Patents by Inventor Norimasa Miura

Norimasa Miura has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20160199419
    Abstract: Disclosed is a novel process for producing a Muse cell-like cell or a novel method for extending the replicative life span of a cell population. Provided is a process for producing a Muse cell-like cell, comprising the step of inhibiting the expression or function of ELAVL2, TEAD1, or GATAD2B. At this time, siRNA or shRNA may be used to inhibit the expression or function of ELAVL2, TEAD1, or GATAD2B.
    Type: Application
    Filed: August 28, 2014
    Publication date: July 14, 2016
    Inventor: Norimasa MIURA
  • Patent number: 9257682
    Abstract: In method for manufacturing an external cladding for a laminate battery according to the present invention, austenitic stainless steel foil having a thermoplastic resin layer on one of a front surface and a rear surface and a lubricating film on the other surface is used as a material, the stainless steel foil is disposed such that the surface provided with the thermoplastic resin layer opposes a punch, and drawing is implemented on the stainless steel foil without using lubricating oil in a condition where an annular region of the stainless steel foil, which is contacted by a shoulder portion of the punch, is set at a temperature of 20° C. or lower, and an exterior region on an exterior of the annular region is set at a temperature between 40° C. and 100° C.
    Type: Grant
    Filed: March 16, 2012
    Date of Patent: February 9, 2016
    Assignee: Nisshin Steel Co., Ltd.
    Inventors: Katsunari Norita, Norimasa Miura, Setsuko Koura
  • Publication number: 20150231683
    Abstract: An austenitic stainless steel foil 2 with a thickness equal to or less than 300 ?m is disposed to face a punch 12, and the stainless steel foil 2 is subjected to drawing in a state in which an annular region 2a of the stainless steel foil 2 that is in contact with a shoulder portion 12d of the punch 12 is set to a temperature up to 30° C. and an external region 2b outside the annular region 2a is set to a temperature of from 40° C. to 100° C.
    Type: Application
    Filed: September 26, 2013
    Publication date: August 20, 2015
    Applicant: NISSHIN STEEL CO., LTD.
    Inventors: Katsunari Norita, Norimasa Miura
  • Publication number: 20140370371
    Abstract: Provided is an external packaging material for a laminated battery, which is one of two external packaging materials constituting a battery case accommodating a battery element, and each configured by a stainless steel sheet provided with a resin layer, the battery case being formed by fusing together the resin layers in a state in which tabs connected to the battery element are disposed between the two external packaging materials, wherein a stepped portion conforming to the cross-sectional shape of each of the tabs at a position where the tab is inserted between the two external packaging materials is formed in advance before the tab is inserted.
    Type: Application
    Filed: August 27, 2014
    Publication date: December 18, 2014
    Inventors: Kazunori OZAWA, Yasunori OZAWA, Yusuke HONMA, Norihiro KON, Yoshie YOSHIDA, Norimasa MIURA, Katsunari NORITA, Setsuko KOURA
  • Publication number: 20140013590
    Abstract: In method for manufacturing an external cladding for a laminate battery according to the present invention, austenitic stainless steel foil having a thermoplastic resin layer on one of a front surface and a rear surface and a lubricating film on the other surface is used as a material, the stainless steel foil is disposed such that the surface provided with the thermoplastic resin layer opposes a punch, and drawing is implemented on the stainless steel foil without using lubricating oil in a condition where an annular region of the stainless steel foil, which is contacted by a shoulder portion of the punch, is set at a temperature of 20° C. or lower, and an exterior region on an exterior of the annular region is set at a temperature between 40° C. and 100° C.
    Type: Application
    Filed: March 16, 2012
    Publication date: January 16, 2014
    Inventors: Katsunari Norita, Norimasa Miura, Setsuko Koura
  • Publication number: 20130190389
    Abstract: A novel compound to induce a pluripotent stem cell is provided. A novel anti-malignant-tumor substance is provided. A pluripotent stem cell-inducing agent, including a single-stranded or double-stranded polynucleotide containing the base sequence shown in SEQ ID NO:41 or a base sequence including deletion, substitution, or addition of 1 to 3 bases in SEQ ID No: 41, in which the pluripotent stem cell-inducing agent induces a cell to become a pluripotent stem cell is provided.
    Type: Application
    Filed: June 28, 2011
    Publication date: July 25, 2013
    Applicant: NATIONAL UNIVERSITY CORPORATION TOTTORI UNIVERSITY
    Inventor: Norimasa Miura
  • Publication number: 20130184335
    Abstract: A novel compound to induce a pluripotent stem cell is provided. A novel anti-malignant-tumor substance is provided. A pluripotent stem cell-inducing agent, including one or more single-stranded or double-stranded polynucleotides selected from the group consisting of: a) a single-stranded or double-stranded polynucleotide containing a sequence of SEQ ID NO:1 or a sequence including deletion, substitution, or addition of 1 to 3 bases in SEQ ID No: 1, b) a single-stranded or double-stranded polynucleotide containing a sequence of SEQ ID NO:2 or a sequence including deletion, substitution, or addition of 1 to 3 bases in SEQ ID No: 2, c) a single-stranded or double-stranded polynucleotide containing a sequence of SEQ ID NO:3 or a sequence including deletion, substitution, or addition of 1 to 3 bases in SEQ ID No: 3, in which the pluripotent stem cell-inducing agent induces a cell to become a pluripotent stem cell is provided.
    Type: Application
    Filed: June 28, 2011
    Publication date: July 18, 2013
    Applicant: NATIONAL UNIVERSITY CORPORATION TOTTORI UNIVERSITY
    Inventor: Norimasa Miura
  • Patent number: 8148514
    Abstract: Disclosed is a novel substance capable of regulating the expression of a telomerase reverse transcriptase gene in a cell of a mammal. A gene capable of regulating the expression of hTERT, comprising a nucleotide sequence depicted in SEQ ID No: 1 or 2. The expression of a telomerase reverse transcriptase gene can be inhibited by inhibiting the expression of the gene. By utilizing this mechanism, the expression of a telomerase reverse transcriptase gene can be regulated.
    Type: Grant
    Filed: March 31, 2010
    Date of Patent: April 3, 2012
    Assignee: National University Corporation Tottori University
    Inventor: Norimasa Miura
  • Patent number: 8148513
    Abstract: Disclosed is a novel substance capable of regulating the expression of a telomerase reverse transcriptase gene in a cell of a mammal. A gene capable of regulating the expression of hTERT, comprising a nucleotide sequence depicted in SEQ ID No: 1 or 2. The expression of a telomerase reverse transcriptase gene can be inhibited by inhibiting the expression of the gene. By utilizing this mechanism, the expression of a telomerase reverse transcriptase gene can be regulated.
    Type: Grant
    Filed: March 31, 2010
    Date of Patent: April 3, 2012
    Assignee: National University Corporation Tottori University
    Inventor: Norimasa Miura
  • Patent number: 8124755
    Abstract: Disclosed is a novel substance capable of regulating the expression of a telomerase reverse transcriptase gene in a cell of a mammal A gene capable of regulating the expression of hTERT, comprising a nucleotide sequence depicted in SEQ ID No: 1 or 2. The expression of a telomerase reverse transcriptase gene can be inhibited by inhibiting the expression of the gene. By utilizing this mechanism, the expression of a telomerase reverse transcriptase gene can be regulated.
    Type: Grant
    Filed: March 31, 2010
    Date of Patent: February 28, 2012
    Assignee: National University Corporation Tottori University
    Inventor: Norimasa Miura
  • Patent number: 7985852
    Abstract: Disclosed is a novel substance capable of regulating the expression of a telomerase reverse transcriptase gene in a cell of a mammal. A gene capable of regulating the expression of hTERT, comprising a nucleotide sequence depicted in SEQ ID No: 1 or 2. The expression of a telomerase reverse transcriptase gene can be inhibited by inhibiting the expression of the gene. By utilizing this mechanism, the expression of a telomerase reverse transcriptase gene can be regulated.
    Type: Grant
    Filed: March 28, 2006
    Date of Patent: July 26, 2011
    Assignee: National University Corporation Tottori University
    Inventor: Norimasa Miura
  • Publication number: 20100248356
    Abstract: Disclosed is a novel substance capable of regulating the expression of a telomerase reverse transcriptase gene in a cell of a mammal. A gene capable of regulating the expression of hTERT, comprising a nucleotide sequence depicted in SEQ ID No: 1 or 2. The expression of a telomerase reverse transcriptase gene can be inhibited by inhibiting the expression of the gene. By utilizing this mechanism, the expression of a telomerase reverse transcriptase gene can be regulated.
    Type: Application
    Filed: March 31, 2010
    Publication date: September 30, 2010
    Applicant: NATIONAL UNIVERSITY CORPORATION TOTTORI UNIVERSITY
    Inventor: Norimasa Miura
  • Publication number: 20100184208
    Abstract: Disclosed is a novel substance capable of regulating the expression of a telomerase reverse transcriptase gene in a cell of a mammal A gene capable of regulating the expression of hTERT, comprising a nucleotide sequence depicted in SEQ ID No: 1 or 2. The expression of a telomerase reverse transcriptase gene can be inhibited by inhibiting the expression of the gene. By utilizing this mechanism, the expression of a telomerase reverse transcriptase gene can be regulated.
    Type: Application
    Filed: March 31, 2010
    Publication date: July 22, 2010
    Applicant: NATIONAL UNIVERSITY CORPORATION TOTTORI UNIVERSITY
    Inventor: Norimasa Miura
  • Publication number: 20100184216
    Abstract: Disclosed is a novel substance capable of regulating the expression of a telomerase reverse transcriptase gene in a cell of a mammal. A gene capable of regulating the expression of hTERT, comprising a nucleotide sequence depicted in SEQ ID No: 1 or 2. The expression of a telomerase reverse transcriptase gene can be inhibited by inhibiting the expression of the gene. By utilizing this mechanism, the expression of a telomerase reverse transcriptase gene can be regulated.
    Type: Application
    Filed: March 31, 2010
    Publication date: July 22, 2010
    Applicant: NATIONAL UNIVERSITY CORPORATION TOTTORI UNIVERSITY
    Inventor: Norimasa Miura
  • Publication number: 20090124794
    Abstract: Disclosed is a novel substance capable of regulating the expression of a telomerase reverse transcriptase gene in a cell of a mammal. A gene capable of regulating the expression of hTERT, comprising a nucleotide sequence depicted in SEQ ID No: 1 or 2. The expression of a telomerase reverse transcriptase gene can be inhibited by inhibiting the expression of the gene. By utilizing this mechanism, the expression of a telomerase reverse transcriptase gene can be regulated.
    Type: Application
    Filed: March 28, 2006
    Publication date: May 14, 2009
    Applicant: NATIONAL UNIVERSITY CORPORATION TOTTORI UNIVERSITY
    Inventor: Norimasa Miura
  • Publication number: 20070178461
    Abstract: To provide a cancer diagnostic method capable of detecting evidence presenting the presence of cancer cells in early stage cancer. Cancer diagnostic method comprised of; a process to obtain the sample containing RNA only as a somatic cell and cancer cell fraction from body fluid and a process having a reverse transcription reaction step to generate cDNA using reverse transcriptase from the sample containing said RNA only and a PCR reaction step utilizing fluorescent dye using the following primers for hTERT, CGGAAGAGTGTCTGGAGCAA and GGATGAAGCGGAGTCTGGA to quantify the PCR product amplified by the PCR reaction using the fluorescent dye binding to the PCR product.
    Type: Application
    Filed: November 18, 2004
    Publication date: August 2, 2007
    Inventors: Norimasa Miura, Goshi Shiota
  • Patent number: 4962840
    Abstract: A control system for a cigarette making and pack aging system including a cigarette making machine, a cigarette packaging machine with a variable operation speed, and a reservoir mechanism provided between the cigarette making machine and the cigarette packaging machine, a current reserve amount calculating unit for calculating a current reserve amount in the reservoir mechanism, an intermediate reserve amount calculating unit for calculating an intermediate reserve amount, a desired value setting unit for setting a maximum reserve amount and a minimum reserve amount of the reservoir mechanism on the basis of the intermediate reserve amount, a comparison unit for comparing the current reserve amount with the maximum reserve amount and the minimum reserve amount, and a speed control unit for controlling the speed of the packaging machine on the basis of a comparison result by the comparison unit.
    Type: Grant
    Filed: July 17, 1989
    Date of Patent: October 16, 1990
    Assignee: Japan Tobacco Inc.
    Inventors: Norimasa Miura, Yoshihisa Sato