Abstract: A clamp assembly for selectively blocking flow while clearing and leak testing a fuel line of a gas turbine fuel supply system is provided. The clamp assembly includes a clamp body configured to surround a flanged joint of the fuel line. A seal is rotatably held between the clamp body portions and includes a hollow ear in fluid communication with a center hole of the seal. The seal includes a tab or pin with which the seal can be rotated between a sealed position and an unsealed position. In the unsealed position, the hollow ear is aligned with the vent, and in the sealed position, the hollow ear is blocked by internal surfaces of the clamp body. Embodiments include a locking assembly allowing the seal to be locked in one and/or both of the open and closed positions.

Abstract: A cutting tool includes a cemented carbide substrate. The cemented carbide consists of hard constituents in a metallic binder. The hard constituents include WC. The WC content in the cemented carbide is 80-93 wt %. The cemented carbide has Ni and Al, and a Ni content of 3-13 wt %, a weight ratio of Co/Ni<0.33, a weight ratio of Fe/Ni<0.25, a weight ratio of Cr/Ni<0.25 and a weight ratio of 0.02<Al/(Ni+Co+Fe)<0.1. The crack resistance W is defined as the ratio of the load applied on a Vickers hardness indentation and the total crack length of the cracks formed at the corners of the Vickers hardness indentation. The product of the hardness H(rake) at the rake face and the crack resistance W(rake) at the rake face is H(rake)*W(rake)>5000 HV100*N/?m.

Abstract: A composition which includes one or more carotenoids, and use of the composition for nematode control.

Abstract: A method for reducing artefacts in printed objects comprises receiving print data to be printed by a printhead arrangement, the printhead arrangement being movable in a print direction and comprising a plurality of printhead dies, wherein printhead dies adjacent to each other comprise an overlap area when viewed in the print direction. The print data to be printed are modified near and/or at the overlap areas between printhead dies of the printhead arrangement to compensate for drop placement.

Abstract: Systems and methods for developing personalized instructional content include a computing device using software modules which capture data about subjects, teachers, and learners, train artificial intelligence models based on the acquired data, use the artificial intelligence models to generate instructional content personalized to an instructor and/or learner based their input, compare the generated instructional content to vetted sources and correct errors, and cause the processor to output a personalized instructional course including the updated generated instructional materials in the format capable of display to an individual learner.

Abstract: A method for performing a technical process in which application programs are executed redundantly in a plurality N of computing instances and, on the basis of an MooN system, wherein M is at least two and N is at least three, a comparison of the plurality N of results of the redundant execution of the application programs is performed in a voting. When a minority of the results is different from a majority of the results with identical content, the minority is excluded during the performance of the technical process, is repaired with a state copy of one of the intact computing instances and reintegrated into the process. There is also described a computer program product and a provisioning apparatus.

Abstract: A dispensing lid assembly having a lid portion that seals off the opening of the container but for an aperture and a centrally disposed interface void. The lid portion provides an integrated, external measuring spout in communication with the aperture. A dial portion may be rotatably coupled to the lid portion so that they rotate independent of each other. The dial portion is operatively associated with a diaphragm disposed under the lid portion so that rotation of the dial portion selectively moves the diaphragm between an open configuration and a closed configuration closing off the aperture and fluidly disconnecting the compartment of the container from the external measuring spout.

Abstract: Anchoring system for floating platform (100) that eliminates pitching and rolling movements of the floating platform (100), by means of several anchoring lines (200) attached to the seabed (5), which are supported by several rotary fixing means (2, 3) or pulleys of the floating platform (100) and are all joined together in a common counterweight (1) hanging from the platform (100). Each anchoring line (200) comprises sublines (200d, 200c) (direct, crossover or diagonal), which keep the counterweight (1) always in correspondence with the central axis (300) of the floating platform (100). It also eliminates the pendulum movement of the counterweight (1) and is valid for floating platforms (100) with an odd number of protruding structural arms (12). The system is applicable to any type of floating platform (100), although it is particularly suitable for floating platforms that support offshore wind turbines and marine leisure platforms.

Abstract: The invention relates to nucleic acids and methods for restoring acid alpha-glucosidase (GAA) activity in patients with Pompe disease using splice-switching technology.

Abstract: The present invention relates to a method for measuring the levels of Protein C (PROC), preferably Activated Protein C (APC), in a subject in need thereof, the method comprising a step of performing an enzymatic digestion of one or more biological samples isolated from the subject, and a step of measuring the levels of the peptide of SEQ ID NO 1 (LGEYDLR) and/or SEQ ID NO 2 (TFVL-NFIK), wherein the levels of SEQ ID NO 1 and/or SEQ ID NO 2 correspond to the levels of PROC, preferably APC, present in said one or more biological samples. Methods for classifying subjects and prognosticating the response to treatments are also included.

Abstract: The present invention relates to a process for the manufacture of microporous carbon materials to perform selective separations of nitrogen in gas mixtures such as hydrogen sulfide, carbon dioxide, methane and C2, C3 and C4+ hydrocarbons, with high efficiency, shaped of microspheres or cylinders from copolymers of poly (vinylidene chloride-co-methyl acrylate) with density of 1.3 to 1.85 g/cm.sup.3 or poly (vinylidene chloride-co-vinyl chloride) with density of 1.3 to 1.85 g/cm.sup.3, using two stages. The first stage consists of a surface passivation of the material by chemical attack in a highly alkaline alcohol solution, with the aim of effecting a precarbonization on the surface of the copolymer that during the pyrolysis process is not deformed and gradually develops microporosity. The material of the first stage presents, in the layer, percentages between 55% to 85% carbon, between 5% to 20% oxygen, and between 10% to 40% chlorine.

Abstract: Dual composition block copolymers made from conjugated diene and monovinyl aromatic monomers in batch organolithium initiated polymerization show advantageous performance in the production of crosslinked microcellular rubber compounds and pressure sensitive hot melt adhesives. The dual composition block copolymers are partially coupled with a coupling agent linking inner monovinyl aromatic blocks. Their un-coupled low molecular weight fraction has greater monovinyl aromatic repeating unit content than their coupled high molecular weight fraction. Crosslinked microcellular rubber articles made from the dual composition block copolymers exhibit lower density, smaller and more homogeneous cell size, higher softness and higher resiliency than prior art block copolymers. Rubber compounding of formulations comprising the dual composition block copolymers proceed at slightly lower torque and slightly lower temperature than with prior art block copolymers.

Abstract: Disclosed is an oligomeric compound comprising from 10 to 50 monomer subunits, at least part of the sequence of which is complementary to the following sequence: AAGGAAACUGCCAUCUCCAA (SEQ ID NO: 1 in the appended sequence listing). Also disclosed is a pharmaceutical composition comprising said oligomeric compound and use for treating Duchenne Muscular Dystrophy.

Abstract: A thermal radiation shield for blocking thermal radiation at a gas turbine piping connection joint is provided. The thermal radiation shield is configured to surround the gas turbine piping connection joint. The thermal radiation shield includes at least two shield portions in contact with one another at a pair of flanged ends. The at least two shield portions collectively define an opening. Each shield portion of the at least two shield portions includes an inner shell, an outer shell, and insulation disposed between the inner shell and the outer shell. One of the inner shell or the outer shell includes a pipe connection bracket that extends into the opening.

Abstract: This disclosure includes techniques for controlling smart home devices upon entering a home with a fingerprint sensor in a doorbell device. After capturing a fingerprint of a digit of a guest and sending the fingerprint to a server device, the server device matches the fingerprint of the digit to an entry in a guest fingerprint database for a first user. The server device sends an operational command to a smart home device separate from the doorbell device and located at a same premises as the doorbell device. In response to receiving the operational command from the server device, the smart home device performs an action corresponding to the operational command.

Abstract: A random number generator comprising a light source (7) configured to emit photons (10) throughout a light emission time interval, a photosensor (12) configured to absorb photons emitted from the light source throughout a light absorption time interval concurrent with the light emission time interval thereby to generate a continuous electrical output signal (13) extending throughout the absorption time interval, and a processor (14) configured to determine temporal variations in the continuous electrical output signal and to generate therefrom one or more quantum random numbers (15).

Abstract: A cutting tool includes a supporting body and a cBN or PCD cutting edge tip attached to the supporting body via a 5-150 ?m braze joint. The supporting body is cemented carbide having 3-25 wt % of a metallic binder, optionally up to 25 wt % of carbides or carbonitrides of one or more elements of group 4, 5, or 6, and the rest WC. The metallic binder includes at least 40 wt % Ni, and the braze joint has, in the order from the supporting body, a first layer of TiC situated next thereto, with an average thickness of 10-400 nm, a second layer, with an average thickness of 0.5-8 ?m, having in average at least 5 wt % metallic Ni, in average 25-60 wt % metallic Cu and in average 15-45 wt % metallic Ti, and a third layer, with an average thickness of 4-145 ?m, having metallic Ag and metallic Cu.

Abstract: The invention relates to nucleic acids and methods for restoring acid alpha-glucosidase (GAA) activity in patients with Pompe disease using splice-switching technology.

Abstract: A sintered cemented carbide insert for mining or cutting applications includes a mean WC grain size of between 0.8-18 ?m, a binder phase in a weight between 4-18 wt %, a gamma phase with the cubic gamma phase precursors in a weight of between 0.8-10 wt %, and any unavoidable impurities and a balance of WC. A difference between the hardness at any point 0.3 mm from the surface of the insert and the hardness of the bulk is at least 25 HV3, wherein hardness is measured according to ISO EN6507. A method of producing the cemented carbide is also provided.

Abstract: Disclosed are systems and methods that provide a novel framework that automatically and dynamically adjusts and controls the real-world conditions of an environment within a location. Such adjustment can be based on characteristics of items and/or persons within a location, such that the integrity of the items are prevented from being compromised. The framework can function by determining and enforcing safe thresholds for environmental conditions (e.g., temperature and humidity, for example) using artificial intelligence and/or machine learning (AI/ML) techniques. Climate and environmental condition information within the location, as well as attributes/characteristics of the location and/or items therein can be accounted for, and leveraged in determining environmentally safe thresholds that can be utilized for monitoring the location. When real-world conditions in the environment approach and/or exceed the safe thresholds, a climate system (e.g.