Phage-based detection of borreliosis and means therefor
This invention relates to methods of detecting Borrelia burgdorferi sensu lato or for detecting Borrelia associated with Relapsing Fever (RF), kits for carrying out such methods, and methods of treating Borrelia burgdorferi sensu lato or RF infections in a subject. Uses of phage specific for Borrelia are also provided.
Latest UNIVERSITY OF LEICESTER Patents:
This invention relates to methods of detecting Borrelia burgdorferi sensu lato or for detecting Borrelia associated with Relapsing Fever (RF), kits for carrying out such methods, and methods of treating Borrelia burgdorferi sensu lato or RF infections in a subject. Uses of phage specific for Borrelia are also provided.
BACKGROUNDBorrelia burgdorferi sensu lato (s.l.) is a group of bacterial species of the Borrelia genus of the spirochete phylum, and that are known to be the causative agent in Lyme Disease (LD). Among them, three main species that are commonly found in Lyme patients in Europe are B. burgdorferi sensu stricto (s.s.), B. afzelii, and B. garinii. While B. burgdorferi s.s. causes LD both in the USA and in Europe. The other less commonly encountered LD species include Borrelia spielmanii, Borrelia valaisiana, Borrelia bissettii, Borrelia lusitaniae, Borrelia finlandensis, Borrelia bavariensis, Borrelia japonica, Borrelia sinica, Borrelia spielmanii, Borrelia tanukii, Borrelia turdi, Borrelia Yangtze, Borrelia mayonii, Borrelia carolinensis, Borrelia andersonii, Borrelia lonestari, and Borrelia Americana.
Bacteria that cause LD are spread to humans through the bite of bacterially infected ticks (and less frequently through other insects). It is the most commonly reported tick-born disease in the United States, and Centres for Disease Control and Prevention (CDC) records approximately 30 000 confirmed cases of LD annually. However, the number of suspected Borrelia infection is around 300 000 every year according to CDC. In Europe, the number of LD cases has increased steadily over the last two decades, with an estimation of about 85 000 cases every year. In England and Wales, it is estimated that around 3,000 new cases of LD are diagnosed each year.
Clinical diagnosis of LD is often problematic because the symptoms of LD are easily confused with other diseases. The manifestations of infection can range from a distinctive rash, tiredness, muscle pain, headaches, to severe arthritic, neurologic and cardiac conditions. Consequently, lab-based determination of Borrelia infection plays a vital role in LD diagnosis. Current lab-based diagnostic methods focus on indirectly determining the presence or absence of the bacteria in the body of the patient based on the human immune response to that bacterium. The current method of direct detection of Borrelia presence in patient suffers from low sensitivity, and therefore is regarded as of no diagnostic value.
A first problem associated with all known methodologies is as a result of the fact that the bacteria are only easily accessible from blood samples during the early stages of infection. In later stages of infection, the bacteria tend to migrate to the nervous system, where they can remain sequestered and so difficult to locate and identify with conventional diagnostic tools. Consequently, identification of infection in the later stages by attempting to detect the presence of the bacteria often has to involve the analysis of cerebrospinal fluid or the like, rather than the simpler analysis of blood samples.
The current “gold standard” technique for identifying presence of the bacteria involves growing a suspended bacterial culture from a sample from an individual suspected of contracting Lyme disease, and later characterising the bacteria in that culture. Often the characterisation is based on microscopy evaluation of morphological features of the bacteria. However, growing cultures takes up to 7 weeks before a sufficiently large and developed cultured population has been obtained from which to confirm the presence of the bacteria. Even then, such tests may not enable differentiation between Lyme disease and other tick-borne bacterial infections. For example, the bacteria associated with Relapsing Fever (RF) are morphologically similar to the bacteria that cause LD. LD and RF also have overlapping clinical symptoms. Consequently, a patient may be diagnosed as suffering from LD by this method, when in fact they suffer from RF; this being a problem as treatment methodologies may differ for each disease.
A second diagnostic methodology involves antibody based procedures. Antibodies (i.e. diagnostic antibodies) specific for the infected host's own antibodies that are raised as part of the immune response within the host to the infection (i.e. immune response antibodies) are used to detect the presence or absence of the infection. Unfortunately, however, such antibody based methodologies have only a short window of opportunity to accurately identify the presence of the infection. During the early stage of LD (2-3 weeks post infection), the antibody response in the host as part of their own immune reaction to infection is not normally sufficiently developed to be clearly detected by the diagnostic antibodies. In later stage LD, the production of immune response antibodies is suppressed by the bacteria, and so again the antibody signal may be too weak to be detected with a reasonable degree of accuracy. Consequently, antibody-based diagnostic methods are estimated to falsely identify 54% of patients as un-infected.
The third known diagnostic method involves the PCR-based detection of the bacteria. Due to the often extremely low concentration of the relevant bacteria in a patient's sample, such methods have a poor level of sensitivity. It has been calculated that only one third of patients suffering from LD in the USA showed a positive PCR result when their Cerebrospinal fluid samples were tested. Half of patients in the early stage of LD showed a negative PCR-derived result for the presence of the bacteria in blood samples.
As an example of current difficulties with diagnosing and treating LD, the veterinary profession report that tests used by them and based on the use of diagnostic antibodies commonly provides large number of false positive results for Borrelia burgdorferi sensu lato infection in horses. As a result, it is generally accepted that a large number of horses are needlessly treated with antibiotics such as oxytetracyline.
Consequently, there is a need for alternative methods of detecting the presence of Borrelia burgdorferi s.l., the causative agent of LD. Because of the similar difficulties faced with diagnosing relapsing fever (RF) which is also caused by Borrelia species and is often wrongly diagnosed as LD and vice versa, there is also a need for alternative methods of detecting the presence of Borrelia which are the causative agents of Relapsing Fever (herein referred to as Relapsing Fever Borrelia (RF Borrelia) such as Borrelia miyamotoi and Borrelia hermsii.
SUMMARY OF THE INVENTIONBacteriophages (or phages) are viruses that can infect and multiply in a bacterium. Commonly they consist of a core of nucleic acid enclosed within a protein coat (i.e. the capsid). Phage that infect Borrelia burgdorferi s.l. and RF Borrelia are very poorly understood. The lack of research effort/output concerning Borrelia phages is mainly due to the following two hurdles. Firstly, growing Borrelia strains in vitro needs a complicated medium to mimic their in vivo conditions. This coupled with the demand for highly skilled, ‘purpose-trained’ scientists, who need to possess a good level of specialist knowledge concerning both Borrelia and phages, means that the academic output concerning Borrelia phages has been inhibited. Secondly, the commonly used phage characterisation methods, such as plaque assays, can't be simply translated into a Borrelia phage study because Borrelia have not previously been observed to grow on a solid agar surface to form a confluent cell growth on which phages could be observed. The inventors consider that they are the first to consistently grow viable lawns of Borrelia, on which a study of Borrelia phage can be conducted.
For an agent to be suitable for use in detecting the presence or absence of a bacterial infection, the agent should be capable of specifically identifying the bacteria associated with the infection. Advantageously, that agent should also be able to detect the bacterial infection in the least invasive manner possible. Phage have to-date not been suggested as useful in identifying the presence or absence of B burgdorferi s.l. infection. Even if they had, due to the limited understanding of phage that are known to infect B. burgdorferi s.l, there has been insufficient information to determine if phage could be used in such a diagnostic method. The art has continued to develop all relevant diagnostics by directing methodologies to the direct identification of the bacteria, or identification of immune response antibodies directly raised against the bacteria.
However, after extensive experimentation, it has surprisingly been found by the inventors that phage can be found that are specific to their B. burgdorferi s.l. or Relapsing Fever Borrelia host. As a result, successful methodologies have been provided for identifying infection of such bacteria and based on identifying the presence or absence of such phage.
Relapsing Fever Borrelia are any Borrelia species which are the causative agents of Relapsing Fever, for example, Borrelia miyamotoi, Borrelia hermsii, Borrelia recurrentis, Borrelia crocidurae, Borrelia duttoni, Borrelia hispanica, Borrelia parkeri and Borrelia turicatae or any combination thereof.
Therefore, in a first aspect of the present invention, there is provided a method of determining the presence or the absence of B. burgdorferi s.l. or RF Borrelia in a sample, the method comprising the steps of:—
-
- a) detecting the presence or absence of a phage specific for B. burgdorferi s.l or RF Borrelia in the sample; and
- b) determining the presence of B. burgdorferi s.l. or RF Borrelia in the sample on the basis of the detection of the phage, or the absence of B. burgdorferi s.l. or RF Borrelia in the sample on the basis of the lack of detection of the phage.
The inventors have surprisingly found that B burgdorferi s.l. and RF Borrelia even those in sequestered states, dispense large numbers of phage. Consequently, for example, even when the bacteria are sequestered and so difficult to detect with little or no bacteria to be found in the blood, a blood sample from an infected subject does contain large numbers of phage or phage fragments originating from the bacteria. Consequently, a particularly advantageous aspect of the present invention is that the methods of the present invention can be practiced on a non-neuronal sample such as blood sample (e.g. whole blood, serum, plasma), urine sample, faecal sample, skin sample, lymph sample, or combinations thereof and still provide useful conclusions on the presence of absence of bacterial infection irrespective of the stage of infection; something that is not possible with known diagnostic methodologies.
Phage Specific for Borrelia burgdorferi Sensu Lato or RF Borrelia
The inventors have found that phylogenetic analysis of for example the terminase genes of the phage revealed a tight correlation between the terminase gene sequences and the identity of Borrelia species (
The same analysis has been carried out for other phage genes. For example, holins and endolysins. Phylogentic analyses based on holins (
Specificity can therefore be defined as a method which distinguishes between the phage of B. burgdorferi s.l. and the phage from other Borrelia species. For example, a nucleotide primer or antibody which binds preferentially to the phage of B. burgdorferi sensu lato; or does not cross-react with a nucleotide sequence or amino acid sequence from another Borrelia species. The method also may distinguish between the phage of RF Borrelia and the phage from other species.
Phage
A bacteriophage, also commonly called a phage, is a virus which infects and replicates within a bacterium. The phages described herein can be pro-phages, temperate/lysogenic phages, phage-like particles (such as plasmids) or lytic phages.
A prophage/temperate/lysogenic phage is a bacteriophage particle made of either double or single strand DNA or RNA. Phage genomes can be inserted and integrated into the circular bacterial DNA chromosome or existing as an extrachromosomal plasmid. This is a latent form of a phage, in which the viral genes are present in the bacterium without causing disruption of the bacterial cell and sometimes may provide competitive advantage to the overall fitness of the bacterial host.
A lytic or virulent phage contains viral DNA/RNA which exists separately from the host bacterial DNA and replicates separately from the host bacterial DNA. Lytic phage are released upon destruction of the infected cell and its membrane.
Sample
The sample may be derived from a number of origins. The sample may therefore comprise or consist of plasma, serum, whole blood, cerebrospinal fluid, urine, faecal matter, skin, brain tissue, glial cells, lymph, sweat or amniotic fluid, or any combination thereof.
A sample may therefore be one that is taken from the subject at any time after infection and consistently provide the correct determination of the presence of the infection. Most surprisingly, the sample may be obtained shortly after infection (i.e. early stage infection), or after the infection has been well developed and that bacteria have become sequestered (i.e. late stage infection). This demonstrates a technical advantage associated with the present invention over known methodologies. Early stage infection would generally be considered to be less than 2 or 3 weeks from infection. Late stage infection would generally be considered to occur when the infected subject begins to suffer from neurological disorders (i.e. brain fog), which can be from 6 months after infection.
The subject from which the sample may be obtained is any animal that suffers from LD or RF. For example, the subject may be human, equine, canine, feline, ovine, caprine, ticks, lice, or any combination thereof. The subject may therefore be human, insect or animal.
Detection of Phage
By detection is meant determining if an interaction between the phage and a detection molecule specific for Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia, for example a primer or antibody specific for a phage nucleic acid or protein respectively, is present or absent. These methods may be carried out ex vivo or in vitro. Detection may also be in vivo, for example via a dye probe.
The detection molecule which specifically binds the phage specific for the Lyme or RF Borrelia may be tagged or labelled. For example, detection may include the use of an agent which is capable of detection (a label) using for example spectrophotometry, flow cytometry, or microscopy. Exemplary labels include radioactive isotopes (such as 3H, 14C, 15N, 35S, 90V, 99Tc, 111Ln, 125I, or 131I), fluorophores (such as fluorescein, fluorescein isothiocyanate, rhodamine or the like), chromophores, ligands, chemiluminescent agents, bioluminescent agents (such as luciferase, green fluorescent protein (GFP) or yellow fluorescent protein), enzymes that can produce a detectable reaction product (such as horseradish peroxidise, luciferase, alkaline phosphatase, beta-galactosidase) and combinations thereof.
Phages can also be labelled with any DNA dye, such as SYBR Green, SYBR Gold, EB. The next generation sequencing technologies, such as short-read sequencing technologies (e.g. 454, IIlumina, SOLiD and Ion Torrent) and long-read sequencing technology (e.g. PacBio sequencing) can also be used in identifying phage via whole genome sequencing.
Detection of Phage Nucleic Acid
Detection of the phage may comprise detection of the phage gene or gene fragment.
The phage gene may be defined by a nucleic acid sequence for the region of a phage genome that is specific to a B burgdorferi s.l. host in the case of Lyme disease diagnosis (i.e. the nucleic acid sequence is, or is part of, a phage gene that is found in only the target host, e.g. B. burgdorferi s.l., or in a phage specific for such a host, or part thereof). Alternatively, the phage gene may be defined by a nucleic acid sequence for the region of a phage genome that is specific to a RF Borrelia host in the case of RF diagnosis (i.e. the nucleic acid sequence is, or is part of, a phage gene that is found in only the target host, e.g. RF Borrelia or in a phage specific for such a host, or part thereof).
The applicant has found that a suitable phage gene is the gene that encodes the holin, endolysin, integrase, capsid, portal or terminase protein, or combinations thereof.
The following describes nucleic acid sequences specific to B. burgdorferi s.l. phage.
For example, the phage gene may be the B. burgdorferi s.l. terminase gene, when this is the case the gene may be a nucleic acid according to the sequence of SEQ ID NO.s 1-10 or a gene capable of encoding a protein according to the sequence of SEQ ID NO.s 36-45. Optionally, the terminase gene may be a nucleic acid with a greater than or equal to 70-100% sequence homology with SEQ ID NO.s 1-10 or a gene capable of encoding a protein with a greater than 70-100% sequence homology with SEQ ID NO.s 36-45. For example, greater than or equal to 70, 75, 80, 85, 90 or 95, 96, 97, 98, 99 or 99.5% sequence homology with SEQ ID NO.s 1-10 or 46-45. With regards to homologous genes and proteins, preferably these retain the function of the terminase.
Alternatively or additionally, the phage gene may be the holin (SEQ ID NO.s 17-25), endolysin (SEQ ID NO.s 26-34), integrase (SEQ ID NO.16), capsid and/or portal (SEQ ID NO. 11-15) gene(s). Alternatively, the phage gene may be a gene capable of encoding a holin protein according to the sequence of SEQ ID NO.s 52-60 or an endolysin protein (SEQ ID NO.s 61-69) or an integrase protein (SEQ ID NO 51) or a capsid and/or portal protein (SEQ ID NO.s 46-50). Optionally, the gene detected may be a nucleic acid with a greater than 70-100% sequence homology with any of SEQ ID NO.s 11-34) or a gene capable of encoding a protein with a greater than 70-100% sequence homology with SEQ ID NO.s 36-69. For example, greater than or equal to 70, 75, 80, 85, 90 or 95, 96, 97, 98, 99 or 99.5% sequence homology with SEQ ID NO.s 11-34 or 36-69. With regards to homologous genes and proteins, preferably these retain the function of the holin, portal, endolysin, integrase or capsid protein.
Instead of percentage sequence homology, a homologue of the phage gene may alternatively be defined as one with addition, substitution and/or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50 contiguous or non-contiguous nucleotides, preferably whilst retaining function of the protein encoded by the gene, the addition, substitution and deletion being relative to the unmodified sequence of SEQ ID NO.s 1-34.
Detection may also involve detection of a fragment of any of the holin, endolysin, integrase, portal, capsid or terminase protein, or combinations thereof. For example, detection of a 50-1300 base pair fragment. For example, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250 or 1300 contiguous base pairs or any range of base pairs based on these values. Optionally, the gene fragment to be detected may be a nucleic acid with equal to or greater than 70-100% sequence homology with any fragment of SEQ ID NO.s 1-34. For example, equal to or greater than 70, 75, 80, 85, 90 or 95, 96, 97, 98, 99 or 99.5% sequence homology with any fragment of SEQ ID NO.s 1-34, preferably whilst retaining function of the protein encoded by the gene.
For example, a fragment of the terminase gene detected may be: GAGTGGATAGCAAGCACTGATTCAATTTTTACACAAATAAATATTACTGATGATT ATGTATTTACTAGCCCGATAGCATATTTAGACCCAGCATTTAGTGTTGGCGGGG ATAACACTGCATTATGTGTTATGGAGCGAGTTGATGAT (SEQ ID NO. 35) or any sequence with equal to or greater than 70-100% sequence homology with SEQ ID NO. 35). For example, equal to or greater than 70, 75, 80, 85, 90 or 95, 96, 97, 98, 99 or 99.5% sequence homology with SEQ ID NO. 35.
The following describes nucleic acid sequences specific to RF Borrelia phage.
The phage gene may be the RF Borrelia terminase gene, when this is the case the gene may be a nucleic acid according to the sequence of SEQ ID NO.s 84 or 86 or a gene capable of encoding a protein according to the sequence of SEQ ID NO.s 85 or 87. Optionally, the terminase gene may be a nucleic acid with equal to or greater than 70-100% sequence homology with SEQ ID NO.s 84 or 86; or a gene capable of encoding a protein with equal to or greater than 70-100% sequence homology with SEQ ID NO.s 85 or 87. For example, equal to or greater than 70, 75, 80, 85, 90 or 95, 96, 97, 98, 99 or 99.5% sequence homology with SEQ ID NO.s 84 or 86, preferably whilst retaining function of the terminase protein encoded by the gene.
Alternatively or additionally, the phage gene may be the holin (SEQ ID NO.s 97-100), endolysin (SEQ ID NO. 101), integrase (SEQ ID NO.103), capsid and/or portal (SEQ ID NO.s 102) gene(s). Alternatively, the phage gene may be a gene capable of encoding a holin protein according to the sequence of SEQ ID NO.s 104-107 or an endolysin protein (SEQ ID NO. 108) or an integrase protein (SEQ ID NO. 110) or a capsid and/or portal protein (SEQ ID NO. 109). Optionally, the gene detected may be a nucleic acid with a greater than 70-100% sequence homology with any of SEQ ID NO.s 97-103) or a gene capable of encoding a protein with a greater than 70-100% sequence homology with SEQ ID NO.s 104-110. For example, greater than or equal to 70, 75, 80, 85, 90 or 95, 96, 97, 98, 99 or 99.5% sequence homology with SEQ ID NO.s 97-103 or 104-110. With regards to homologous genes and proteins, preferably these retain the function of the holin, portal, endolysin, integrase or capsid protein.
Instead of percentage sequence homology, a homologue of the phage gene may alternatively be defined as one with addition, substitution and/or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50 contiguous or non-contiguous nucleotides, preferably whilst retaining function of the protein encoded by the gene, the addition, substitution and deletion being relative to the unmodified sequence of SEQ ID NO.s 84, 86 or 97-103.
Detection may also involve detection of a fragment of any of the holin, endolysin, integrase, portal, capsid or terminase protein, or combinations thereof. For example, detection of a 50-1300 base pair fragment. For example, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250 or 1300 contiguous base pairs or any range of base pairs based on these values. Optionally, the gene fragment to be detected may be a nucleic acid with equal to or greater than 70-100% sequence homology with any fragment of SEQ ID NO.s 84, 86 or 97-103. For example, equal to or greater than 70, 75, 80, 85, 90 or 95, 96, 97, 98, 99 or 99.5% sequence homology with any fragment of SEQ ID NO.s 84, 86 or 97-103, preferably whilst retaining function of the protein encoded by the gene.
The following description applies to the detection of the entire phage gene or a gene fragment for a phage specific for B. burgdorferi s.l. or RF Borrelia.
Isolation of the Nucleic Acid from a Sample
In order to assist molecular biological tools to practice the step of detecting, step a) may be preceded by the step of isolating nucleic acid from the sample, and step a is practiced on the isolated nucleic acid. Any method available to the skilled person that is capable of isolating nucleic acid from the sample would be appropriate for use in the present application. Not wishing to be restricted further, but in the interest of clarity, isolation of the nucleic acid from the sample may be performed using phenol chloroform extraction and isopropanol precipitation, or using membrane based nucleic acid isolation kits (such as QIAGEN® kits; QIAAmp DNA stool mini Kit®).
The inventors have devised an efficient method for isolation of nucleic acid from a sample containing Borrelia. Therefore, also provided is a method of extracting phage DNA from Borrelia, the method comprising: a) incubating the Borrelia in ammonium hydroxide; and b) adding phenol-chloroform to the Borrelia and ammonium hydroxide mixture.
The method may further comprise centrifugation to remove bacterial debris. The resulting supernatant following removal of the bacterial debris may be mixed with sodium acetate. Isopropanol may then be added to the supernatant and sodim acetate mixture. A further step of centrifugation may then be carried out to precipitate the phage DNA
The same volume of phenol-chloroform may be used as the volume of ammonium hydroxide.
Part a) may be carried out at a temperature of 50-150° C. For example, 70-130° C., 80-120° C. or 90-110° C.
The ammonium hydroxide concentration may be 0.5-1M. For example, 0.6M, 0.7M, 0.8M, 0.9M.
Further exemplary details are provided in the examples section under the heading “PCR and sequencing”.
Detection of the Nucleic Acid
Any method known to the skilled person and capable of detecting the presence or absence of a gene (optionally in an isolated nucleic acid) may be suitable for use in step a) of the presently claimed invention. As the phage gene may be present in relatively low copy number, in order to make detection easier, in one embodiment of the present invention the method of detecting involves subjecting the isolated nucleic acid to amplification of the phage gene, e.g. by real time polymerase chain reaction (q PC R).
Alternatively or additionally detection of the phage gene may be confirmed by nucleic acid sequence analysis, by detection of labelled nucleotides inserted in the amplified product, or by detection of hybridisation of probe that is specific to the phage gene (hybridisation being detected, for example, by use of labelled probes).
Apart from Taqman-based qPCR platform, other methods of nucleic acid detection that can be used include SYBR green-based real time PCR assay, digital PCR which involves splitting the same qPCR mix into a large number of individual wells. The endpoint PCR products are determined using Poisson statistical analysis according to the presence (scored as ‘1’) and absence (scored as ‘0’) of fluorescent signal in each well. Other possible methods include Loop mediated isothermal amplification (LAMP), an isothermal nucleic acid amplification technique that does not require a thermal cycler. LAMP could be employed to target terminase, holin, endolysin, integrase, capsid, and portal proteins; and DNA hybridisation based methods such as Fluorescence in situ hybridisation (FISH), which works by performing a DNA/DNA hybridisation using fluorescently labelled short DNA strands (the phage genes) as probes to hybridise to its complementary parts on genomic DNA.
Detection may include the use of an agent which is capable of detection (a label) using for example spectrophotometry, flow cytometry, or microscopy. Exemplary labels include radioactive isotopes (such as 3H, 14C, 15N, 35S, 90V, 99Tc, 111Ln, 125I, or 131I), fluorophores (such as fluorescein, fluorescein isothiocyanate, rhodamine or the like), chromophores, ligands, chemiluminescent agents, bioluminescent agents (such as luciferase, green fluorescent protein (GFP) or yellow fluorescent protein), enzymes that can produce a detectable reaction product (such as horseradish peroxidise, luciferase, alkaline phosphatase, beta-galactosidase) and combinations thereof.
The following relates to primers specific for B. Burgdorferi s.l. phage.
The step of amplification may involve the use of a forward primer selected from the group consisting of nucleic acids comprising or consisting of SEQ ID NO 70:
Alternatively, or additionally, the step of amplification involves the use of a reverse primer selected from the group consisting of nucleic acids comprising or consisting of SEQ ID NO. 71:
Alternatively or additionally, the step of amplification may involve the use of any one or more of the primers of SEQ ID NO.s 73-77 and/or 79-83.
Where identification of the phage gene is achieved by the use of hybridisation probes, suitable probes could be any capable of specifically binding to the phage gene, or portion thereof. For example, appropriate probes may be any one or more of the aforementioned primers comprising or consisting of SEQ ID NO.s 70-77 and/or 79-83, or nucleic acids comprising or consisting of SEQ ID NO.s 1-34 or fragment thereof, any homologue thereof, or specifically binding portions thereof, or any combination thereof.
The following relates to primers specific for RF Borrelia phage.
The step of amplification may involve the use of any of primers comprising or consisting of SEQ ID NO.s 88-96, any homologue thereof, or specifically binding portions thereof, or any combination thereof.
Where identification of the phage gene is achieved by the use of hybridisation probes, suitable probes could be any capable of specifically binding to the phage gene, or portion thereof. For example, appropriate probes may be any one or more of the aforementioned primers comprising or consisting of SEQ ID NO.s 88-96, or nucleic acids comprising or consisting of SEQ ID NO.s 84, 86 and/or 97-103 or fragment thereof, any homologue or thereof, or specifically binding portions thereof, or any combination thereof.
Detection may also comprise detection of a phage RNA or RNA fragment. For example, an RNA fragment of 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250 or 1300 base pairs or any range of base pairs based on these values.
For example, presence of the phage gene may also be detected by detection of the corresponding mRNA. This can be achieved by performing a reverse transcriptase real time PCR by performing a real time PCR against cDNA synthesised from total RNA. For example, by hybridisation of primers to mRNA. The methodology used in PCR methods, for example RT-PCR, will be well known to those skilled in the art.
Apart from PCR, there are probe-based methods such as Northern blotting, in situ hybridisation. There are also RNA sequencing method that can be used in detecting phage RNA via sequencing the total RNA.
Some methods may require the isolation of RNA from a sample. Such isolation techniques are known in the art and may utilise commercially available RNA isolation kits from manufacturers such as Qiagen or Maxwell viral total nucleic acid purification kit from Promega or the isolation methods described above with regards to gene sequence detection.
Detection of Phage Proteins
Detection may also comprise detection of a phage protein or protein fragment.
Other ways of detecting the Borrelia phage include detection of the phage specific proteins.
In the case of LD, the phage protein is one specific to a B burgdorferi s.l. host (i.e. the amino acid sequence is found in only the target host, e.g. B. burgdorferi s.l., or in a phage specific for such a host, or part thereof).
Suitable proteins for LD detection include holin (SEQ ID NO.s 52-60), endolysin (SEQ ID NO. 61-69), integrase (SEQ ID NO. 51), portal (SEQ ID NO. 46-50), capsid and/or terminase (SEQ ID NO.s 36-45).
Optionally, the amino acid sequence detected may have equal to or greater than 70-100% sequence homology with SEQ ID NO.s 36-69 or may be encoded by a gene having equal to or greater than 70-100% sequence homology with SEQ ID NO.s 1-34. For example, equal to or greater than 70, 75, 80, 85, 90 or 95, 96, 97, 98, 99 or 99.5% sequence homology with SEQ ID NO.s 36-69 or 1-34. With regards to homologous genes and proteins, preferably these retain the function of the holin, portal, endolysin, integrase or capsid protein.
In the case of RF, the phage protein is one specific to a RF Borrelia host (i.e. the amino acid sequence is found in only the target host, e.g. RF Borrelia or in a phage specific for such a host, or part thereof).
Suitable proteins for RF detection include terminase (SEQ ID NO.s 85 or 87), holin (SEQ ID NO.s 104-107), endolysin (SEQ ID NO. 108), portal protein (SEQ ID NO. 109) and/or integrase (SEQ ID NO. 110).
Optionally, the amino acid sequence detected may have equal to or greater than 70-100% sequence homology with SEQ ID NO.s 85, 87 or 104-110 or may be encoded by a gene having equal to or greater than 70-100% sequence homology with SEQ ID NO.s 84, 86 or 97-103. For example, equal to or greater than 70, 75, 80, 85, 90 or 95, 96, 97, 98, 99 or 99.5% sequence homology with SEQ ID NO.s 84-87 or 97-110. With regards to homologous genes and proteins, preferably these retain the function of the holin, portal, endolysin, integrase or capsid protein.
Instead of percentage sequence homology, a homologue may be defined as a protein with addition, substitution and/or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50 contiguous or non-contiguous amino acids, preferably whilst retaining function of the protein, the addition, substitution and deletion being relative to the unmodified sequence of SEQ ID NO.s 85, 87 or 104-100.
Detection may also involve detection of a fragment of any of the holin, endolysin, integrase, portal, capsid or terminase proteins, or combinations thereof. For example, detection of an epitope on any of these proteins by an antibody specific for Borrelia burgdorferi sensu lato. The epitope may be a linear epitope. For example, a fragment may comprise a stretch of amino acid residues of at least 5 to 10 contiguous amino acids, 10 to 15 contiguous amino acids, 15 to 20 contiguous amino acids, or 20 to 30 or more contiguous amino acids. Or the epitope may be a non-contiguous epitope specific to the phage protein. For example, a non-contiguous epitope comprising 5, 10, 15 or 20 amino acids.
Optionally, the protein fragment to be detected may be an amino acid with equal to or greater than 70-100% sequence homology with any fragment of SEQ ID NO.s 36-69, 85, 87 or 104-110). For example, equal to or greater than 70, 75, 80, 85, 90 or 95, 96, 97, 98, 99 or 99.5% sequence homology with any fragment of SEQ ID NO.s 36-69, 85, 87 or 104-110 whilst retaining the function of the protein.
Protein specific detection can be carried out by any method known in the art. For example, Immunohistochemistry (IHC) can be used to detect protein expression. Western blotting and ELISA are also methods useful for detecting protein expression and secretion. Antibodies or other proteins or molecules capable of selective binding to the phage proteins can be used for detection. Protein can also be detected by MALDI-TOF mass spectrometry. Protein sequencing, for example by mass spectrometry or Edman degradation, can also be used for detection. Linear fragments of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500 amino acids or any range of these numbers may be sequenced.
Phage protein can be detected using a primary antibody with binding specificity for the phage protein. The primary antibody can be labelled with a detectable moiety or can be conjugated to a hapten (such as biotin or the like) wherein the hapten is detectable by a detectably labelled cognate hapten binding molecule, for example streptavidin horseradish peroxidase. Alternatively, a secondary antibody can be used which specifically binds the first primary antibody and instead this secondary antibody may be detectable as described above for the primary antibody.
The binding specificity of phage antibodies (antibodies with binding specificity to a phage protein) can be established using, for example, Western blotting.
The term antibody refers to an immunoglobulin molecule or combinations thereof that specifically binds to or is immunologically reactive with a particular antigen and includes polyclonal, monoclonal, genetically engineered and otherwise modified forms of antibodies, not limited to chimeric antibodies, humanised antibodies, heteroconjugate antibodies (for example bispecific antibodies, diabodies, triabodies, and tetrabodies), single chain Fv antibodies (scFv), or polypeptides that contain at least a portion of immunoglobulin that is sufficient to confer specific antigen binding to the polypeptide. Antibody fragments include proteolytic antibody fragments such as F(ab′)2 fragments, Fab′ fragments, Fab′-SH fragments, Fab fragments, FV, rIgG, recombinant antibody fragments such as sFv fragments, dsFv fragments, bispecific sFv fragments, bispecific dsFv fragments, complementarity determining region (CDR) fragments, camelid antibodies and antibodies produced by cartilaginous and bony fishes and isolated binding domains thereof. A Fab fragment is a monvalent fragment consisting of the VL, VH, CL and CH1 domains; a F(ab′)2 fragment is a bivalent fragment comprising two Fab fragments linked by a disulphide bridge at the hinge region, an Fd fragment consists of the VH and CH1 domains; an FV fragment consists of the VL and VH domains of a single arm of an antibody; and a dAb fragment consists of a VH domain. A single chain antibody (scFv) is an antibody in which a VL and VH region are paired to form a monovalent molecule via a synthetic linker that enables them to be made as a single protein chain. Diabodies are bivalent, bispecific antibodies in which the VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow for pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain and creating two antigen binding sites. A chimeric antibody is an antibody that contains one or more regions from one antibody and one or more regions from one or more other antibodies. An antibody may have one or more binding sites. If there is more than one binding site, the binding sites may be identical to one another or may be different. For instance, a naturally occurring immunoglobulin has two identical binding sites, a single chain antibody or Fab fragment has one binding site, while a bispecific or bifunctional antibody has two different binding sites.
Alternatively, other proteins which are capable of selective binding may also be used for detection.
For example, the phage protein may be detected using aptamers (for example a single stranded nucleic acid molecule (such as, DNA or RNA) that assumes a specific, sequence dependent shape and binds to the phage protein with high affinity and specificity), mirror image aptamers (SPIEGELMER™), engineered nonimmunuoglobulin binding proteins, for example nonimmunoglobulin binding proteins based on scaffolds including fibronectin (ADNECTINS™), CTLA-1 (EVIBODIES™), lipocalins (ANTICALINS™), protein A domain (AFFIBODIES™) or the like.
Homology
With regards to nucleic acid sequences, homology may be defined as to a nucleotide sequence which encodes a protein with a similar function. With regards to protein sequences, homology may be defined as to a protein with a similar function. For example, a protein with the same function from another Borrelia burgdorferi sensu lato or RF Borrelia species.
Percentage homology can be defined as the percentage of identical residues and the percentage of residues conserved with similar physiochemical properties. The degree of homology between sequences may be determined using any suitable method known in the art (See e.g., Smith and Waterman, Adv. Appl. Math., 2:482 [1981]; Needleman and Wunsch, J. Mol. Biol, 48:443 [1970]; Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444 [1988]; programs such as GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, Wis.); and Devereux et al., Nucl. Acid Res., 12:387-395 [1984]).
The above percentages of homology may equally apply to percentage sequence identity only. For example, the percentage of nucleic acid residues which are identical between the terminase nucleic acid sequence and another terminase sequence, which may for example, be from a different Borrelia species.
Instead of percentage sequence homology, a homologue of the phage gene may be defined as one with addition, substitution or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50 contiguous or non-contiguous nucleotides, preferably whilst retaining function of the protein encoded by the gene, the addition, substitution and deletion being relative to the unmodified sequence.
Sequences
In a further aspect of the present invention there is provided the phage genes, primers, nucleic acids and hybridising probes; and amino acid sequences as defined above.
For reference, a table of the various gene sequences isolated from various B. burgdorferi s.l. in the sequence listing is provided below along with the corresponding proteins.
The SEQ ID NO.s of the primers used for gene sequence detection are also provided:
Provided below is a table of the various gene sequences isolated from various Borrelia species in the sequence listing which are causative agents of RF:
The SEQ ID NO.s of the primers used for gene sequence detection are also provided:
Homologues and fragments of these nucleic acid and protein sequences are also provided in accordance with the description above for the detection method.
Also provided are use of the above sequences, homologues and fragments as diagnostic markers for LD or RF.
Species Detection
The Borrelia burgdorferi sensu lato may be any that are the causative agent for LD.
For example any of Borrelia afzelii, Borrelia spielmanii, Borrelia valaisiana, Borrelia Borrelia finlandensis, Borrelia bugdorferi sensu strictu, Borrelia bissettii, Borrelia bavariensis, Borrelia japonica, Borrelia lusitaniae, Borrelia sinica, Borrelia spielmanii, Borrelia tanukii, Borrelia turdi, Borrelia valaisiana, Borrelia Yangtze, Borrelia mayonii, Borrelia carolinensis, Borrelia andersonii, Borrelia lonestari, and Borrelia Americana or any combination thereof. For example, it may be Borrelia afzelii, Borrelia bugdorferi sensu strict, Borrelia garinii, or any combination thereof. For example, it may be Borrelia bugdorferi sensu strictu, or any combination of Borrelia bugdorferi sensu strictu with any of the above.
The RF Borrelia may be any that are the causative agent for RF. For example, any of Borrelia miyamotoi, Borrelia hermsii, Borrelia recurrentis, Borrelia crocidurae, Borrelia duttoni, Borrelia hispanica, Borrelia parkeri and Borrelia turicatae or any combination thereof.
The inventors were surprised that when analysing Borrelia burgdorferi sensu lato species specific phage genes further, these genes not only showed specificity to Borrelia burgdorferi sensu lato, but also specifically to species within that group. The RF Borrelia specific phage genes were also found to be specific to particular species.
None of the known methods can distinguish between different species of Borrelia. This can be an important advantage as knowing what species of Borrelia is present can educate the treatment regimen and thereby optimise the success of treatment (as some species of Borrelia respond better to specific antibiotics than do others).
Consequently, the method may determine the presence or the absence of a species of Borrelia burgdorferi sensu lato or RF Borrelia in the sample, the method comprising the steps of:—
-
- a) detecting the presence or absence of the Borrelia burgdorferi sensu lato or RF Borrelia species specific phage gene in the sample;
- b) determining the presence of the species of the Borrelia burgdorferi sensu lato or RF Borrelia in the sample on the basis of the detection of the species specific phage gene, or the absence of the species of Borrelia burgdorferi sensu lato or RF Borrelia in the sample on the basis of the lack of detection of the species specific phage gene.
In order to assist molecular biological tools to practice the step of detecting, step a) may be preceded by the step of isolating nucleic acid from the sample, and step a) is practiced on the isolated nucleic acid. Any method available to the skilled person that is capable of isolating nucleic acid from the sample would be appropriate for use in the present application. Not wishing to be restricted further, but in the interest of clarity, isolation of the nucleic acid from the sample may be performed using phenol chloroform extraction and isopropanol precipitation, or using membrane based nucleic acid isolation kits (such as QIAGEN® kits; QIAAmp DNA stool mini Kit®).
For example, when the bacteria is Borrelia bugdorferi sensu strictu the Borrelia bugdorferi sensu strictu specific phage gene may be any of those discussed above. For example, the gene may be a terminase gene (i.e. the phage gene), which can be that according to SEQ ID NO 1. Optionally the gene is a nucleic acid with equal to or greater than 70-99.5% sequence homology to any one of SEQ ID No. 1. The forward primer used to amplify the Borrelia bugdorferi sensu strictu specific terminase gene is a nucleic acid comprising or consisting of SEQ ID NO 70. The reverse primers may be a nucleic acid comprising or consisting of SEQ ID NO 71. Where identification of this gene is achieved by the use of hybridisation probes, suitable probes would be any of the aforementioned primers, nucleic acids comprising or consisting of SEQ ID NO 1-10 or 35, any homologue thereof, or specifically binding portions thereof, or any combination thereof.
For example, when the bacteria is Borrelia miyamotoi, the specific phage gene may be any of those discussed above. For example, the gene may be a terminase gene (i.e. the phage gene), which can be that according to SEQ ID NO 84. Optionally the gene is a nucleic acid with equal to or greater than 95, 96, 97, 98, 99 or 99.5% sequence homology to SEQ ID No. 84. The forward primer used to amplify the Borrelia miyamotoi specific terminase gene is a nucleic acid comprising or consisting of SEQ ID NO 89 or 92. The reverse primers may be a nucleic acid comprising or consisting of SEQ ID NO 90 or 93. Where identification of this gene is achieved by the use of hybridisation probes, suitable probes would be nucleic acids comprising or consisting of SEQ ID NO 84, or any primer comprising or consisting of SEQ ID NO.s 88-93; any homologue thereof, or specifically binding portions thereof, or any combination thereof.
Kit
In a further aspect of the present invention there is a kit for determining the presence or the absence of Borrelia burgdorferi sensu lato and or RF Borrelia in a sample, the kit may comprise one or more of the aforementioned primers for specifically hybridising with nucleic acid sequence of a Borrelia specific phage gene. The selection of the primer, or preferably primer pairs (i.e. forward and reversed primers) would be guided by the target Borrelia burgdorferi sensu lato or RF Borrelia species. The kit may further comprise hybridisation probes which may be the aforementioned primers, or any of the aforementioned probes. Again, the choice of probes would be selected on the basis of the target species to be identified by the kit. The choice of hybridisation probes for a kit for determining the presence of Borrelia burgdorferi sensu lato, or indeed a kit for identifying a specific species of such bacteria can be extrapolated from the details of appropriate hybridisation probes discussed above. As an alternative to nucleic acid probes, antibodies which bind to phage specific proteins may be included in a kit. Such antibodies are discussed above.
Monitoring the Progression of Infection
The method may be applied to monitoring the progression of an infection from Borrelia burgdorferi sensu lato or RF Borrelia; or a species of such bacteria based on the teachings of the earlier aspects of the present invention.
The terms used in this aspect of the present invention are the same as, and so refer back to, the terms used in earlier aspects of the present invention.
In a further aspect of the present invention there is provided a method of monitoring the progression of infection from Borrelia burgdorferi sensu lato or RF Borrelia. The method comprising steps of:—
-
- a) determining the amount of phage in a first sample obtained from the subject;
- b) detecting the amount of phage in a second sample obtained from the subject at a second time point;
- c) comparing the amount of phage in the first sample identified in step a) with that identified for the second sample in step b).
The method may include the step of isolating a first population of nucleic acid from a first sample obtained from the subject at a first time period, prior to step a). The method may include the step of isolating a second population of nucleic acid from a second sample obtained from the subject at a second time point, prior to step b).
Treatment
Detection of the presence of Borrelia burgdorferi sensu lato in a sample from a subject confirms a diagnosis that the subject has LD. Treatment for Borrelia burgdorferi sensu lato infection is the treatment of Lyme disease.
Detection of the presence of an RF Borrelia in a sample from a subject confirms a diagnosis that the subject has RF.
Any of the methods described may include the step of administering an antibiotic or more than one antibiotic. Such a method may be capable of determining the ability for the antibiotic to treat Borrelia burgdorferi sensu lato or RF infection, or species specific Borrelia burgdorferi sensu lato or RF infection.
The following relates to treatment of LD:
The recommended treatment for infection is a combined therapy comprising one, two, or sometimes three, antibiotics used at the same time. This may be in the form of sequential treatments or synchronously combined long-term antibiotic treatment. Antibiotics such as tetracyclines can be used for treatment alone or in combination with hydroxychloroquine. This may involve simultaneous administration of the antibiotics.
The main antibiotics recommended for use are: 1) pencillins; 2) cephalosporins; 3) macrolides; 4) fluroquinolones and/or 5) cyclines.
Any of the above antibiotics may be combined or used sequentially.
As an example, cephalosporins can be used alone or in combination with minocycline. This treatment may involve alternating between the two antibiotics. Doxycycline and/or minocycline can be combined with azithromycin and/or hydroxychloroquine. Other combinations based on the above classes of antibiotics or other antibiotics are possible.
The terms used in this aspect of the present invention are the same, and so refer back to the same terms used in earlier aspects of the present invention.
The following relates to treatment of RF:
For relapsing fever (RF), treatment uses the same classes of antibiotic as for LD. Treatment for infection may be a combined therapy comprising one, two, or sometimes three, antibiotics used at the same time. This may be in the form of sequential treatments or synchronously combined long-term antibiotic treatment. Any of the above antibiotics may be combined or used sequentially.
For example, oral treatment may include a daily single dose of any of an antibiotic from any of the above classes 1-5. For example, oral treatment may consist of a daily single dose of tetracycline 500 mg, doxycycline 200 mg, or, when tetracyclines are contraindicated, erythromycin 500 mg. Treatment duration may be up to 7-10 days or more owing to reported relapses of 20% or greater after single-sequence. In adults, intravenous therapy with doxycycline, erythromycin, tetracycline, or procaine penicillin G may be used when oral therapy is not tolerated.
Procaine penicillin G may be administered at a single dose of 600,000 IU in adult patients with LBRF or 600,000 IU daily in patients with RF.
For example, in a further aspect of the present invention there is provided a method of treating an infection resulting from Borrelia burgdorferi sensu lato or RF Borrelia, or species of Borrelia burgdorferi sensu lato or RF Borrelia, the method comprising steps of:—
-
- a) identifying Borrelia burgdorferi sensu lato or RF Borrelia infection, or the species of Borrelia burgdorferi sensu lato or RF Borrelia infection, using the method according to the first aspect of the present invention;
- b) selecting at least one antibiotic that is suitable for treating Borrelia burgdorferi sensu lato or RF Borrelia infection, or the determined species of Borrelia burgdorferi sensu lato or RF Borrelia;
- c) administering the selected antibiotic(s) to the subject identified in step a as being infected by Borrelia burgdorferi sensu lato or RF Borrelia.
In a further aspect of the present invention there is provided a method of treating an infection of Borrelia burgdorferi sensu lato or RF Borrelia, or species of Borrelia burgdorferi sensu lato or RF Borrelia, the method comprising steps of:—
-
- a) selecting at least one antibiotic that is suitable for treating Borrelia burgdorferi sensu lato or RF Borrelia infection, or the determined species of Borrelia burgdorferi sensu lato or RF Borrelia;
- b) administering the selected antibiotic(s) to a subject that had been identified as having Borrelia burgdorferi sensu lato or RF Borrelia infection, or the species of Borrelia burgdorferi sensu lato or RF Borrelia infection, by the method according to the first aspect of the present invention.
Alternatively, the method may be applied for research purposes, for example, research into the physiological effects of Borrelia burgdorferi sensu lato or RF Borrelia. The method may also be applied in clinical situations when it is important to determine if a subject has been infected with the Borrelia burgdorferi sensu lato or RF Borrelia. Consequently, in one embodiment in the present invention, the method is a method of diagnosing infection of Borrelia burgdorferi sensu lato or RF Borrelia or species of Borrelia burgdorferi sensu lato or RF Borrelia in the subject, the method comprising the steps:—
-
- a) detecting the presence or absence of phage or species specific phage in the sample;
- b) determining that the subject is infected with Borrelia burgdorferi sensu lato or RF Borrelia, or a species thereof by detecting the phage or species specific phage in the sample, or determining that the subject is not infected with Borrelia burgdorferi sensu lato or RF Borrelia or a species thereof, by the lack of detection of the phage, or a species thereof, in the sample.
The terms used in this aspect of the invention are the same as, and so refer back to, the same terms used in earlier aspects of the present invention. For example, samples used in each of the methods of the present invention may be obtained shortly after infection (i.e. early stage infection), or after the infection has been well developed and that bacteria have become sequestered (i.e. late stage infection).
The step of detection for all methods of the invention may be a quantification step, i.e. the amount of phage gene, RNA or protein is calculated. The methods for all methods of the invention may involve the step of taking the sample from a subject. Wherein all the methods of the invention may involve the selection of subjects for treatment for LD when a sample from the subject is determined to be positive for the presence of Borrelia burgdorferi sensu lato; or may involve the selection of subjects for treatment for RF when a sample from the subject is determined to be positive for the presence or RF Borrelia.
The present invention will now be described, by way of example, with reference to the accompanying figures, in which:—
The present invention will now be described with reference to the following examples, which are by way of illustration alone. The following examples are not intended to completely define or otherwise limit the scope of the invention.
EXAMPLESLyme Disease
Borrelia burgdorferi Sensu Lato Isolates
Lab cultures of Borrelia burgdorferi sensu lato (s.l.) strains were provided by professor Sven Bergström (Umeå University, Sweden). Two Borrelia miyamotoi strains were provided by the CDC (Centers for Disease Control and Prevention, USA). The lab strains were maintained in BSKII medium. Routine characterisation was carried out using phase contrast microscope.
PCR and Sequencing
DNA was extracted from serum samples using a novel method of combining ammonium hydroxide and phenol chloroform. 600 μL of samples (was incubated in the presence of 1.2 ml 0.7 M ammonium hydroxide at 100° C. for 5 min, followed by 10 min at 100° C. with the tube open. After the tube was cooled to room temperature, the samples were extracted with the same volume of phenol-chloroform (1:1). After incubation time of 5 min at RT, the solution was centrifuged for 10 min at 18 000 g. The clear supernatant was transferred into a new 2 ml tube and mixed with 0.1 volume of 3 M sodium acetate. This suspension was then mixed with 0.7 volumes of room-temperature isopropanol. DNA was precipitated down by centrifuging at 21 000 g for 10 min at 4° C. After decanting the supernatant, 1.5 ml of room-temperature 70% ethanol was added followed by centrifuging at 21 000 g for 10 min at 4° C. The resulting DNA pellet was briefly air dried for 5 min, and dissolved in 50-100 μl of a suitable buffer (such as elution buffer, EB, which is 10 mM Tris-Cl, pH 8.5).
PCR primers were designed manually against conserved regions in all known Borrelia phage terminase gene sequences. The primers amplify a 194 bp product from 8 lab all Lyme Borrelia burgdorferi s.l. strains. PCRs were carried out in a LabCycler (SensoQuest GmbH, Göttingen, Germany) in a total volume of 50 μl, containing 0.25 mM dNTPs, 3 mM MgCl2, 2 μM primers, 50 ng of template DNA, 0.5 unit of Taq polymerase (Bioline), and 5 μl 10×Taq buffer (Bioline). Amplification conditions were: 94° C. for 2 min, 30 cycles of 94° C. for 45 sec, 48° C. for 45 sec, 72° C. for 1 min, with a final extension of 10 min at 72° C. PCR products were gel-purified using a Qiagen gel extraction kit, and subjected to TOPO TA cloning (Invitrogen). Sequencing was carried out by GATC Biotech. Sequencing results were edited using Chromas 2.33, searched using a nucleotide BLAST (NCBI).
Borrelia burgdorferi Sensu Lato Species Identification
A previous reported Multi locus sequence typing (MLST) scheme was used to distinguish different genotypes of Borrelia.
Phylogenetic Analysis
Phylogenetic analysis were constructed using the program Molecular Evolutionary Genetics Analysis (MEGA) package version 4.1 (Beta) (Tamura et al., 2007; Kumar et al., 2008). Alignment Explorer/CLUSTAL in MEGA 4.1 (Beta) was used to align the DNA sequences. NJ and MP analysis were conducted on a nucleotide data set; for NJ a maximum composite likelihood model was used and for MP a close-neighbour-interchange with a search level of 3 was used. Supports for clades were estimated using a bootstrap analysis implemented in MEGA using 1,000 replicates. The trees were rooted with phage Lambda (NC_001416) as an outgroup.
Nucleic Acid Hybridisation
“Hybridization” refers to the association of two nucleic acid sequences to one another by hydrogen bonding. Typically, one sequence will be fixed to a solid support and the other will be free in solution. Then, the two sequences will be placed in contact with one another under conditions that favour hydrogen bonding.
Factors that affect this bonding include: the type and volume of solvent; reaction temperature; time of hybridization; agitation; agents to block the non-specific attachment of the liquid phase sequence to the solid support (Denhardt's reagent or BLOTTO); concentration of the sequences; use of compounds to increase the rate of association of sequences (dextran sulphate or polyethylene glycol); and the stringency of the washing conditions following hybridization.
“Stringency” refers to conditions in a hybridization reaction that favour association of very similar sequences over sequences that differ. For example, the combination of temperature and salt concentration should be chosen that is approximately 120 to 200° C. below the calculated Tm of the hybrid under study. The temperature and salt conditions can often be determined empirically in preliminary experiments in which samples of genomic DNA immobilized on filters are hybridized to the sequence of interest and then washed under conditions of different stringencies. See Sambrook et al. at page 9.50.
Variables to consider when performing, for example, a Southern blot are (1) the complexity of the DNA being blotted and (2) the homology between the probe and the sequences being detected. The total amount of the fragment(s) to be studied can vary a magnitude of 10, from 0.1 to 1 mg for a plasmid or phage digest to 10-9 to 10-8 g for a single copy gene in a highly complex eukaryotic genome. For lower complexity polynucleotides, substantially shorter blotting, hybridization, and exposure times, a smaller amount of starting polynucleotides, and lower specific activity of probescan be used. For example, a single-copy yeast gene can be detected with an exposure time of only 1 hour starting with 1 mg of yeast DNA, blotting for two hours, and hybridizing for 4-8 hours with a probe of 108 cpm/mg.
For a single-copy mammalian gene a conservative approach would start with 10 mg of DNA, blot overnight, and hybridize overnight in the presence of 10% dextran sulphate using a probe of greater than 108 cpm/mg, resulting in an exposure time of 24 hours.
Several factors can affect the melting temperature (Tm) of a DNA-DNA hybrid between the probe and the fragment of interest, and consequently, the appropriate conditions for hybridization and washing. In many cases the probe is not 100% homologous to the fragment. Other commonly encountered variables include the length and total G+C content of the hybridizing sequences and the ionic strength and formamide content of the hybridization buffer. The effects of all of these factors can be approximated by a single equation: where Ci is the salt concentration (monovalent ions) and n is the length of the hybrid in base pairs (slightly modified from Meinkoth & Wahl (1984) Anal. Biochem. 138: 267-284).
In designing a hybridization experiment, some factors affecting nucleic acid hybridization can be conveniently altered. The temperature of the hybridization and washes and the salt concentration during the washes are the simplest to adjust. As the temperature of the hybridization increases (i.e. stringency), it becomes less likely for hybridization to occur between strands that are no homologous, and as a result, background decreases. If the radiolabeled probe is not completely homologous with the immobilized fragment (as is frequently the case in gene family and interspecies hybridization experiments), the hybridization temperature must be reduced, and background will increase. The temperature of the washes affects the intensity of the hybridizing band and the degree of background in a similar manner. The stringency of the washes is also increased with decreasing salt concentrations.
In general, convenient hybridization temperatures in the presence of 50% formamide are 42° C. for a probe with is 95% to 100% homologous to the target fragment, 37° C. for 90% to 95% homology, and 32° C. for 85% to 90% homology. If the homology between the probe and the target fragment are not known, the simplest approach is to start with both hybridization and wash conditions which are nonstringent. If non-specific bands or high background are observed after autoradiography, the filter can be washed at high stringency and re-exposed. If the time required for exposure makes this approach impractical, several hybridization and/or washing stringencies should be tested in parallel. Nucleic acid Probe Assays.
Example 1: Efficacy of Phage-Based Test, as Shown in Spiked BloodA known number of cells of Borrelia burgdorferi s.s. B31 strain (1000, 100, 10, and 1 cell/cell) were added into 1 ml of commercial available healthy human whole blood (3 replicas). Total DNA was extracted from 100 μl of the spiked blood, respectively using the Qiagen blood and tissue kit. The extracted DNA was then used as a template for PCR amplification of the terminase gene (primers used were as shown in SEQ ID No. 70 and 71—forward and reverse).
As clearly demonstrated in the gel picture shown in
Comparison with Known Methodologies
The present invention, as described above, using the terminase PCR targeting B. burgdorferi s.l. was practiced on samples with known concentrations of Borrelia burgdorferi strain B31. The sensitivity of the present test was compared with bacteria-based PCR, our terminase PCR targeting B. burgdorferi s.l. phage-based PCR. The test of the present invention showed a markedly higher sensitivity compared to the known test, and could detect bacteria at a concentration ˜1 bacterium per ml (see Table 1).
The phage-based PCR was positive against Lyme Borrelia suspension with a concentration of less than 1 bacterium per ml, while the bacterial PCR was negative.
Example 2: Comparative Study of Methods of Present Invention with Conventional 16sPCR MethodFour individual Borrelia burgdorferi B31 cultures were diluted to 10 Borrelia/ml, 100 μl of these diluted cultures were then subjected to DNA extraction using the Qiagen blood and tissue kit. The resulting extracted DNA was then used as a template for PCR amplification of the terminase gene (primers used were as shown in SEQ ID No. 70 and 71—forward and reverse) and as a template for PCR amplification of the 16S (a bacterial gene for ribosomal RNA, commonly as a molecular diagnostic tool for detecting presence of absence of bacteria). As can be seen in the gel picture shown in
This example demonstrated that the efficiency of terminase PCR is higher than 16S PCR.
Example 3: Demonstrate of Test According to Present Invention on Different Borrelia Burgdorferi s.l. SpeciesTerminase PCR was carried out against a set of different Borrelia genotypes (different isolates).
The gel picture of
This demonstrated that this terminase PCR technique of the present invention can amplify the four key strains of Borrelia burgdorferi s.l. group, which are Burgdorferi, afzelii, and valaisiana. This terminase PCR technique was also applied to other bacteria, such as Clostridium difficile, Burkholderia thailandensis, E. coli, Salmonella, legionellae, and haemophilia strains. None of these bacteria generated any PCR product with terminase primer.
Further analysis was carried out to determine the efficiency of the method to distinguish between Lyme Borrelia and relapsing fever Borrelia strains.
Primers and TaqMan probes (Table 3) were designed based on the B. burgdorferi terminase gene sequence (GenBank accession NC 000948.1) using PrimerQuest® Tool (IDT). To ensure the specificity of the primer/probe combinations (referred to as ‘BbFAM’), BLAST analysis using sequences submitted to GenBank was performed. All hits with e-value <0.01 were Lyme Borrelia species dominated by B. burgdorferi with one hit of each of the following Borrelia strains: B. mayonii, B. garinii, B. afzelii, B. bisettii, and B. valasiana. In addition, ‘In silico’ was performed against all the available bacterial species, PCR product of the correct sizes was only observed from plasmid fractions of Borrelia burgdorferi. This demonstrated that the primer/probe combinations can detect the Lyme Borrelia strains. The TaqMan probe was labelled 5′ with 6-carboxyfluorescein (FAM) fluorescent dye and a double-quencher with a ZEN™. Quencher and Iowa Black FQ to the 3′ (5′FAM/ZEN/3′IBFQ). These double-quenched probes generate less background and increased signal compared to probes containing a single quencher. Both primers, the probe and PrimeTime Gene Expression Master Mix were supplied by IDT.
As seen in table 4, the primer/probe were tested against DNA extracted from different genotypes of Borrelia strains. All Lyme Borrelia strains (1-6) tested generated a positive PCR with a threshold cycle (Ct) value <30. No Ct value can be detected from Relapsing fever Borrelia strains. Apart from ‘in silico’ PCR, ‘wet experiment’ was also carried out to confirm that no PCR products were observed when BbFAM PCR was performed against a range of different bacterial DNA including, E. coli, Pseudomonas, Clostridium, Haemophilus, Burkholderia, and Salmonella.
To test the robustness, efficiency and the limit of detection (LOD) of the BbFAM PCR, a series of five tenfold dilutions of a plasmid carrying terminase gene fragment were amplified with BbFAM. To construct a standard for real time PCR, a plasmid carrying the terminase gene fragment was made. This plasmid served as the positive control and helped the calculations of the copy numbers in each PCR. The terminase plasmid was constructed as described below:
PCR primers were designed using Primer Blast against terminase gene sequence (SEQ ID No 1). The primers were FTer721:AGACTAAGATGCGGGCAAGA (SEQ ID NO. 82) and RTer721:TTGCATCAAGAGCGTCATCA (SEQ ID NO. 83). A 721 bp PCR product was generated. PCRs were carried out in a LabCycler (SensoQuest GmbH, Göttingen, Germany) in a total volume of 50 μl, containing 0.25 mM dNTPs, 3 mM MgCl2, 3 μM primers, 50 ng of template DNA, 0.5 unit of Taq polymerase (Bioline), and 5 μl 10×Taq buffer (Bioline). Amplification conditions were: 94° C. for 2 min, 30 cycles of 94° C. for 30 sec, 50° C. for 30 sec, 72° C. for 1 min, with a final extension of 10 min at 72° C. PCR products were gel-purified using a Qiagen gel extraction kit, and subjected to cloning using NEB® PCR Cloning Kit according to the standard protocol. The positive clones were confirmed by PCR and sequencing. The resulting plasmid carrying terminase gene fragments were purified using Qiagen plasmid kit and used as positive controls. The concentration of DNA was measured with a Qubit Fluorometer (Invitrogen). The copy number of the plasmid DNA with the terminase gene fragment was calculated according the following formula (available online):
To work out the limit of detection (LOD) of the Taqman real time PCR, firstly 10-fold serial dilutions of the plasmid DNA carrying terminase fragment were tested to evaluate the performance of Taqman PCR. Each dilution (106-102) was tested by BbFAM PCR with five replicates (Table 5).
Next, the plasmid DNA was diluted from 1000 copies numbers to 100, 80, 60, 40, 20, 10, 5, and 1 copies/PCR. Ten replicates were used for each dilution. Probit analysis in SPSS was performed to calculate the LOD of 32 copies of plasmids with 95% probability.
The results were summarised in the following two tables:
The LOD determined by Probit analysis with 95% probability was 30 copies of plasmid DNA.
The copy numbers of plasmid DNA template per PCR ranged from 106 to 102. As shown in
To rule out the possibility of human DNA interference, human DNA and healthy whole blood were purchased from Sigma. Total DNA was extracted from the healthy whole blood. Both DNAs were examined using BbFAM PCR. No Ct values were observed from any PCRs, while positive PCR targeting human housekeeping genes RNase P produced positives. This confirmed that the human DNA had no effect on BbFAM PCR.
ConclusionThis experiment demonstrated that this terminase PCR is specific for Borrelia burgdorferi sensu lato and that using real time sequencing, the test has a very low limit of detection (LOD).
PCR primers for holin, endolysin and for amplifying the region which contains both these genes (SEQ ID NO. 72-77; the region containing both genes=SEQ ID NO. 78) have also been demonstrated to be able to amplify the correct regions of Lyme Borrelia.
Example 4: Comparative Study of Methods of Present Invention with Conventional 16sPCR Method Practiced in Serum SampleFive Lyme-positive serum samples (S1-S5) (as tested and confirmed by antibody and clinical presentation tests) were subjected to DNA extraction using Qiagen Blood and tissue kit. The DNAs were then analysed using both terminase (top panel) and 16S (bottom panel) PCR primers, respectively (in the case of terminase, primers used were as in SEQ ID No. 70 and 71). As seen in the gel pictures shown in
This example demonstrated that terminase PCR has a much higher sensitivity than techniques based on 16s. +=control, a high concentration of bacterial cells.
Example 5: Clinical ResultsThe sensitivity of the BbFAM PCR was also investigated against 222 serum samples, which are all derived from clinically-confirmed Lyme patients (among those patients, 91 of patients have ELISA and or Western Blot data).
207 out of the 222 patients showed BbFAM PCR positive, representing a sensitivity of 93.2%.
91 out of 222 patients had been examined by either ELISA and/or WB.
Out of the 91 patients, 16 of them showed ELISA and/or WB positive, representing a sensitivity of 17.6%. Out of these 91 patients, 85 showed positive to BbFAM PCR, representing a sensitivity of 93.4%, which agrees well with the sensitivity calculated based on 222 patients. If you look into the correlation between BbFAM PCR results to the ELISA/WB data, you will find that the 16 ELISA and/or WB positive patients all showed BbFAM PCR positive. In addition, 6 patients from the 91 patient cohort who displayed BbFAM PCR negative also showed ELISA/WB negative. The vast majority of clinically confirmed patients in the 91 cohort only showed positive to BbFAM PCR, but negative to ELISA/WB, an indication of high sensitivity and reliability of BbFAM PCR. To compare the sensitivity of BbFAM with the current commercial Lyme PCR detection kit, GeneProof Borrelia burgdorferi PCR Kit was applied to 65 serum samples that were randomly selected from the 222 cohort. Only 7 out of 65 serum samples showed positive to GeneProof kit (a sensitivity of 10.8%).
SUMMARYThis is the first study to use a molecular marker to investigate the distribution and diversity of Borrelia phages.
A phylogentic tree constructed by the inventors on phage terminase gene shows that it is a good phylogenetic marker because the Borrelia phage sequences form a discrete yet genetically diverse group which is clearly separated from other spirochetes. Lyme disease infection (ie Borrelia burgdorferi sensu lato infection) forms a discrete well supported clade and these correlate well with bacteria.
Summary for Lyme Disease
-
- 1) Overall ability to identify LD much higher sensitivity compared to bacterial 16S method. In addition, the clinical results also demonstrate that the phage terminase-based real time PCR is significantly more sensitive than bacterial 16S-based PCR (GeneProof PCR kit).
- 2) Relates to multiple species of Borrelia burgdorferi sensu lato (Table 4: Phage terminase-based real time PCR against different Lyme Borrelia and Relapsing fever Borrelia strains)
- 3) Early detection possible as the phage based test can detect a low concentration of bacteria. The real time PCR has a low detection limit of 30 copies of terminase gene.
Primers and TaqMan probes (Table 8) were designed based on the B. hermsii terminase gene sequence using PrimerQuest® Tool (IDT). To ensure the specificity of the primer/probe combinations (referred to as ‘BhFAM’), BLAST analysis using sequences submitted to GenBank was performed. Big E-value drops were observed from 0.000004 to 0.004 between B. hermsii hit and the next closest blast hit of B. turicatae and B. parkeri.
‘In silico PCR’ was performed against all the available bacterial species, PCR product of the correct sizes was only observed from Borrelia hermsii. The TaqMan probe was labelled 5′ with 6-carboxyfluorescein (FAM) fluorescent dye and a double-quencher with a ZEN™ Quencher and Iowa Black FQ to the 3′ (5′FAM/ZEN/3′IBFQ). These double-quenched probes generate less background and increased signal compared to probes containing a single quencher. Both primers, the probe and PrimeTime Gene Expression Master Mix were supplied by IDT. by IDT.
As seen in table 9, the primer/probe were tested against DNA extracted from different genotypes of Borrelia strains. No positive can be seen from all Lyme Borrelia strains (1-6) and other relapsing fever Borrelia strains. Only B. hermsii generated the correct PCR product. Apart from ‘in silico’ PCR, ‘wet experiment’ was also carried out to confirm that no PCR products were observed when BhFAM PCR was performed against a range of different bacterial DNA including, E. coli, Pseudomonas, Clostridium, Haemophilus, Burkholderia, and Salmonella.
Two sets of primers and TaqMan probes were designed based on two B. miyamotoi terminase genes using PrimerQuest® Tool (IDT) with manual inspection (referred to as ‘BmFAM’ and ‘Bm-2FAM’, respectively as shown in the Table 10). Both sets target different versions of terminase genes located on different plasmids, therefore they are complementary to each other in detecting B. miyamotoi. To ensure the specificity of the primer/probe combinations, BLAST analysis using sequences submitted to GenBank was performed. Big E-value drops were observed for both sets of Taqman probes. For example, BmFAB and Bm-1FAM showed E-value drops from 0.0002 to 0.79 and 0.006 to 1.6, respectively, between miyamotoi hits and the next closest blast hit. ‘In silico PCR’ (http://insilico.ehu.es/PCR/) was performed against all the available bacterial species, PCR product of the correct sizes was only observed from Borrelia miyamotoi. This demonstrated specificity of the primer/probe combinations in detecting B. miyamotoi strains. The TaqMan probe was labelled 5′ with 6-carboxyfluorescein (FAM) fluorescent dye and a double-quencher with a ZEN™. Quencher and Iowa Black FQ to the 3′ (5′FAM/ZEN/3′IBFQ). These double-quenched probes generate less background and increased signal compared to probes containing a single quencher. Primers, probes and PrimeTime Gene Expression Master Mix were supplied by IDT.
As seen in table 11, the primer/probe were tested against DNA extracted from different genotypes of Borrelia strains. No Ct value can be detected from all Lyme Borrelia strains (1-6) and relapsing fever Borrelia strains. PCR positive can only be observed in B. miyamotoi DNA. In addition, no PCR products were observed when both sets of primer/probe were performed against a range of different bacterial DNA including, E. coli, Pseudomonas, Clostridium, Haemophilus, Burkholderia, and Salmonella.
As a pilot study, 43 tubs of blood/serum samples derived from healthy volunteers and Lyme patients were randomly chosen and subjected to test agasint BmFAM and BbFAM, respectively. Results were as follows: 7 (16.3%) tubes showed positive to BmFAM, while 26 (60.5%) showed positive to BbFAM. This demonstrated a potential low level of B. miyamotoi carriage in the population. Large scale clinical validation is on-going.
Summary for Relapsing Fever
-
- 1) The phage-based test can specifically amplify RF Borrelia strains, and didn't amplify LD Borrelia strains. This makes it possible to design a phage terminase-based duplex PCR to diagnose LD and RF at the same time.
- 2) The phage-based RF tests have the ability to distinguish different RF Borrelia strains, such as B. miyamotoi and B. hermsii. This would enable clinicians to better manage and prescribe antibiotics once the RF species was known. With a fully validated phage-based RF test, clinicians would be better informed about which Borrelia species are causing the symptoms.
- 3) As a result of these successful initial validation results, large scale clinical validation is currently under way.
Claims
1. A method of determining infection of a subject by either Borrelia burgodorferi sensu lato or Relapsing Fever Borrelia with phage specific for Borrelia by determining presence or the absence of the phage dispensed from and specific to Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia in a blood sample derived from the subject infected or suspected of being infected by Borrelia burgodorferi sensu lato or Relapsing Fever Borrelia, the method comprising the steps of:
- a) extracting phage nucleic acid from the blood sample by
- i) incubating the Borrelia in ammonium hydroxide and
- ii) adding phenol-chloroform to the Borrelia and ammonium hydroxide mixture,
- b) detecting the presence or absence of the phage nucleic acid dispensed from and specific to Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia in the blood sample obtained from a subject infected or suspected of being infected by Borrelia burgodorferi sensu lato or Relapsing Fever Borrelia; and
- c) determining the Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia infection of the subject wherein detection of the phage specific to either of Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia in the sample is indicative of infection of the subject of Borrelia burgodorferi sensu lato or Relapsing Fever Borrelia, and the lack of detection of phage dispensed by Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia in the sample indicates the subject is not infected by Borrelia burgodorferi sensu lato or Relapsing Fever Borrelia.
2. The method of claim 1, wherein the phage nucleic acid encodes a terminase protein.
3. The method of claim 1, wherein the phage nucleic acid comprises a nucleic acid according to the sequence of:
- a) SEQ ID NOS: 1-10; or a nucleic acid with greater than or equal to 70-99.5% sequence homology with SEQ ID NOS: 1-10; or a fragment thereof, or wherein the phage nucleic acid is capable of encoding a protein according to any one of SEQ ID NOS: 36-45 or a fragment thereof, or
- b) SEQ ID NOS: 84 or 86; or a nucleic acid with greater than or equal to 70-99.5% sequence homology with SEQ ID NOS: 84 or 86; or a fragment thereof, or wherein the phage nucleic acid is capable of encoding a protein according to any one of SEQ ID NOS: 85 or 87 or a fragment thereof.
4. The method of claim 1, wherein the phage nucleic acid detected comprises SEQ ID NO. 35; or a nucleic acid with greater than or equal to 70-99.5% sequence homology to SEQ ID NO. 35.
5. The method of claim 1, wherein the sample is plasma or whole blood.
6. The method of claim 1, wherein the sample is one that has been obtained in the early or late stage of Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia infection.
7. The method of claim 1, wherein the Borrelia burgdorferi sensu lato may be any of Borrelia afzelii, Borrelia spielmanii, Borrelia valaisiana, Borrelia garinii, Borrelia finlandensis, Borrelia bugdorferi sensu strictu, Borrelia bissettii, Borrelia bavariensis, Borrelia japonica, Borrelia lusitaniae, Borrelia sinica, Borrelia spielmanii, Borrelia tanukii, Borrelia turdi, Borrelia valaisiana, Borrelia yangtze, Borrelia mayonii, Borrelia carolinensis, and Borrelia andersonii, Borrelia lonestari, and Borrelia Americana or any combination thereof.
8. The method of claim 1, wherein the Relapsing Fever Borrelia may be any of Borrelia miyamotoi, Borrelia hermsii, Borrelia recurrentis, Borrelia crocidurae, Borrelia duttoni, Borrelia hispanica, Borrelia parkeri and Borrelia turicatae or any combination thereof.
9. The method of claim 1, wherein the method may determine the presence or the absence of a species ofBorrelia burgdorferi sensu lato or Relapsing Fever Borrelia in the sample, the method comprising the steps of:
- a) detecting the presence or absence of the Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia species specific phage in the sample; and
- b) determining the presence of the species of the Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia in the sample on the basis of the detection of the species specific phage, or the absence of the species of Borrelia burgdorferi sensu lato or Relapsing Fever Borrelia in the sample on the basis of the lack of detection of the species specific phage.
10. The method of claim 1, wherein the method additionally comprises treatment of a patient for Lyme disease, the patient's sample having tested positive for Borrelia burgdorferi sensu lato.
11. The method of claim 1, wherein the method additionally comprises treatment of a patient for Relapsing Fever, the patient's sample having tested positive for Relapsing Fever Borrelia.
12. The method of claim 10 or 11, wherein treatment comprises administering at least one antibiotic.
13. The method of claim 1 wherein the method further comprises subjecting the isolated nucleic acid to amplification by real time polymerase chain reaction.
14. The method of claim 2 wherein the method further comprises a forward primer which is a nucleic acid comprising SEQ ID NO: 70 to amplify a Borrelia bugdorferi sensu strictu specific terminase gene.
15. The method of claim 14 wherein the method further comprises a reverse primer which is a nucleic acid comprising SEQ ID NO: 71 to amplify the Borrelia bugdorferi sensu strictu specific terminase gene.
16. The method of claim 2 wherein the method further comprises a primer which is a nucleic acid comprising any one of SEQ ID NOS: 88 to 93 to amplify a Borrelia miyamotoi specific terminase gene.
17. The method of claim 16 wherein the method further comprises a forward primer which is a nucleic acid comprising SEQ ID NO: 89 or 92 to amplify the Borrelia miyamotoi specific terminase gene.
18. The method of claim 17 wherein the method further comprises a reverse primer which is a nucleic acid comprising SEQ ID NO: 90 or 93 to amplify the Borrelia miyamotoi specific terminase gene.
| 20030138868 | July 24, 2003 | Jungblut et al. |
| 20120184710 | July 19, 2012 | Lundberg et al. |
| 1394254 | March 2004 | EP |
| 98/58943 | December 1998 | WO |
| WO-9858943 | December 1998 | WO |
| 03/033724 | April 2003 | WO |
- Eggers, Christian H., “Identification and characterization of a bacteriophage of Borrelia burgdorferi” (2000). Graduate Student Theses, Dissertations, & Professional Papers. (Year: 2000).
- Chomczynski and Sacchi, Nature Protocols, 2006, 1(2):581-585. (Year: 2006).
- International Search Report dated Dec. 22, 2017 in corresponding PCT/GB2017/053323.
- Babb, Kelly et al., “Borrelia burgdorferi EbfC, a Novel, Chromosomally Encoded Protein, Binds Specific DNA Sequences Adjacent to erp Loci on the Spirochete's Resident cp32 Prophages,” Journal of Bacteriology, Jun. 2006, vol. 188, No. 12, pp. 4331-4339.
- Miller, Jennifer C. et al., “Expression of Borrelia burgdorferi erp genes during infection of non-human primates,” Microbial Pathogenesis, vol. 39, 2005, pp. 27-33.
- Miller, Jennifer C. et al., “Borrelia burgdorferi erp genes are expressed at different levels within tissues of chronically infected mammalian hosts,” International Journal of Medical Microbiology, vol. 296 S1, 2006, pp. 185-194.
- Search Report under Section 17 dated Aug. 20, 2017 for corresponding GB Application No. GB1618565.4.
- Christian H. Eggers, et al., Molecular Evidence for a New Bacteriophage of Borrelia burgdorferi, Journal of Bacteriology (Dec. 1999) vol. 181, No. 23, p. 7308-7313.
- Jonathan T. Skare, et al., Cloning and Molecular Characterization of Plasmid-Encoded Antigens of Borrelia burgdorferi Infection and Immunity (Sep. 1999) vol. 67, No. 9, p. 4407-4417.
- Thad B. Stanton, et al., Detection of bacteriophage VSH-1 svp38 gene in Brachyspira spirochetes, FEMS Microbiology Letters (2003) 224 p. 225-229.
- Office Action dated Oct. 24, 2022 in corresponding Chinese Application No. 201780082195.0.
Type: Grant
Filed: Nov 3, 2017
Date of Patent: Aug 29, 2023
Patent Publication Number: 20190276877
Assignees: UNIVERSITY OF LEICESTER (Leicester), PHELIX RESEARCH AND DEVELOPMENT LIMITED (London)
Inventors: Martha Rebecca Jane Clokie (Leicestershire), Jinyu Shan (Leicestershire), Louis Charles Teulieres (London)
Primary Examiner: Nicole Kinsey White
Application Number: 16/346,178
International Classification: C12Q 1/689 (20180101); C12Q 1/6811 (20180101); C12Q 1/6888 (20180101); G01N 33/569 (20060101);