Abstract: A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2?-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2?-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.

Abstract: Compositions and a method are provided for the treatment of prostate and other endocrine tumors in mammals, including humans, by administration of an antisense oligodeoxynucleotide (ODN) which is complementary to a portion of the gene encoding IGFBP-2. Using the Shionogi tumor model in vitro and in vivo, the administration of such an ODN was shown to reduce proliferation of tumor cells, and also to delay the progression to androgen independence. Thus, treatment of prostate and other hormone-regulated cancer in mammals, including humans, and delay of the progression of prostate tumors to androgen independence is accomplished by administering to the mammal a therapeutically effective amount of an antisense oligodeoxynucleotide which is complementary to a portion of the nucleic acid sequence encoding IGFBP-2 and which reduces the amount of IGFBP-2 in the treated cells.

Abstract: A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2′-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2′-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.

Abstract: Administration of antisense oligodeoxynucleotides (ODN) targeted against the testosterone-repressed prostate message-2 (TRPM-2) gene can reduce the amount of TRPM-2 in renal cell cancer (RCC) cells and other cancer cells, and as a result enhance chemosensitivity of these cells to chemotherapy agents and radiation. Thus, for example, the sensitivity of renal cell cancer cells to a chemotherapeutic agent can be increased by exposing renal cell cancer cells to a chemotherapeutic agent and an agent which reduces the amount of TRPM-2 in the renal cell cancer cells. This provides an improved method for treatment of renal cell cancer, which is generally resistant to treatment with known chemotherapy agents.