Patents by Inventor Luis A. Garcia

Luis A. Garcia has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20250077322
    Abstract: A method for performing a technical process in which application programs are executed redundantly in a plurality N of computing instances and, on the basis of an MooN system, wherein M is at least two and N is at least three, a comparison of the plurality N of results of the redundant execution of the application programs is performed in a voting. When a minority of the results is different from a majority of the results with identical content, the minority is excluded during the performance of the technical process, is repaired with a state copy of one of the intact computing instances and reintegrated into the process. There is also described a computer program product and a provisioning apparatus.
    Type: Application
    Filed: August 30, 2024
    Publication date: March 6, 2025
    Inventors: Andreas Schallenberg, Stefan Gerken, Matthias Bolz, Uwe Eckelmann-Wendt, Faustino Frechilla Daza, Fernando Meya Delfa, Jose Luis Garcia Cano
  • Patent number: 12240655
    Abstract: A dispensing lid assembly having a lid portion that seals off the opening of the container but for an aperture and a centrally disposed interface void. The lid portion provides an integrated, external measuring spout in communication with the aperture. A dial portion may be rotatably coupled to the lid portion so that they rotate independent of each other. The dial portion is operatively associated with a diaphragm disposed under the lid portion so that rotation of the dial portion selectively moves the diaphragm between an open configuration and a closed configuration closing off the aperture and fluidly disconnecting the compartment of the container from the external measuring spout.
    Type: Grant
    Filed: April 5, 2023
    Date of Patent: March 4, 2025
    Inventors: Goktug Duman, Jorge Luis Garcia
  • Patent number: 12193579
    Abstract: A transportable gravity flow display rack for food and/or drink containers (such as milk gallons) having a pallet base adapted to receive the forks from a forklift or pallet jack, a plurality of vertical upright supports, a first cross bar and a second cross bar, and one or more inclined storage racks, thereby facilitating the flow of the containers towards a costumer in response to gravity.
    Type: Grant
    Filed: August 24, 2023
    Date of Patent: January 14, 2025
    Inventors: Orlando González Nuñez, Luis A. García Vázquez
  • Publication number: 20240426189
    Abstract: A method comprising a) providing a packer comprising a tubular mandrel, a swellable elastomeric body supported on the mandrel, and first and second end caps secured to the mandrel, each end cap having an inner bore therethrough and being positioned such that a first end of each end cap abuts an end of the swellable elastomeric body, wherein the first end of at least one end cap includes a strain absorbing undercut formed in the inner bore thereof; b) positioning the packer within a wellbore; c) providing a swelling fluid into the wellbore; d) forming a fluid seal against the wellbore with the swellable elastomeric body; and e) extruding the swellable elastomeric body into the undercut.
    Type: Application
    Filed: June 20, 2024
    Publication date: December 26, 2024
    Inventors: Luis A. GARCIA, Tim DAVIS
  • Publication number: 20240409188
    Abstract: Anchoring system for floating platform (100) that eliminates pitching and rolling movements of the floating platform (100), by means of several anchoring lines (200) attached to the seabed (5), which are supported by several rotary fixing means (2, 3) or pulleys of the floating platform (100) and are all joined together in a common counterweight (1) hanging from the platform (100). Each anchoring line (200) comprises sublines (200d, 200c) (direct, crossover or diagonal), which keep the counterweight (1) always in correspondence with the central axis (300) of the floating platform (100). It also eliminates the pendulum movement of the counterweight (1) and is valid for floating platforms (100) with an odd number of protruding structural arms (12). The system is applicable to any type of floating platform (100), although it is particularly suitable for floating platforms that support offshore wind turbines and marine leisure platforms.
    Type: Application
    Filed: July 18, 2022
    Publication date: December 12, 2024
    Inventor: Antonio Luís GARCÍA FERRÁNDEZ
  • Publication number: 20240392300
    Abstract: The invention relates to nucleic acids and methods for restoring acid alpha-glucosidase (GAA) activity in patients with Pompe disease using splice-switching technology.
    Type: Application
    Filed: August 13, 2024
    Publication date: November 28, 2024
    Inventors: Luis Garcia, Aurelie Avril
  • Publication number: 20240377410
    Abstract: The present invention relates to a method for measuring the levels of Protein C (PROC), preferably Activated Protein C (APC), in a subject in need thereof, the method comprising a step of performing an enzymatic digestion of one or more biological samples isolated from the subject, and a step of measuring the levels of the peptide of SEQ ID NO 1 (LGEYDLR) and/or SEQ ID NO 2 (TFVL-NFIK), wherein the levels of SEQ ID NO 1 and/or SEQ ID NO 2 correspond to the levels of PROC, preferably APC, present in said one or more biological samples. Methods for classifying subjects and prognosticating the response to treatments are also included.
    Type: Application
    Filed: March 1, 2022
    Publication date: November 14, 2024
    Inventors: José Luis GARCÍA GIMÉNEZ, Federico Vicente PALLARDÓ CALATAYUD, Salvador MENA MOLLÁ, Nieves CARBONELL MONLEÓN
  • Patent number: 12138616
    Abstract: The present invention relates to a process for the manufacture of microporous carbon materials to perform selective separations of nitrogen in gas mixtures such as hydrogen sulfide, carbon dioxide, methane and C2, C3 and C4+ hydrocarbons, with high efficiency, shaped of microspheres or cylinders from copolymers of poly (vinylidene chloride-co-methyl acrylate) with density of 1.3 to 1.85 g/cm.sup.3 or poly (vinylidene chloride-co-vinyl chloride) with density of 1.3 to 1.85 g/cm.sup.3, using two stages. The first stage consists of a surface passivation of the material by chemical attack in a highly alkaline alcohol solution, with the aim of effecting a precarbonization on the surface of the copolymer that during the pyrolysis process is not deformed and gradually develops microporosity. The material of the first stage presents, in the layer, percentages between 55% to 85% carbon, between 5% to 20% oxygen, and between 10% to 40% chlorine.
    Type: Grant
    Filed: January 25, 2024
    Date of Patent: November 12, 2024
    Assignee: Instituto Mexicano del Petróleo
    Inventors: Federico Jesus Jimenez Cruz, Jose Luis Garcia Gutierrez, Jose Francisco Gaspar Silva Sanchez, Liliana Alejandra Astudillo Lopez Lena, Fidencio Hernandez Perez, Alberto Cabrales Torres, Maria Del Carmen Martinez Guerrero, Marco Antonio Dominguez Aguilar, Arturo Trejo Rodriguez, Florentino Rafael Murrieta Guevara
  • Publication number: 20240368591
    Abstract: Disclosed is an oligomeric compound comprising from 10 to 50 monomer subunits, at least part of the sequence of which is complementary to the following sequence: AAGGAAACUGCCAUCUCCAA (SEQ ID NO: 1 in the appended sequence listing). Also disclosed is a pharmaceutical composition comprising said oligomeric compound and use for treating Duchenne Muscular Dystrophy.
    Type: Application
    Filed: October 4, 2021
    Publication date: November 7, 2024
    Inventors: Luis GARCIA, Aurélie GOYENVALLE, Fedor SVINARTCHOUK, Graziella GRIFFITH, Aurélie AVRIL-DELPLANQUE
  • Publication number: 20240368386
    Abstract: Dual composition block copolymers made from conjugated diene and monovinyl aromatic monomers in batch organolithium initiated polymerization show advantageous performance in the production of crosslinked microcellular rubber compounds and pressure sensitive hot melt adhesives. The dual composition block copolymers are partially coupled with a coupling agent linking inner monovinyl aromatic blocks. Their un-coupled low molecular weight fraction has greater monovinyl aromatic repeating unit content than their coupled high molecular weight fraction. Crosslinked microcellular rubber articles made from the dual composition block copolymers exhibit lower density, smaller and more homogeneous cell size, higher softness and higher resiliency than prior art block copolymers. Rubber compounding of formulations comprising the dual composition block copolymers proceed at slightly lower torque and slightly lower temperature than with prior art block copolymers.
    Type: Application
    Filed: July 18, 2024
    Publication date: November 7, 2024
    Applicant: Dynasol Elastómeros, S.A. de C.V.
    Inventors: Daniel Abraham Elizarrarás Maya, Abel Zúñiga Calles, Gabriel Hernández Zamora, José Luis García Vidales, Jesús Eduardo Ibarra Rodríguez
  • Patent number: 12129799
    Abstract: A thermal radiation shield for blocking thermal radiation at a gas turbine piping connection joint is provided. The thermal radiation shield is configured to surround the gas turbine piping connection joint. The thermal radiation shield includes at least two shield portions in contact with one another at a pair of flanged ends. The at least two shield portions collectively define an opening. Each shield portion of the at least two shield portions includes an inner shell, an outer shell, and insulation disposed between the inner shell and the outer shell. One of the inner shell or the outer shell includes a pipe connection bracket that extends into the opening.
    Type: Grant
    Filed: December 29, 2022
    Date of Patent: October 29, 2024
    Assignee: GE Infrastructure Technology LLC
    Inventors: Salvador Zavala Perez, Jose Luis Garcia Arellano, Jesus Barrera Perez, Edward William Cummings
  • Publication number: 20240338984
    Abstract: This disclosure includes techniques for controlling smart home devices upon entering a home with a fingerprint sensor in a doorbell device. After capturing a fingerprint of a digit of a guest and sending the fingerprint to a server device, the server device matches the fingerprint of the digit to an entry in a guest fingerprint database for a first user. The server device sends an operational command to a smart home device separate from the doorbell device and located at a same premises as the doorbell device. In response to receiving the operational command from the server device, the smart home device performs an action corresponding to the operational command.
    Type: Application
    Filed: June 20, 2024
    Publication date: October 10, 2024
    Applicant: Ademco Inc.
    Inventors: José Miguel Díaz Arriaga, Rodolfo Piña Ramírez, César Rodríguez Esqueda, Edgar Abraham González Romero, José Luis García Hernández
  • Publication number: 20240329935
    Abstract: A random number generator comprising a light source (7) configured to emit photons (10) throughout a light emission time interval, a photosensor (12) configured to absorb photons emitted from the light source throughout a light absorption time interval concurrent with the light emission time interval thereby to generate a continuous electrical output signal (13) extending throughout the absorption time interval, and a processor (14) configured to determine temporal variations in the continuous electrical output signal and to generate therefrom one or more quantum random numbers (15).
    Type: Application
    Filed: May 30, 2023
    Publication date: October 3, 2024
    Applicant: Crypta Labs Limited
    Inventor: Jose Luis Garcia Coello
  • Publication number: 20240307960
    Abstract: A cutting tool includes a supporting body and a cBN or PCD cutting edge tip attached to the supporting body via a 5-150 ?m braze joint. The supporting body is cemented carbide having 3-25 wt % of a metallic binder, optionally up to 25 wt % of carbides or carbonitrides of one or more elements of group 4, 5, or 6, and the rest WC. The metallic binder includes at least 40 wt % Ni, and the braze joint has, in the order from the supporting body, a first layer of TiC situated next thereto, with an average thickness of 10-400 nm, a second layer, with an average thickness of 0.5-8 ?m, having in average at least 5 wt % metallic Ni, in average 25-60 wt % metallic Cu and in average 15-45 wt % metallic Ti, and a third layer, with an average thickness of 4-145 ?m, having metallic Ag and metallic Cu.
    Type: Application
    Filed: December 20, 2021
    Publication date: September 19, 2024
    Inventors: Jose Luis GARCIA, Leif DAHL, Johnny BRUHN, Erik HOLMSTROM
  • Patent number: 12091665
    Abstract: The invention relates to nucleic acids and methods for restoring acid alpha-glucosidase (GAA) activity in patients with Pompe disease using splice-switching technology.
    Type: Grant
    Filed: August 3, 2021
    Date of Patent: September 17, 2024
    Assignee: Synthena AG
    Inventors: Luis Garcia, Aurelie Avril
  • Publication number: 20240295012
    Abstract: A sintered cemented carbide insert for mining or cutting applications includes a mean WC grain size of between 0.8-18 ?m, a binder phase in a weight between 4-18 wt %, a gamma phase with the cubic gamma phase precursors in a weight of between 0.8-10 wt %, and any unavoidable impurities and a balance of WC. A difference between the hardness at any point 0.3 mm from the surface of the insert and the hardness of the bulk is at least 25 HV3, wherein hardness is measured according to ISO EN6507. A method of producing the cemented carbide is also provided.
    Type: Application
    Filed: July 8, 2022
    Publication date: September 5, 2024
    Inventors: Malin MARTENSSON, Carl-Johan MADERUD, Anders NORDGREN, Jose Luis GARCIA
  • Publication number: 20240288192
    Abstract: Disclosed are systems and methods that provide a novel framework that automatically and dynamically adjusts and controls the real-world conditions of an environment within a location. Such adjustment can be based on characteristics of items and/or persons within a location, such that the integrity of the items are prevented from being compromised. The framework can function by determining and enforcing safe thresholds for environmental conditions (e.g., temperature and humidity, for example) using artificial intelligence and/or machine learning (AI/ML) techniques. Climate and environmental condition information within the location, as well as attributes/characteristics of the location and/or items therein can be accounted for, and leveraged in determining environmentally safe thresholds that can be utilized for monitoring the location. When real-world conditions in the environment approach and/or exceed the safe thresholds, a climate system (e.g.
    Type: Application
    Filed: February 7, 2024
    Publication date: August 29, 2024
    Applicant: Ademco Inc.
    Inventors: Julio Alberto Delgado Trevizo, Mario Ballesteros, Miguel Diaz, Abraham Gonzalez Romero, Jose Luis Garcia, Cesar Rodriguez, Rodolfo Piña
  • Publication number: 20240278882
    Abstract: An anchoring system for floating platform which eliminates the pitch and roll movements of the floating platform using anchoring lines (200) attached to the seabed (5), which are supported by several pulleys or rotary fixing means (2, 3) of the floating platform (100) and are all joined in a common counterweight (1) hanging from the floating platform (100). Each anchoring line (200) comprises a direct subline (200d) and a cross subline (200c), which maintain the counterweight (1) always located in correspondence with the central axis (300) of the floating platform (100). It also describes a novel method for installing the floating platform at its destination without the aid of special ships.
    Type: Application
    Filed: June 10, 2022
    Publication date: August 22, 2024
    Inventor: Antonio Luís GARCÍA FERRÁNDEZ
  • Patent number: 12060755
    Abstract: A modular tool anchor includes an anchor body positionable about a tubular. The anchor includes an anchor wedge for gripping against the tubular. A wedge drive screw engages a piston that biases the wedge into contact with the tubular as the wedge drive screw is tightened. The anchor also includes a compression seal positioned within the anchor body. A sealing flange abuts the compression seal. As seal compression screws are tightened, the sealing flange engages the compression seal and forces it against the tubular.
    Type: Grant
    Filed: August 2, 2023
    Date of Patent: August 13, 2024
    Assignee: TAM INTERNATIONAL, INC.
    Inventor: Luis Garcia
  • Patent number: 12054613
    Abstract: Dual composition block copolymers made from conjugated diene and monovinyl aromatic monomers in batch organolithium initiated polymerization show advantageous performance in the production of crosslinked microcellular rubber compounds and pressure sensitive hot melt adhesives. The dual composition block copolymers are partially coupled with a coupling agent linking inner monovinyl aromatic blocks. Their un-coupled low molecular weight fraction has greater monovinyl aromatic repeating unit content than their coupled high molecular weight fraction. Crosslinked microcellular rubber articles made from the dual composition block copolymers exhibit lower density, smaller and more homogeneous cell size, higher softness and higher resiliency than prior art block copolymers. Rubber compounding of formulations comprising the dual composition block copolymers proceed at slightly lower torque and slightly lower temperature than with prior art block copolymers.
    Type: Grant
    Filed: December 10, 2019
    Date of Patent: August 6, 2024
    Assignee: Dynasol Elastómeros, S.A. de C.V.
    Inventors: Daniel Abraham Elizarrarás Maya, Abel Zúñiga Calles, Gabriel Hernández Zamora, José Luis García Vidales, Jesús Eduardo Ibarra Rodríguez