Abstract: Provided herein are Myc-Max inhibitory compounds having the structure of Formula (I) and compositions thereof for use in the treatment of cancer. In particular, the Myc-Max inhibitory compounds may be useful for the treatment of cancers selected from one or more of: prostate cancer, breast cancer, colon cancer, cervical cancer, small-cell lung carcinomas, neuroblastomas, osteosarcomas, glioblastomas, melanoma and myeloid leukaemia.

Abstract: Provided herein are uses of the compounds for the treatment of various indications, including prostate cancer and Kennedy's disease.

Abstract: Provided herein are Myc-Max inhibitory compounds having the structure of Formula (I) and compositions thereof for use in the treatment of cancer. In particular, the Myc-Max inhibitory compounds may be useful for the treatment of cancers selected from one or more of: prostate cancer, breast cancer, colon cancer, cervical cancer, small-cell lung carcinomas, neuroblastomas, osteosarcomas, glioblastomas, melanoma and myeloid leukaemia.

Abstract: Provided herein are Myc-Max inhibitory compounds having the structure of Formula (I) and compositions thereof for use in the treatment of cancer. In particular, the Myc-Max inhibitory compounds may be useful for the treatment of cancers selected from one or more of: prostate cancer, breast cancer, colon cancer, cervical cancer, small-cell lung carcinomas, neuroblastomas, osteosarcomas, glioblastomas, melanoma and myeloid leukaemia.

Abstract: The present invention provides compounds having Ar-V7 inhibitory activity, their manufacture, pharmaceutical compositions containing them and their use as therapeutically active substances. The active compounds of the present invention are useful in the therapeutic and/or prophylactic treatment of cancer.

Abstract: Administration of antisense oligodeoxynucleotides (ODN) targeted against the testosterone-repressed prostate message-2 (TRPM-2) gene can reduce the amount of TRPM-2 in renal cell cancer (RCC) cells and other cancer cells, and as a result enhance chemosensitivity of these cells to chemotherapy agents and radiation. Thus, for example, the sensitivity of renal cell cancer cells to a chemotherapeutic agent can be increased by exposing renal cell cancer cells to a chemotherapeutic agent and an agent which reduces the amount of TRPM-2 in the renal cell cancer cells. This provides an improved method for treatment of renal cell cancer, which is generally resistant to treatment with known chemotherapy agents.

Abstract: A method for treating an individual suffering from a cancer comprising administering to the individual i) a chemotherapeutic agent, and ii) one antisense oligonucleotide having nucleotides in the sequence set forth in Seq. ID No. 4 and which antisense oligonucleotide has a phosphorothioate modification that increases the stability thereof in vivo, wherein the cancer expresses testosterone-repressed prostate message-2 (TRPM-2), thereby treating said individual.

Abstract: A method for treating an individual suffering from a cancer comprising administering to the individual a chemotherapeutic agent, and ii) one antisense oligonucleotide having nucleotides in the sequence set forth in Seq. ID No. 4 and which antisense oligonucleotide has a phosphorothioate modification that increases the stability thereof in vivo, wherein the cancer expresses testosterone-repressed prostate message-2 (TRPM-2), thereby treating said individual.

Abstract: It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. In addition, it has also been found that antisense TRPM-2 has beneficial effect for other cancer types. Specifically, antisense TRPM-2 ODN enhances chemosensitivity in human Renal cell cancer, a normally chemoresistant disease with no active chemotherapeutic agent having an objective response rate higher than 10%. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN.

Abstract: Administration of antisense oligodeoxynucleotides (ODN) targeted against the testosterone-repressed prostate message-2 (TRPM-2) gene can reduce the amount of TRPM-2 in renal cell cancer (RCC) cells and other cancer cells, and as a result enhance chemosensitivity of these cells to chemotherapy agents and radiation. Thus, for example, the sensitivity of renal cell cancer cells to a chemotherapeutic agent can be increased by exposing renal cell cancer cells to a chemotherapeutic agent and an agent which reduces the amount of TRPM-2 in the renal cell cancer cells. This provides an improved method for treatment of renal cell cancer, which is generally resistant to treatment with known chemotherapy agents.

Abstract: Administration of antisense oligodeoxynucleotides (ODN) targeted against the testosterone-repressed prostate message-2 (TRPM-2) gene can reduce the amount of TRPM-2 in renal cell cancer (RCC) cells and other cancer cells, and as a result enhance chemosensitivity of these cells to chemotherapy agents and radiation. Thus, for example, the sensitivity of renal cell cancer cells to a chemotherapeutic agent can be increased by exposing renal cell cancer cells to a chemotherapeutic agent and an agent which reduces the amount of TRPM-2 in the renal cell cancer cells. This provides an improved method for treatment of renal cell cancer, which is generally resistant to treatment with known chemotherapy agents.

Abstract: It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. In addition, it has also been found that antisense TRPM-2 has beneficial effect for other cancer types. Specifically, antisense TRPM-2 ODN enhances chemosensitivity in human Renal cell cancer, a normally chemoresistant disease with no active chemotherapeutic agent having an objective response rate higher than 10%. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN.

Abstract: It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. In particular, such antisense therapy can be applied in treatment of prostate cancer and renal cell cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Thus, prostate cancer can be treated in an individual suffering from prostate cancer by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual, and administering to the individual a composition effective to inhibit expression of TRPM-2 by the tumor cells, thereby delaying the progression of prostatic tumor cells to an androgen-independent state in an individual. Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer.

Abstract: It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. In particular, such antisense therapy can be applied in treatment of prostate cancer and renal cell cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Thus, prostate cancer can be treated in an individual suffering from prostate cancer by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual, and administering to the individual a composition effective to inhibit expression of TRPM-2 by the tumor cells, thereby delaying the progression of prostatic tumor cells to an androgen-independent state in an individual Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer.

Abstract: Antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. Seq ID No. 4 (cagcagcagagtcttcatcat) is an antisense oligonucleotide which inhibits expression of TRPM-2 by tumor cells, and which can be combined with a pharmaceutically acceptable carrier suitable for human administration.

Abstract: Administration of antisense oligodeoxynucleotides (ODN) targeted against the testosterone-repressed prostate message-2 (TRPM-2) gene can reduce the amount of TRPM-2 in renal cell cancer (RCC) cells and other cancer cells, and as a result enhance chemosensitivity of these cells to chemotherapy agents and radiation. Thus, for example, the sensitivity of renal cell cancer cells to a chemotherapeutic agent can be increased by exposing renal cell cancer cells to a chemotherapeutic agent and an agent which reduces the amount of TRPM-2 in the renal cell cancer cells. This provides an improved method for treatment of renal cell cancer, which is generally resistant to treatment with known chemotherapy agents.

Abstract: It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. In particular, such antisense therapy can be applied in treatment of prostate cancer and renal cell cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Thus, prostate cancer can be treated in an individual suffering from prostate cancer by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual, and administering to the individual a composition effective to inhibit expression of TRPM-2 by the tumor cells, thereby delaying the progression of prostatic tumor cells to an androgen-independent state in an individual Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer.

Abstract: Administration of antisense oligodeoxynucleotides (ODN) targeted against the testosterone-repressed prostate message-2 (TRPM-2) gene can reduce the amount of TRPM-2 in renal cell cancer (RCC) cells and other cancer cells, and as a result enhance chemosensitivity of these cells to chemotherapy agents and radiation. Thus, for example, the sensitivity of renal cell cancer cells to a chemotherapeutic agent can be increased by exposing renal cell cancer cells to a chemotherapeutic agent and an agent which reduces the amount of TRPM-2 in the renal cell cancer cells. This provides an improved method for treatment of renal cell cancer, which is generally resistant to treatment with known chemotherapy agents.

Abstract: Antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer for example prostate cancer and renal cell cancer. Antisense TRPM-2 ODN treatment of prostatic tumor cells in vivo is effective for delaying the onset of androgen independence and can be used in combination with androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual. Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN. Thus, the antisense TRPM-2 ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-2 has been observed.

Abstract: It has been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer, particularly prostate and renal cell cancers. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence, thus prostate cancer can be treated by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in an individual, and administering a composition effective to inhibit expression of TRPM-2 by the tumor cells. Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer and in human Renal cell cancer. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN.