the pitch and roll movements of the floating platform using anchoring lines (200) attached to the seabed (5), which are supported by several pulleys or rotary fixing means (2, 3) of the floating platform (100) and are all joined in a common counterweight (1) hanging from the floating platform (100). Each anchoring line (200) comprises a direct subline (200d) and a cross subline (200c), which maintain the counterweight (1) always located in correspondence with the central axis (300) of the floating platform (100). It also describes a novel method for installing the floating platform at its destination without the aid of special ships.

Abstract: This invention relates to a blister opening system comprising a blister body (1) arranged over a support surface (1??); a header (2) comprising an impelling surface (2?), wherein said header (2) is movable relative to the blister body (1) and transmits a pressure against the blister body (1) through the impelling surface (2?) in a pushing direction (3); and a fluidic outlet channel (4) fluidically connected to the blister body (1). The system is characterized in that the impelling surface (2?) is arranged such that, in a relative position between the header (2) and the blister body (1) the pushing direction (3) and the support surface (1??) form a relative angle (5) substantially different from 90°. The pressure of the impelling surface (2?) against the blister body (1) configures a gas entrapment volume (1?) at an opposite side of the blister body (1) with regard to the fluidic outlet channel (4).

Abstract: A modular tool anchor includes an anchor body positionable about a tubular. The anchor includes an anchor wedge for gripping against the tubular. A wedge drive screw engages a piston that biases the wedge into contact with the tubular as the wedge drive screw is tightened. The anchor also includes a compression seal positioned within the anchor body. A sealing flange abuts the compression seal. As seal compression screws are tightened, the sealing flange engages the compression seal and forces it against the tubular.

Abstract: Dual composition block copolymers made from conjugated diene and monovinyl aromatic monomers in batch organolithium initiated polymerization show advantageous performance in the production of crosslinked microcellular rubber compounds and pressure sensitive hot melt adhesives. The dual composition block copolymers are partially coupled with a coupling agent linking inner monovinyl aromatic blocks. Their un-coupled low molecular weight fraction has greater monovinyl aromatic repeating unit content than their coupled high molecular weight fraction. Crosslinked microcellular rubber articles made from the dual composition block copolymers exhibit lower density, smaller and more homogeneous cell size, higher softness and higher resiliency than prior art block copolymers. Rubber compounding of formulations comprising the dual composition block copolymers proceed at slightly lower torque and slightly lower temperature than with prior art block copolymers.