Abstract: A method of manufacturing a silicon on insulator substrate includes: preparing a semiconductor substrate including a rear side semiconductor layer, an insulating layer, and a front side semiconductor layer, a first surface of the insulating layer being in contact with a surface of the rear side semiconductor layer, and a first surface of the front side semiconductor layer being in contact with a second surface of the insulating layer; forming a high concentration region in which an impurity concentration is increased in the front side semiconductor layer, by injecting impurities into the front side semiconductor layer; heating the semiconductor substrate having the high concentration region; and epitaxially growing an additional semiconductor layer on a second surface of the front side semiconductor layer of the heated semiconductor substrate, the additional semiconductor layer having a lower impurity concentration than the high concentration region.

Abstract: An image forming apparatus and a method of controlling the same, wherein stored user information is referenced to perform authentication of a user based on accepted user information, and the user is allowed to confirm whether or not to reset the user information of the user when authentication of the user fails. The user is caused to select a reset method for resetting the user information of the user in accordance with the confirmation, and reset the stored user information of the user in accordance with the selected reset method.

Abstract: A wedge-shaped contact region can be employed to provide electrical contacts to multiple electrically conductive layers in a three-dimensional device structure. A cavity including a generally wedge-shaped region and a primary region is formed in a dielectric matrix layer over a support structure. An alternating stack of insulating layers and electrically conductive layers is formed by a series of conformal deposition processes in the cavity and over the dielectric matrix layer. The alternating stack can be planarized employing the top surface of the dielectric matrix layer as a stopping layer. A tip portion of each electrically conductive layer within remaining portions of the alternating stack is laterally offset from the tip of the generally wedge-shaped region by a respective lateral offset distance along a lateral protrusion direction. Contact via structures can be formed on the tip portions of the electrically conductive layers to provide electrical contact.

Abstract: A switching element includes a semiconductor substrate that includes a first n-type semiconductor layer, a p-type body layer constituted by an epitaxial layer, and a second n-type semiconductor layer separated from the first n-type semiconductor layer by the body layer, a gate insulating film that covers a range across the surface of the first n-type semiconductor layer, the surface of the body layer, and the surface of the second n-type semiconductor layer, and a gate electrode that faces the body layer through the gate insulating film. An interface between the first n-type semiconductor layer and the body layer includes an inclined surface. The inclined surface is inclined such that the depth of the body layer increases as a distance from an end of the body layer increases in a horizontal direction. The inclined surface is disposed below the gate electrode.

Abstract: The present invention is directed to provide nucleic acid molecules that promote proliferation of pancreatic islet ?-cells. A proliferation promoting agent for promoting proliferation of pancreatic islet ?-cells according to the present invention contains at least one of a nucleic acid molecule having SEQ ID NO: 1 or a nucleic acid molecule having SEQ ID NO: 2: (SEQ?ID?NO:?1) UAAAGUGCUGACAGUGCAGAU (SEQ?ID?NO:?2) AGCUACAUCUGGCUACUGGGUCUC.

Abstract: An apparatus receives and analyzes a packet transmitted via a network, and performs network setting according to data included in the packet. Further, if it is determined that the received packet is a packet addressed to the apparatus and is not a setting packet for the network setting, the apparatus is controlled not to analyze the packet.

Abstract: A method of manufacturing a switching element includes forming a recessed portion in a surface of a GaN semiconductor substrate in which a first n-type semiconductor layer is exposed on the surface, growing a p-type body layer within the recessed portion and on the surface of the GaN semiconductor substrate, removing a surface layer portion of the body layer to expose the first n-type semiconductor layer on the surface of the GaN semiconductor substrate, and leave the body layer within the recessed portion, forming a second n-type semiconductor layer which is separated from the first n-type semiconductor layer by the body layer and is exposed on the surface of the GaN semiconductor substrate, and forming a gate electrode which faces the body layer through an insulating film.

Abstract: A composition which has high 4?-GL purity and can be used as a reference standard for various analyses can be obtained by a more convenient method than one conventionally used. A method for preparing a high-purity 4?-GL composition includes the steps of: (A) subjecting a 4?-GL-containing galacto-oligosaccharide to activated carbon column chromatography, and performing stepwise elution with plural organic solvent aqueous solutions, wherein the organic solvent aqueous solutions are used such that the concentration of the organic solvent in the organic solvent aqueous solution is higher than the concentration of the organic solvent in the immediately preceding organic solvent aqueous solution with respect to a series of elutions; and (B) adding an organic solvent to the final fraction eluted in step (A), and crystallizing the 4?-GL.

Abstract: An apparatus determines a second pixel range of an uncorrected image necessary to generate a first pixel range having pixels in a preset range of a corrected image, including a cache unit determining the second pixel range and reading and holding the second pixel range from memory before executing correction. Correspondences indicating positions of the uncorrected image corresponding to positions of pixels of the corrected image, respectively, are preset. The cache unit specifies a position of the uncorrected image corresponding to a pixel of one of four corners of a rectangular third pixel range including the first pixel range based on the correspondence, specifies pixel ranges of the uncorrected image necessary for pixel value generation, respectively, at the four corners of the third pixel range based on the specified position, and determines a pixel range including a convex set including the specified pixel ranges as the second pixel range.

Abstract: The present image processing apparatus stores setting information for whether to force setting of authentication information for each user. Furthermore, upon accepting a login request from a user, in a case where the stored setting information indicates forcing setting of authentication information, the image processing apparatus displays on a display unit a setting screen for setting authentication information to allow the user to set authentication information. In addition, the image processing apparatus executes login processing in accordance with a setting status of authentication information for the user.

Abstract: An image forming apparatus and a method of controlling the same, wherein stored user information is referenced to perform authentication of a user based on accepted user information, and the user is allowed to confirm whether or not to reset the user information of the user when authentication of the user fails. The user is caused to select a reset method for resetting the user information of the user in accordance with the confirmation, and reset the stored user information of the user in accordance with the selected reset method.

Abstract: A content startup control device includes: a reception unit that receives an instruction from a user to select a content; a vehicle information acquisition unit that acquires information from a vehicle and/or information on traveling as vehicle information; a startup recording unit that stores the vehicle information, which is acquired by the vehicle information acquisition unit when the content is selected or started up in response to the instruction received by the reception unit, as a startup record of the content; a condition creation unit that creates a startup condition under which the content is to be started up based on the startup record; and a content startup control unit that, if the vehicle information acquired from the vehicle information acquisition unit corresponds to the startup condition, proposes startup of a content related to the startup condition or starts up the content related to the startup condition.

Abstract: An image forming apparatus with a plurality of functions including at least a print function includes a print data management unit that stores print data received from a plurality of information processing apparatuses, a login control unit that performs use control on a user-by-user basis, and a user interface control unit that displays a user interface screen on a display unit, where the login control unit causes, in a case where a guest user not required to be authenticated to log into the image forming apparatus is permitted to log into the image forming apparatus, the user interface control unit to display a user interface screen for selecting a function to be used from among the plurality of functions, where the print function is selectable via the user interface screen in units of the plurality of information processing apparatuses.

Abstract: An electric compressor includes an inverter housing accommodating an inverter, a compressor housing accommodating a compression mechanism and an electric motor, and a seal member having an annular shape and interposed between an end surface of a peripheral wall of the compressor housing and an end surface of the inverter housing. The compressor housing has the peripheral wall in which the inverter is disposed. The seal member is retained to the inverter housing by a retaining structure which is disposed inside the peripheral wall of the compressor housing. The retaining structure includes a first projection and a second projection. The first projection is formed on the seal member and projects radially inward. The second projection is formed on the inverter housing. The first projection is located between the second projection and the end surface of the inverter housing so as to restrict movement of the seal member in a direction.

Abstract: A two-dimensional array of vertical field effect transistors is provided, which includes a first-tier structure and a second-tier structure. The first-tier structure includes a laterally alternating sequence of semiconductor rail structures and first dielectric isolation rails that alternates along a first horizontal direction. A first gate dielectric and a first gate electrode that laterally extend along a second horizontal direction are disposed between each neighboring pair of a semiconductor rail structure and a first dielectric isolation rail. The second-tier structure includes a laterally alternating sequence of composite rail structures and second dielectric isolation rails that alternates along the second horizontal direction. Each of the composite rail structures includes a laterally alternating plurality of semiconductor pillar structures and dielectric pillar structures.

Abstract: An image forming apparatus which is able to reliably execute a job received from a mobile device. When a job with user information is received from the mobile device connected to the image forming apparatus via a network, it is determined whether or not the received job is a registration job that requires registration of the user information as authentication information. When it is determined that the received job is the registration job, the user information is obtained from the registration job and registered as the authentication information.

Abstract: An inverter includes a bus bar as a wiring and a ferrite core that covers the bus bar to absorb electromagnetic noise from the bus bar. The bus bar and ferrite core are integrated by mold forming using a resin material in a state of exposing a part of the ferrite core.

Abstract: A switching element includes a semiconductor substrate that includes a first n-type semiconductor layer, a p-type body layer constituted by an epitaxial layer, and a second n-type semiconductor layer separated from the first n-type semiconductor layer by the body layer, a gate insulating film that covers a range across the surface of the first n-type semiconductor layer, the surface of the body layer, and the surface of the second n-type semiconductor layer, and a gate electrode that faces the body layer through the gate insulating film. An interface between the first n-type semiconductor layer and the body layer includes an inclined surface. The inclined surface is inclined such that the depth of the body layer increases as a distance from an end of the body layer increases in a horizontal direction. The inclined surface is disposed below the gate electrode.

Abstract: A method of manufacturing a switching element includes forming a recessed portion in a surface of a GaN semiconductor substrate in which a first n-type semiconductor layer is exposed on the surface, growing a p-type body layer within the recessed portion and on the surface of the GaN semiconductor substrate, removing a surface layer portion of the body layer to expose the first n-type semiconductor layer on the surface of the GaN semiconductor substrate, and leave the body layer within the recessed portion, forming a second n-type semiconductor layer which is separated from the first n-type semiconductor layer by the body layer and is exposed on the surface of the GaN semiconductor substrate, and forming a gate electrode which faces the body layer through an insulating film.

Abstract: In order to provide a novel ?-conjugated compound capable of increasing the light-emission efficiency of an organic electroluminescence element, for example, this ?-conjugated compound has a structure indicated by general formula (1). (In general formula (1): Z1-Z6 each independently indicate a hydrogen atom, a deuterium atom, an electron-donating group D, or an electron-withdrawing group A; at least out of two among Z1-Z6 is an electron-donating group D and the other is an electron-withdrawing group A; and at least one ortho position combination Z1 and Z2, Z2 and Z3, Z3 and Z4, Z4 and Z5, Z5 and Z6, or Z6 and Z1 among Z1-Z6 is one combination out of an electron-donating group D and an electron-donating group D, an electron-withdrawing group A and an electron-withdrawing group A, or an electron-donating group D and an electron-withdrawing group A.