Abstract: The present invention relates to a semi-submersible platform (1) for maritime applications such as wind power, electrical substations or hydrogen generation plants, wherein the semi-submersible platform (1) comprises a base body (2) made of concrete equipped with internal compartments (3) adapted to house ballast water, and three or more buoyancy columns (4) substantially made of concrete, wherein said columns (4) protrude from an upper face of the base body (2) and are arranged at the vertexes of the base body (2), wherein at least one column (4) is internally equipped with respective concentric rings (5, 6), an inner ring (5) and an outer ring (6), joined together by a plurality of radial walls (7) that define anti-flood compartments (8).

Abstract: A tool driver for use in robotic surgery includes a base configured to couple to a distal end of a robotic arm, and a tool carriage slidingly engaged with the base and configured to receive a surgical tool. In one variation, the tool carriage may include a plurality of linear axis drives configured to actuate one or more articulated movements of the surgical tool. In another variation, the tool carriage may include a plurality of rotary axis drives configured to actuate one or more articulated movements of the surgical tool. Various sensors, such as a capacitive load cell for measuring axial load, a position sensor for measuring linear position of the guide based on the rotational positions of gears in a gear transmission, and/or a capacitive torque sensor based on differential capacitance, may be included in the tool driver.

Abstract: An automated system for cleaning solar panels in a solar plant, characterized in that it comprises: at least one chassis, which comprises at least two vertical bars; and at least one longitudinal upper bar, which joins the at least two vertical bars; at least two wheels, arranged at one of the ends of each of the at least two vertical bars; at least one cleaning element; at least one driving means, to mobilize the at least two wheels; and at least one controller means, to control the operation of each of the at least two wheels.

Abstract: A method for performing a technical process in which application programs are executed redundantly in a plurality N of computing instances and, on the basis of an MooN system, wherein M is at least two and N is at least three, a comparison of the plurality N of results of the redundant execution of the application programs is performed in a voting. When a minority of the results is different from a majority of the results with identical content, the minority is excluded during the performance of the technical process, is repaired with a state copy of one of the intact computing instances and reintegrated into the process. There is also described a computer program product and a provisioning apparatus.

Abstract: A dispensing lid assembly having a lid portion that seals off the opening of the container but for an aperture and a centrally disposed interface void. The lid portion provides an integrated, external measuring spout in communication with the aperture. A dial portion may be rotatably coupled to the lid portion so that they rotate independent of each other. The dial portion is operatively associated with a diaphragm disposed under the lid portion so that rotation of the dial portion selectively moves the diaphragm between an open configuration and a closed configuration closing off the aperture and fluidly disconnecting the compartment of the container from the external measuring spout.

Abstract: A device for measuring electrical conductivity comprising: electrodes (700a, 700b); a current source (100) configured to inject an electrical current into a medium (600); a switching block (200) configured to produce a current flow through the medium (600) from the first electrode (700a) to the second electrode (700b) or from the second electrode (700b) to the first electrode (700a); a sensor block (300) connected to the first electrode (700a) and/or the second electrode (700b), configured to amplify an electrical magnitude of the medium (600) generated in response to the current flow in the medium (600); and a feedback block (400) configured to connect the sensor block (300) to the current source (100).

Abstract: Filter element for filtering a liquid, wherein the filter element (1) is designed to be installed in a housing (31) with a cover (32), the filter element (1) having a first end cap (2) facing the cover (32), a second end cap (3), and a filtering medium (4) with a hollow interior (5), wherein the filter medium (4) is arranged between the first end cap (2) and the second end cap (3), wherein the first end cap (2) has a sealing means (6) over the outer circumference of the end cap, wherein the first end cap (2) has a first opening (7), wherein an elastically reversible compensation element (8) can be arranged in the interior (5), said compensation element in a position of a cover-side exterior (9) of the filter element (1) arranged in the interior (5) protrudes into the interior (5) through the first opening (7) and seals the interior (5) in a fluid-tight manner against a passage of liquid from the interior (5) into the cover-side exterior (9) through the first opening (7), wherein the sealing means (6) is desig

Abstract: The invention relates to a filter element (I) for filtering a liquid and for a flow of the liquid from an unfiltered side (50) to a clean side (52). The filter element (I) has a first end cap (2), a second end cap (3), and a filter medium (4) with a hollow interior (5). The filter medium (4) is arranged between the first end cap (2) and the second end cap (2) along an axial direction (A) wherein the first end cap (2) has a first opening (6) for a flow of the liquid, and a grip guard (7) is arranged in the first opening (6), said grip guard being configured to prevent a finger from penetrating into the interior (5) through the first opening (6).

Abstract: An example of an apparatus may include a processor to process request transactions and completion transactions for one or more respective communication protocols, memory coupled to the processor to store error-related transaction information, and circuitry coupled to the memory to save the error-related transaction information in the memory for both the request transactions and the completion transactions for the one or more respective communication protocols. Other examples are disclosed and claimed.

Abstract: Systems and methods for wireless deployment of electrical lower completions are provided. A wet disconnect tool-running tool includes a battery and telemetry section, and electronics and sensors section, and a pressure compensator and control lines section.

Abstract: A transportable gravity flow display rack for food and/or drink containers (such as milk gallons) having a pallet base adapted to receive the forks from a forklift or pallet jack, a plurality of vertical upright supports, a first cross bar and a second cross bar, and one or more inclined storage racks, thereby facilitating the flow of the containers towards a costumer in response to gravity.

Abstract: A method comprising a) providing a packer comprising a tubular mandrel, a swellable elastomeric body supported on the mandrel, and first and second end caps secured to the mandrel, each end cap having an inner bore therethrough and being positioned such that a first end of each end cap abuts an end of the swellable elastomeric body, wherein the first end of at least one end cap includes a strain absorbing undercut formed in the inner bore thereof; b) positioning the packer within a wellbore; c) providing a swelling fluid into the wellbore; d) forming a fluid seal against the wellbore with the swellable elastomeric body; and e) extruding the swellable elastomeric body into the undercut.

Abstract: Anchoring system for floating platform (100) that eliminates pitching and rolling movements of the floating platform (100), by means of several anchoring lines (200) attached to the seabed (5), which are supported by several rotary fixing means (2, 3) or pulleys of the floating platform (100) and are all joined together in a common counterweight (1) hanging from the platform (100). Each anchoring line (200) comprises sublines (200d, 200c) (direct, crossover or diagonal), which keep the counterweight (1) always in correspondence with the central axis (300) of the floating platform (100). It also eliminates the pendulum movement of the counterweight (1) and is valid for floating platforms (100) with an odd number of protruding structural arms (12). The system is applicable to any type of floating platform (100), although it is particularly suitable for floating platforms that support offshore wind turbines and marine leisure platforms.

Abstract: The invention relates to nucleic acids and methods for restoring acid alpha-glucosidase (GAA) activity in patients with Pompe disease using splice-switching technology.

Abstract: The present invention relates to a method for measuring the levels of Protein C (PROC), preferably Activated Protein C (APC), in a subject in need thereof, the method comprising a step of performing an enzymatic digestion of one or more biological samples isolated from the subject, and a step of measuring the levels of the peptide of SEQ ID NO 1 (LGEYDLR) and/or SEQ ID NO 2 (TFVL-NFIK), wherein the levels of SEQ ID NO 1 and/or SEQ ID NO 2 correspond to the levels of PROC, preferably APC, present in said one or more biological samples. Methods for classifying subjects and prognosticating the response to treatments are also included.

Abstract: The present invention relates to a process for the manufacture of microporous carbon materials to perform selective separations of nitrogen in gas mixtures such as hydrogen sulfide, carbon dioxide, methane and C2, C3 and C4+ hydrocarbons, with high efficiency, shaped of microspheres or cylinders from copolymers of poly (vinylidene chloride-co-methyl acrylate) with density of 1.3 to 1.85 g/cm.sup.3 or poly (vinylidene chloride-co-vinyl chloride) with density of 1.3 to 1.85 g/cm.sup.3, using two stages. The first stage consists of a surface passivation of the material by chemical attack in a highly alkaline alcohol solution, with the aim of effecting a precarbonization on the surface of the copolymer that during the pyrolysis process is not deformed and gradually develops microporosity. The material of the first stage presents, in the layer, percentages between 55% to 85% carbon, between 5% to 20% oxygen, and between 10% to 40% chlorine.

Abstract: Dual composition block copolymers made from conjugated diene and monovinyl aromatic monomers in batch organolithium initiated polymerization show advantageous performance in the production of crosslinked microcellular rubber compounds and pressure sensitive hot melt adhesives. The dual composition block copolymers are partially coupled with a coupling agent linking inner monovinyl aromatic blocks. Their un-coupled low molecular weight fraction has greater monovinyl aromatic repeating unit content than their coupled high molecular weight fraction. Crosslinked microcellular rubber articles made from the dual composition block copolymers exhibit lower density, smaller and more homogeneous cell size, higher softness and higher resiliency than prior art block copolymers. Rubber compounding of formulations comprising the dual composition block copolymers proceed at slightly lower torque and slightly lower temperature than with prior art block copolymers.

Abstract: Disclosed is an oligomeric compound comprising from 10 to 50 monomer subunits, at least part of the sequence of which is complementary to the following sequence: AAGGAAACUGCCAUCUCCAA (SEQ ID NO: 1 in the appended sequence listing). Also disclosed is a pharmaceutical composition comprising said oligomeric compound and use for treating Duchenne Muscular Dystrophy.

Abstract: A thermal radiation shield for blocking thermal radiation at a gas turbine piping connection joint is provided. The thermal radiation shield is configured to surround the gas turbine piping connection joint. The thermal radiation shield includes at least two shield portions in contact with one another at a pair of flanged ends. The at least two shield portions collectively define an opening. Each shield portion of the at least two shield portions includes an inner shell, an outer shell, and insulation disposed between the inner shell and the outer shell. One of the inner shell or the outer shell includes a pipe connection bracket that extends into the opening.

Abstract: This disclosure includes techniques for controlling smart home devices upon entering a home with a fingerprint sensor in a doorbell device. After capturing a fingerprint of a digit of a guest and sending the fingerprint to a server device, the server device matches the fingerprint of the digit to an entry in a guest fingerprint database for a first user. The server device sends an operational command to a smart home device separate from the doorbell device and located at a same premises as the doorbell device. In response to receiving the operational command from the server device, the smart home device performs an action corresponding to the operational command.