Patents by Inventor Maomao AN

Maomao AN has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20180294907
    Abstract: A method of a communication device arranged to operate in a cellular communication system is presented. The method comprises determining interference mitigation capabilities for control symbols, transmitting information about the determined interference mitigation capabilities to a network node of the cellular communication system. Also a method of a network node arranged to operate in a cellular communication system. The method comprises receiving from a communication device operating in the cellular communication system information about determined interference mitigation capabilities of the communication device for control symbols, and adapting a performing of one or more radio operation tasks based on the received information. Communication device, network node, and computer programs for the communication device and network node are also presented.
    Type: Application
    Filed: October 3, 2016
    Publication date: October 11, 2018
    Inventors: Maomao Chen, Fredrik Nordström
  • Patent number: 10090338
    Abstract: Disclosed is a method for manufacturing an array substrate, the array substrate and a display device which can reduce manufacturing steps of a color filter process and further reduce manufacturing steps of the display device, thereby saving manufacturing cost and time. The method for manufacturing the array substrate includes: forming a thin film transistor on a base substrate; forming a passivation layer having a via hole on a front side of the thin film transistor and forming a photo spacer on a front side of the passivation layer through a halftone mask patterning process. With this method for manufacturing the array substrate, there is no need to prepare the photo spacer on a back side of the color filter substrate. Therefore, it is possible to reduce manufacturing steps of a color filter process, which in turn further reduces manufacturing steps of the display device, thereby saving manufacturing cost and time.
    Type: Grant
    Filed: August 4, 2016
    Date of Patent: October 2, 2018
    Assignees: BOE TECHNOLOGY GROUP CO., LTD., HEFEI BOE DISPLAY TECHNOLOGY CO., LTD.
    Inventors: Shifei Shen, Jeong Hun Rhee, Youngjin Song, Maomao Fang, Jianxin Hou
  • Publication number: 20180278354
    Abstract: A method of a communication device arranged to operate in a cellular communication system is presented. The method comprises receiving a control symbol from a network node operating a cell of the cellular communication system and serving the communication device, determining interference situation for the control symbol, selecting an interference mitigation algorithm based on the determined interference, and performing the selected interference mitigation algorithm for the received control symbol. A communication device arranged to perform interference mitigation for received control symbols by the method, and a computer program for the communication device are also presented.
    Type: Application
    Filed: October 3, 2016
    Publication date: September 27, 2018
    Inventors: Fredrik Nordström, Maomao Chen
  • Publication number: 20180227036
    Abstract: A method of selecting operation antennas in a multiple input receiver having a plurality of antennas connected to respective antenna ports of the receiver may be provided to save energy and/or other resources. The method comprises determining pairwise correlation of propagation channels among the plurality of antenna ports, respectively, determining a candidate first number of antenna ports to use for operation, selecting the first number of antenna ports among the plurality of antenna ports, wherein the selecting comprises selecting antenna ports based on mutual correlation among the plurality of antennas, and operating the multiple input receiver using the selected first number of antenna ports if there is no significant performance gain from using all of the plurality of antenna ports. A receiver, communication device and computer program for the same, as well as method, computer program and equipment for testing such a receiver are also disclosed.
    Type: Application
    Filed: August 12, 2016
    Publication date: August 9, 2018
    Inventors: Torgny Palenius, Christopher Callender, Maomao Chen
  • Publication number: 20180219652
    Abstract: An inventive UE carrier aggregation (CA) capability reporting signalling model allows UEs (30) aggregating large numbers of component carriers to transmit CA-relevant capabilities to the network more efficiently than the current (legacy) signalling model. Rather than reporting CA/MIMO/CSI/NAICS capabilities separately for each supported band combination, including fallback configurations, embodiments of the present invention either report UE Radio Frequency (RF) and Baseband (BB) related capabilities separately, or report them disassociated from CA band configurations. This approach avoids the need to signal the full UE (30) set of capabilities for each of (possibly many) supported band combinations. Furthermore, fallback capabilities are signalled implicitly, eliminating the need to transmit this data.
    Type: Application
    Filed: July 19, 2016
    Publication date: August 2, 2018
    Inventors: Maomao Chen, Christian Bergljung, Tao Cui, Shaohua Li, Ingrid Nordstrand, Håkan Palm, Riikka Susitaival, Henning Wiemann
  • Publication number: 20180199233
    Abstract: A first user equipment is configured to mitigate multi-antenna inter-stream interference. A method by the first UE includes determining, based on one or more criteria, a number of multi-antenna streams whose interference can be currently mitigated by the first UE, and transmitting information based on the number of multi-antenna streams to a first network node, to a second network node, and/or to a second UE. A related method by a first network node serving or managing the first UE includes obtaining information based on a number of multi-antenna streams whose interference can be currently mitigated by a first UE at the first UE, and performing one or more radio operational tasks using the information based on the number of multi-antenna streams whose interference can be currently mitigated.
    Type: Application
    Filed: January 17, 2018
    Publication date: July 12, 2018
    Inventors: Sairamesh Nammi, Muhammad Kazmi, Maomao Chen
  • Patent number: 10009908
    Abstract: Methods of operating a wireless terminal may be provided. A high-speed indication may be received for a cell of a network node indicating that the cell is adapted to operate in a high-speed environment, and operation of the wireless terminal may be adapted to communicate through the cell of the network node in the high-speed environment responsive to receiving the high-speed indication. Methods of operating a node of a wireless communication network may also be provided. Communication service may be provided through a cell to a plurality of wireless terminals in a high-speed environment, and a high-speed indication may be transmitted through the cell to one of the plurality of wireless terminals, with the high-speed indication indicating that the cell is adapted to operate in a high-speed environment.
    Type: Grant
    Filed: January 19, 2016
    Date of Patent: June 26, 2018
    Assignee: TELEFONAKTIEBOLAGET LM ERICSSON (PUBL)
    Inventors: Torgny Palenius, Peter Alriksson, Maomao Chen, Muhammad Kazmi, Christopher Callender, Joakim Axmon
  • Publication number: 20180176828
    Abstract: A method of an electronic communication device is disclosed. The electronic communication device is arranged to operate in a radio communication system, wherein the radio communication system has capability of performing link adaptation by adapting one or more parameters of communication in view of a quality of a radio link between a network node of the radio communication system and the electronic communication device. The method comprises determining a link adaptation status for the electronic communication device, and transmitting information related to the determined link adaptation status to one or more network nodes of the radio communication system. A method of a network node, an electronic communication device, a network node, and computer programs are also disclosed.
    Type: Application
    Filed: July 30, 2015
    Publication date: June 21, 2018
    Inventors: Maomao Chen, Fredrik Nordstrom
  • Patent number: 9906980
    Abstract: A first user equipment is configured to mitigate multi-antenna inter-stream interference. A method by the first UE includes determining, based on one or more criteria, a number of multi-antenna streams whose interference can be currently mitigated by the first UE, and transmitting information based on the number of multi-antenna streams to a first network node, to a second network node, and/or to a second UE. A related method by a first network node serving or managing the first UE includes obtaining information based on a number of multi-antenna streams whose interference can be currently mitigated by a first UE at the first UE, and performing one or more radio operational tasks using the information based on the number of multi-antenna streams whose interference can be currently mitigated.
    Type: Grant
    Filed: April 29, 2015
    Date of Patent: February 27, 2018
    Assignee: Telefonaktiebolaget L M Ericsson (publ)
    Inventors: Sairamesh Nammi, Muhammad Kazmi, Maomao Chen
  • Publication number: 20180035348
    Abstract: Antenna nodes are controlled to maintain a respective radio cell, each cell having one and the same physical cell identity. The antenna nodes are further controlled to maintain the respective radio cell in a single direction substantially along a path such that each wireless communication device, during movement in a movement direction along the path, can connect either to consecutive antenna nodes towards which the wireless communication device is moving or connect to consecutive antenna nodes away from which the wireless communication device is moving.
    Type: Application
    Filed: May 27, 2015
    Publication date: February 1, 2018
    Applicant: Telefonaktiebolaget LM Ericsson (publ)
    Inventors: Joakim AXMON, Peter ALRIKSSON, Niklas ANDGART, Christopher CALLENDER, Maomao CHEN, Magnus LARSSON, Fredrik NORDSTROM, Torgny PALENIUS
  • Publication number: 20180027424
    Abstract: A method performed in a wireless device (300) of a cellular communication system is disclosed. The wireless device (300) has a first receiver configuration and a second receiver configuration and is capable of operating in DRX. The method comprises determining (110) a DRX configuration of the wireless device, wherein the DRX configuration indicates a time period during which the wireless device (300) should monitor a control channel. The method further comprises monitoring (120) the control channel during said time period using the first receiver configuration if the DRX configuration is a first DRX configuration or monitoring (130) the control channel during said time period using the second receiver configuration if the DRX configuration is a second DRX configuration. A method in a network node, a wireless device, a network node, computer program products, and computer-readable media are also disclosed.
    Type: Application
    Filed: April 13, 2016
    Publication date: January 25, 2018
    Inventors: Maomao CHEN, Muhammad KAZMI
  • Patent number: 9848362
    Abstract: Antenna nodes are controlled to maintain a respective radio cell, each cell having one and the same physical cell identity. The antenna nodes are further controlled to maintain the respective radio cell in a single direction substantially along a path such that each wireless communication device, during movement in a movement direction along the path, can connect either to consecutive antenna nodes towards which the wireless communication device is moving or connect to consecutive antenna nodes away from which the wireless communication device is moving.
    Type: Grant
    Filed: January 30, 2015
    Date of Patent: December 19, 2017
    Assignee: TELEFONAKTIEBOLAGET LM ERICSSON (publ)
    Inventors: Joakim Axmon, Peter Alriksson, Christopher Callender, Maomao Chen, Torgny Palenius
  • Publication number: 20170263655
    Abstract: Disclosed is a method for manufacturing an array substrate, the array substrate and a display device which can reduce manufacturing steps of a color filter process and further reduce manufacturing steps of the display device, thereby saving manufacturing cost and time. The method for manufacturing the array substrate includes: forming a thin film transistor on a base substrate; forming a passivation layer having a via hole on a front side of the thin film transistor and forming a photo spacer on a front side of the passivation layer through a halftone mask patterning process. With this method for manufacturing the array substrate, there is no need to prepare the photo spacer on a back side of the color filter substrate. Therefore, it is possible to reduce manufacturing steps of a color filter process, which in turn further reduces manufacturing steps of the display device, thereby saving manufacturing cost and time.
    Type: Application
    Filed: August 4, 2016
    Publication date: September 14, 2017
    Inventors: Shifei Shen, Jeong Hun Rhee, Youngjin Song, Maomao Fang, Jianxin Hou
  • Publication number: 20170201420
    Abstract: A method performed in a wireless device of a cellular communication system is disclosed. The wireless device has a first receiver configuration and a second receiver configuration. The method comprises receiving data over a data channel of the cellular communication system during a first time period. During a second time period, following directly after the first time period, during which no data is received over said data channel, a control channel of the cellular communication system is monitored using the first receiver configuration. During a third time period, following directly after the second time period, and during which no data is received over said data channel, the control channel is monitored using the second receiver configuration. A method in a network node, a wireless device, a network node, computer program products, and computer-readable media are also disclosed.
    Type: Application
    Filed: April 13, 2016
    Publication date: July 13, 2017
    Inventors: Maomao CHEN, Muhammad KAZMI
  • Publication number: 20160369341
    Abstract: The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment.
    Type: Application
    Filed: December 16, 2015
    Publication date: December 22, 2016
    Inventors: Wen E, Qingmei Kong, Xiaojing Zhang, Hong Shao, Zhenguo Zhao, Shuping Liu, Maomao Li, Xinxia Tian
  • Publication number: 20160365993
    Abstract: A method of a wireless communication device adapted to receive MIMO signals from a network node of a cellular communication network is disclosed. The MIMO signals comprises a variable number P of codewords conveyed by a variable number Q of MIMO layers, Q>P and P>1. The method comprises selecting a preferred mapping scheme for codeword-to-layer mapping based on a preferred number of layers and a channel quality metric related to the transmission of the MIMO signals, the preferred mapping scheme being selected among a plurality of available codeword-to-layer mapping schemes. The method also comprises transmitting an indication of the preferred mapping scheme to the network node. A related method for the network node is also disclosed.
    Type: Application
    Filed: January 27, 2016
    Publication date: December 15, 2016
    Inventors: Maomao CHEN, Fredrik NORDSTROM
  • Publication number: 20160359647
    Abstract: A method in a network node of a cellular communications system for providing MIMO transmissions to a communication device in the cellular communications system is disclosed. The MIMO transmissions use P code words mapped onto Q MIMO layers, where P?2 and Q>P. The method comprises mapping the code words for transmission to the communication device onto the MIMO layers according to a selected mapping scheme that has been selected among a plurality of available mapping schemes available for use for MIMO transmission of P code words over Q MIMO layers in the cellular communications system. A corresponding method for the communication device is also disclosed.
    Type: Application
    Filed: January 27, 2016
    Publication date: December 8, 2016
    Inventors: Maomao Chen, Fredrik Nordstrom
  • Publication number: 20160360537
    Abstract: Methods of operating a wireless terminal may be provided. A high-speed indication may be received for a cell of a network node indicating that the cell is adapted to operate in a high-speed environment, and operation of the wireless terminal may be adapted to communicate through the cell of the network node in the high-speed environment responsive to receiving the high-speed indication. Methods of operating a node of a wireless communication network may also be provided. Communication service may be provided through a cell to a plurality of wireless terminals in a high-speed environment, and a high-speed indication may be transmitted through the cell to one of the plurality of wireless terminals, with the high-speed indication indicating that the cell is adapted to operate in a high-speed environment.
    Type: Application
    Filed: January 19, 2016
    Publication date: December 8, 2016
    Inventors: Torgny PALENIUS, Peter ALRIKSSON, Maomao CHEN, Muhammad KAZMI, Christopher CALLENDER, Joakim AXMON
  • Publication number: 20160345221
    Abstract: Antenna nodes (310, 311, 312, 313) are controlled to maintain a respective radio cell (320, 321, 322, 323), each cell having one and the same physical cell identity. The antenna nodes are further controlled to maintain the respective radio cell in a single direction substantially along a path such that each wireless communication device (301, 303), during movement in a movement direction (302, 301) along the path, can connect either to consecutive antenna nodes towards which the wireless communication device is moving or connect to consecutive antenna nodes away from which the wireless communication device is moving.
    Type: Application
    Filed: January 30, 2015
    Publication date: November 24, 2016
    Inventors: Joakim AXMON, Peter ALRIKSSON, Christopher CALLENDER, Maomao CHEN, Torgny PALENIUS
  • Publication number: 20160337227
    Abstract: Different Out-of-sync thresholds are defined for Radio Link Monitoring by a UE having a selectively enabled advanced receiver feature. When the advanced receiver feature is disabled, the UE monitors received signal quality and compares a signal quality metric to a first threshold developed for a reference receiver. When the advanced receiver feature is enabled, the UE compares the signal quality metric to a second threshold indicating lower signal quality than the first threshold. In either case, if the signal quality meets the respective threshold, the UE goes Out-of-sync. The Out-of-sync UE continues to monitor received signal quality. Regardless of whether the advanced receiver feature is enabled or not, a third threshold, developed for the reference receiver, is applied to determine when to return to In-sync. In one embodiment, the reference receiver enables two antennas, and the advanced receiver feature is enabling four antennas.
    Type: Application
    Filed: May 12, 2016
    Publication date: November 17, 2016
    Inventors: Torgny Palenius, Christopher Callender, Maomao Chen, Fredrik Nordström