Abstract: A network node in a wireless communication network generates configuration information that configures an extent to which a wireless communication device autonomously adapts a number of different receiver components that the wireless communication device uses under different conditions at the wireless communication device, subject to minimum receiver component requirements respectively specified for the different conditions. In some examples, the different conditions may be associated with correlation of propagation channels received at the wireless communication device. The network node transmits the configuration information to the device. Correspondingly, the device autonomously adapts the number of different receiver components that the wireless communication device uses in accordance with the configuration information.

Abstract: In MIMO wireless communication networks, receiver MIMO antenna parameters are not static over time. For example, the MIMO channel correlation is higher for high frequency bands than for low frequency bands. This variability of the receiver antenna parameters introduces uncertainty based the reported CSI (e.g., CQI, PMI, RI) if the network uses only static assumptions for such antenna parameter values. In embodiments, the UE determines the current status of its receive antenna parameters—such as number, configuration, correlation, and power imbalance—and transmits this information to the network (e.g., serving BS). The network node then based on the received information performs one or more radio operational tasks leading to more efficient use of radio resources and enhanced system performance.

Abstract: A first user equipment is configured to mitigate multi-antenna inter-stream interference. A method by the first UE includes determining, based on one or more criteria, a number of multi-antenna streams whose interference can be currently mitigated by the first UE, and transmitting information based on the number of multi-antenna streams to a first network node, to a second network node, and/or to a second UE. A related method by a first network node serving or managing the first UE includes obtaining information based on a number of multi-antenna streams whose interference can be currently mitigated by a first UE at the first UE, and performing one or more radio operational tasks using the information based on the number of multi-antenna streams whose interference can be currently mitigated.

Abstract: Methods and systems for allocating regional inventory to reduce out-of-stock costs are described. A method may include identifying a total number of units of an item to be stored in a plurality of regions and determining an order forecast for the item in each of the plurality of regions. The method may also include receiving a unit out-of-stock cost of the item in each of the plurality of regions and calculating an expected cost for each of the plurality of regions based, at least in part, on the total number of units of the item, each region's respective order forecast, and each region's respective unit out-of-stock cost. The method may further include allocating a portion of the total number of units of the item to each of the plurality of regions to reduce a sum of the expected costs.

Abstract: The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment.

Abstract: Methods and systems for allocating regional inventory to reduce out-of-stock costs are described. A method may include identifying a total number of units of an item to be stored in a plurality of regions and determining an order forecast for the item in each of the plurality of regions. The method may also include receiving a unit out-of-stock cost of the item in each of the plurality of regions and calculating an expected cost for each of the plurality of regions based, at least in part, on the total number of units of the item, each region's respective order forecast, and each region's respective unit out-of-stock cost. The method may further include allocating a portion of the total number of units of the item to each of the plurality of regions to reduce a sum of the expected costs.