Abstract: A system may include one or more devices. The one or more devices may obtain thermal parameters associated with a target measure of physical transformation of a four-dimensional (4D) object. The one or more devices may apply, during a printed process for the 4D object and using one or more thermal devices, air to a 4D printed material generated based on the printing process. The one or more devices may determine, using one or more camera devices, an actual measure of physical transformation of the 4D printed material resulting from applying the air to the 4D material. The one or more devices may determine whether the actual measure of physical transformation is different than the target measure of physical transformation. The one or more devices may provide an option to terminate the printing process if the actual measure of physical transformation is different than the target measure of physical transformation.

Abstract: A wind turbine includes a hub, at least one blade and at least one pitch bearing to connect the at least one blade to the hub. The at least one pitch bearing has at least an inner ring and an outer ring, and at least a rolling race. The wind turbine further includes at least a tensioning system configured to exert a radial compression force to at least a part of the outer ring of the at least one pitch bearing, thus increasing the resultant stiffness of the at least one pitch bearing.

Abstract: The present disclosure provides a compound of formula I, as well as complexes and compositions comprising a compound of formula I, wherein said compositions and complexes are useful for delivery of certain agents, including, for example, nucleic acids.

Abstract: A capacitive sensor for measuring the level of a substance in a tank is provided, which has a motherboard with a plurality of layers (1a, 1b, 1c, 1d, 1e), wherein each layer (1a, 1b, 1c, 1d, 1e) has one or more plates with components, such as measuring electrodes (2), microcontroller (3), and tracks (4) for connecting the measuring electrodes (2) to the microcontroller (3), wherein the capacitive sensor has a first layer (1a) which in turn has a plate having a plurality of linearly distributed measuring electrodes (2), wherein all the tracks (4) for connecting the measuring electrodes (2) to the microcontroller (3) has the same shape and length, and are surrounded by at least one guard plate (8) and optionally at least one shielding plate (7), both made of a conductive material.

Abstract: A method comprising a) providing a packer comprising a tubular mandrel, a swellable elastomeric body supported on the mandrel, and first and second end caps secured to the mandrel, each end cap having an inner bore therethrough and being positioned such that a first end of each end cap abuts an end of the swellable elastomeric body, wherein the first end of at least one end cap includes a strain absorbing undercut formed in the inner bore thereof; b) positioning the packer within a wellbore; c) providing a swelling fluid into the wellbore; d) forming a fluid seal against the wellbore with the swellable elastomeric body; and e) extruding the swellable elastomeric body into the undercut.

Abstract: A surgical robotic system comprising: a surgical robotic arm having a plurality of robotic arm links and a plurality of joints operable to move according to multiple degrees of freedom; a proximity sensor coupled to the surgical robotic arm, the proximity sensor comprising a plurality of sensing pads operable to detect a movement of a nearby controlling object prior to contact with the surgical robotic arm; and a processor configured to determine a desired position of the surgical robotic arm based on the detected movement of the nearby controlling object and drive a movement of more than one of the plurality of robotic arm links or the plurality of joints to achieve the desired position of the surgical robotic arm.

Abstract: Anchoring system for floating platform (100) that eliminates pitching and rolling movements of the floating platform (100), by means of several anchoring lines (200) attached to the seabed (5), which are supported by several rotary fixing means (2, 3) or pulleys of the floating platform (100) and are all joined together in a common counterweight (1) hanging from the platform (100). Each anchoring line (200) comprises sublines (200d, 200c) (direct, crossover or diagonal), which keep the counterweight (1) always in correspondence with the central axis (300) of the floating platform (100). It also eliminates the pendulum movement of the counterweight (1) and is valid for floating platforms (100) with an odd number of protruding structural arms (12). The system is applicable to any type of floating platform (100), although it is particularly suitable for floating platforms that support offshore wind turbines and marine leisure platforms.

Abstract: The present invention relates to a method and a system for identifying an anomaly in a chest X-ray image in posteroanterior orientation based on neural networks, which comprises: receiving the image in a classification module with a plurality of convolutional neural networks, each trained to identify at least one specific graphic pattern associated with a pathology; obtaining, for each of the convolutional neural networks, a probability of detecting the specific graphic pattern; receiving in a fully connected neural network all the probabilities obtained; and determining whether the chest X-ray image contains an anomaly, based on the detection probabilities provided.

Abstract: The invention relates to nucleic acids and methods for restoring acid alpha-glucosidase (GAA) activity in patients with Pompe disease using splice-switching technology.

Abstract: The present invention proposes a connection structure for a robot that operates inside pipes, as its small size allows high tractions in restricted spaces. It can be applied to form the connection structure of intervention robotic systems that operate under traction and can also be used to connect two umbilicals without using a large volume connector. Accordingly, the solution found by the present application solves the connection problems between two systems, the robot and the umbilical cable, and solves the problem of the state of the art, using a splice housing (1) that internally contains a splice hood (5).

Abstract: The present invention relates to a method for measuring the levels of Protein C (PROC), preferably Activated Protein C (APC), in a subject in need thereof, the method comprising a step of performing an enzymatic digestion of one or more biological samples isolated from the subject, and a step of measuring the levels of the peptide of SEQ ID NO 1 (LGEYDLR) and/or SEQ ID NO 2 (TFVL-NFIK), wherein the levels of SEQ ID NO 1 and/or SEQ ID NO 2 correspond to the levels of PROC, preferably APC, present in said one or more biological samples. Methods for classifying subjects and prognosticating the response to treatments are also included.

Abstract: The present invention relates to a process for the manufacture of microporous carbon materials to perform selective separations of nitrogen in gas mixtures such as hydrogen sulfide, carbon dioxide, methane and C2, C3 and C4+ hydrocarbons, with high efficiency, shaped of microspheres or cylinders from copolymers of poly (vinylidene chloride-co-methyl acrylate) with density of 1.3 to 1.85 g/cm.sup.3 or poly (vinylidene chloride-co-vinyl chloride) with density of 1.3 to 1.85 g/cm.sup.3, using two stages. The first stage consists of a surface passivation of the material by chemical attack in a highly alkaline alcohol solution, with the aim of effecting a precarbonization on the surface of the copolymer that during the pyrolysis process is not deformed and gradually develops microporosity. The material of the first stage presents, in the layer, percentages between 55% to 85% carbon, between 5% to 20% oxygen, and between 10% to 40% chlorine.

Abstract: Disclosed is an oligomeric compound comprising from 10 to 50 monomer subunits, at least part of the sequence of which is complementary to the following sequence: AAGGAAACUGCCAUCUCCAA (SEQ ID NO: 1 in the appended sequence listing). Also disclosed is a pharmaceutical composition comprising said oligomeric compound and use for treating Duchenne Muscular Dystrophy.

Abstract: Dual composition block copolymers made from conjugated diene and monovinyl aromatic monomers in batch organolithium initiated polymerization show advantageous performance in the production of crosslinked microcellular rubber compounds and pressure sensitive hot melt adhesives. The dual composition block copolymers are partially coupled with a coupling agent linking inner monovinyl aromatic blocks. Their un-coupled low molecular weight fraction has greater monovinyl aromatic repeating unit content than their coupled high molecular weight fraction. Crosslinked microcellular rubber articles made from the dual composition block copolymers exhibit lower density, smaller and more homogeneous cell size, higher softness and higher resiliency than prior art block copolymers. Rubber compounding of formulations comprising the dual composition block copolymers proceed at slightly lower torque and slightly lower temperature than with prior art block copolymers.

Abstract: A thermal radiation shield for blocking thermal radiation at a gas turbine piping connection joint is provided. The thermal radiation shield is configured to surround the gas turbine piping connection joint. The thermal radiation shield includes at least two shield portions in contact with one another at a pair of flanged ends. The at least two shield portions collectively define an opening. Each shield portion of the at least two shield portions includes an inner shell, an outer shell, and insulation disposed between the inner shell and the outer shell. One of the inner shell or the outer shell includes a pipe connection bracket that extends into the opening.

Abstract: A surgical robotic system including a surgical table, a surgical robotic manipulator coupled to the surgical table and comprising a plurality of links coupled together by a plurality of joints that are operable to move with respect to one another to move the surgical robotic manipulator, at least one of the plurality of links or the plurality of joints having a portion that faces another of the plurality of links or the plurality of joints, a proximity sensing assembly coupled to the portion of the at least one of the plurality of links or the plurality of joints, the proximity sensing assembly operable to detect an object prior to the surgical robotic manipulator colliding with the object and to output a corresponding detection signal, and a processor operable to receive the corresponding detecting signal and cause the manipulator or the object to engage in a collision avoidance operation.

Abstract: A tool driver for use in robotic surgery includes a base configured to couple to a distal end of a robotic arm, and a tool carriage slidingly engaged with the base and configured to receive a surgical tool. In one variation, the tool carriage may include a plurality of linear axis drives configured to actuate one or more articulated movements of the surgical tool. In another variation, the tool carriage may include a plurality of rotary axis drives configured to actuate one or more articulated movements of the surgical tool. Various sensors, such as a capacitive load cell for measuring axial load, a position sensor for measuring linear position of the guide based on the rotational positions of gears in a gear transmission, and/or a capacitive torque sensor based on differential capacitance, may be included in the tool driver.

Abstract: This disclosure includes techniques for controlling smart home devices upon entering a home with a fingerprint sensor in a doorbell device. After capturing a fingerprint of a digit of a guest and sending the fingerprint to a server device, the server device matches the fingerprint of the digit to an entry in a guest fingerprint database for a first user. The server device sends an operational command to a smart home device separate from the doorbell device and located at a same premises as the doorbell device. In response to receiving the operational command from the server device, the smart home device performs an action corresponding to the operational command.

Abstract: A random number generator comprising a light source (7) configured to emit photons (10) throughout a light emission time interval, a photosensor (12) configured to absorb photons emitted from the light source throughout a light absorption time interval concurrent with the light emission time interval thereby to generate a continuous electrical output signal (13) extending throughout the absorption time interval, and a processor (14) configured to determine temporal variations in the continuous electrical output signal and to generate therefrom one or more quantum random numbers (15).

Abstract: The present invention describes a wind turbine comprising a hub, at least one blade and at least one pitch bearing to connect the at least one blade to the hub, the at least one pitch bearing comprising at least an inner ring and an outer ring, and at least a rolling race, wherein the wind turbine further comprises at least a tensioning system configured to exert a radial compression force to at least a part of the outer ring of the at least one pitch bearing, thus increasing the resultant stiffness of the at least one pitch bearing.