Multiplex amplification and detection
The invention relates to the field of multiplex amplification. In particular, the invention relates to methods for assaying a sample for one or more nucleic acid targets in a single reaction based on the distinct melting temperatures or melting profiles of primers and/or probes. The invention also provides probes and kits for use in such methods.
Latest OXITEC LTD Patents:
This patent application is a divisional of U.S. patent application Ser. No. 13/822,129, filed on Jun. 21, 2013, now U.S. Pat. No. 9,284,607, which is a national stage filing under 35 U.S.C. 371 of International Application No. PCT/GB2011/052068, filed on Oct. 25, 2011, which claims foreign priority benefits to United Kingdom Patent Application No. 1017978.6, filed on Oct. 25, 2010, and which are incorporated herein by reference in their entireties.
SEQUENCE LISTINGThe instant application contains a Sequence Listing which has been submitted in text format via EFS-Web and is hereby incorporated by reference in its entirety. Said text copy, created on 3/11/2013, is named 12636759ASFILED_SequenceListing-Text and is 5815 bytes in size.
The present invention relates to the field of multiplex detection. In particular, the invention relates to methods for assaying a sample for one or more nucleic acid targets in a single reaction based on the distinct melting temperatures or melting profiles of probes. The invention also provides probes and kits for use in such methods.
Multiplex PCR, which uses multiple pairs of primers to simultaneously amplify multiple target sequences in a single PCR reaction, is a more efficient approach to PCR than standard single primer-pair PCR. The simultaneous amplification of various targets reduces both the cost and turn-around time of PCR analysis, minimizes experimental variations and the risk of cross-contamination, and increases the reliability of end results. Multiplex PCR has been used in many areas of DNA testing including identification of micro-organisms, gene expression analysis, mutation and polymorphism analysis, genotyping and DNA array analysis, and RNA detection.
Real-time PCR has been developed to quantify amplified products during PCR reactions. Real-time PCR is based on the principles that emission of fluorescence from dyes directly or indirectly associated with the formation of newly-synthesized amplicons or the annealing of primers with DNA templates can be detected and is proportional to the amount of amplicons in each PCR cycle. Real-time PCR is carried out in a closed-tube format and it is quantitative. Several methods are currently available for performing real-time PCR, such as utilising TaqMan probes (U.S. Pat. Nos. 5,210,015 and 5,487,972, and Lee et al., Nucleic Acids Res. 21:3761-6, 1993), molecular beacons (U.S. Pat. Nos. 5,925,517 and 6,103,476, and Tyagi and Kramer, Nat. Biotechnol. 14:303-8, 1996), self-probing amplicons (scorpions) (U.S. Pat. No. 6,326,145, and Whitcombe et al., Nat. Biotechnol. 17:804-7, 1999), Amplisensor (Chen et al., Appl. Environ. Microbiol. 64:4210-6, 1998), Amplifluor (U.S. Pat. No. 6,117,635, and Nazarenko et al., Nucleic Acids Res. 25:2516-21, 1997, displacement hybridization probes (Li et al., Nucleic Acids Res. 30:E5, 2002); DzyNA-PCR (Todd et al., Clin. Chem. 46:625-30, 2000), fluorescent restriction enzyme detection (Cairns et al. Biochem. Biophys. Res. Commun. 318:684-90, 2004) and adjacent hybridization probes (U.S. Pat. No. 6,174,670 and Wittwer et al., Biotechniques 22:130-1, 134-8, 1997). Most of these probes consist of a pair of dyes (a reporter dye and an acceptor dye) that are involved in fluorescence resonance energy transfer (FRET), whereby the acceptor dye quenches the emission of the reporter dye. In general, the fluorescence-labelled probes increase the specificity of amplicon quantification.
Another form of probe used in PCR is a double-stranded linear probe which has two complementary oligonucleotides. The probes described in the prior art have been of equal length, in which at least one of the oligonucleotides acts as a probe for a target sequence in a single-stranded conformation. The 5′ end of one of the oligonucleotides is labelled with a fluorophore and the 3′ end of the other oligonucleotide is labelled with a quencher, e.g., an acceptor fluorophore, or vice versa. When these two oligonucleotides are annealed to each other, the two labels are close to one another, thereby quenching fluorescence. Target nucleic acids, however, compete for binding to the probe, resulting in a less than proportional increase of probe fluorescence with increasing target nucleic acid concentration (Morrison L. et al., Anal. Biochem., Vol. 183, pages 231-244 (1989); U.S. Pat. No. 5,928,862).
Double-stranded linear probes modified by shortening one of the two complementary oligonucleotides by a few bases to make a partially double-stranded linear probe, are also known in the art. In such double-stranded linear probes in the prior art, the longer oligonucleotide has been end-labelled with a fluorophore and the slightly shorter oligonucleotide has been end-labelled with a quencher. In the double-stranded form, the probe is less fluorescent due to the close proximity of the fluorophore and the quencher. In the presence of a target, however, the shorter quencher oligonucleotide is displaced by the target. As a result, the longer oligonucleotide (in the form of probe-target hybrid) becomes substantially more fluorescent (Li et al., Nucleic Acids Research, Vol. 30, No. 2, e5 (2002)).
US 2005/0227257 describes a slightly modified double stranded linear nucleic acid probe. The probe described in this patent application is modified by shortening one of the two complementary oligonucleotides by more bases, compared to the above, to make a partially double-stranded linear probe.
Fluorescent hybridisation probes have also been used in other fields. For example, methods for multiplex genotyping using fluorescent hybridisation probes have been described (e.g. U.S. Pat. No. 6,140,054) which use the melting temperature of fluorescent hybridization probes that hybridize to a PCR amplified targeted region of genome/nucleic acid sequence to identify mutations and polymorphisms.
The advent of high-throughput genetic testing has necessitated both qualitative and quantitative analysis of multiple genes and has led to the convergence of multiplex PCR and real-time PCR into multiplex real-time PCR. Since double-stranded DNA intercalating dyes are not suitable for multiplexing due to their non-specificity, fluorescence-labelled probes have made multiplex real-time PCR possible. However, multiplex real-time PCR is limited by the availability of fluorescence dye combinations. Currently, only up to four or five fluorescence dyes can be detected and quantified simultaneously in real-time PCR.
US2005/0053950 describes a protocol for quantifying multiplex real-time polymerase chain reactions (PCR). The methods quantify multiple PCR products or amplicons in a single real-time PCR reaction based on the different melting temperatures (Tm) of each amplicon and the emission changes of double-stranded DNA dyes such as SYBR Green I when amplicons are in duplex or in separation. For a specific amplicon with a Tm, the emission difference between the emission reading taken at a temperature below the Tm and the emission reading taken at a temperature above the Tm corresponds to the emission value of the amplicon in duplex. Accordingly, the emission difference of each amplicon in a single PCR reaction can be used to quantify each amplicon. However, the multiplexity and sensitivity of such methods can be relatively low. For example, the difference in melting temperatures between amplicons of the order of 100-150 nucleotides in length is small. Therefore, these techniques require the use of amplicons with large differences in their sizes in order to be able to distinguish between them.
There is a need, however, to develop other methods of amplifying and quantifying multiple target sequences in a single PCR reaction for multiplex real-time PCR with greater levels of multiplexity and sensitivity.
The method of the present invention differs from prior art technologies. Firstly, the method is based on the different melting properties (Tm or melting profile) of each probe and the emission changes of labels on the probe when the probe's internal double-stranded portions are in duplex or in separation. The probe of present invention comprises a double-stranded portion which can be formed by a first oligonucleotide and a second oligonucleotide; the double stranded portion has a distinct Tm for each probe which distinguishes different probes within a set of probes comprising the same or similar labels. Secondly, the first oligonucleotide may or may not comprise one or more labels and it is the first oligonucleotide which is consumed during the amplification reaction. The emission difference between the emission readings at two different temperatures corresponds to the emission value of the probe after some probe being consumed. Thirdly, measuring melting profiles of unconsumed probes provide an indication of the presence or amount of target nucleic acids presented in a sample.
To facilitate understanding of the invention, a number of terms are defined below.
As used herein, the terms “target sequence”, “target nucleic acid”, “target nucleic acid sequence” and “nucleic acids of interest” are used interchangeably and refer to a desired region which is to be either amplified, detected or both. The target sequence, which is the object of amplification and detection, can be any nucleic acid. The target sequence can be RNA, cDNA, genomic DNA, or DNA or RNA, for example from a disease-causing micro-organism or virus. The target sequence can also be DNA treated by chemical reagents, various enzymes and physical exposure. A target nucleic acid sequence of interest in a sample may appear as single-stranded DNA or RNA such as cDNA, mRNA, other RNA or as separated complementary strands. Separating complementary strands of target nucleic acid may be accomplished by physical, chemical or enzymatic means. For the ease of description and understanding, references to nucleic acids of interest or targets refer both to these moieties as found in a test sample and to amplified copies of portions of theses nucleic acids, unless specifically noted to the contrary.
“Primer” as used herein refers to an oligonucleotide, whether occurring naturally or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced i.e., in the presence of nucleotides and an agent for polymerization such as DNA polymerase and at a suitable temperature and buffer. The primers herein are selected to be substantially complementary to the different strands of each specific sequence to be amplified. This means that the primers must be sufficiently complementary to hybridize with their respective strands. A non-complementary nucleotide fragment may be attached to the 5′-end of the primer, with the remainder of the primer sequence being complementary to the diagnostic section of the target base sequence. Commonly, the primers are complementary except when non-complementary nucleotides may be present at a predetermined primer terminus as described.
The term “complementary to” is used herein in relation to a nucleotide that will base pair with another specific nucleotide. Thus adenosine is complementary to uridine or thymidine and guanosine is complementary to cytidine. It is appreciated that whilst thymidine and guanosine may base pair under certain circumstances they are not regarded as complementary for the purposes of this specification. For purposes of the present invention, the term “substantially complementary” means that equal or more than 70%, preferably more than 80%, more preferably more than 90% and most preferably more than 95% or 99% of nucleobases on one strand of the probe finds its Watson-Crick binding partner on the other strand of the probe (or in the nucleic acid of interest) in an alignment such that the corresponding nucleotides can hybridize to each other.
The terms “duplex” and “double-stranded” are interchangeable, mean one strand of oligo-poly-nucleotides hybridises to the complementary oligo-poly-nucleotides.
The term “identical” means that two nucleic acid sequences have the same sequence or a complementary sequence.
As used herein, “continuous monitoring” and similar terms refer to monitoring multiple times during a cycle of PCR, preferably during temperature transitions, and more preferably obtaining at least one data point in each temperature transition.
As used herein, “cycle-by-cycle” monitoring means monitoring the PCR reaction once or multiple times each cycle.
The term “Actual Consumed Amount” (ACA) means the amount of probe being consumed in a reaction as reflected by fluorescence measuring.
“Amplification” as used herein denotes the use of any amplification procedures to increase the concentration of a particular nucleic acid sequence within a mixture of nucleic acid sequences.
The term “sample” as used herein is used in its broadest sense. A biological sample suspected of containing nucleic acid can comprise, but is not limited to, genomic DNA, cDNA (in solution or bound to a solid support), and the like.
The term “label” as used herein refers to any atom or molecule which can be used to provide or aid to provided a detectable (preferably quantifiable) signal, and which can be attached to a nucleic acid or protein. Labels may provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, magnetism, enzymatic activity and the like.
The term “adjacent” or “substantially adjacent” as used herein refers to the positioning of two oligonucleotides on its complementary strand of the template nucleic acid. The two template regions hybridised by oligonucleotides may be contiguous, i.e. there is no gap between the two template regions. Alternatively, the two template regions hybridised by the oligonucleotides may be separated by 1 to about 40 nucleotides, more preferably, about 1 to 10 nucleotides.
The term “thermally cycling,” “thermal cycling”, “thermal cycles” or “thermal cycle” refers to repeated cycles of temperature changes from a total denaturing temperature, to an annealing (or hybridising) temperature, to an extension temperature and back to the total denaturing temperature. The terms also refer to repeated cycles of a denaturing temperature and an extension temperature, where the annealing and extension temperatures are combined into one temperature. A total denaturing temperature unwinds all double stranded fragments into single strands. An annealing temperature allows a primer to hybridize or anneal to the complementary sequence of a separated strand of a nucleic acid template. The extension temperature allows the synthesis of a nascent DNA strand of the amplicon.
The term “reaction” as used herein refers to hybridisation reaction, extension reaction or amplification reaction or other biological, chemical reactions.
The terms “amplification mixture” or “PCR mixture” as used herein refer to a mixture of components necessary to detect target nucleic acid from nucleic acid templates. The mixture may comprise nucleotides (dNTPs), probes, a thermostable polymerase, primers, and a plurality of nucleic acid templates. The mixture may further comprise a Tris buffer, a monovalent salt, and Mg2+. The concentration of each component is well known in the art and can be further optimized by an ordinary skilled artisan.
The terms “amplified product” or “amplicon” refers to a fragment of DNA amplified by a polymerase using a pair of primers in an amplification method such as PCR
The term “melting profile” refers to a collection of measurements of an oligo (or poly)nucleotide and its complement which indicate the oligo (or poly)nucleotide molecule's transition from double-stranded to single-stranded nucleic acid (or vice-versa). The transition of a nucleic acid from double-stranded to single-stranded form is often described in the art as the “melting” of that nucleic acid molecule. The transition may also be described as the “denaturation” or “dissociation” of the nucleic acid. Accordingly, a melting profile of the present invention may also be referred to as a “dissociation profile”, a “denaturation profile”, a “melting curve”, a “dissociation curve”, a “hybridisation/dissociation profile” etc.
The “melting temperature” or “Tm” of a nucleic acid molecule generally refers to the temperature at which a polynucleotide dissociates from its complementary sequence. Generally, the Tm may be defined as the temperature at which one-half of the Watson-Crick base pairs in duplex nucleic acid molecules are broken or dissociated (i.e., are “melted”) while the other half of the Watson-Crick base pairs remain intact in a double stranded conformation. In preferred embodiments where duplex nucleic acid molecules are oligonucleotides and in other embodiments where the duplex nucleic acids dissociate in a two-state fashion, the Tm of a nucleic acid may also be defined as the temperature at which one-half of the nucleic acid molecules in a sample are in a single-stranded conformation while the other half of the nucleic acid molecules in that sample are in a double-stranded conformation. Tm, therefore defines a midpoint in the transition from double-stranded to single-stranded nucleic acid molecules (or, conversely, in the transition from single-stranded to double-stranded nucleic acid molecules). It is well appreciated in the art that the transition from double-stranded to single-stranded nucleic acid molecules does not occur at a single temperature but, rather, over a range of temperatures. Nevertheless, the Tm provides a convenient measurement for approximating whether nucleic acid molecules in a sample exist in a single-stranded or double-stranded conformation. As such, the melting temperature of a nucleic acid sample may be readily obtained by simply evaluating a melting profile for that sample.
The term “consumed” or “consumption” means that the amount of free labeled probes is decreased at a temperature at which the labeled probe is normally intact. The labeled probe may comprise or not comprise double stranded portion; the consumption of the labeled probe may result in detection signal changes. The consumption of the labeled probe may involve probe hybridisation to target nucleic acid or degradation of the probe upon hybridisation to target nucleic acid. In the case of the probe comprising a double stranded portion, the decrease in the amount of free labeled probe may be a result of at least one strand of the probe being unavailable to form double-stranded portion, which is either the first oligonucleotide of the probe or second oligonucleotide of the probe or both. The absence of at least one strand of the probe means the first oligonucleotide of the probe, the second oligonucleotide of the probe or both oligonucleotides of the probe are hybridised with the target nucleic acid. The hybridisation of the first oligonucleotide of the probe, the second oligonucleotide of the probe or both oligonucleotides of the probe with the target nucleic acid may be followed by extension of the oligonucleotides of the probe which acts as a primer, or by degradation of the oligonucleotides of the probe.
The present invention describes methods that allow the essentially simultaneous amplification and detection of a large number of different target nucleic acid sequences.
In a first aspect, the invention provides a method for assaying a sample for one or more target nucleic acids, said method comprising:
- (a) contacting a sample comprising one or more target nucleic acids with an amplification reaction mixture comprising:
- (i) one or more pairs of forward/reverse oligonucleotide primers, wherein the primer pairs are capable of amplifying one or more target nucleic acids, if present in the sample,
- (ii) a set of two or more probes, wherein at least one probe in the set comprises a double-stranded portion,
- wherein each probe in the set comprises a detectable label or detectable combination of labels which is/are capable of producing a changeable signal which is characteristic for each probe, and
- wherein said two or more probes comprise the same detectable label or different detectable labels with undistinguishable emission spectra and wherein the melting characteristics of each of such probes are different, each probe with double-stranded portion has a signature melting temperature, whereas single-stranded probes having no double stranded portion does not have a signature melting temperature;
- (b) performing an amplification reaction on the sample/reaction mixture under amplification conditions, wherein, when a target nucleic acid is present, the portions of probes which are substantially complementary to part of that target nucleic acid are hybridised with the target nucleic acid, therefore being consumed, wherein the consumption of probes causes changes of detectable signal in the labels, and the consumed probe are no longer able to form double stranded portion if the original probe has a double-stranded portion; and
- (c) measuring, at least once, the melting profile of the unconsumed probes in the reaction mixture by detecting the signal(s) from the labels in those probes as a function of temperature, wherein the presence or absence of a melting characteristics of any probes in the melting profile analysis is an indication of unconsumption or consumption of that probe, which further provides an indication of whether or not at least one target nucleic acid is present in said sample.
In another aspect, the invention provides a method for assaying a sample for one or more target nucleic acids, said method comprising:
- (a) contacting a sample comprising one or more target nucleic acids with a reaction mixture comprising:
- a set of two or more probes, wherein at least one probe in the set comprises a double-stranded portion,
- wherein each probe in the set comprises a detectable label or detectable combination of labels which is/are capable of producing a changeable signal which is characteristic for each probe, and
- wherein said two or more probes comprise the same detectable label or different detectable labels with undistinguishable emission spectra and wherein the melting characteristics of each of such probes are different, each probe with double stranded portion has a signature melting temperature, whereas single-stranded probes having no double stranded portion does not have a signature melting temperature;
- (b) performing the reaction on the sample/reaction mixture, wherein the reaction is a primer extension reaction under extension conditions, wherein, when a target nucleic acid is present, the corresponding probe which is extendable, is hybridised with target nucleic acid, therefore being consumed during the primer extension reaction, wherein the consumption of probes causes changes of detectable signal in the labels, and the consumed probe are no longer able to form double stranded portion if the original probe has a double-stranded portion; and
- (c) measuring, at least once, the melting profile of the unconsumed probes in the reaction mixture by detecting the signal(s) from the labels in those probes as a function of temperature, wherein the presence or absence of a melting characteristics of any probes in the melting profile analysis is an indication of unconsumption or consumption of that probe, which further provides an indication of whether or not at least one target nucleic acid is present in said sample.
In another aspect, the invention provides a method for assaying a sample for one or more target nucleic acids, said method comprising:
- (a) contacting a sample comprising one or more target nucleic acids with a hybridisation reaction mixture comprising:
- a set of two or more probes, wherein at least one probe in the set comprises a double-stranded portion,
- wherein each probe in the set comprises a detectable label or detectable combination of labels which is/are capable of producing a changeable signal which is characteristic for each probe, and
- wherein said two or more probes comprise the same detectable label or different detectable labels with undistinguishable emission spectra and wherein the melting characteristics of each of such probes are different, each probe with double stranded portion has a signature melting temperature, whereas single-stranded probes having no double stranded portion does not have a signature melting temperature;
- (b) performing the hybridisation reaction on the sample/reaction mixture under hybridisation conditions, wherein, when a target nucleic acid is present, the corresponding probes which are substantially complementary to part of that target nucleic acid are hybridised with target nucleic acid, therefore being consumed during the reaction, wherein the consumption of probes causes changes of detectable signal in the labels, and the consumed probe are no longer able to form double stranded portion if the original probe has a double-stranded portion; and
- (c) measuring, at least once, the melting profile of the unconsumed probes in the reaction mixture by detecting the signal(s) from the labels in those probes as a function of temperature, wherein the presence or absence of a melting characteristics of any probes in the melting profile analysis is an indication of unconsumption or consumption of that probe, which further provides an indication of whether or not at least one target nucleic acid is present in said sample.
In another embodiment of the present invention, said set of two or more probes may comprise at least one single-stranded probe which does not comprise a double stranded portion.
The single-stranded probe may be a double dye labeled probe which causes detectable signal changes upon hybridisation of the probe with a target nucleic acid and/or degradation of the probe.
In another embodiment of the present invention, said set of two or more probes may comprise at least two probes having double-stranded portions,
wherein a first probe has a melting temperature Tm1 in terms of its double-stranded portion,
wherein a second probe has a melting temperature Tm2 in terms of its double-stranded portion,
wherein Tm1>Tm2,
wherein the same labels are independently attached to the first and second probes,
wherein a reduction of any melting peak at Tm1 and/or Tm2 provides indication of consumption of the first and/or second probe(s).
In the above mentioned methods, the probe having double-stranded portion can be molecular beacon probe. Alternatively, the probe having double-stranded portion may comprise:
a first oligonucleotide which comprises a first region and a second region, wherein said first region is substantially complementary to part of one target nucleic acid, and
at least one second oligonucleotide which comprises a region which is substantially complementary to the second region of the first oligonucleotide,
such that the first and second oligonucleotides are capable of forming a double-stranded portion.
In any of the above methods, said melting profile may be measured before reaction/amplification takes place (pre-amplification melting profile), and/or is measured after completion of reaction/amplification (post-amplification melting profile), and/or is measured during reaction/amplification at each cycle or selected cycles (mid-amplification melting profile),
wherein said method additionally comprises step (d)
- (i) comparing at least two melting profiles obtained in (c)
- and/or
- (ii) comparing a melting profile obtained in step (c)
with a previously-obtained melting profile of the same probes or
with a melting profile of the same probes obtained in parallel at the same time in control reactions, or
with a theoretical melting profile of the same probes
- wherein a change in the melting profile provides an indication of whether or not at least one target nucleic acid is present in said sample/reaction mixture,
wherein said the pre-amplification melting profile is measured in the same reaction vessel before the start of reaction/amplification, or is measured in a separate reaction vessel where no amplification takes place due to that reaction mixture lacking one or more ingredients necessary for the reaction/amplification,
wherein in step (d) the post-amplification or mid-amplification melting profile is compared with the pre-amplification melting profile of the duplex of probes to determine whether a particular probe is consumed, this being indicative of the presence of the corresponding target in the sample.
In another embodiment, the second oligonucleotides of the probes may be physically separated from the main reaction mix containing first oligonucleotides of the probe, primers, reaction buffer, enzyme and other ingredients necessary for the amplification during the reaction, but is mixed with the main reaction mix after the completion of the amplification process, so that the melting profile can be measured. This can be done by adding the second oligonucleotides to the main reaction vessel after the reaction completion. Alternatively, a single reaction vessel may have two separate chambers, one of which accommodates the main reaction mix; another chamber contains the second oligonucleotides. After the reaction completion, the liquids of two chambers are mixed together and melting profile is measured. In this way, it is not necessary to open the reaction vessel, therefore reducing the risk of contamination.
In the methods of the present invention, at least one detectable label may be a fluorescent label, wherein step (b) further comprises the step (b1) obtaining cycle by cycle fluorescence emissions (FE) at various measuring temperatures (MT), wherein said fluorescence emissions (FE) is a baseline corrected fluorescence (dR).
In any of the methods, said amplification may be an isothermal amplification or a thermal cycling amplification reaction comprising two or more cycles of denaturing, annealing, and primer extension steps.
The consumption of probes may be achieved through hybridisation of the probe or the one oligonucleotide of the probe, to the target sequence, which is followed by the incorporation of the probe or the one oligonucleotide of the probe, into the amplified product, or wherein when the probe or the first oligonucleotide of the probe, can be incorporated into the amplified product, the probe or the first oligonucleotide of the probe is extendable primer or is one of the pair of forward/reverse oligonucleotide primers.
The consumption of probes may be achieved through hybridisation of the probe to the target sequence, which is followed by degradation of the probe or the first and/or second oligonucleotide of the probe, wherein when the probe is degraded during the reaction, the reaction mixture may comprise enzyme with nuclease activity.
In another aspect, the invention provides a kit for assaying for one or more nucleic acid targets, which kit comprises a set of two or more probes comprising:
-
- at least one probe in the set comprises a double-stranded portion,
- wherein each probe in the set comprises a detectable label or detectable combination of labels which is/are capable of producing a changeable signal which is characteristic for each probe, and
- wherein said two or more probes comprise the same detectable label or different detectable labels with undistinguishable emission spectra and wherein the melting characteristics of each of such probes are different, each probe with double-stranded portion has a signature melting temperature, whereas single-stranded probes having no double stranded portion does not have a signature melting temperature;
- or at least one single-stranded probe which does not comprise a double stranded portion, wherein said single-stranded probe is a double dye labeled probe which causes detectable signal changes upon hybridisation of the probe with a target nucleic acid and/or degradation of the probe;
- or at least two probes having double-stranded portions,
wherein a first probe has a melting temperature Tm1 in terms of its double-stranded portion,
wherein a second probe has a melting temperature Tm2 in terms of its double-stranded portion,
wherein Tm1>Tm2,
-
- wherein the same labels are independently attached to the first or/and second probes,
- wherein a reduction of any melting peak at Tm1 and/or Tm2 provides indication of consumption of the first and/or second probe(s)
In one aspect, the invention provides a method for assaying a sample for one or more target nucleic acids, said method comprising:
- (a) contacting a sample comprising one or more target nucleic acids with a reaction mixture comprising:
a set of two or more probes, wherein at least one probe having double-stranded portion may comprise
-
- a first oligonucleotide which comprises a first region and second region, wherein first region is substantially complementary to part of one target nucleic acid, and
- at least one second oligonucleotide which comprises a region which is substantially complementary to the second region of the first oligonucleotide,
- such that the first and second oligonucleotides are capable of forming a double-stranded portion of the probe,
wherein each probe comprises a detectable label or detectable combination of labels which is/are capable of producing a changeable signal which is characteristic of the presence or absence of a target nucleic acid, and
wherein at least two of the probes comprise the same detectable label or different detectable labels with undistinguishable emission spectra and wherein the melting characteristics (melting temperature Tm) of each of such probes are different, and are distinguishable in a melting profile analysis;
- (b) performing the reaction on the sample/reaction mixture, wherein the reaction is a primer extension reaction under extension conditions, wherein, when a target nucleic acid is present, the probes act as primer and are extended, therefore are consumed, wherein the first oligonucleotides of the corresponding probe which are extendable primers, are hybridised with target sequence, therefore are consumed during the primer extension reaction, wherein the consumed oligonucleotides of probes are no longer available to participate in forming double stranded portion (the duplex) of the probe; and
- (c) measuring, at least once, the melting profile of the unconsumed probes in the reaction mixture by detecting the signal(s) from the labels in those probes as a function of temperature, wherein the melting profile provides an indication of whether or not at least one target nucleic acid is present in said sample.
In this embodiment, the first oligonucleotides of probes act as primers. In a primer extension reaction, a mixture of probes is added into the reaction mixture containing all ingredients for extension under extension conditions. If a particular target nucleic acid is present in the reaction, the oligonucleotides of the corresponding probe are hybridised with target sequence, followed by extension and incorporation into the primer extension product, therefore are consumed. The consumed oligonucleotides are no longer available to participate in forming the double stranded portion of the probe. In the melting profile analysis, the consumed probe can be seen as a peak reduced or missing.
In one embodiment of the present invention, the reaction mixture may contain at least one probe which does not comprise the double-stranded portion. This kind of probe is referred to as single-stranded probe. Single-stranded probe may not show a distinguished melting profile during measuring melting profile analysis, for example one single-stranded probe may not have a distinguished melting temperature (Tm). However, a single stranded probe may have a detectable signal changes when hybridised to a target nucleic acid. During a melting profile analysis in the step (c), the consumed single stranded probe is distinguishable from the rest of probes which comprise double stranded portion. For example, during a melting profile analysis in the step (c), if a detectable signal is increased while the melting profile of the reaction mixture does not reveal a significant melting curve change, i.e. the distinct melting signature for each probes with double-stranded portions are intact, it is can be inferred that the increased signal is due to consumed single-stranded probe which does not have a signature melting profile.
In another aspect, the invention provides a method for assaying a sample for one or more target nucleic acids, said method comprising:
- (a) contacting a sample comprising one or more target nucleic acids with a hybridisation reaction mixture comprising:
a set of two or more probes, wherein at least one probe comprises
-
- a first oligonucleotide which comprises a first region which is substantially complementary to part of one target nucleic acid and a second region, and
- at least one second oligonucleotide which comprises a region which is substantially complementary to the second region of the first oligonucleotide,
- such that the first and second oligonucleotides are capable of forming a double-stranded portion,
wherein said at least one probe comprises a detectable label or detectable combination of labels which is/are capable of producing a changeable signal which is characteristic of the presence or absence of a double-stranded portion between the first and second oligonucleotides of that probe, and
wherein at least two of the probes comprise the same detectable label or different detectable labels with undistinguishable emission spectra and wherein the melting characteristics of the double-stranded portions between the first and second oligonucleotides of each of such probes are different and are distinguishable in a melting profile analysis;
- (b) performing the hybridisation reaction on the sample/reaction mixture under hybridisation conditions, wherein, when a target nucleic acid is present, the first oligonucleotides of probes which are substantially complementary to part of that target nucleic acid are hybridised with target sequence, therefore are consumed during the reaction, wherein the consumed oligonucleotides of probes are no longer available to participate in forming double stranded portion (the duplex) of the probe; and
- (c) measuring, at least once, the melting profile of unconsumed probes in the reaction mixture by detecting the signal(s) from the labels in those probes as a function of temperature,
- wherein the melting profile provides an indication of whether or not at least one target nucleic acid is present in said sample.
In one embodiment, the reaction mixture may contain at least one probe which does not comprise a double-stranded portion. The probes or the first oligonucleotides of probes may act as hybridisation probe. In a hybridisation reaction, a mixture of probes is added into the reaction mixture containing all hybridisation ingredients under hybridisation conditions. If a particular target nucleic acid is present in the reaction, the oligonucleotides of the corresponding probe are hybridised to the target sequence, therefore are consumed. The consumed oligonucleotides are no longer available to participate in forming the double stranded portion of the probe. In the melting profile analysis, the consumed probe can be seen as a peak reduced or missing.
In another aspect, the invention provides a method for assaying a sample for one or more target nucleic acids, said method comprising:
- (a) contacting a sample comprising one or more target nucleic acids with an amplification reaction mixture comprising:
- (i) one or more pairs of forward/reverse oligonucleotide primers, wherein the primer pairs are capable of amplifying one or more target nucleic acids, if present in the sample,
- (ii) a set of two or more probes, wherein at least one probe comprises
- a first oligonucleotide which comprises a first region which is substantially complementary to part of one target nucleic acid and a second region, and
- at least one second oligonucleotide which comprises a region which is substantially complementary to the second region of the first oligonucleotide,
- such that the first and second oligonucleotides are capable of forming a double-stranded portion,
- wherein said at least one probe comprises a detectable label or detectable combination of labels which is/are capable of producing a changeable signal which is characteristic of the presence or absence of a double-stranded portion between the first and second oligonucleotides of that probe, and
- wherein at least two of the probes comprise the same detectable label or different detectable labels with undistinguishable emissions spectra and
- wherein the melting characteristics of the double-stranded portions between the first and second oligonucleotides of each of such probes are different, and are distinguishable in a melting profile analysis;
- (b) performing an amplification reaction on the sample/amplification reaction mixture wherein, when a target nucleic acid is present, the first oligonucleotides which are substantially complementary to part of that target nucleic acid are hybridised with target sequence, therefore are consumed during the amplification reaction;
- (c) measuring, at least once, the melting profile of the unconsumed probes by detecting the signal(s) from the labels in those probes as a function of temperature,
- wherein the melting profile provides an indication of whether or not at least one target nucleic acid has been amplified in said sample/amplification reaction mixture.
wherein a first probe of said at least two of the probes has a melting temperature Tm1 in terms of its double-stranded portion,
wherein a second probe of said at least two of the probes has a melting temperature Tm2 in terms of its double-stranded portion,
wherein Tm1>Tm2,
wherein the same labels are independently attached to the first and second probes,
wherein a reduction of any melting peak at Tm1 and/or Tm2 provides indication of consumption of the first and/or second probe(s).
Preferably, the above method includes step (d):
-
- (i) comparing at least two melting profiles obtained in (c)
- and/or
- (ii) comparing a melting profile obtained in step (c)
- with a previously-obtained melting profile of the same probes or
- with a melting profile of the same probes obtained in parallel at the same time in control reactions, or
- with a theoretical melting profile of the same probes
- wherein a change in the melting profile provides an indication of whether or not at least one target nucleic acid has been amplified in said sample/amplification reaction mixture.
In this embodiment, the reaction mixture comprises at least one single-stranded probe which does not have a signature melting profile.
The amplification reaction can be any amplification method, such as PCR, SDA, NASBA, LAMP, 3 SR, ICAN, TMA, Helicase-dependent isothermal DNA amplification and the like. PCR is a preferred amplification method.
The amplification reaction mixture will comprise standard amplification reagents. Amplification reagents can conveniently be classified into four classes of components: (i) an aqueous buffer, often including without limitation a magnesium salt, (ii) amplification substrates, such as DNA or RNA, (iii) one or more oligonucleotide primers (normally two primers for each target sequence, the sequences defining the 5′ ends of the two complementary strands of the double-stranded target sequence when PCR is employed), and (iv) an amplification enzyme such as a polynucleotide polymerase (for example, Taq polymerase for PCR or RNA polymerase for TMA), or a ligase. Appropriate nucleoside triphosphates will also generally be required. Additional reagents or additives can also be included at the discretion of the skilled artisan and selection of these reagents is within the skill of the ordinary artisan. Of course, when the amplification reagents are used to cause both reverse transcription and amplification, then reverse transcription reagents are also included in the amplification reagents. Selection of amplification reagents, according to the method of amplification reaction used, is within the skill of the ordinary artisan.
In the methods described herein, a sample is provided which is suspected to contain the target nucleic acid or the nucleotide variant of interest. The target nucleic acid contained in the sample may be double-stranded genomic DNA or cDNA if necessary, which is then denatured, using any suitable denaturing method including physical, chemical, or enzymatic means that are known to those of skill in the art. A preferred physical means for strand separation involves heating the nucleic acid until it is completely (>99%) denatured. Typical heat denaturation involves temperatures ranging from about 80° C. to about 105° C., for times ranging from a few seconds to minutes. As an alternative to denaturation, the target nucleic acid may exist in a single-stranded form in the sample, such as single-stranded RNA or DNA viruses.
The denatured nucleic acid strands are then incubated with oligonucleotide primers and probes under hybridisation conditions, i.e. conditions that enable the binding of the primers or probes to the single nucleic acid strands. In some embodiments of the invention the annealed primers and/or probes are extended by a polymerizing agent. Template-dependent extension of the oligonucleotide primer(s) is catalyzed by a polymerizing agent in the presence of adequate amounts of the four deoxyribonucleoside triphosphates (dATP, dGTP, dCTP, and dTTP), or analogues, in a reaction medium comprised of the appropriate salts, metal cations and pH buffering system. Suitable polymerizing agents are enzymes known to catalyze primer- and template-dependent DNA synthesis. The reaction conditions for catalyzing DNA synthesis with these DNA polymerases are well known in the art. Probes are consumed during amplification.
An amplification primer can be a target-specific primer, which comprises a 3′ priming portion which is complementary to a desired region of target nucleic acid. For SNP genotyping or detecting variant nucleotides, the amplification primer may be an allele-specific primer, wherein a terminal nucleotide of the primer is selected to be either complementary to the suspected variant nucleotide or to the corresponding normal nucleotide such that an extension product of the primer is synthesised when the primer anneals to the diagnostic region containing a particular nucleotide, but no such extension product is synthesised when the primer anneals to the diagnostic region containing no particular nucleotide of the target nucleic acid sequence.
Primer pairs of forward and reverse primers are included in the amplification reaction mixture such that, if a target nucleic acid is present in the sample, the primer pairs are capable of amplifying that target nucleic acid, preferably in an exponential manner.
In some embodiments, there will be 1-50, 1-25, 1-20 or 1-10 primer pairs in the reaction mixture. In other embodiments there will be 5-50, 5-25, 5-20 or 5-10 primer pairs in the reaction mixture. As mentioned above, the forward or reverse primer in a particular primer pair might be a universal primer which is common to more than one primer pair.
The amplification reaction mixture comprises a set of two or more probes. At least one probe comprises a double stranded portion. The probe may be a molecular beacon probe or the probe may comprise two strands:
-
- a first oligonucleotide which comprises a first region and a second region, wherein the first region is substantially complementary to part of one target nucleic acid, and
- a second oligonucleotide which comprises a region which is substantially complementary to the second region of the first oligonucleotide,
- such that the first and second oligonucleotides are capable of forming a double-stranded portion of the probe.
The first oligonucleotide must be capable of binding, under appropriate hybridisation conditions, to part of at least one of the target nucleic acids. Preferably, each first oligonucleotide is specific to part of only one of the target nucleic acids. The first oligonucleotide will have a first region whose nucleotide sequence is complementary or substantially complementary to the nucleotide sequence of part of one of the target nucleic acids. The length of this first complementary region is preferably 6-100 nucleotides, more preferably 15-30 nucleotides.
The overall length of the first oligonucleotide is preferably 15-150 nucleotides, more preferably 17 to 100 nucleotides, and most preferably 20-80 nucleotides.
In some embodiments, where the reaction involves primer extension or amplification, the part of the target nucleic acid to which the first oligonucleotide is complementary must fall within or overlap with the sequence to be amplified by the forward and reverse primers. Alternatively, the first oligonucleotide can be one of the amplification primers, for example, either the forward or reverse primer. In some embodiments, the first and/or second oligonucleotide is not a forward or reverse primer.
The second oligonucleotide comprises a region which is substantially complementary to a second region of the first oligonucleotide. The length of this second region is preferably 4-100 nucleotides, more preferably 15-30 nucleotides. The second region of the first oligonucleotide may overlap or may not overlap with the first region of the first oligonucleotide.
The overall length of the second oligonucleotide is preferably 6-150 nucleotides, more preferably 10 to 100 nucleotides, and most preferably 12-80 nucleotides.
The first and second oligonucleotides may comprise 1-5 or 1-10 or more nucleotides that are not complementary to the target nucleic acid or to the first oligonucleotide, respectively, at the 5′ or the 3′ end.
The second oligonucleotides of probes may not be present in the reaction mix during the reaction process. It is possible that during the PCR amplification, only the first oligonucleotides of probes are in the reaction mix. After the completion of amplification, the second oligonucleotides of probes are added to reaction tube for melting profile analysis.
The oligonucleotide probe may comprise nucleotides, nucleotide derivatives, nucleotide analogs, and/or non-nucleotide chemical moieties. Modifications of the probe that may facilitate probe binding include, but are not limited to, the incorporation of positively charged or neutral phosphodiester linkages in the probe to decrease the repulsion of the polyanionic backbones of the probe and target (see Letsinger et al., 1988, J. Amer. Chem. Soc. 110:4470); the incorporation of alkylated or halogenated bases, such as 5-bromouridine, in the probe to increase base stacking; the incorporation of ribonucleotides into the probe to force the probe:target duplex into an “A” structure, which has increased base stacking; and the substitution of 2,6-diaminopurine (amino adenosine) for some or all of the adenosines in the probe; the incorporation of nucleotide derivatives such as LNA (locked nucleic acid), PNA (peptide nucleic acid) or the like.
Generally the 3′ terminus of the probe will be “blocked” to prohibit incorporation of the probe into a primer extension product. But in some preferred embodiments of the present invention, some probes are also working as primers and therefore are not blocked at the 3′ terminus. “Blocking” can be achieved by using non-complementary bases or by adding a chemical moiety such as biotin or a phosphate group to the 3′ hydroxyl of the last nucleotide, which may, depending upon the selected moiety, serve a dual purpose by also acting as a label for subsequent detection or capture of the nucleic acid attached to the label. Blocking can also be achieved by removing the 3′-OH or by using a nucleotide that lacks a 3′-OH such as a dideoxynucleotide.
It will be readily understood that the term “probe” refers to a plurality of that type of probes, i.e. the reaction mixture does not comprise merely a single molecule of that probe.
In some embodiments of the invention, the first region of said first oligonucleotide does not overlap or does not substantially overlap with the second region of said first oligonucleotide.
In other embodiments of the invention, the first region of the first oligonucleotide is substantially overlapping with the second region of said first oligonucleotide or the second region is embedded within the first region. In such embodiments, the Tm of the duplex of said first oligonucleotide hybridised with the target sequence is preferably higher than the Tm of the duplex of said first oligonucleotide hybridised with the second oligonucleotide such that if a target is present, the first oligonucleotide forms stronger hybrids with the target and consequently melts at a higher temperature than the first/second oligonucleotide duplex.
Preferably, said Tm of the duplex of said first oligonucleotide hybridised with the target sequence is at least 2 degrees or at least 5 degrees higher than the Tm of the duplex of said first oligonucleotide hybridised with the second oligonucleotide.
In other embodiments, the first oligonucleotide may comprise a third region which is identical or substantially identical to the sequence of a primer which is used in the amplification.
At least one probe of the present invention is capable of forming a double-stranded portion. Because of this double-stranded portion, the probe has a melting temperatures Tm and a signature melting profile. In particular, a mixture of multiple probes of the present invention also has a signature melting profile.
The melting temperature (Tm) is affected by a number of factors, including but not limited to, salt concentration, DNA concentration, and the presence of denaturants, nucleic acid sequence, GC content, and length. Typically, each probe of double stranded nucleic acids has a unique Tm. At a temperature below a given Tm at least 50% of nucleic acid duplex remains in duplex form. By contrast, at a temperature above a given Tm, over 50% of nucleic acid duplexes are expected to unwind into two single stranded oligonucleotide chains.
The Tm of any given DNA fragment can be determined by methods well known in the art. For example, one method in the art to determine a Tm of a DNA fragment is to use a thermostatic cell in an ultraviolet spectrophotometer and to measure absorbance at 268 nm as the temperature slowly rises. The absorbance versus temperature is plotted, presenting an S-shape curve with two plateaus. (See
The Tm of a probe or Tms of a mixture of multiple probes can also be determined by the nearest neighbour method and fine-tuned or accurately determined in the presence of a double stranded DNA dye or labels on the probe in a single reaction. For example, a reaction mixture containing a probe and appropriate buffer is heated from a hybridising temperature to the total denaturing temperature at a rate of 0.01° C. to 3° C. per second. At the same time, the mixture is illuminated with light at a wavelength absorbed by the dye (label) and the dye's (label's) emission is detected and recorded as an emission reading. The first negative derivative of the emission reading with respect to temperature is plotted against temperature to form a number of normal curves, and each peak of the curve corresponds to the actual Tm of the probe. The curve is also know as “melting profile” or “hybridisation/dissociation profile”. The Tm or melting profile of a probe can also be estimated by a computer program based on theory well known in the art.
For a multiplex detection, sets of multiple probes for multiple target sequences are included in a reaction. In one embodiment, the different probes in a set of probes can comprise the same labels or labels with undistinguishable emission spectra. Each probe in such a set should have different Tms, therefore enabling the individual melting profiles to be distinguished from one another. While the individual probe has a melting profile, the mixture of the multiple probes in the set also has melting profile which is characteristics for the set of the probes. The reaction mixture may comprise one single stranded probe which does not have a signature melting temperature.
In accordance with the present invention, multiple target nucleic acid sequences can be analysed in a single vessel by designing sets of probes that hybridise to different target sequences and probes have different melting temperatures in terms of the probe's internal double-stranded portions. If a target sequence is present, its corresponding probe is consumed. The sequence of the target can then be determined based on the comparison of the melting profile of the probes before and after the reactions. Advantageously, the different probes in a set can be attached with the same label, allowing for monitoring at a single emission wavelength. In one embodiment each probe in the set is attached with the same labels, for example a fluorescent energy transfer pair or contact quenching pair, and more particularly, a first label which is a fluorophore and a second label which is a quencher. On the other hand, the multiple sets of probes can be attached with different label pairs so that the sets of probes can be distinguished from one another based on the distinguishable emission spectra.
In accordance with one embodiment, the method of analysing multiple targets uses a mixture of probes that are attached with different labels that have distinguishable emission spectra as well as probes that are attached with labels that have the same or overlapping emission spectra, but are distinguishable based on differences in melting temperatures of the internal double stranded portions of the probes.
In the case of probe having double stranded portion, the probe may comprise two strands: a first oligonucleotide and a second oligonucleotide, wherein said first oligonucleotide comprises a first region substantially complementary to a target nucleic acid (see for example,
In one aspect, the first region of said first oligonucleotide is not overlapping or not substantially overlapping with second region of said first oligonucleotide (see for example
In another aspect, the first region of said first oligonucleotide is substantially overlapping with the second region of said first oligonucleotide or the second region is embedded in the first region (see for example,
In yet another aspect, the first oligonucleotide comprises a third region which is identical or substantially identical to a primer sequence (see for example,
In some embodiments of the invention, the first and second oligonucleotides are linked by a linker moiety. This linker moiety may comprise nucleotides, nucleotide derivatives, nucleotide analogs or a non-nucleotide chemical linkage, i.e. the first and second oligonucleotides might be a single stretch of contiguous oligonucleotides (
The above described probe in which first and second oligonucleotides are linked by a linker moiety can be regarded as molecular beacon probe or analogue of molecular beacon probe (see U.S. Pat. Nos. 5,925,517 and 6,10,3476, herein incorporated by reference). The reaction mixture in the present invention may comprise one or more than one such molecular beacon probes or its analogue. According to the claim 1 of U.S. Pat. No. 5,925,517, a molecular beacon probe is a signaling unitary hybridization probe useful in an assay having conditions that include a detection temperature for detecting at least one nucleic acid strand containing a preselected nucleic acid target sequence, said probe comprising: a single-stranded target complement sequence having from 10 to about 140 nucleotides, having a 5′ terminus and a 3′ terminus, and being complementary to the target sequence;
flanking the target complement sequence, a pair of oligonucleotide arms consisting of a 5′ arm sequence covalently linked to said 5′ terminus and a 3′ arm sequence covalently linked to said 3′ terminus, said pair of oligonucleotide arms forming a stem duplex 3-25 nucleotides in length, said stem duplex having a melting temperature above said detection temperature under said assay conditions; and
at least one interacting label pair, each pair comprising a first label moiety conjugated to the 5′ arm sequence and a second label moiety conjugated to the 3′ arm sequence,
said probe having, under said assay conditions in the absence of said target sequence, a characteristic signal whose level is a function of the degree of interaction of said first and second label moieties, said signal having a first level at 10° C. below said melting temperature, a second level at 10° C. above said melting temperature and a third level at said detection temperature,
wherein under the assay conditions at the detection temperature and in the presence of an excess of said target sequence, hybridization of the target complement sequence to the target sequence alters the level of said characteristic signal from said third level toward the second level by an amount of at least ten percent of the difference between the first and second levels.
The analogue of molecular beacon probe in the present invention does not require that the stem duplex having a melting temperature above said detection temperature under assay conditions.
The melting temperature of stem duplex of the analogue of molecular beacon probe in the present invention is independence of the assay temperature, since we are interested in measuring the melting profile of the probe. The melting temperatures of stem duplex of each probe are characteristic to each probe and distinguishable between probes. If the probe is consumed during the reaction, its melting profile at the end of reaction will tell the difference. The 5′ arm or 3′ arm of molecular beacon probe or its analogue may be complementary to the target sequence or may be arbitrary sequences. The 5′ arm may be labeled with at least one fluorophore, the 3′ arm may be labeled with at least one quencher.
The single-stranded probe having no double-stranded portion, the molecular beacon probe, the analogue of molecular beacon probes or the first oligonucleotide of the probe with double-stranded portion is capable of being consumed during amplification. Alternatively, both the first and second oligonucleotides of the probe with double-stranded portion are capable of being consumed during amplification. It is preferred that the first oligonucleotide is designed to be consumed, while the second oligonucleotide may remain unchanged in a reaction.
The probe may be extendable, thereby acting as a primer. Alternatively, the first oligonucleotide is blocked at the 3′ end and second oligonucleotide is blocked at the 3′ end, thereby being non-extendable.
Each probe comprises a detectable label which is capable of producing a changeable signal which is characteristic of the presence or absence of double-stranded portion of that probe.
Furthermore, at least two of the probes comprise the same detectable label(s) or different detectable labels(s) with undistinguishable emission spectra.
The label on the probe may be a fluorophore, or the probe may comprise an interactive pair of labels, for example fluorophores and/or non-fluorophore dyes. One example of such interactive labels is a fluorophore-quencher pair. The label on the probe can be located anywhere as long as it interacts with other labels or other entities such as G nucleotides.
In some embodiments, the first oligonucleotide comprises a first label and the second oligonucleotide comprises second label. Preferably, the first label is a fluorophore and the second label is a quencher, or vice versa.
In other embodiments, the probe comprises two labels, the labels being a FRET pair. Preferably one label is on the first oligonucleotide and the second label is on the second oligonucleotide. Another preferred version of probes is that the first oligonucleotide is dual labelled, the second oligonucleotide is labelled or unlabelled.
Additionally, both the first and second oligonucleotides can also comprise a plurality of label moieties. For example, the first oligonucleotide and/or the second oligonucleotide may comprise both a fluorophore and a quencher.
Typically, the fluorophore and the quencher are attached to the oligonucleotides such that when the first oligonucleotide is bound to an unlabelled template sequence (e.g., a target), the fluorophore and the quencher are separated.
Alternatively, the fluorophore and the quencher are attached to the oligonucleotides such that when the first oligonucleotide is bound to an unlabelled template sequence (e.g., a target), the fluorophore and the quencher are brought into close proximity and hence the fluorophore is quenched.
“Fluorophore” as used herein to refer to a moiety that absorbs light energy at a defined excitation wavelength and emits light energy at a different defined wavelength.
Examples of fluorescence labels include, but are not limited to: Alexa Fluor dyes (Alexa Fluor 350, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 660 and Alexa Fluor 680), AMCA, AMCA-S, BODIPY dyes (BODIPY FL, BODIPY R6G, BODIPY TMR, BODIPY TR, BODIPY 530/550, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY 630/650, BODIPY 650/665), Carboxyrhodamine 6G, carboxy-X-rhodamine (ROX), Cascade Blue, Cascade Yellow, Cyanine dyes (Cy3, Cy5, Cy3.5, Cy5.5), Dansyl, Dapoxyl, Dialkylaminocoumarin, 4′,5′-Dichloro-2′,7′-dimethoxy-fluorescein, DM-NERF, Eosin, Erythrosin, Fluorescein, FAM, Hydroxycoumarin, IRDyes (IRD40, IRD 700, IRD 800), JOE, Lissamine rhodamine B, Marina Blue, Methoxycoumarin, Naphthofluorescein, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, PyMPO, Pyrene, Rhodamine 6G, Rhodamine Green, Rhodamine Red, Rhodol Green, 2′,4′,5′,7′-Tetra-bromosulfone-fluorescein, Tetramethyl-rhodamine (TMR), Carboxytetramethylrhodamine (TAMRA), Texas Red and Texas Red-X.
As used herein, the term “quencher” includes any moiety that is capable of absorbing the energy of an excited fluorescent label when it is located in close proximity to the fluorescent label and capable of dissipating that energy. A quencher can be a fluorescent quencher or a non-fluorescent quencher, which is also referred to as a dark quencher. The fluorophores listed above can play a quencher role if brought into proximity to another fluorophore, wherein either FRET quenching or contact quenching can occur. It is preferred that a dark quencher which does not emit any visible light is used. Examples of dark quenchers include, but are not limited to, DABCYL (4-(4′-dimethylaminophenylazo) benzoic acid) succinimidyl ester, diarylrhodamine carboxylic acid, succinimidyl ester (QSY-7), and 4′,5′-dinitrofluorescein carboxylic acid, succinirnidyl ester (QSY-33), quencher 1, or “Black hole quenchers” (BHQ-1, BHQ-2 and BHQ-3), nucleotide analogs, nucleotide G residues, nanoparticles, and gold particles.
The interactive label pair can form either FRET or a contact quenching relationship. The quencher is preferably a non-fluorescent entity. The quencher may be a nanoparticle. A nanoparticle may be a gold nanoparticle. It is also possible that the quencher is a G residue or multiple G residues.
The label or combination of labels on each probe are capable of producing a changeable signal which is characteristic of each probe.
At least one label is attached to the probe or the first oligonucleotide or to the second oligonucleotide of the probe. The label either increases or decreases fluorescence emission when the first oligonucleotide is bound to the second oligonucleotide.
Preferably, the probe comprises a first label and a second label, wherein at least one label is capable of producing a detectable signal and wherein the signal strength is affected by the proximity of the two labels.
In some embodiments of the invention, the first label is attached to one strand of the double stranded portion and the second label is attached to the opposite strand of the double stranded portion of the probe such that said first label and second label are in close proximity when the probe's internal duplex is formed.
In other embodiments, the first label is attached to the first oligonucleotide, and the second label is attached to the second oligonucleotide such that said first label and second label are in close proximity when the probe's internal double-stranded portion is formed.
In some embodiments of the invention, the first oligonucleotide does not comprise a label. In other embodiments, the second oligonucleotide comprises a single label which is capable of changing fluorescence emission when hybridised with the first oligonucleotide.
In some embodiments, the first label is attached to the first oligonucleotide and the second label is attached to the second oligonucleotide such that said first label and second label are in close proximity when the probe's internal duplex is formed. Preferably, the first label is attached to the second region of the first oligonucleotide and the second label is attached to the region of the second oligonucleotide which is complementary to the second region of the first oligonucleotide such that the first and second labels are brought into close proximity upon formation of the probe's internal duplex. Examples of such embodiments are shown in
In some aspects of the invention, the first oligonucleotide of the probe does not comprise a label, but the second oligonucleotide of the probe comprises at least one, preferably two, labels.
In one embodiment of this aspect, the second oligonucleotide comprises a first label and a second label. The first label is attached at or near one end of second oligonucleotide and the second label is attached at or near the other end of the second oligonucleotide, whereby when the second oligonucleotide is not hybridised with the first oligonucleotide, the second oligonucleotide is in a random-coiled or a stem-loop structure which brings the first label and second label in close proximity. When the second oligonucleotide is hybridised with the first oligonucleotide, the two labels are held away from each other. Examples of such embodiments are shown in
As is known in the prior art, a double-labelled oligonucleotide can form a random-coiled structure when it is in single-stranded form and at certain permissive temperatures. This kind of linear oligonucleotide probes in solution behaves like a random coil: its two ends occasionally come close to one another, resulting in a measurable change in energy transfer. However, when the probe binds to its template, the probe-template hybrid forces the two ends of the probe apart, disrupting the interaction between the two terminal moieties, and thus causing a fluorescence emission change. In the present invention, this kind of a double-labelled oligonucleotide may be included in the set of two or more probes. The feature of probe having not obvious melting temperature is distinguishable from rest of probes having double stranded portion and signature melting temperatures.
A double-labelled oligonucleotide can also form a stem-loop structure known as molecular beacon. Molecular beacon probes are single-stranded oligonucleic acid probes that can form a hairpin structure in which a fluorophore and a quencher are usually placed on the opposite ends of the oligonucleotide. At either end of the probe short complementary sequences allow for the formation of an intramolecular stem, which enables the fluorophore and the quencher to come into close proximity. The loop portion of the molecular beacon is complementary to a target nucleic acid of interest. Binding of this probe to its target nucleic acid of interest forms a hybrid that forces the stem apart. This causes a conformation change that moves the fluorophore and the quencher away from each other and leads to a more intense fluorescent signal (Tyagi S. and Kramer F. R., Nature Biotechnology, Vol. 14, pages 303-308 (1996); Tyagi et al., Nature Biotechnology, Vol. 16, pages 49-53(1998); Piatek et al., Nature Biotechnology, Vol. 16, pages 359-363 (1998); Marras S. et al., Genetic Analysis: Biomolecular Engineering, Vol. 14, pages 151-156 (1999); Tpp I. et al, BioTechniques, Vol 28, pages 732-738 (2000)).
In the present invention, molecular beacon probe or its analogue probe may be included in the probe set in a reaction, where each molecular beacon probe has a signature melting temperature therefore is distinguishable during melting profile analysis.
In another embodiment, one type of the second oligonucleotides of the linear probe with double-stranded portion, which can be a molecular beacon-like oligonucleotide, is part of a double-stranded portion of a probe. The differences of this kind of probe from other probes are that the second oligonucleotide may not hybridise to the target sequence, but to the second region of the first oligonucleotide which may be unrelated to the target sequence. The second oligonucleotide may be capable of hybridising to the target sequence, but it is designed that it may not be able to hybridise to the target sequence in a real amplification reaction. The second oligonucleotide may contain sequence which is incapable of binding a target sequence strongly. During an extension and annealing step of amplification, the temperature may be too high for the second oligonucleotide to hybridise to the target sequence. While during the signal collection step, which often is carried out after an extension step, the temperature may be low, but the target sequence may be unavailable for the second oligonucleotide to hybridise, as the target sequence to be amplified may become double-stranded due to the extension of amplification primer already take place. Therefore, during signal collection step, the second oligonucleotide may only be able to hybridise to the unconsumed first oligonucleotide of the probe.
In another aspect, the first oligonucleotide does not comprise a label whereas the second oligonucleotide comprises a label. When the second oligonucleotide hybridises to the first oligonucleotide to form the double-stranded portion of the probe, the label changes its detectable signal emission relative to the emission of the label in the single-stranded form of the second oligonucleotide. This may be because either the label is brought into close proximity with a nucleotide or nucleotides in the first oligonucleotide, or the label is held away with a nucleotide or nucleotides in the second oligonucleotide.
It is known in the prior art that the emission of a fluorescence dye can be changed when in close proximity to certain nucleotides, for example a G nucleotide.
In other embodiments, the first oligonucleotide of the probe does not comprises a label, and the probe comprises two second oligonucleotides which are capable of hybridising adjacently or substantially adjacently to different parts of the second region of the first oligonucleotide, wherein one of the second oligonucleotides is attached with a first label, and the other second oligonucleotide is attached with a second label, such that when the two second oligonucleotides are hybridised to the first oligonucleotide, the two labels are brought in close proximity and one label affects the signal from the other.
This close proximity may, for example, cause either FRET or contact quenching relationship. The two second oligonucleotides that hybridise to the first oligonucleotide are part of the probe. The two labelled second oligonucleotides are designed to not hybridise to amplified target sequence, but to hybridise to the unconsumed first oligonucleotide. Examples of such embodiments are given in
In yet other embodiments, the first and second oligonucleotides of a probe are joined by a linker moiety which comprises nucleotides or a non-nucleotide chemical linker, allowing the first oligonucleotide and second oligonucleotide to form a stem-loop structure, wherein the first and second oligonucleotides are each labelled such that, when the probe forms an internal stem-loop structure, the labels are brought into close proximity and one label affects the signal from the other.
The linker may, for example, be a simple moiety of formula (CH2)n or a linker which is functionally equivalent thereto. (n is preferably 1-100 or 1-50). Preferably, the linker is an oligonucleotide which is contiguous with the first and second oligonucleotides. The loop is preferably complementary to the target sequence.
At least two of the probes in the amplification reaction mixture comprise the same detectable label or a different detectable label with undistinguishable emission spectra.
In multiplex reactions, two or more probes are used to assay for the presence of two or more target nucleic acids. This does not necessary mean, however, that different distinguishable labels are needed for each of the different probes. Each probe will have a characteristic melting profile which will be dependent on the features of its internal double-stranded portion. Therefore, provided that two or more probes have distinguishable melting characteristics, the same label(s) can be used for those probes. In other words, different probes which are labelled with the same labels or labels having undistinguishable emission spectra must have different melting characteristics, preferably different melting temperatures (Tm). These different melting characteristics will allow the individual probes to be identified and/or quantified in step (c).
As used herein, the term “melting characteristics” includes the melting profile of a probe (preferably measured by detecting the signal from the label(s) on that probe as function of temperature) and/or the melting temperature (Tm) of a probe.
When the melting characteristics of probes are said to be “different”, it will be understood that the differences are to be measured under the same or control conditions.
In some embodiments of the invention, two or more probes are labelled with the same detectable label. For example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20 or 30 or more different probes may all be labelled with the same label.
In step (b), an amplification reaction is performed on the sample/amplification (or sample/hybridisation) reaction mixture wherein, when a target nucleic acid is present, the probe which are substantially complementary to part of that target nucleic acid are consumed during the amplification reaction.
The amplification reaction can be carried out under conditions known in the art such that the probes which are substantially complementary to part of the target nucleic acid are consumed.
Preferably, the amplification comprises at least one denaturing step, at least one annealing step and at least one primer extension step.
More preferably, the amplification is a thermal cycling amplification comprising two or more denaturing, annealing, and primer extension steps.
Preferred amplification reactions include PCR, SDA, NASBA, LAMP, 3 SR, ICAN, TMA, Helicase-dependent isothermal DNA amplification and the like. PCR is a preferred amplification method. If the amplification is PCR, the conditions comprise thermally cycling the reaction.
When a target nucleic is present in the sample, at least some of the probes which are complementary to part of the target nucleic acids will hybridise thereto under appropriate reaction conditions. The probes will therefore be consumed.
The consumption of the probes is achieved through hybridisation of the probe to the target sequence, which may be followed by incorporation of the probe into the amplified product or/and degradation of the probe during the amplification step. In other words, after consumption, the probe is no longer able to reconstitute the probe of which it previously formed a part.
In an amplification reaction, in the case of probe having two strands, the probe of the present invention can be constituted by adding the first and second oligonucleotides in the reaction at any ratio of the second oligonucleotide to the first oligonucleotide, for example preferably more than 1, or may be more than 0.1 and less than 1. Thus the first and second oligonucleotides may be added to the amplification reaction mixture independently.
Depending on the type of assay and the type of label that is actually used, the signal from the probe (e.g. fluorescence emission) may either increase or decrease when the probe or the first oligonucleotide of the probe is consumed. Reference is made, for example, to the embodiments shown in
In one embodiment, the probe is extendable and acts as the forward or reverse primer. The first oligonucleotide of the probe may be one of the amplification primers, which is capable of being incorporated into an amplified product, thereby being consumed (see for example
In another embodiment of the present invention, the single-stranded probe or the first oligonucleotide of the probe having two strands is degraded during amplification. The first oligonucleotide may, for example, comprise nucleotides or non-nucleotide chemicals which are sensitive to a digestion agent. In a further example, upon hybridising to the target sequence the probe or the first oligonucleotide can be degraded by the digestion agent. For example, the probe or the first oligonucleotide can comprise RNA nucleotides. When the first oligonucleotide hybridises to the target sequence, it can be degraded by enzymes with the RNase H activity. It can be designed such that the first oligonucleotide is not able to be degraded when hybridised to the second oligonucleotide to form the double stranded portion of the probe. The first oligonucleotide can also be degraded by an exonuclease. For example, the 3′ nucleotide of the first oligonucleotide can be degraded by the 3′ exonuclease activity of a polymerase. The first oligonucleotide can also be degraded by an endonuclease, for example by a restriction enzyme upon hybridisation to a target nucleic acid.
It is preferred that the single-stranded probe or the first oligonucleotide of the probe having two strands is degraded by the 5′ exonuclease activity of a DNA polymerase, such as Taq DNA polymerase. In this embodiment, the first oligonucleotide of the probe may be blocked at the 3′ end, and hence is therefore non-extendable. The first oligonucleotide hybridises to the target sequence in the region bounded by the forward and reverse primers and can be degraded by a nuclease activity, such as 5′ exonuclease activity of Taq polymerase during PCR amplification (see for example
In yet another embodiment of the present invention, the consumption of the probe can simply be the hybridisation of the probe to the target sequence, whereby the hybridised probe is not available to form double stranded duplex of the probe (see, for example,
In yet another embodiment of the present invention, the first oligonucleotide of the probe may play a role as a nested inner amplification primer. The first oligonucleotide and an outer amplification primer anneal to the same strand of the target nucleic acid. The outer amplification primer and the first oligonucleotide may be both extended upon hybridisation to the target nucleic acid. The extension strand of the first oligonucleotide may be displaced during the extension of the outer primer if the DNA polymerase comprises a displacement activity. The extension strand of the first oligonucleotide may be degraded during the extension of the outer primer if the DNA polymerase comprises a 5′ exonuclease activity.
In some embodiments, an amplification condition can be designed such that at some stages of the amplification, even when the target is present, the probe is not consumed, whereas at other stages of the amplification the probe is consumed. For example, if the amplification is PCR, at the some thermal cycles of amplification, the probe may not be consumed, because the annealing and extension temperature are set too high for the probe to bind. The amplification thermal condition can be designed such that the probes can be consumed at some stages, or the last cycle of the amplification. For example, after thermal cycling the PCR vessels are incubated at a temperature which is set lower than either annealing and extension temperatures of the thermal cycling. This low temperature allows the probe to hybridise to the target nucleic acids, resulting in either extension or degradation of the hybridised probe.
Step (b) may further comprise the step (b1) of measuring cycle by cycle fluorescence emissions (FEs) at various measuring temperatures (MTs). The measuring temperatures (MTs) refers to the temperature at which an emission reading of the label in the probe is taken cycle by cycle to determine the emission amount of a probe.
The emission of a label on the probe is preferably obtained, detected and/or recorded in each cycle in a reaction after the reaction mixture is illuminated or excited by light with a wavelength absorbed by the label. The term “cycle by cycle” refers to measurement in each cycle. The emission reading at a measuring temperature is taken to calculate the emission amount of a remaining probe in a cycle. Emission can be detected, recorded, or obtained continuously or intermittently.
In a continuous recording process, the emission of the probe is monitored and recorded, for example, every 50 ms, every 100 ms, every 200 ms or every 1 s, in each cycle of, for example, a PCR reaction. A three dimensional plot of time, temperature and emission can be formed. In any given cycle, the emission reading at a time point that corresponds to a desired MT is taken to determine the emission amount of the probe in the cycle. In an intermittent recording process, the emission reading is taken only when the reaction temperature reaches a desired MT in each cycle.
For the probes which are consumed by incorporating into the amplified product or being degraded by a digestion agent, the obtaining of the cycle by cycle fluorescence emissions (FE) is preferably performed after the completion of the extension step at each cycle. For the probes which are consumed by being hybridised to the target sequence, the obtaining of the cycle by cycle fluorescence emissions (FE) may be performed before the completion of the extension step at each cycle.
Fluorescence emissions (FE) is used herein to refer to baseline corrected fluorescence (dR). Normally, for each well (reaction) and each optical path the raw fluorescence data are fitted over the specified range of cycles using a linear least mean squares algorithm (or other such algorithm) to produce a baseline. The value of the baseline function is calculated for every cycle and subtracted from the raw fluorescence to produce the baseline corrected fluorescence (dR).
The fluorescence intensity data (amplification plots) can be described as a two-component function: a linear component or background and an exponential component that contains the relevant information. To isolate the exponential component, the linear contribution to the fluorescence can be estimated and subtracted. It is a three-step process that is carried out for each amplification plot (i.e. each reaction and each label):
-
- 1. Identify the range of cycles during which all contributions to the fluorescence are strictly linear (no exponential increase in fluorescence).
- 2. Using the fluorescence intensity values during the cycles determined above, fit the data to a straight line (a function predicting the contribution of the linear components throughout the reaction).
- 3. Subtract the predicted background fluorescence intensity during each cycle. The resulting curve corresponds to the change in fluorescence due to DNA amplification.
When the amplification reaction mixture comprises “n” probes for multiplex detection of “n” nucleic acid targets, first probe has a melting temperature of Tm1, the second probe has a melting temperature of Tm2, the third probe has a melting temperature of Tm3, the k-th probe has a melting temperature Tmk, and the n-th probe has a melting temperature of Tmn, wherein Tm1>Tm2>Tm3 . . . >Tmk . . . >Tmn, wherein n and k are positive integers, 1≤k≤n, and n≥2.
The percentage of a probe's double-stranded form out of the total amount of probes at a particular temperature or at series temperatures may be determined experimentally or predicted which can be done by a computer program. Since the first negative derivative of a probe's melting emission with respect to temperature is plotted to form a normal distribution curve, an ordinary person skilled in the field of statistics could readily define a MT at which a percentage of the total number of a given probe is in duplex form or in single-stranded (i.e. separated) form. Accordingly, a measuring temperature is a temperature at which no more than 20%, for example, of a probe is in single-stranded form. A table may be created listing percentages of double-stranded (ds) and single-stranded forms(s) of each probe at each temperature.
A first fluorescence emission FEa can be obtained at a measuring temperature MTa, at which more than 50% of first probe is in duplex form; second fluorescence emission FEb can be obtained at a measuring temperature MTb, at which more than 50% of second probe is in duplex form; k-th fluorescence emission FEk can be obtained at a measuring temperature MTk, at which more than 50% of k-th probe is in duplex form; n−1 fluorescence emissions FE(n−1) can be obtained at a measuring temperature MT(n−1), at which more than 50% of (n−1)-th probe is in duplex form, n-th fluorescence emission FEn can be obtained at a measuring temperature MTn, at which more than 50% of n-th probe is in duplex form, and optionally a fluorescence emission FE0 can be obtained at a measuring temperature MT0, at which no more than 10% of first probe is in duplex form.
Although the above-mentioned 50% is a preferred amount of probe in the duplex form, it should be appreciated that any percentage can be used, such as 40%, 55%, 70% or 80%. It is preferred that in the step obtaining cycle by cycle a fluorescence emission FEk at a measuring temperature MTk, at which no more than 30% of (k−1)-th probe is in the probe's internal duplex form. It is even preferred that in the step obtaining cycle by cycle a fluorescence emission FEk at a measuring temperature MTk, at which no more than 20% of (k−1)-th probe is in the probe's internal duplex form.
The step (b) may further comprise the step (b2) determining cycle by cycle Actual Consumed Amount of fluorescence emission from consumed probe for each probe, wherein the Actual Consumed Amount of fluorescence emission t of k-th probe is depicted as ACAk. At a particular measuring temperature (MTa), where a probe has certain percentage (dska)% in ds (double-strand) form, the fluorescence emission FE at this measuring temperature MTa contributed by first probe will be (ds1a)%*(ACA1), contributed by the second probe will be (ds2a)%*(ACA2), contributed by the k-th probe will be (dska)%*(ACAk). For example, at 60° C. 70% of probe 1 is in ds form; at 50° C. 80% in ds. The FE contributed by the probe 1 at 60° C. will be 70%*(ACA1); FE contributed by the probe 1 at 50° C. will be 80%*(ACA1). If multiple probes are present, the FE will be the total amount contributed by consumed probes of all probes. The calculation of Actual Consumed Amount (ACA) can use the following formula:
- At temperature a, the total fluorescence emission will be
FEa=(ACA1)*(ds1a)%+(ACA2)*(ds2a)%+(ACA3)*(ds3a)% . . . +(ACAn)*(dsna)% - At temperature b, the total fluorescence emission will be
FEb=(ACA1)*(ds1b)%+(ACA2)*(ds2b)%+(ACA3)*(ds3b)% . . . +(ACAn)*(dsna)% - At temperature c, the total fluorescence emission will be
FEc=(ACA1)*(ds1c)%+(ACA2)*(ds2c)%+(ACA3)*(ds3c)% . . . +(ACAn)*(dsna)% - And so on. The individual ACA can be calculated from the above formulas. “*” denotes “multiply by”.
It is preferred that the Actual Consumed Amount of each probe is obtained though a computer program which performs the above calculation. Alternatively, the calculation can be done manually.
For example, in an amplification reaction, there are three probes for three target sequences. At temperature 65° C., 5% of the first probe is in duplex form, 0% of the second probe and 0% of third probe is in duplex form. At 60° C., 60% of the first probe is in duplex form, 5% of second probe is in duplex form, 0% of the third probe is in duplex form. At 55° C., 90% of the first probe is in duplex form, 55% of second probe is in duplex form, 5% of third probe is in duplex form. At 45° C., more than 95% of all probes are in duplex form. The first fluorescence emission is collected at 60° C., which is FE60, the second fluorescence emission is collected at 55° C., which is FE55, the third fluorescence emission is collected at 45° C., which is FE45. Optionally before the first fluorescence emission is collected, a fluorescence emission is collected at 65° C. or above, which is FE65. The FE contributed by the actual consumed amount ACA from individual probe is calculated as ds %*(ACA). See the table below:
The individual ACA can be calculated from the above formulas. If we assume 5%*ACA can be neglected. The approximate ACA can be calculated from (1), (2) and (3), where
ACA1=(EF60)/0.6
ACA2=((EF55)−0.9/0.6*(EF60))/0.55
ACA3=(EF45)/0.95−(EF60)/0.6−(EF55−(0.9/0.6)*(EF60))/0.55
As a PCR mixture undergoes thermal cycling, the fluorescence emission and actual consumed amount (ACA) are recorded (calculated) and plotted over the number of cycles to form an emission versus cycle plot. In the initial cycles, there is little change in the emission amount which appears as a baseline or a plateau in the plot. As thermal cycling continues, an increase in emission amount above the baseline may be expected to be observed, which indicates that the amplified product (or consumed probes) has accumulated to the extent that fluorescence emission of a probe in the presence of the amplified product (or consumed probe) exceeds the detection threshold of a PCR instrument. An exponential increase in emission amount initiates the exponential phase and eventually reaches another plateau when one of the components in the PCR mixture becomes limiting. The plot usually produces an S-shape curve with two plateaus at both ends and an exponential phase in the middle. In the exponential phase, the emission amount of the probe is increasing to (1+E) fold over the previous amount of each cycle, wherein E is the efficiency of amplification, which ideally should be 100% or 1. It is commonly known that the higher the starting amount of the nucleic acid template from which a product is amplified, the earlier an increase over baseline is observed. As is well known in the art, the emission versus cycle plot provides significant information for attaining the initial copy number or amount of the nucleic acid template.
As is known in the field of real-time PCR, the unknown amount of a nucleic acid template may be quantified by comparing the emission versus cycle plot of the template with standardized plots.
In one embodiment of the present invention, when a plurality of nucleic acid templates are amplified to form a plurality of amplified products, each product is preferably compared with a standard curve formed by the same product. A single product per dilution per PCR mixture can be used to form the standard curve. Preferably, at each dilution, a plurality of products are placed in a single PCR mixture and emission readings of each probe can be measured and plotted to form a standard curve based on methods described in the present invention.
The starting amount of a nucleic acid template in a sample can also be determined by normalizing the template to a house-keeping gene or a normalizer in relative relationship to a calibrator without using a standard curve.
In one embodiment of the present invention, a plurality of nucleic acid templates of interest are amplified and quantified in a single PCR mixture. The starting amount of each nucleic acid template can simultaneously be calculated and normalized to a normalizer. It is also contemplated that a plurality of nucleic acid templates and a normalizer template can be monitored and amplified in the same PCR reaction. It is further contemplated that more than one housekeeping template or normalizer can be amplified along with multiple nucleic acid templates in a single PCR reaction. It is further contemplated that the relative amount among these templates or the ratios between or among these templates can be determined from a single PCR mixture.
Step (c) comprises measuring, at least once, the melting profile of the double-stranded portions between the first and second oligonucleotides of unconsumed probes by detecting the signals from the labels in those probes as a function of temperature, wherein the melting profile provides an indication of whether or not at least one target nucleic acid has been amplified in said sample/amplification reaction mixture. This step can be performed immediately after PCR amplification if the reaction mix contains the second oligonucleotides of probes, or is done by adding the second oligonucleotides of probes, if which are not present in the reaction, into the main reaction mix, then performing the melting curve analysis.
To determine the melting (profile) curve for each probe or each set of probes, the reaction mixture is illuminated with light that is absorbed by the labels of the probes and the fluorescence of the reaction is monitored as a function of temperature. More particularly, the fluorescence of the labels is measured as the temperature of the sample is raised (or decreased) until a baseline level of fluorescence is achieved.
The data may be presented as fluorescence vs. temperature plots or as first derivative plots of fluorescence vs. temperature, for example. The two plots are interchangeable, but each focuses the viewer's attention on different aspects of the data. The melting peak (or Tm) is best viewed on derivative plots. However, the broadening of the transition and appearance of low melting transitions are easier to observe on fluorescence vs. temperature plots. The point at which there is a shift in the rate of decrease or increase of fluorescence can be more easily identified by viewing a plot of the first derivative of the fluorescence vs. temperature. The point of maximum rate of change is considered the melting temperature of the probe duplex. If one probe has a higher Tm, it forms a stronger probe duplex and will consequently melt at a higher temperature than another probe. The distinctly different melting temperatures of different probes allow identification of which probe is consumed during amplification (if the probes have the same label).
In some methods of this invention, fluorescence is monitored as a function of a denaturing gradient. Independent from the type of gradient, however, what is actually monitored is the change in fluorescence caused by the dissociation of the two strands of the double-stranded portion of the probe. The denaturing gradient may be a thermal gradient. In other words, the invention is illustratively directed to a method, characterized in that during or subsequent to the (preferably PCR) amplification, temperature dependent fluorescence is monitored. It is often desirable, however, if the monitoring of temperature-dependent fluorescence is part of a homogeneous assay format such that (PCR) amplification and monitoring temperature dependent fluorescence are carried out in the same reaction vessel without intermediate opening of the reaction chamber.
Melting profile analysis may be obtained by monitoring temperature-dependent fluorescence during melting or hybridisation. Usually, melting curve analyses are performed as slowly as possible in order to generate precise and highly reproducible data, in order to obtain an exact determination of the melting point, which is defined as the maximum of the first derivative of a temperature versus fluorescence plot. However, if the selected time parameters are comparatively short, certain advantages may be seen.
A melting profile may be measured after completion of amplification (post-amplification melting profile), and/or may be measured during amplification at each cycle or at selected cycles (mid-amplification melting profile).
In one embodiment, the temperature-dependent fluorescence is monitored after completion of a PCR reaction. In an alternative embodiment, the temperature-dependent fluorescence is monitored in real-time during a PCR reaction.
In one embodiment during said measuring, the amplified product (amplicon) remains double stranded, thereby involving little, if any, or no detectable change of signals. While in other embodiment, the measuring melting profile may be performed when some of the amplified product is in single-stranded form.
The skilled person will be able to determine, merely from the melting profile after amplification (and without comparing the melting profile with any other melting profiles) whether or not at least one target nucleic acid has been amplified. For example,
The method of the invention may further comprise a step (d)
- (i) comparing at least two melting profiles obtained in (c)
- and/or
- (ii) comparing a melting profile obtained in step (c)
with a previously-obtained melting profile of the same probes or
with a melting profile of the same probes obtained in parallel at the same time in control reactions, or
with a theoretical melting profile of the same probes,
- wherein a change in the melting profile provides an indication of whether or not at least one target nucleic acid has been amplified in said sample/amplification reaction mixture.
The melting profile may be measured before amplification takes place (pre-amplification melting profile), and/or is measured after completion of amplification (post-amplification melting profile), and/or is measured during amplification at each cycle or selected cycles (mid-amplification melting profile),
A pre-amplification melting profile of the probes may be measured in the same reaction vessel before the start of amplification, or may be measured in a separate reaction vessel where no amplification takes place due to that the reaction mixture lacking one or more ingredients necessary for the amplification. Examples of such ingredients include a dNTP, a polymerase or a target nucleic acid.
It should be noted that the method of the invention does not necessarily require the pre-amplification melting profile to be measured as part of the method of the invention. This profile might be one which is characteristic of the probe or combination of probes in question and which might have been measured previously and/or stored in a retrievable manner, for example in a computer-readable format.
Each probe in the reaction mixture will be specific for a particular target nucleic acid. Different probes are used which are labelled with the same label or labels having undistinguishable emission spectra, and the probes are selected so as to have different melting characteristics, for example different melting profiles or different melting temperatures (Tms).
The melting profile which is obtained in step (c) will be an amalgamation of the melting profiles of the probes which are present in the amplification reaction mixture. Due to the fact that different probes are selected so as to have different melting profiles, the individual contributions made by each probe to the combined melting profile will be separable by those skilled in the art, either manually or preferably by computer-implemented means. In this way, the presence or absence of particular probes, and hence the presence or absence of particular target nucleic acids in the sample, can be distinguished from one another.
Comparison of the pre- and post-amplification melting profiles of each probe may identify which feature of the curve that is a signature for a particular probe has disappeared or has been reduced, therefore indicating that that particular probe is consumed during amplification and further indicating that the corresponding target is present in the sample.
It is preferred that the comparison of the melting profiles of probes before amplification taking place and after completion of amplification or after some cycles of amplification is done by a computer program. The computer program determines which probe or how much the probe is consumed, which is indicative of which target or how much of the corresponding target is present in a sample.
The melting temperatures (Tm) of probes with the same label(s) or different label(s) with indistinguishable emission spectra will generally be different from the melting temperatures of each other similarly-labelled probe. In one embodiment, multiple probes in a set are each labelled with the same label (or different label(s) with indistinguishable emission spectra) and each probe has a distinct melting temperature range. In a multiplex assay, when a reaction temperature rises from the hybridising temperature to a denaturing temperature, the probe duplex with the lowest Tm unwinds first, the probe duplex with the next highest Tm separates next, and the probe duplex with the highest Tm denatures last. Concurrently, the fluorescent emission of the label attached to the probe changes in proportion to the rising reaction temperature due to the incremental melting of the probe duplex, hence allowing each probe to be distinguished in the combined melting profile. The shape and position of a melting curve is a function of GC/AT ratio, length, and the sequence of the double-stranded portion of the probe.
Preferably, the Tms of probes with the same label(s) or different label(s) with indistinguishable emission spectra are at least 2° C., preferably at least 3° C., 4° C. or 5° C. different from other similarly-labelled probes.
In one aspect of the present invention, real time fluorescence monitoring of a PCR reaction is used to acquire a probe's melting curves during the PCR reaction. The temperature cycles of PCR that drive amplification alternately denature the accumulating product and the labelled probes at a high temperature, and anneal the primers and at least one strand of the probe to the product at a lower temperature, thereby consuming some probes. Plotting fluorescence as a function of temperature as the sample is heated through the dissociation temperature of probe's internal double stranded portion of the remaining (unconsumed) probe gives a probe's melting curve. Thus continuous monitoring of fluorescence during a PCR reaction provides a system for detecting changes of probe concentrations by probe melting profiles. Such a system, particularly a HRM-PCR system, can be used to differentiate the remaining probes separated by less than 2° C. in melting temperature.
The invention also provides a method for monitoring a PCR amplification of at least two nucleic acid targets, said method comprising:
- (a) contacting a sample comprising one or more target nucleic acids with an amplification reaction mixture comprising:
- (i) one or more pairs of forward/reverse oligonucleotide primers, wherein the primer pairs are capable of amplifying one or more target nucleic acids, if present in the sample, and a nucleic acid polymerase,
- (ii) a set of two or more probes, wherein at least one probe comprises a double stranded portion, which can be molecular beacon probe, or which may comprise two strands:
- a first oligonucleotide which comprises a first region which is substantially complementary to part of one target nucleic acid and a second region, and
- at least one second oligonucleotide which comprises a region which is substantially complementary to a second region of the first oligonucleotide,
- such that the first and second oligonucleotides are capable of forming a double-stranded portion,
- wherein each probe comprises a detectable label which is capable of producing a changeable signal which is characteristic of the presence or absence of a double-stranded portion between the first and second oligonucleotides of that probe, and
- wherein the at least two of the probes comprise the same detectable label or different detectable labels with undistinguishable emissions spectra
- wherein the melting characteristics of the double-stranded portions of each of such probes are different;
- (b) performing an amplification reaction on the sample/amplification reaction mixture wherein, when a target nucleic acid is present, the corresponding probes which are substantially complementary to part of that target nucleic acid are consumed during the amplification reaction; and
wherein the step (b) further comprises the step (b1) obtaining cycle by cycle fluorescence emissions (FE) at various measuring temperatures (MT), wherein said fluorescence emissions (FE) are baseline corrected fluorescence (dR),
wherein when said amplification reaction mixture comprises “n” probes for multiplex detection of “n” nucleic acid targets, wherein first probe has a melting temperature of Tm1, second probe has a melting temperature of Tm2, third probe has a melting temperature of Tm3, n-th probe has a melting temperature of Tmn, wherein Tm1>Tm2>Tm3 . . . >Tmn, wherein the percentages of the double-stranded form of each probe at a particular temperature or different temperatures are determined experimentally or are calculated in theory by a computer program, wherein a first fluorescence emission FEa is obtained at a measuring temperature MTa, at which more than 50% of first probe is in duplex form, second fluorescence emission FEb is obtained at a measuring temperature MTb, at which more than 50% of second probe is in duplex form, n−1 fluorescence emission FE(n−1) is obtained at a measuring temperature MT(n−1), at which more than 50% of (n-1)th probe is in duplex form, n-th fluorescence emission FEn is obtained at a measuring temperature MTn, at which more than 80% of n-th probe is in duplex form, and optionally a fluorescence emission FE0 is obtained at a measuring temperature MT0, at which no more than 10% of first probe is in duplex form, wherein n is a positive integer and n≥2,
wherein the step (b) may further comprise the step (b2) determining cycle by cycle Actual Consumed Amount of fluorescence emission from consumed probe for each probe, wherein the Actual Consumed Amount of fluorescence emission t of k-th probe is depicted as ACAk. At a particular measuring temperature (MTa), wherein a probe has certain percentage (dska)% in ds (double-strand) form, the fluorescence emission FE at this measuring temperature MT contributed by first probe will be (ds1a)%*(ACAk), contributed by the second probe will be (ds2a)%*(ACA2), contributed by the k-th probe will be (dska)%*(ACAk). For example, at 60° C. 70% of probe 1 is in ds form; at 50° C. 80% in ds form. At 60° C. the FE contributed by the probe 1 will be 70%*(ACA1); at 50° C. FE contributed by the probe 1 will be 80%*(ACA1). If multiple probes are present, the FE will be the total amount contributed by consumed probes of all probes. The calculation of Actual Consumed Amount (ACA) can use the following formula:
- At temperature “a”, the total fluorescence emission will be
FEa=(ACA1)*(ds1a)%+(ACA2)*(ds2a)%+(ACA3)*(ds3a)% . . . +(ACAn)*(dsna)% - At temperature “b”, the total fluorescence emission will be
FEb=(ACA1)*(ds1b)%+(ACA2)*(ds2b)%+(ACA3)*(ds3b)% . . . +(ACAn)*(dsna)% - At temperature “c”, the total fluorescence emission will be
FEc=(ACA1)*(ds1c)%+(ACA2)*(ds2c)%+(ACA3)*(ds3c)% . . . +(ACAn)*(dsna)% - And so on. The individual ACA can be calculated from the above formulas.
wherein the emission amount of each probe is obtained though a computer program or is done manually.
The invention also provides a computer software product for use with the method of the invention adapted, when run on suitable data processing means, for comparing melting profiles of probes and/or quantifying a real time PCR amplification of multiplex targets which performs the calculation of the florescence emission and Actual Consumed Amount (ACA).
Generally, ACA can be calculated manually once the emission values are acquired through a PCR instrument and the percentages of the double stranded form of each probe at each temperature are known. However, it is frequently desirable to automate the calculation through the use of a computer system.
In a further embodiment, the invention relates to a computer system comprising a computer memory having a computer software program stored therein, wherein the computer software program, when executed by a processor or in a computer, performs methods according to the present invention. In a preferred embodiment, a computer program product comprises a computer memory having a computer software program stored therein, wherein the computer software program performs a method comprising the step of calculating the ACA and/or determination of features of melting profiles during amplification or at the end amplification.
As will be appreciated by those skilled in the art, a computer program product of the present invention, or a computer software program of the present invention, may be stored on and/or executed in a PCR instrument and used to calculate the amount of each probe.
The invention further provides a kit for assaying for one or more nucleic acid targets, which kit comprises a probe comprising:
-
- a first oligonucleotide of 15-150 nucleotides which comprises a first region which is substantially complementary to part of one target nucleic acid and a second region, and
- at least one second oligonucleotide of 4-150 nucleotides which comprises a region which is substantially complementary to the second region of the first oligonucleotide,
- such that the first and second oligonucleotides are capable of forming a double-stranded portion,
- wherein each probe comprises a detectable label or detectable combination of labels which is/are capable of producing a changeable signal which is characteristic of the presence or absence of a double-stranded portion between the first and second oligonucleotides of that probe,
- and wherein
- (a) the first oligonucleotide of the probe does not comprise a label, the second oligonucleotide comprises a first label and a second label, wherein the first label is attached at or near one end of second oligonucleotide and the second label is attached at or near the other end of the second oligonucleotide, whereby when the second oligonucleotide is not hybridised with the first oligonucleotide, the second oligonucleotide is in a random-coiled or a stem-loop structure which brings the first label and second label in close proximity and wherein when the second oligonucleotide is hybridised with the first oligonucleotide, the two labels are held away from each other; or
- (b) the first oligonucleotide does not comprise a label and the second oligonucleotide comprises a label, wherein when the second oligonucleotide hybridises to the first oligonucleotide to form the double-stranded portion of the probe, the label is capable of changing its detectable signal emission relative to the emission of the label when in the single-stranded form of the second oligonucleotide; or
- (c) the first oligonucleotide of the probe does not comprises a label, the probe comprises two second oligonucleotides which are capable of hybridising adjacently or substantially adjacently to different parts of the second region of the first oligonucleotide, wherein one of the second oligonucleotides is attached with a first label, and the other second oligonucleotide is attached with a second label, such that when the two second oligonucleotides are hybridised to the first oligonucleotide, the two labels are brought in close proximity and one label affects the signal from the other.
The invention also provides the use of a probe as defined in (a)-(c) above in a method of the invention.
The invention also provides the use of a probe comprising
-
- a first oligonucleotide of 15-150 nucleotides which comprises a first region which is substantially complementary to part of one target nucleic acid and a second region, and
- at least one second oligonucleotide of 4-150 nucleotides which comprises a region which is substantially complementary to the second region of the first oligonucleotide,
- such that the first and second oligonucleotides are capable of forming a double-stranded portion,
- wherein each probe comprises a detectable label or detectable combination of labels which is/are capable of producing a changeable signal which is characteristic of the presence or absence of a double-stranded portion between the first and second oligonucleotides of that probe,
- and wherein
- (a) the first label is attached to the second region of the first oligonucleotide and the second label is attached to the region of the second oligonucleotide which is complementary to the second region of the first oligonucleotide such that the first and second labels are brought into close proximity upon formation of the probe's internal duplex, or
- (b) the first and second oligonucleotides of the probe are joined by a linker moiety which comprises nucleotides or a non-nucleotide chemical linker, allowing the first oligonucleotide and second oligonucleotide to form a stem-loop structure, wherein the first and second oligonucleotides are each labelled such that, when the probe forms an internal stem-loop structure, the labels are brought into close proximity and one label affects the signal from the other,
- in a method as disclosed herein.
Another aspect of the invention is directed to a method for assaying a sample for one or more variant nucleotides on the target nucleic acids, said method comprising:
- (a) contacting a sample comprising target nucleic acids with an amplification reaction mixture comprising:
- (i) one or more pairs of forward/reverse oligonucleotide primers, wherein the primer pairs are capable of amplifying one or more target nucleic acids, if present in the sample,
- (ii) at least one pair of probes, wherein first probe in the pair comprises sequence complementary to the wild-type target nucleic acid sequence (the normal sequence), second probe in the pair comprises sequence complementary to the target nucleic acid sequence containing variant nucleotides (for example, SNP, mutated nucleotides etc), wherein each probe in the pair comprises
- a first oligonucleotide which comprises a first region which is substantially complementary to part of one target nucleic acid and a second region, and
- at least one second oligonucleotide which comprises a region which is substantially complementary to the second region of the first oligonucleotide,
- such that the first and second oligonucleotides are capable of forming a double-stranded portion,
- wherein each probe in the pair comprise the same second oligonucleotide,
- wherein each probe comprises a detectable label or detectable combination of labels which is/are capable of producing a changeable signal which is characteristic of the presence or absence of a double-stranded portion between the first and second oligonucleotides of that probe, and
- wherein at least two of the probes comprise the same detectable label or different detectable labels with undistinguishable emission spectra and wherein the melting characteristics of the double-stranded portions between the first and second oligonucleotides of each of such probes are different;
- (b) performing an amplification reaction on the sample/amplification reaction mixture wherein, when a target nucleic acid is present, the first oligonucleotides of probes which are substantially complementary to part of that target nucleic acid are consumed during the amplification reaction; and
- (c) measuring, at least once, the melting profile of any double-stranded portions between the first and second oligonucleotides of any unconsumed probes by detecting the signal(s) from the labels in those probes as a function of temperature,
- wherein the melting profile provides an indication of whether or not at least one target nucleic acid has been amplified in said sample/amplification reaction mixture.
The same second oligonucleotide in the pair of the probe may comprise universal base or Inosine which corresponds to the variant nucleotide in the target nucleic acid sequence. The universal base may be 3-nitropyrrole 2′-deoxynucleoside, 5-nitroindole, pyrimidine analog or purine analog. Inosine occurs naturally in the wobble position of the anticodon of some transfer RNAs and is known to form base pairs with A, C and U during the translation process (
For scanning multiple mutations or SNPs in a target sequence, multiple first oligonucleotides of different probes hybridising to different sites of the same amplified product may be included in a reaction. The probes may contain a competing pair of probes, the first probe in the pair hybridises to the wild-type (normal nucleotide) sequence; the second probe in the pair hybridises to target sequence containing the variant (mutated) nucleotides. When the wild-type target sequence is present, the probe complementary to the wild-type target sequence is consumed. When the target sequence having the variant nucleotide is present, the probe complementary to the variant target sequence is consumed. The multiple first oligonucleotides may hybridise to the same strand of target nucleic acid sequence adjacent to each other or with some overlapping region between adjacent first oligonucleotides (
The invention further provides a method for assaying a sample for one or more target nucleic acids, said method comprising:
- (a) contacting a sample comprising one or more target nucleic acids with an amplification reaction mixture comprising:
- (i) one or more pairs of forward/reverse oligonucleotide primers, wherein the primer pairs are capable of amplifying one or more target nucleic acids, if present in the sample,
- (ii) a set of two or more probes, wherein at least one probe in the set comprises a double-stranded portion,
- wherein at least one probe comprises two oligonucleotides: first oligonucleotides, which is also referred to as a target-hybridising oligonucleotide (THO) and second oligonucleotide, which is also referred to as a partially complementary oligonucleotide (PCO), THO and PCO are capable of hybridising to each other, forming a partially double-stranded probe, wherein each probe in the set comprises a detectable label or detectable combination of labels which is/are capable of producing a changeable signal which is characteristic for each probe, and
- wherein said two or more probes comprise the same detectable label or different detectable labels with undistinguishable emission spectra and wherein the melting characteristics of each of such probes are different, each probe with double-stranded portion has a signature melting temperature, whereas single-stranded probes having no double stranded portion do not have a signature melting temperature;
- (b) performing an amplification reaction on the sample/reaction mixture under amplification conditions, wherein, when a target nucleic acid is present, THO which are substantially complementary to part of that target nucleic acid are hybridised with the target nucleic acid, therefore being consumed, wherein the consumption of probes causes changes of detectable signal in the labels, and the consumed probes are no longer able to form a double stranded portion if the original probe has a double-stranded portion; and
- (c) measuring, at least once, the melting profile of the unconsumed probes in the reaction mixture by detecting the signal(s) from the labels in those probes as a function of temperature, wherein the presence or absence of melting characteristics of any probes in the melting profile analysis is an indication of unconsumption or consumption of that probe, which further provides an indication of whether or not at least one target nucleic acid is present in said sample.
wherein THO is complementary to a target sequence, and is labeled with a fluorophore and a quencher,
wherein PCO, which is partially complementary to THO, contains modified the 3′ end to prevent its extension, e.g. by attaching a label or a phosphate group,
wherein, if the 3′ end of PCO is attached with a label which is not quencher, for example a phosphate group, fluorescence emission is increased by hybridisation of THO and PCO, this type of probe is termed plus probe (+THO:PCO),
wherein, if the 3′ end of PCO is attached with a quencher, fluorescence emission is decreased by hybridisation of THO and PCO, this type of probe is termed minus probe (−THO:PCO).
The set of two or more probes may comprise plus probes only. Or the set of two or more probes may comprise minus probes only. Or the set of two or more probes may comprise mixed plus probes and minus primers. Or the set of two or more probes may comprise mixed single-stranded probe and plus probes or minus probes.
The consumption of probes may be achieved through hybridisation of the THO to the target sequence, which is followed by the incorporation of the THO into the amplified product, or wherein when the THO can be incorporated into the amplified product, the THO is an extendable primer or one of the pair of forward/reverse oligonucleotide primers.
The consumption of probes may be achieved through hybridisation of the THO to the target sequence, which is followed by degradation of the THO, wherein when the THO is degraded during the reaction, the reaction mixture comprises an enzyme with nuclease activity.
The set of two or more probes comprises at least two probes having double-stranded portions,
wherein a first probe has a melting temperature Tm1 in terms of its double-stranded portion,
wherein a second probe has a melting temperature Tm2 in terms of its double-stranded portion,
wherein Tm1>Tm2,
wherein the same labels are independently attached to the first and second probes,
wherein a reduction of any melting peak at Tm1 and/or Tm2 provides indication of consumption of the first and/or second probe(s).
In one embodiment, the amplification reaction mixture may comprises two related THO (probes) for assaying single nucleotide polymorphism (SNP), one THO is for one allele, second THO is for second allele. The two related THOs for assaying single nucleotide polymorphism (SNP) are capable of hybridising to the same PCO to form partially double stranded probes. The two related THOs may be attached with the same label(s). The two related THOs may differ by one nucleotide which is corresponding to the SNP. When one SNP is present as homozygous, its corresponding THO is consumed; its signature peak in the melting curve profile is disappeared or reduced. When the SNP is present as heterozygous, both THOs are consumed; the signature peaks for both alleles in the melting curve profile are disappeared or reduced.
The invention also provide a kit for assaying for one or more nucleic acid targets, which comprises a set of two or more probes according to any one of the preceding claims comprising:
-
- at least one probe in the set comprises a double-stranded portion,
- wherein said at least one probe comprises two oligonucleotides: a target-hybridising oligonucleotide (THO) and a partially complementary oligonucleotide (PCO), THO and PCO are capable of hybridising to each other, forming a partially double-stranded probe,
- wherein each probe in the set comprises a detectable label or detectable combination of labels which is/are capable of producing a changeable signal which is characteristic for each probe, and
- wherein said two or more probes comprise the same detectable label or different detectable labels with undistinguishable emission spectra and wherein the melting characteristics of each of such probes are different, each probe with a double-stranded portion has a signature melting temperature, whereas single-stranded probes having no double stranded portion do not have a signature melting temperature;
wherein THO is complementary to a target sequence, and is labeled with a fluorophore and a quencher,
wherein PCO, which is partially complementary to THO, contains modified the 3′ end to prevent its extension, e.g. by attaching a label or a phosphate group,
wherein, if the 3′ end of PCO is attached with a phosphate group, fluorescence emission is increased by hybridisation of THO and PCO, this type of probe is termed plus probe (+THO:PCO),
wherein, if the 3′ end of PCO is attached with a quencher, fluorescence emission is decreased by hybridisation of THO and PCO, this type of probe is termed minus probe (−THO:PCO),
wherein said set of two or more probes comprises plus probes only,
or said set of two or more probes comprises minus probes only,
or said set of two or more probes comprises mixed plus probes and minus primers.
or said set of two or more probes comprises mixed single-stranded probe and plus probes or minus probes.
In the kit, the set of two or more probes may comprise two related THOs (probes) for assaying single nucleotide polymorphism (SNP), one THO is for one allele, second THO is for second allele,
wherein said two related THOs are capable of hybridising the same PCO to form partially double stranded probes,
wherein said two related THOs are attached with the same label(s).
The present invention is further defined in the following Examples, in which parts and percentages are by weight and degrees are Celsius, unless otherwise stated. It should be understood that these Examples, while indicating preferred embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. The disclosure of each reference set forth herein is incorporated herein by reference in its entirety.
Example 1All primers used in the subsequent experiments were synthesized by EUROGENTEC. Amplification primers and probe are:
Primer/probe K10R266Fam (the first oligonucleotide) is labelled at the 5′ end with FAM. K10R266Dab (the second oligonucleotide) contains DABCYL at the 3′ end. K10R266Fam and K10R266Dab can form double-stranded portion as:
The above hybrid is referred to as probe K10R266. Primer/probe SV40R1F3FAM (the first oligonucleotide) is labelled at the 5′ end with FAM. SV40R1F3Dab (the second oligonucleotide) contains DABCYL at the 3′ end. SV40R1F3FAM and SV40R1F3Dab can form double-stranded portion as:
This hybrid is referred to as probe SV40R1F3.
The first oligonucleotide and the second oligonucleotide were combined at various ratios, typically 1:3 to form a partially double-stranded linear DNA probe. In the absence of target, the formation of the first and the second oligonucleotide hybrid brings the quencher and the fluorophore into close proximity, efficiently quenching the fluorescent signal. In the presence of the target, the first oligonucleotide preferentially hybridises to the target sequence and incorporates into the amplicon. As a result, the quencher is separated from the fluorophore resulting in an increase in fluorescence emission.
Primer pair K10R266Fam and K10F155 amplifies a 110 bp product in the presence of a K10 target sequence. SV40R1F3FAM and SV40RealR amplifies a 125 bp product in the presence of an SV40 target sequence.
Example 2Melting profile experiments were performed as follows: The thermal stability of the probes was characterized in melting profile experiments where fluorescence emission was measured at temperatures ranging from 40 to 90° C. Melting temperature Tm is defined as the characteristic temperature where the first and the second oligonucleotide duplex dissociate.
Each melting profile was measured in a tube in a 20 μl reaction containing PCR buffer (1× ThermoPol reaction buffer, New England BioLabs). Thermal cycling was performed in an Mx3005p quantitative PCR system (Stratagene) with the following cycling conditions: 1 cycle of denaturation at 90° C. for 3 min; 50 cycles of 30 second holding at a range of temperatures from 40 to 90° C. with a 1° C. increment per cycle. Fluorescence measurements were recorded during each 30 second hold of the 50 cycles.
Melting profiles were determined for probe K10R266 (probe 1) and probe SV40R1F3 (probe 2) by monitoring fluorescence at temperatures ranging from 90 to 40° C. K10R266 has a Tm of 72° C.; SV40R1F3 has a Tm of 62° C. (
Melting profiles were determined for a series of mixtures of probe K10R266 and probe SV40R1F3:
Sample 1 contains 0.5 μM of K10R266 and 0.5 μM of SV40R1F3.
Sample 2 contains 0.5 μM of K10R266 and 0.25 μM of SV40R1F3.
Sample 3 contains 0.5 μM of K10R266 and 0.125 μM of SV40R1F3.
Sample 4 contains 0.5 μM of K10R266 and 0.0625 μM of SV40R1F3.
Sample 5 contains 0.5 μM of K10R266 and 0.003125 μM of SV40R1F3.
The profiles are shown in
A combination of probes K10R266 and SV40R1F3 were tested in real-time PCR assays using plasmids DNA containing K10 and SV40 sequence as templates.
A master reaction mixture was made containing 0.5 μM of K10R266 and 0.5 μM of SV40R1F3 (combination of first oligonucleotide and second nucleotide in 1:3 ratio mix) and standard PCR ingredients (NEB). Amplification reactions were performed in Stratagene Mx3005 real-time PCR system with the following cycling conditions:
-
- 1. Before amplification, melting profile: 50 cycles of 30 second holding at a range of temperatures from 90 to 40° C. with a 1° C. decrement per cycle, fluorescence measurements were recorded during each 30 second hold of the 50 cycles.
- 2. Amplification: 30 cycles of 94° C. 20 s; 63° C. 30 s; 51° C. 30 s; 72° C. 30 s; fluorescence measurements were recoded during the read steps 63° C., 51° C. and 72° C.
- 3. Post-amplification melting profile: 50 cycles of 30 second holding at a range of temperatures from 40 to 90° C. with a 1° C. increment per cycle, fluorescence measurements were recorded during each 30 second hold of the 50 cycles.
Four reactions were set up: reaction 1 contains K10 template; reaction 2 contains SV40 template; reaction 3 contains both K10 and SV40 templates; reaction 4 contains no template.
The pre-amplification melting profiles for four reactions are shown in
Fluorescence emission was collected at 72° C. during amplification is shown in
Comparison of the pre-amplification and post-amplification melting profiles indicated the following:
-
- In reaction 1 the K10R266 probe is consumed and the profile is the signature of SV40R1F3 probe.
- In reaction 2 the SV40R1F3 probe is consumed.
- In reaction 3, both K10R266 and SV40R1F3 probes are consumed.
- In reaction 4, no probe is consumed and the pre- and post-amplification profiles are similar.
Cycle by cycle fluorescence emissions FE were obtained at three measuring temperatures: MT 72° C., 63° C. and 51° C.
A first fluorescence emission FE1 is obtained at a measuring temperature 63° C., at which no more than 10% of second probe (SV40R1F3) is in duplex form (the internal double-stranded form of the probe); second fluorescence emission FE2 is obtained at a measuring temperature 51° C., at which more than 95% of two probes are in duplex form, and optionally a fluorescence emission FE0 is obtained at a measuring temperature 72° C., at which no more than 10% of first probe (K10R266) is in duplex form.
In the amplification reactions there are two probes for two target sequences K10 and SV40. At temperature 72° C., 10% of the K10R266 probe is in duplex form, 0% of the SV40R1F3 probe is in duplex form. At 63° C., 90% of the K10R266 probe is in duplex form, 5% of SV40R1F3 probe is in duplex form. At 51° C., more than 98% of all probes are in duplex form.
The first fluorescence emission is collected at 63° C., which is FE1; the second fluorescence emission is collected at 51° C., which is FE2.
Assuming 5%*ACA2 is negletable, ACA1=FE1/90%; ACA2=FE2/98%−FE1/90%. ACA1 is the actual consumed amount of probe 1; ACA2 is the actual consumed amount of probe 2.
The amplification plot for the actual consumed amount of the first probe (K10) is drawn as ACA1. The amplification plot for the actual consumed amount of the second probe (SV40R1F3) is shown as ACA2 (
The calculation of the actual consumed amount can be performed manually. The calculation can also be performed through a computer program or software. To expedite the quantification, software was designed to manage emission data from the multiplex real-time PCR and perform appropriate calculations. The software had other functions, such as manual selection of the Ct and subtraction of blanks.
The software was implemented in Visual Basic for applications (VBA) as an Addin for Microsoft Excel. The source code was organized in two main modules. One module contained all the “utility” functions such as mathematical functions, functions to generate arrays from emission data present in the Excel sheets, functions to print result data and labels, functions to handle errors or template and functions to generate charts of a certain types. The second module contained the functions to control the flow of the program. This module contained all the functions making possible the interaction with the user, such as menu selections, bar slicing, inclusion/exclusion of data in the standard curve.
Example 3Amplification primers and probe are:
The oligonucleotide K10R266Fam is an amplification primer, in the same time the oligonucleotide K10R266Fam is the first oligonucleotide of the probe 1. K10R266Fam (the first oligonucleotide) is labelled at the 5′ end with FAM. K10R266Dab (the second oligonucleotide) contains DABCYL at the 3′ end. K10R266Fam and K10R266Dab can form double-stranded portion. The hybrid of K10R266Fam and K10R266Dab is referred to as probe 1.
The oligonucleotide SV40R1F3FAM is an amplification primer, in the same time the oligonucleotide SV40R1F3FAM is the first oligonucleotide of the probe 2. SV40R1F3FAM (the first oligonucleotide) is labelled at the 5′ end with FAM. SV40R1F3Dab (the second oligonucleotide) contains DABCYL at the 3′ end. SV40R1F3FAM and SV40R1F3Dab can form double-stranded portion. The hybrid of SV40R1F3FAM and SV40R1F3Dab is referred to as probe 2.
The oligonucleotide JKR3Fam is an amplification primer, in the same time the oligonucleotide JKR3Fam is the first oligonucleotide of the probe 3. JKR3Fam (the first oligonucleotide) is labelled at the 5′ end with FAM. JKR3FDabF (the second oligonucleotide) contains DABCYL at the 3′ end. JKR3Fam and JKR3FDabF can form double-stranded portion. The hybrid of JKR3Fam and JKR3FDabF is referred to as probe 3.
The first oligonucleotide and the second oligonucleotide were combined at various ratios, typically 1:2-1:4 to form a partially double-stranded linear DNA probe. In the absence of target, the formation of the first and the second oligonucleotide hybrid brings the quencher and the fluorophore into close proximity, efficiently quenching the fluorescent signal. In the presence of the target, the first oligonucleotide preferentially hybridises to the target sequence and incorporates into the amplicon. As a result, the quencher is separated from the fluorophore resulting in an increase in fluorescence emission.
Primer pair K10R266Fam and K10F155 amplifies a 110 bp product in the presence of a K10 target sequence. SV40R1F3FAM and SV40RealR amplifies a 125 bp product in the presence of an SV40 target sequence. Primers JKR3Fam and JKF2 amplifies a 222 bp product in the presence of Jak2 target sequence.
Melting profile analysis of probe 1, probe2, probe 3 and mixed probe 1, 2 and 3 were performed using the Stratagene Mx3005 real-time PCR machine (
Singleplex, doubleplex and triplex amplifications were performed using the same reaction master mix, but in the presence of one target, or two targets or all three targets.
A master reaction mixture was made containing 0.1 μM of first oligonucleotides of each of the three probes, 0.4 μM of second oligonucleotides of each of the three probes, 0.2 μM of primers (not the first oligonucleotide of probe) of each target, and standard PCR ingredients (NEB). Amplification reactions were performed in Stratagene Mx3005 real-time PCR system with the following cycling conditions:
-
- 1. Amplification: 40 cycles of 94° C. 15 s; 63° C. 20 s; 50° C. 20 s; 55° C. 20 s 63° C. 20 s; 68° C. 20 s; 72° C. 20 s; fluorescence measurements were recorded during the read steps 50° C., 55° C., 63° C., 68° C., and 72° C.
- 3. Post-amplification melting profile: after last cycle at 72° C. for 20 sec, cool to 40° C. hold for 30 second, and then slowly increase the temperature to 78° C., the fluorescence emission data is continually collected during the rising temperatures.
Eight reactions were set up: reaction (A) contains no template; reaction (B) contains target 2 template; reaction (C) contains target 3 template; reaction (D) contains target 2 and 3; reaction (E) contains target 1; reaction (F) contains targets 1 and 2; reaction (G) contains targets 1 and 3; reaction (H) contains targets 1, 2 and 3. The post-amplification melting profiles for eight reactions are shown in
Comparison of the post-amplification melting profiles in the presence of targets and without target indicated the following (
In reaction A the no probe is consumed and the melting profile is the signature of the mixture of all three probes.
In reaction B the probe 2 is consumed.
In reaction C, probe 3 is consumed.
In reaction D, probes 2 and 3 are consumed.
In reaction E, probe 1 consumed.
In reaction F, probes 1 and 2 are consumed.
In reaction G, probes 1 and 3 are consumed.
In reaction H, probes 1, 2 and 3 are consumed.
Cycle by cycle fluorescence emissions FE were obtained at five measuring temperatures:
MT 50° C., 55° C., 63° C., 68° C., and 72° C. The Actual Consumed Amount for each probe may be calculated by the formula FEa=(ACA1)*(ds1a)%+(ACA2)*(ds2a)%+(ACA3)*(ds3a)% . . . +(ACAn)*(dsna)%.
Example 4Amplification primers for target 1 (K10):
Probe for target 1 (referred to as probe 1) includes: first oligonucleotide K10R266Famph GTTCAATTGGGTTTCACCGCGCTTAGTTACA (SEQ ID NO: 7), which 5′ end is attached with Fam; 3′ end is attached with a phosphate group instead of 3′-OH; and second oligonucleotide K10R266Dab GCGCGGTGAAACCCAATTGAAC (SEQ ID NO: 2), which 3′ end is attached with DABCYL.
Amplification primers for target 2 (SV40):
Probe for target 2 (referred to as probe2) includes: first oligonucleotide SV40R1F3FAPh ATCAGCCATACCACATTTGTAGAGGTTTTAC (SEQ ID NO: 10), which 5′ end is attached with Fam; 3′ end is attached with a phosphate group instead of 3′-OH; and second oligonucleotide SV40R1F3Dab CAAATGTGGTATGGCTGAT (SEQ ID NO: 4), which 3′ end is attached with DABCYL.
The first oligonucleotide and the second oligonucleotide were combined at various ratios, typically 1:2-1:4 to form a partially double-stranded linear DNA probe. In the absence of target, the formation of the first and the second oligonucleotide hybrid brings the quencher and the fluorophore into close proximity, efficiently quenching the fluorescent signal. In the presence of the target, the first oligonucleotide preferentially hybridises to the target sequence. As a result, the quencher is separated from the fluorophore resulting in an increase in fluorescence emission.
The first oligonucleotides in probe 1 and 2 are modified to contain blocked 3′ end, so that it cannot be extended. However, when the first oligonucleotide binds to the target sequence, it can be degraded by the 5′ nuclease activity of a polymerase. The degradation of the first oligonucleotide of the probe (the consumed probes) results in decrease of the number of first oligonucleotide available to bind with the second oligonucleotides of probe, thereby increasing the fluorescence signal when measured at appropriate temperature.
Melting profile analysis of probe 1, probe2, and mixed probe 1 and 2 was performed using the Stratagene Mx3005 real-time PCR machine (
The percentages of double stranded form and single stranded form of each probe were estimated in the following table. The actual calculation can also be done by computer software.
The estimation (calculation) can be done based on the multi-component view of the dissociation curve (the Fluorescence R versus temperature,
Multiplex Real-Time PCR and Standard Curve Analysis
Primer-probe master mix was set up as follows: the primers and probes were mixed to a final concentration 0.4 μM of probes and 0.6 μM of primers, which creates a 2× primer-probe master mix.
The reaction mix was created by combining equal amount of 2× primer-probe master mix and 2× TaqMan® Gene Expression Master Mix (Applied Biosystem, cat. No 4369514).
Template DNAs containing target 1, target 2, and mixed target 1 and 2 were serially diluted as follows: 1, 0.1, 0.01, 0.001, 0.0001, 0.00001, 0.000001.
The singleplex PCRs were performed using DNA sample containing target 1 (k10) or target 2 (SV40). Doubleplex PCR was performed using DNA sample containing mixture of target 1 (k10) and target 2 (SV40).
The thermal profile was: 95° C. for 8 min 30 sec; 40 cycles of 94° C. 10 s; 66° C. 20 s; 63° C. 20 sec; 54° C. 30 s; 52° C. 20 s; 61° C. 20 s; 62° C. 20 s; 68° C. 20 s; fluorescence measurements were recoded during the read steps 66° C., 63° C., 54° C.; 52° C.; 61° C.; 62° C.; 68° C.
Fluorescence emission (dR) at 62° C. was chosen as FE1; Fluorescence emission (dR) at 52° C. was chosen as FE2. Based on the table above and the formula for calculation of Actual Consumed Amount (ACA) in the description and claims, we had followings:
At 62° C.,FE1=0.75*(ACA1)+0.05*ACA2 (1)
At 52° C.,FE2=100%*ACA1+100%*ACA2 (2)
According to (1) and (2),
ACA1=(FE1−0.05*FE2)/0.7
ACA2=(0.75*FE2−FE1)/0.7
For the doubleplex reaction where both targets are present, The FE1 and FE2 were obtained. The calculated ACAs for the target 1 were obtained using ACA1=(FE1−0.05*FE2)/0.7 The graphic presentation of the amplification plots for ACA1 is shown in
The calculated ACAs for the target 2 were obtained using ACA2=(0.75*FE2−FE1)/0.7 The graphic presentation of the amplification plots for ACA2 is shown in
If only target 1 is present in the reaction, the graphic presentation of the amplification plots for ACA1 is shown in
If only target 2 is present in the reaction, the graphic presentation of the amplification plots for ACA1 is shown in
Amplification primers for target 1 (K10):
Probe for target 1 (referred to as probe 1) includes: first oligonucleotide K10R266Famph GTTCAATTGGGTTTCACCGCGCTTAGTTACA (SEQ ID NO: 7), which 5′ end is attached with Fam; 3′ end is attached with a phosphate group instead of 3′-OH; and second oligonucleotide K10R266Dab GCGCGGTGAAACCCAATTGAAC (SEQ ID NO: 2), which 3′ end is attached with DABCYL.
Amplification primers for target 2 (SV40):
Probe for target 2 (referred to as probe2) includes: first oligonucleotide SV40R1F3FAPh ATCAGCCATACCACATTTGTAGAGGTTTTAC (SEQ ID NO: 10), which 5′ end is attached with Fam; 3′ end is attached with a phosphate group instead of 3′-OH; and second oligonucleotide SV40R1F3Dab CAAATGTGGTATGGCTGAT (SEQ ID NO: 4), which 3′ end is attached with DABCYL.
Amplification primers for target 3 (Jak2):
Probe for target 3 (referred to as probe 3) includes: first oligonucleotide JKR3FamPh AACAGATGCTCTGAGAAAGGCATTAGA (SEQ ID NO: 16), which 5′ end is attached with Fam; 3′ end is attached with a phosphate group instead of 3′-OH; and second oligonucleotide JKR3FDabF CTCAGAGCATCTGTT (SEQ ID NO: 12), which 3′ end is attached with DABCYL.
Amplification primers for target 4 (Kras):
Probe for target 4 (referred to as probe 4) includes: first oligonucleotide KR12GVFamPh GAATATAAACTTGTGGTAGTTGGAGCTGT (SEQ ID NO: 19), which 5′ end is attached with Fam; 3′ end is attached with a phosphate group instead of 3′-OH; and second oligonucleotide KR12GVFamDab CACAAGTTTATATTC (SEQ ID NO: 20), which 3′ end is attached with DABCYL.
The first oligonucleotide and the second oligonucleotide were combined at various ratios, typically 1:2-1:4 to form a partially double-stranded linear DNA probe. In the absence of target, the formation of the first and the second oligonucleotide hybrid brings the quencher and the fluorophore into close proximity, efficiently quenching the fluorescent signal. In the presence of the target, the first oligonucleotide preferentially hybridises to the target sequence. As a result, the quencher is separated from the fluorophore resulting in an increase in fluorescence emission.
The first oligonucleotides in all probes are modified to contain blocked 3′ end, so that it cannot be extended. However, when the first oligonucleotide binds to the target sequence, it can be degraded by the 5′ nuclease activity of a polymerase. The degradation of the first oligonucleotide of the probe (the consumed probes) results in decrease of the number of first oligonucleotide available to bind with the second oligonucleotides of probe, thereby increasing the fluorescence signal when measured at appropriate temperature.
Multiplex Real-Time PCR and Standard Curve Analysis
Primer-probe master mix was set up as follows: the primers and probes were mixed to a final concentration 0.4 μM of probes and 0.6 μM of primers, which creates a 2× primer-probe master mix.
The reaction mix was created by combining equal amount of 2× primer-probe master mix and 2× TaqMan® Gene Expression Master Mix (Applied Biosystem, cat. No 4369514).
The thermal profile was: 95° C. for 8 min 30 sec; 40 cycles of 94° C. 10 s; 66° C. 20 s; 63° C. 20 sec; 54° C. 30 s; 49° C. 20 s; 55° C. 20 s; 61° C. 20 s; 68° C. 20 s; fluorescence measurements were recoded during the read steps 66° C., 63° C., 54° C.; 49° C.; 55° C.; 61° C.; 68° C. Various combinations of targets present in the reaction were used.
Example 6The principles of this novel method are as follows: Firstly, for each target we design a probe consisting of two oligonucleotides: a target-hybridising oligonucleotide (THO) and a partially complementary oligonucleotide (PCO). THO and PCO are capable of hybridising to each other, forming a partially double-stranded probe (
In a multiplex PCR reaction using this system, there are at least two probes for two different targets, which are labeled with the same fluorophore. To distinguish the different probes with the same labels, each probe is designed to have a unique Tm which can be recognised in a melting curve analysis. In a proof of principle experiment, we designed two probes: one for HPV16 sequence and one for HPV18 sequence, which are both plus probes, with Tm(HPV16)=46° C. and Tm(HPV18)=37° C. (
Secondly, the target-hybridising oligonucleotide (THO) capable of hybridising to the target sequence, can be consumed during amplification. In the absence of a target, THO is not consumed, thus remains in the same concentration throughout the reaction. The melting profile of the THO:PCO hybrid does not change. In the presence of a target, the THO hybridises to the target sequences and, as a result, is consumed and therefore the concentration decreases. The melting peak of the THO:PCO hybrid is reduced or disappears in the melting curve analysis.
The key feature of consumption of THO can be achieved by any of several methods. For example, THO may be incorporated into a PCR product, where THO acts as a primer. In this study, we selected the THO to work as a TaqMan probe, which is degraded during the amplification (Holland et al. 1991). The degradation of THO, like TaqMan-based real-time PCR, results in the increase of fluorescence signal, which can be monitored during PCR. In the mean time, during the melting curve analysis, the degradation of THO results in the decrease or disappearance of its signature melting peak, indicating that the corresponding probe is being consumed, which in turn points out which target is amplified.
To test this system, we designed probes and primers for detecting the two most virulent and high risk HPV strains: HPV16 and HPV18 in a single detection channel in a real-time PCR machine. Two plus probes were designed, targeting the E6/E7 region of the HPV genome sequence (
Real time PCR was performed to test the design of the HPV16 and HPV18 probes/primers. Probe hybrids THO:PCO were pre-tested in a melting curve analysis to determine the fluorescence levels, so that when they were mixed together, they had similar heights of melting peaks (
We next determined whether more targets could be detected in a single detection channel. Four minus probes labeled with FAM dye were designed for HPV16, HPV31, HPV52 and HPV59 sequences. The probes' THOs are complementary to the conserved L1 region of the HPV genome sequences. After amplification, melting profiles were obtained. Compared against the negative control, individual HPV target sequences can be correctly distinguished. Similarly, four other minus probes labeled with HEX dye were designed, targeting the conserved L1 region of the HPV genome sequences, which could detect HPV18, HPV39, HPV58 and HPV68 sequences. Results show that these four HPV sequences can be correctly genotyped.
A combination of plus and minus probes were also tested for detecting HPV sequences. Two minus probes labeled with Texas Red dye, targeting the L1 region of HPV33 and HPV45 sequences, and one plus probe labeled with the same Texas Red dye, targeting the L1 region of HPV35 sequence were included in a PCR reaction. After PCR amplification, a melting curve analysis was performed. Compared against the no DNA control, in the presence of each target, its corresponding melting peak either reduced or disappeared. We next tested if a combination of minus probe and single-stranded probe could also be used. Two minus probes labeled with Cy5 dye, targeting the L1 region of HPV56 and HPV66 sequences, and one single stranded probe labeled with the same Cy5 dye, targeting the L1 region of HPV51 sequence were included in a PCR reaction. After PCR amplification, a melting curve analysis was performed. Compared against the no DNA control, in the presence of HPV56 or HPV66, its corresponding melting peak either reduced or disappeared. However, when the target HPV51 template was present, the melting peaks for HPV56 and HPV66 did not change, but the whole fluorescence signal increased. The increase of the whole fluorescence signal is reflected by proportionally lifting up its melting curve in comparison with the negative control. The amplification plots also show a normal amplification curve, which is due to the presence of the HPV51 sequence. This demonstrated that an individual HPV sequence can be distinguished by using a combination of multiple minus probes and one single-stranded probe.
These 14 probes (targeting the L1 region) were mixed together and used in a single PCR amplification. Of all the 14 high risk HPV sequences, individual sequences were detected and distinguishable in a one-step, closed tube reaction. Our results demonstrate that it may be possible to overcome the current one channel—one target limitation. In accordance with this method in a multiplex PCR, either real-time monitoring or end-point detection, a greater number of target sequences can be analysed in a single closed tube by designing sets of probes that hybridise to different target sequences and have different melting temperatures. If a target sequence is present, its corresponding probe is consumed. The target can then be determined based on the comparison of the melting profiles of the probes before and after the reactions. Advantageously, the different probes in a set can be attached with the same label, allowing for monitoring at a single emission wavelength. Our method provides a significant improvement over the current closed-tube multiplex PCR technology, allowing for a 2-4 fold increase in the capacity of targets being analysed in the current instruments.
In the present study, the method is useful for detecting the presence or absence of a target or multiple targets. It can be performed in an ordinary PCR machine, then genotyped for the targets by melting curve analysis. This is the closed-tube end-point detection approach. Using this method eliminates the need for an expensive real-time PCR machine, which in turn is cost saving as there is no need to pay high royalty for a real-time PCR licence. It also avoids the need to open the tube for gel analysis. If quantitative data is required, the method can be performed in a real-time PCR machine by monitoring fluorescence signal in real-time. In a single detection channel, where multiple targets are detected, the quantity of one of these targets that is present can be precisely determined. However, if more than one of these targets are present, the quantitation data is obtained collectively for the combination of the multiple targets from one detection channel, or individual quantitative data can be obtained by the method described in this invention.
Methods
The target-hybridising oligonucleotides (THOS) were synthesized with a fluorescein (FAM) label at the 5′ end and a BHQ1 at the 3′ end. The nucleotide sequence for HPV16 THO is: 5′ TTCAGGACCCACAGGAGCGACCC 3′. The nucleotide sequence for HPV18 THO is: 5′ AGCCCCAAAATGAAATTCCGGTTGACC 3′. Partially complementary oligonucleotides (PCOs) were synthesized with the same length as THOs and were attached with a phosphate group at the 3′ end. The nucleotide sequence for HPV16 PCO is: 5′ GGGTTGCTTCTGTGAGTCTTGAA 3′. The nucleotide sequence for HPV18 PCO is: 5′ GGTTAACTGGAGTTTTATTATGAGGCT 3′. A THO and PCO were combined at a ratio of 1:2 to form a partially double-stranded nucleic acid probe.
Targets were prepared by PCR amplification of the HPV16 and HPV18 sequences and cloned into a pJet vector (Clonejet PCR cloning kit, Fermentas). Plasmids were purified with Genejet plasmid miniprep kit (Fermentas). Forward and reverse primers were designed to be upstream and downstream of the probe-binding region. The sequences for HPV16 forward and reverse primers are 5′ AGACATTTTATGCACCAAAAGAGAACT 3′ and 5′ TCTGTGCATAACTGTGGTAACTTTCTG 3′, respectively. The sequences for HPV18 forward and reverse primers are 5′ GTATGCATGGACCTAAGGCAACA 3′ and 5′ TCGCTTAATTGCTCGTGACATAGA 3′, respectively. Oligonucleotides were synthesized by Eurogentec.
PCR reactions in a final volume of 25 ul consist of two equal amounts of mix: 12.5 ul of 2× FastStart Universal Probe master (Rox) (Roche Diagnostics Gmbh, Mannheim Germany) and 12.5 ul primer/probe mix. Primer/probe mix was created as follows: the primers and probes were mixed to a final concentration of 0.4 μM of probes and 0.6 μM of primers, and various amounts of target templates were added. Amplification reactions and melting profiles were performed in a Stratagene real-time PCR MX3005P system. The thermal profile was: 95° C. for 9 min 30 sec; 40 cycles of 95° C. for 20 sec and 60° C. for 60 sec. Fluorescence measurements were recorded during the read steps at 60° C. Post-amplification melting profile had the following conditions: after the last cycle of PCR, heat at 95° C. for 10 sec, cool to 30° C. and hold for 30 sec, then slowly increase the temperature to 80° C. The fluorescence emission data is continually collected during the rising temperatures. The first negative derivative of the emission reading, with respect to temperature, is plotted against the temperature to form melting curves, and the peak of the curve corresponds to the Tm of the probe.
SEQUENCE LISTING FREE TEXT
- SEQ ID NOs: 1, 2, 5, 7 and 21 <223> K10 derived PCR primer
- SEQ ID NOs: 3, 4, 6 and 8-10 <223> SV40 derived PCR primer
- SEQ ID NOs: 11-16 <223> Jak2 derived PCR primer
- SEQ ID NOs: 17-20 <223> Kras derived PCR primer
Claims
1. A kit for assaying for one or more nucleic acid targets, the kit comprising a set of two or more probes comprising:
- wherein at least two probes in the set each comprise a double-stranded portion, wherein said at least two probes each comprise two oligonucleotides: a target-hybridising oligonucleotide (THO) and a partially complementary oligonucleotide (PCO), THO and PCO are capable of hybridising to each other, forming a partially double-stranded probe, wherein each probe in the set comprises a detectable label or detectable combination of labels which is/are capable of producing a changeable signal which is characteristic for each probe, and
- wherein said at least two probes comprise the same detectable label or different detectable labels with undistinguishable emission spectra and wherein the melting characteristics of each of such probes are different, each probe with a double-stranded portion has a signature melting temperature, whereas single-stranded probes having no double stranded portion do not have a signature melting temperature;
- wherein THO is complementary to a target sequence, and is labeled with a fluorophore and a quencher,
- wherein PCO, which is partially complementary to THO, contains a modification to the 3′ end to prevent its extension,
- wherein, the 3′ end of a first PCO is attached with a label which is not a quencher, wherein fluorescence emission is increased by hybridisation of THO and PCO, thereby forming a plus probe (+THO:PCO),
- wherein, the 3′ end of a second PCO is attached with a quencher, wherein fluorescence emission is decreased by hybridisation of THO and PCO, thereby forming a minus probe (−THO:PCO),
- wherein said set of two or more probes comprises
- a mixture of plus probes and minus probes.
2. The kit according to claim 1, wherein said set of two or more probes comprises two probes for assaying a single nucleotide polymorphism (SNP), wherein each probe of said two probes is comprised of a THO wherein a first THO hybridizes to a first allele of a gene, and a second THO hybridizes to a second allele of said gene, wherein said first THO and said second THO are capable of hybridising to two identical PCOs wherein each THO and PCO pair forms a partially double-stranded probe and wherein said first THO and said second THO are attached with identical label(s).
3. The kit according to claim 1 or 2 wherein said modification to the 3′ end comprises a label or a phosphate group.
| 5210015 | May 11, 1993 | Gelfand et al. |
| 5487972 | January 30, 1996 | Gelfand et al. |
| 5925517 | July 20, 1999 | Tyagi et al. |
| 5928862 | July 27, 1999 | Morrison |
| 6103476 | August 15, 2000 | Tyagi et al. |
| 6117635 | September 12, 2000 | Nazarenko et al. |
| 6140054 | October 31, 2000 | Wittwer et al. |
| 6174670 | January 16, 2001 | Wittwer et al. |
| 6326145 | December 4, 2001 | Whitcombe et al. |
| 6472156 | October 29, 2002 | Wittwer et al. |
| 6635427 | October 21, 2003 | Wittwer et al. |
| 20030224434 | December 4, 2003 | Wittwer et al. |
| 20040023207 | February 5, 2004 | Polansky |
| 20040229253 | November 18, 2004 | Hyldig-Nielsen et al. |
| 20050053950 | March 10, 2005 | Zudaire Ubani et al. |
| 20050227257 | October 13, 2005 | Abravaya et al. |
| 20060188902 | August 24, 2006 | Narayanan et al. |
| 20080064033 | March 13, 2008 | Hanner et al. |
| 20110207131 | August 25, 2011 | Fu |
| 20120164645 | June 28, 2012 | Fu |
| 20130267434 | October 10, 2013 | Fu |
| 2005061734 | July 2005 | WO |
| 2006044994 | April 2006 | WO |
| 2007045890 | April 2007 | WO |
| WO 2008/043987 | April 2008 | WO |
| WO 2008044129 | April 2008 | WO |
| WO 2008/104791 | September 2008 | WO |
| WO 2010/013017 | February 2010 | WO |
| 2010139937 | December 2010 | WO |
| WO 2012/056227 | May 2012 | WO |
- Pearson et al., “Improved tools for biological sequence comparison,” Proc. Natl. Acad. Sci. USA, 1988; 85(8):2444-8.
- Devereux et al., “A comprehensive set of sequence analysis programs for the VAX,” Nucleic Acids Res. 1984; 12(1Pt 1):387-95.
- Cairns et al. Biochem. Biophys. Res. Commun. 318:684-90, 2004.
- Chen et al., Appl. Environ. Microbiol. 64:4210-6, 1998.
- Housni et al: “Single-Nucleotide Polymorphism Genotyping by Melting Analysis of Dual-Labeled Probes: Examples Using Factor V Leiden and Prothrombin 20210A Mutations”, Clinical Chemistry, vol . 49, No. 10, Oct. 1, 2003, pp. 1669-1672.
- Huang S et al. (2007) Thermodynamically modulated partially double-stranded linear DNA probe design for homogeneous real-time PCR Nucleic Acids Res_ 35(16):e101_.
- Lee et al., Nucleic Acids Res. 21:3761-6, 1993.
- Letsinger et al., 1988, J. Amer. Chern. Soc. 110:4470.
- Li et al., Nucleic Acids Research, vol. 30, No. 2, e5 (2002).
- Livak et al. (1995) “Oligonucleotides with Fluorescent Dyes at Opposite Ends Provide a Quenched Probe System Useful for Detecting PCR Product and Nucleic Acid Hybridization,” PCR Methods and Applications 4: 357-362_.
- Luk et al. (2007) “Partially double-stranded linear DNA probes: Novel design for sensitive detection of genetically polymorphic targets,” Journal of Virological Methods 144(1-2), 1-11_.
- Marras et al. (2002) Efficiencies of fluorescence resonance energy transfer and contact-mediated quenching in oligonucleotide probes_ Nucleic Acids Res_ 30(21 ):e122_.
- Marras S. et al., Genetic Analysis: Biornolecular Engineering, vol. 14, pp. 151-156 (1999).
- Morrison L. et al., Anal. Biochem., vol. 183, pp. 231-244 (1989).
- Nazarenko et al., Nucleic Acids Res. 25:2516-21, 1997.
- Piatek et al., Nature Biotechnology, vol. 16, pp. 359-363 (1998).
- Tapp I. et al, BioTechniques, vol. 28, pp. 732-738 (2000).
- Todd et al., Clin. Chem. 46:625-30, 2000.
- Tyagi et al., Nature Biotechnology, vol. 16, pp. 49-53 (1998).
- Tyagi S. and Kramer F. R., Nature Biotechnology, vol. 14, pp. 303-308 (1996).
- Whitcombe et al., Nat. Biotechnol. 17:804-7, 1999.
- Wittwer et al., Biotechniques 22: 130-1, 134-8, 1997.
- PCT/GB2011/052068 Intenational Search Report and Written Opinion dated Sep. 20, 2012 (27 pages).
- Fu et al., “Multiplex Detection and SNP Genotyping in a Single Fluorescence Channel,” PLoS One. 2012;7(1):e30340, 1-8.
- Fiandaca et al., “Self-reporting PNA/DNA primers for PCR analysis”, Genome Research 11: pp. 609-613 (2001).
- Bengra et al., “Genotyping of essential hypertension single-nucleotide polymorphisms by a homogeneous PCR method with universal energy transfer primers.” Clinical Chemistry. 2002 Dec 1;48(12):2131-40.
- United States Patent Office Final Rejection for Application No. 141992369, dated Jun. 13, 2019, 10 pages.
Type: Grant
Filed: Mar 14, 2016
Date of Patent: Sep 3, 2019
Patent Publication Number: 20160289751
Assignee: OXITEC LTD (Abingdon)
Inventor: Guoliang Fu (Abingdon)
Primary Examiner: Kaijiang Zhang
Application Number: 15/069,114
International Classification: C12Q 1/68 (20180101); C40B 40/06 (20060101); C12Q 1/6851 (20180101); C12Q 1/6858 (20180101); C12Q 1/6876 (20180101); C12Q 1/686 (20180101);