Oral care product comprising a mutan binding domain

Disclosed is a polypeptide hybrid containing an amino acid sequence with binding affinity for mutan, the amino acid sequence being bound to an active component useful for oral care purposes; an oral care composition comprising a mutan binding domain; an oral care product comprising such an oral care composition of the invention; and finally the use of a mutan binding polypeptide hybrid or a single unit MBD for oral care purposes, including preventing dental plaque formation and/or removal of existing dental plaque.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is a continuation of U.S. application Ser. No. 09/295,744 filed Apr. 20, 1999, which is a continuation of PCT application No. PCT/DK97/00470 filed Oct. 27, 1997, and claims priority under 35 U.S.C. 119 of Danish application 1186/96 filed Oct. 25, 1996, the contents of which are fully incorporated herein by reference.

FIELD OF THE INVENTION

[0002] The present invention relates to a polypeptide with specific binding affinity for mutan, an oral care composition comprising a polypeptide hybrid of the invention, an oral care product comprising such an oral care composition, and finally the use of a polypeptide with a specific binding affinity for mutan for oral care purposes, including preventing dental plaque formation and/or removal of existing dental plaque.

BACKGROUND OF THE INVENTION

[0003] The formation of dental plaque leads to dental caries, gingival inflammation, periodontal disease, and eventually tooth loss. Dental plaque is a mixture of bacteria, epithelial cells, leukocytes, macrophages, and other oral exudate. Said bacteria produce highly branched polysaccharides which together with microorganisms from the oral cavity form an adhesive matrix for the continued proliferation of dental plaque.

[0004] As plaque continues to accumulate rock hard white or yellowish deposits arise. These deposits are called calcified plaque, calculus or tartar, and are formed in the saliva from plaque and minerals, such as in particular calcium.

[0005] Oral Polysaccharides

[0006] Oral polysaccharides mainly consist of the adhesive polysaccharides termed “fructans” and “glucans”.

[0007] Glucans are produced from carbohydrates, such as sucrose introduced into the mouth, e.g. as a food or beverage constituent, by the action of cariogenic microorganisms, such as Streptococcus sobrinus or Streptococcus sanguis, growing in the oral cavity.

[0008] The term “glucan” is a general common term covering a number of polysaccharides and includes cellulose, starch, dextran, mutan, pullulan etc.

[0009] Oral glucans comprise water-soluble dextran, having large portions of alpha-1,6-glucosidic linkage and as the major component a water-insoluble extra-cellular polysaccharide called “mutan” comprised of a backbone with alpha-1,3-glycosidic linkages and branches with alpha-1,6-glycosidic linkages.

[0010] Mutan bind to almost any surface such as the surface of teeth, (i.e. hydroxyapatite constituting the hard outer porous layer of the teeth), pellicle, the cell surface of oral microorganisms as well as to acceptor proteins on the cell of said cariogenic bacteria adhering to the teeth surface.

[0011] WO 95/31556 (Unilever) discloses the glucan binding domain of glycosyltransferase having specificity for binding to dextran (being a polysaccharide with mainly alpha-1,6-glucosidic linkages).

[0012] According to WO 95/31556 the glucan binding domain is covalently chemically bound to “material” having an activity, such as inhibitory effect against the formation of dental plaque. Said material may be an enzyme, such as galactose oxidase (see Example 6).

[0013] Polysaccharide binding domains conjugated to other proteins and peptides to aid in downstream processing of recombinant fermentation are known. For instance, researchers have made fusion or hybrid proteins containing a starch binding domain (Chen et al. (1991), Gene 991, p. 121-126), cellulose binding domain (Ong et al. (1989), TIBTech 7, p. 239-243) for the purpose of purifying the proteins on starch and cellulose resins, Polysaccharide binding fusion proteins useful as removable labels (WO 93/21331).

SUMMARY OF THE INVENTION

[0014] It is the object of the present invention to provide oral care products which efficiently prevent the formation of dental plaque and/or facilitates removal of already deposited dental plaque.

[0015] In the first aspect the present invention relates to a polypeptide hybrid comprising an amino acid sequence with binding affinity for mutan, said amino acid sequence being bound to an active component useful for oral care purposes.

[0016] In the second aspect the invention relates to an oral care composition comprising a polypeptide hybrid comprising an amino acid sequence with binding affinity for mutan bound, said amino acid sequence being bound to an active component useful for oral care purposes and further ingredients conventionally used in oral care compositions.

[0017] In the third aspect the invention relates to an oral care product comprising an oral care composition of the invention.

[0018] In the final aspect the invention relates to the use of a composition of the invention or oral care product of the invention for preventing the formation of dental plaque and/or removing dental plaque.

BRIEF DESCRIPTION OF THE DRAWINGS

[0019] FIG. 1 shows the binding isotherm of T. harzianum mutanase binding to mutan,

[0020] FIG. 2 shows lineage of the mutanase constructs pMT1796, pJW104 and pJW105. Regions of the plasmids are labelled as follows: the lipase and mutanase genes as open boxes; the mutan binding domain as “cooh terminus”; a thick-lined arc=promoter; an arrow signifies the direction of transcription; ø=mutanase signal sequence; ▪=mutanase prosequence; restriction enzyme sites are labelled.

[0021] FIG. 3 outlines the construction of the expression plasmid pJW105. Regions are marked as follows: the Humicola lanuginosa lipase gene (lipolase gene) as a striped box; the mutanase gene as an open box; primers by an arrow indicating their 5′ to 3′ orientation; the TAKA promoter by a heavy-line; restriction enzyme sites are labelled.

DETAILED DESCRIPTION OF THE INVENTION

[0022] It is the object of the present invention to provide oral care products which efficiently prevent the formation of dental plaque and/or facilitates removal of already deposited dental plaque.

[0023] The inventors of the present invention have provided polypeptide hybrids which increase the amount of active component delivered to dental plaque. This results in improved removal of dental plaque and/or in an improved dental plaque inhibiting/preventing effect when used in oral care compositions and products in comparison to the effect obtained by prior art oral care compositions and products, e.g. the composition disclosed in WO 95/31556, which delivers the active component to the dextran component of dental plaque.

[0024] The increased delivery of active component is obtained by a polypeptide (or amino acid sequence) which target(s) (ie. binds to) the major component of dental plaque, i.e. mutan.

[0025] Said polypeptide capable of binding to mutan may be bound to an active component useful for oral care purposes to form a polypeptide hybrid.

[0026] By using a polypeptide hybrid having a binding affinity for mutan an increased amount of active component (e.g. an enzyme) is brought in close contact with the substrate (i.e. the mutan component of the dental plaque), in comparison with e.g. polypeptide hybrids which target minor components, such as the dextran component, of dental plaque.

[0027] Consequently, when targeting the dental plaque using a polypeptide hybrid capable of binding to mutan more active component (e.g. enzyme) is delivered to the place of action resulting in a more efficient processing (e.g. degradation) of oral polysaccharides and hereby removal of dental plaque. In other words the mutan binding domain of the polypeptide hybrid provides access and proximity between the active component its substrate.

[0028] Further, the dental plaque formation is more efficiently prevented as the mutan binding domain acts as a sort of competitive inhibitor blocking the binding sites to which the dental plaque forming bacteria, such as Streptococcus sobrinus, and glucan binding proteins, such as glucosyltransferases (GTFs), can adhere. Consequently, a mutan binding domain may according to the present invention be a “single unit Mutan Binding Domain” as defined below.

[0029] As described in Example 12 it was found that the isolated single unit mutan binding domain binds to mutan, indicating that mutan binding domains are suitable for increasing the delivery of active component fused to the mutan binding domain to the mutan of dental plaque. Further, Example 12 also shows that single unit mutan binding domains are suitable for preventing the formation of dental plaque as the mutan binding domain when binding to mutan of dental plaque) inhibit further access of plaque forming microorganisms.

[0030] MBD

[0031] In the following “mutan binding domain” will be abbreviated as “MBD” and is meant to define all polypeptide sequences or peptide sequences having affinity for binding to mutan.

[0032] Most known MBDs today are found internally or at the N or C termini of mutanases.

[0033] As described in the Examples below, illustrating the present invention, the mutanase derived from Trichoderma harzianum CBS 243.71 comprises a mutan binding domain in the C-terminal end and a catalytic domain in the N-terminal end.

[0034] Single Unit Mutan Binding Domain (Single Uunit MBD)

[0035] The term “single unit MBD” may also be referred to as “Isolated MBD” or “Separated MBD”.

[0036] In the context of the present invention a “single unit MBD” includes up to the entire part of the amino acid sequence of a MBD-containing enzyme, e.g. a polysaccharide hydrolysing enzyme, being essentially free of the catalytic domain, but retaining the MBD(s).

[0037] Thus, in the context of the invention, the entire catalytic amino acid sequence of an enzyme (e.g. a mutanase) or other enzymes comprising one or more MBDs is not to be regarded as a single unit MBD.

[0038] Typically a single unit MBD constitutes one or more MBDs of a polysaccharide hydrolysing enzyme, one or more MBDs of a mutan binding protein or a protein designed and/or engineered to be capable of binding to mutan.

[0039] The single unit MBD is at least as large as the minimum number of amino acids in the amino acid sequence required to bind to mutan.

[0040] A single unit MBD may also be an amino acid sequence in which the binding and catalytic domain are one and the same.

[0041] Isolation of a MBD

[0042] In order to isolate the MBD of e.g. a mutanase, several genetic approaches may be used. One method uses restriction enzymes to remove a portion of the gene and then to fuse the remaining gene-vector fragment in frame to obtain a mutated gene that encodes a protein truncated for a particular gene fragment. Another method involves the use of exonucleases such as Ba131 to systematically delete nucleotides either externally from the 5′ and the 3′ ends of the DNA or internally from a restricted gap within the gene. These gene deletion methods result in a mutated gene encoding a shortened gene molecule which may then be evaluated for substrate binding ability. Appropriate substrates for evaluating the binding activity include mutan.

[0043] Once a nucleotide sequence encoding the substrate binding region has been identified, either as cDNA or chromosomal DNA, it may then be manipulated in a variety of ways to fuse it to a DNA sequence encoding the enzyme of interest. The mutan binding encoding fragment and the DNA encoding the enzyme of interest are then ligated with or without a linker. The resulting ligated DNA may then be manipulated in a variety of ways to provide for expression. Microbial hosts such as Aspergillus, e.g., A. niger and A. oryzae, Bacillus, E. coli or S. cerevisiae are preferred.

[0044] According to the invention the MBD may be bound to any active component including organic compounds, inorganic complexes, proteins, enzymes, peptides, antibodies and various ligands, which are useful for oral purposes, especially anti-plaque or anti-stain agents.

[0045] The coupling of the MBD and the active component may be performed through e.g. ester, sulfhydryl, peptide, isopeptide, amide and other types of chemical bonds.

[0046] MBD Hybrids

[0047] In the first aspect the invention relates to a polypeptide hybrid comprising an amino acid sequence with binding affinity for mutan bound to an active component useful for oral care purposes.

[0048] In an embodiment of the invention the MBD is conjugated to an enzyme to form a fusion protein or polypeptide-enzyme hybrid.

[0049] The enzyme moiety of the MBD-enzyme hybrid may be an enzyme from the following group of enzyme including oxidases, peroxidases, proteases, lipases, glucosidases, lipases, esterases, deaminases, ureases and polysaccharide hydrolases or mixtures thereof.

[0050] Examples 3 to 5 describe the construction, expression and purification of a MBD-enzyme hybrid constituted of the T. harzianum CBS 243.71 MBD fused to a Humicola lanuginosa lipase (Lipolase®). Other MBD-enzyme hybrids may be prepared in a corresponding way.

[0051] The above mentioned enzyme activities are preferred for oral care purposes as these activities are known to be suitable for oral care purposes. Some of the included enzyme activities are known to be capable of contributing to the degradation of different constituents of dental plaque.

[0052] Preferred as the enzyme moiety are glucosidases, preferably alpha-glycosidases, especially mutanases, dextranases, pullulanases and alpha-amylases, and mixtures thereof.

[0053] In the case of using a dextranase as the enzyme moiety it may for instance be derived from a strain of the genera Penicillium, Paecilomyces, Aspergillus, Fusarium, Spicaria, Verticillium, Helminthosporium and Chaetomium; bacteria of the genera Lactobacillus, Streptococcus, Celivibrio, Cytophaga, Brevibacterium, Pseudomonas, Corynebacterium, Arthrobacter and Flavobacterium, and yeasts such as Lipomyces starkeyi.

[0054] Specifically contemplated is dextranases derived from a strain of Paecilomyces or Penicillium, such as Paecilomyces lilacinum or Penicilium lilacinus.

[0055] In the case of using a mutanase as the enzyme moiety it may for instance be derived from a strain of the genera Trichoderma, Streptomyces, Cladosporium, Bacillus, Aspergillus

[0056] Specifically contemplated is mutanases derived from Trichoderna, such as Trichoderma harziaum, especially the deposited strain Trichoderma harzianum CBS 243.71.

[0057] It is preferred that the enzyme(s) is(are) substantially active at temperatures and pHs prevailing in the mouth when using the oral care product of the invention. This normally means that the enzymes should be substantially active between 20° C. and 40° C., and at pHs in the range from pH 4.0 to 8.0.

[0058] The term “substantially active” means in the context of the present invention that the enzyme in question has a relative activity above 70%, in particular above 80%, especially above 90% of the activity at the temperature optimum.

[0059] When using a MBD-enzyme hybrid of the invention a smaller amount of enzyme need to be used to obtain the desired effect and/or less time is needed to obtain the desired effect.

[0060] Preparation of MBD Hybrids

[0061] MBD hybrids of the invention may be prepared by recombinant DNA technology e.g. as described in WO 95/16782, WO 95/31556, WO 93/21331, WO 90/00609 or other documents referred to in the “Background of the Invention” section above.

[0062] More specifically MBD hybrids may be prepared by transforming into a host cell a DNA construct comprising at least a fragment of DNA encoding the MBD ligated, with or without a linker, to a DNA sequence encoding the polypeptide, e.g. an enzyme, of interest and growing the host cell to express the fused gene. The MBD hybrids may be described by the following formula:

MBD—MR—X,

[0063] wherein:

[0064] MBD can be either the N-terminal or the C-terminal region of an amino acid sequence corresponding to at least the MBD;

[0065] MR is the middle region (the linker), and may be a bond, or a short linking group of from about 2 to about 100 carbon atoms, in particular of from 2 to 40 carbon atoms, or typically from about 2 to about 100 amino acids, in particular of from 2 to 40 amino acids; and

[0066] X can be either the N-terminal or the C-terminal region and is the polypeptide of interest.

[0067] Other MBD Coniugates

[0068] The MBD hybrid may also be a conjugate of a MBD and another polypeptide, such as a non-enzymatic protein or peptide, or a chemical moiety. This will add an additional property to the oral care composition.

[0069] The MBD may be bound to anti-plaque agents, anti-staining agents, anti-microbial agents, antibodies, antibody fragments, histamins, lactoferins, defensins, magainins, cecropins, and other cationic anti-bacteriocins and bacteriocins.

[0070] Further, the MBD may also be chemically conjugated to e.g. microbicides including, but not limited to, triclosan, chlorhexidine, quaternary ammonium compounds, chloroxylenol, chloroxyethanol, thymol, and fluoride.

[0071] Anti-microbial cat-ions such as Zn, Sn, Cu and others can also be complexed to MBDs by forming conjugates with appropriate chelating agents such as (poly)carboxylic acids, amino acids and so on.

[0072] The user of an oral care product of the invention (which will be describe in more details below), prepared from the oral care composition of the invention also described below, will benefit from the present invention, as the direct and indirect disadvantages (e.g. yellow deposits on the teeth and prevention of dental holes and gingivitis, respectively) can be prevented more effectively than with prior art products.

[0073] Oral Care Compositions

[0074] In a second aspect the invention relates to an oral care composition comprising a MBD hybrid or single unit MBD and further ingredients conventionally used in oral care compositions.

[0075] The oral care composition of the invention may advantageously comprise MBD hybrids of the invention described above.

[0076] The enzyme moiety of the MBD-enzyme hybrids in the oral care composition may be an enzyme from the following group of enzyme including oxidases, peroxidases, proteases, lipases, glucosidases, lipases, esterases, deaminases, ureases and polysaccharide hydrolases, or mixtures thereof.

[0077] An oral care composition of the invention may suitably have incorporated an amount of 0.001-10 mg/ml MBD-hybrid calculated on the basis of final oral care product.

[0078] In a preferred embodiment the MBD hybrid is a MBD-enzyme hybrid. Preferred enzyme activities are glycosidase activities, such as an alpha-glycosidase activity, such as dextranase, mutanase, pullulanase and/or alpha-amylase activity.

[0079] In the cases of using a hybrid MBD-dextranase, MBD-mutanase, and/or MBD-pullulanase the enzyme activity should lie in the range from 0.001 KDU to 1000 KDU/ml, preferably from 0.01 KDU/ml to 500 KDU/ml, especially from 0.1 KDU/ml to 100 KDU/ml for MBD-dextranases, from 0.001 MU/ml to 1000 MU/ml, preferably from 0.01 MU/ml to 500 MU/ml, especially from 0.01 MU/ml to 100 MU/ml and from 0.01 MU/ml to 100 MU/ml, for MBD-mutanases, in the range from 0.001 KDU to 1000 KPU/ml, preferably from 0.01 KPU/ml to 500 KPU/ml, especially from 0.1 KPU/ml to 100 KPU/ml for MBD-pullulanase.

[0080] It is also contemplated according to the invention to include other enzyme activities in the oral care compositions of the invention. Contemplated enzymes, beside dextranase and mutanase, may be from the group including proteases, such as papain, endoglucosidases, lipases, amylase and mixtures thereof.

[0081] Oral Care Products

[0082] The invention also relates to oral care products comprising an oral care composition of the invention. The oral care product may have any suitable physical form (i.e. powder, paste, gel, liquid, ointment, tablet etc.). An “oral care product” can be defined as a product which can be used for maintaining or improving the oral hygiene in the mouth of humans and animals, by preventing formation of dental plaque, removing dental plaque, preventing and/or treating dental diseases etc.

[0083] At least in the context of the present invention, oral care products also encompass products for cleaning dentures, artificial teeth and the like.

[0084] Examples of such oral care products include toothpaste, dental cream, gel or tooth powder, odontic, mouth washes, pre- or post brushing rinse formulations, chewing gum, lozenges, and candy.

[0085] Toothpastes and tooth gels typically include abrasive polishing materials, foaming agents, flavouring agents, humectants, binders, thickeners, sweetening agents, whitening/bleaching/stain Ad removing agents, water, and optionally enzymes.

[0086] Mouth washes, including plaque removing liquids, typically comprise a water/alcohol solution, flavor, humectant, sweetener, foaming agent, colorant, and optionally enzymes.

[0087] Abrasive polishing material might also be incorporated into the dentifrice product of the invention. According to the invention said abrasive polishing material includes alumina and ion hydrates thereof, such as alpha alumina trihydrate, magnesium trisilicate, magnesium carbonate, kaolin, aluminosilicates, such as calcined aluminum silicate and aluminum silicate, calcium carbonate, zirconium silicate, and also powdered plastics, such as polyvinyl chloride, polyamides, polymethyl methacrylate, polystyrene, phenol-formaldehyde resins, melamine-formaldehyde resins, urea-formaldehyde resins, epoxy resins, powdered polyethylene, silica xerogels, hydrogels and aerogels and the like. Also suitable as abrasive agents are calcium pyrophosphate, water-insoluble alkali metaphosphates, dicalcium phosphate and/or its dihydrate, dicalcium orthophosphate, tricalcium phosphate, particulate hydroxyapatite and the like. It is also possible to employ mixtures of these substances.

[0088] Dependent on the oral care product the abrasive product may be present in from 0 to 70% by weight, preferably from 1% to 70%. For toothpastes the abrasive material content typically lies in the range of from 10% to 70% by weight of the final toothpaste product.

[0089] Humectants are employed to prevent loss of water from e.g. toothpastes. Suitable humectants for use in oral care products according to the invention include the following compounds and mixtures thereof: glycerol, polyol, sorbitol, polyethylene glycols (PEG), propylene glycol, 1,3-propanediol, 1,4-butanediol, hydrogenated partially hydrolyzed polysaccharides and the like. Humectants are in general present in from 0% to 80%, preferably 5 to 70% by weight in toothpaste.

[0090] Silica, starch, tragacanth gum, xanthan gum, extracts of Irish moss, alginates, pectin, cellulose derivatives, such as hydroxyethyl cellulose, sodium carboxymethyl cellulose and hydroxypropyl cellulose, polyacrylic acid and its salts, polyvinylpyrrolidone, can be mentioned as examples of suitable thickeners and binders, which helps stabilizing the dentifrice product. Thickeners may be present in toothpaste creams and gels in an amount of from 0.1 to 20% by weight, and binders to the extent of from 0.01 to 10% by weight of the final product.

[0091] As foaming agent soap, anionic, cationic, non-ionic, amphoteric and/or zwitterionic surfactants can be used. These may be present at levels of from 0% to 15%, preferably from 0.1 to 13%, more preferably from 0.25 to 10% by weight of the final product.

[0092] Surfactants are only suitable to the extent that they do not exert an inactivation effect on the present MBD hybrids. Surfactants include fatty alcohol sulphates, salts of sulphonated mono-glycerides or fatty acids having 10 to 20 carbon atoms, fatty acid-albumen condensation products, salts of fatty acids amides and taurines and/or salts of fatty acid esters of isethionic acid.

[0093] Suitable sweeteners include saccharin.

[0094] Flavors, such as spearmint, are usually present in low amounts, such as from 0.01% to about 5% by weight, especially from 0.1% to 5%.

[0095] Whitening/bleaching agents include H2O2 and may be added in amounts less that 5%, preferably from 0.25 to 4%, calculated on the basis of the weight of the final product.

[0096] Water is usually added in an amount giving e.g. toothpaste a flowable form.

[0097] Further water-soluble anti-bacterial agents, such as chlorhexidine digluconate, hexetidine, alexidine, quaternary ammonium anti-bacterial compounds and water-soluble sources of certain metal ions such as zinc, copper, silver and stannous (e.g. zinc, copper and stannous chloride, and silver nitrate) may also be included.

[0098] Also contemplated according to the invention is the addition of compounds which can be used as fluoride source, dyes/colorants, preservatives, vitamins, pH-adjusting agents, anti-caries agents, desensitizing agents etc.

[0099] Other essential components used in oral care products and in oral care products of the invention are enzymes. Enzymes are biological catalysts of chemical reactions in living systems.

[0100] Enzymes combine with the substrates on which they act forming an intermediate enzyme-substrate complex. This complex is then converted to a reaction product and a liberated enzyme which continue its specific enzymatic function.

[0101] Enzymes provide several benefits when used for cleansing of the oral cavity. Proteases break down salivary proteins, which are adsorbed onto the tooth surface and form the pellicle, the first layer of resulting plaque. Proteases along with lipases destroy bacteria by lysing proteins and lipids which form the structural components of bacterial cell walls and membranes.

[0102] Dextranase breaks down the organic skeletal structure produced by bacteria that forms a matrix for bacterial adhesion. Proteases and amylases, not only prevents plaque formation, but also prevents the development of calculus by breaking-up the carbohydrate-protein complex that binds calcium, preventing mineralization.

[0103] A toothpaste produced from an oral care composition of the invention (in weight % of the final toothpaste composition) may typically comprise the following ingredients: 1 Abrasive material 10 to 70% Humectant 0 to 80% Thickener 0.1 to 20% Binder 0.01 to 10% Sweetener 0.1% to 5% Foaming agent 0 to 15% Whitener 0 to 5% Enzymes 0 to 20% MBD hybrid and/or single unit MBD 0.0001% to 1%

[0104] In a specific embodiment of the invention the oral care product comprises 2 a) 10% to 70% Abrasive material b) 0 to 80% Humectant c) 0.1 to 20% Thickener d) 0.01 to 10% Binder e) 0.1% to 5% Sweetener f) 0 to 15% Foaming agent g) 0 to 5% Whitener h) 0 to 20% Enzymes i) 0.0001% to 1% MBD hybrid and/or single unit MBD

[0105] Said MBD hybrid referred to in connection with the specific toothpaste and mouth wash above may have any activity, such as enzymatic activity, suitable for oral care purposes. Preferred enzyme activities are alpha-glycosidases, especially dextranases, mutanases, pullulanases, and alpha-amylases. Said enzyme referred to include all enzyme activities suitable in oral care products.

[0106] Use of an Oral Care Composition or Product

[0107] In the third aspect the invention relates to the use of the composition of the invention or an oral care product of the invention for preventing the formation of plaque and/or for removing dental plaque.

[0108] Method of Manufacture

[0109] The oral care composition and products of the present invention can be made using methods which are common in the oral product area.

MATERIALS AND METHODS

[0110] Materials

[0111] Enzymes

[0112] Mutanase produced by Trichoderma harzianum CBS 243.71 (available from Novo Nordisk A/S) Humicola lanuginosa lipase (available from Novo Nordisk ANS as Lipolase®) and is described in EP 305 216.

[0113] Plasmids

[0114] pAHL: a Humicola lanuginosa lipase gene (sometimes referred to as lipolase gene) containing plasmid described in EP 305,216.

[0115] pMT1 796: mutanase expression plasmid prepared as described in Example 8.

[0116] pHD414: Aspergillus expression vector is a derivative of the plasmid p775 (described in EP 238.023). The construction of the pHD414 is further described in WO 93/11249. pHD414 contains the A. niger glucoamylase terminator and the A. oryzae TAKA amylase promoter.

[0117] pHD414+mut (pHD414 comprising the T. harzianum mutanase gene)

[0118] pHan37 containing the TAKA:TPI promoter

[0119] Linkers 3 Linker #1: GATCCTCACA ATG TTG GGC GTT GTC CGC CGT CTA GGC CTA GG (SEQ ID NO: 15)     GAGTGT TAC AAC CCG CAA CAG GCT GCA GAT CCG GAT CCG C (SEQ ID NO: 16)            Met Leu Gly Val Val Arg Arg Leu Gly Leu Gly (SEQ ID NO: 17) Linker #2:       C CAA TAC TGT TAG T (SEQ ID NO: 18)  GT ACG GTT ATG ACA ATC AGATC (SEQ ID NO: 19) Ala Cys Gln Tyr Cys *** (SEQ ID NO: 20)

[0120] Microorganisms

[0121] Trichoderma harzianum CBS 243.71

[0122] Streptococcus sobnnus strain CBS 350.71 identifiable as OMZ 176

[0123] Actinomyces viscosus DSM 43329

[0124] Fusobacterium nucleatum subsp. polymorphum DSM 20482

[0125] A. oryzae JaL125: Aspergillus oryzae host strain with the alkaline protease gene named “alp” deleted. Strain JaL125 is disclosed in WO 97/35956 (Novo Nordisk A/S)

[0126] Solutions and the Like

[0127] Britton-Robinson Buffer

[0128] CAPS (3-cyclohexylamino-1-propanesulfonic acid) (Sigma)

[0129] Coomassie Brilliant Blue R250(Sigma)

[0130] Peroxidase-conjugated swine immunoglobulins (DAKO, Denmark)

[0131] Erythrosin B (Sigma)

[0132] Equipment

[0133] Shaker (Eppndorf Thermomixer, Type 5436)

[0134] 473A Protein Sequencer from Applied Biosystems

[0135] SDS-PAGE 4-20% (Novex)

[0136] Tricine 16% gel (Novex)

[0137] Tris-Glycine 4-20% (Novex)

[0138] Immobolin PSQ PVDF membrane (Millipore)

[0139] Chromameter CR-200 (Minolta)

[0140] Preparation of Hydroxyapatite Disks

[0141] Hydroxyapatite (HA) disks are prepared by compressing 250 mg of hydroxyapatite in a disk die at about 5,900 kg (13,000 lbs) of pressure for 5 minutes. The disks are then sintered at 600° C. for 4 hours and finally hydrated with sterile deionized water.

[0142] Sterilisation of Hydroxyapatite Disks

[0143] HA disks are sterilised at 180° C. for two hours.

[0144] Preparation of Mutan

[0145] Mutan is prepared by growing Streptococcus sobrinus CBS 350.71 at pH 6.5, 37° C. (kept constant), and with an aeration rate of 75 rpm in a medium comprised of the following components: 4 NZ-Case 6.5 g/liter Yeast Extract 6 g/liter (NH4)2SO4 20 g/liter K2PO4 3 g/liter Glucose 50 g/liter Pluronic PE6100 0.1%

[0146] After 35 hours, sucrose is added to a final concentration of 60 glliter to induce glucosyltransferase. The total fermentation time is 75 hours. The supernatant from the fermentation is centrifuged and filtered (sterile). Sucrose is then added to the supernatant to a final concentration of 5% (pH is adjusted to pH 7.0 with acetic acid) and the solution is stirred overnight at 37° C. The solution is filtered and the insoluble mutan is harvested on propex and washed extensively with deionized water containing 1% sodium benzoate, pH 5 (adjusted with acetic acid). Finally, the insoluble mutan is lyophilized and ground.

[0147] Methods

[0148] Molecular Biology Procedures

[0149] All molecular biology procedures including restriction digests, DNA ligations, E. coli transformations, DNA isolations, Southern hybridizations, PCR amplifications, and library constructions and screenings were completed using standard techniques (Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989. Molecular cloning: A laboratory manual/E. F. Cold Spring Harbor Laboratory Press, Plainview, N.Y.).

[0150] Determination of Dextranase Activity (KDU)

[0151] One Kilo Novo Dextranase Unit (1 KDU) is the amount of enzyme which breaks down dextran forming reducing sugar equivalent to 1 g maltose per hour in Novo Nordisk' method for determination of dextranase based on the following standard conditions: 5 Substrate Dextran 500 (Pharmacia) Reaction time 20 minutes Temperature 40° C. PH 5.4

[0152] A detailed description of Novo Nordisk's analytical method (AF 120) is available on request.

[0153] Determination of Mutanase Activity (MU)

[0154] One Mutanase Unit (MU) is the amount of enzyme which under standard conditions liberates 1 mmol reducing sugar (calculated as glucose) per minute. 6 Standard Conditions Substrate 1.5% mutan Reaction time 15 minutes Temperature 40° C. PH 5.5

[0155] A detailed description of Novo Nordisk's analytical method (AF 180/1-GB) is available from Novo Nordisk A/S on request.

[0156] Preparation of Mutan Adhered Glass Wall

[0157] Streptococcus sobrinus OMZ 176 (CBS 350.71) is inoculated in a glass tube (22 mm diameter×150 mm height) containing 10 ml Todd Hewitt Broth with 2% sucrose and the tube is allowed to stand overnight at 37° C. The broth is discarded and adhered mutan and Streptococcus sobrinus cells on glass wall are washed twice with 10 ml of 0.85% NaCl solution.

[0158] Langmuir Fit

[0159] A=(Amax*E)/((1/K(ads)+E)

[0160] A: Adsorbed enzyme

[0161] E: Free enzyme

[0162] Amax: Max adsorbed enzyme

[0163] K(ads): Adsorption coefficient

[0164] The Langmuir fit is described in Stuart, J. Y. & Ristoph, D. L., (1984), Biotechnol. Bioengng, 27, p 1056+.

[0165] Assessment of the Plaque Inhibition Effect

[0166] The method used for assessing the plaque removal effect is based on the method described by Kao in JP 2250816. According to the present method the hydroxyapatite disks, sterilised as described above, become coated with a biofilm by being placed overnight in the presence of three strains of oral microorganisms (Streptococcus sobrinus, Actinomyces viscosus and Fusobacterium nucleatum) and various enzymes in a Brain Heart Infusion Medium (Difco) containing 0.2% sucrose.

[0167] To test plaque inhibition effect, 0.1% Erythrosin B in PBS (phosphate buffered saline) is used to stain plaque present on the hydroxyapatite disks red. The intensity of the red colour (referred to as a*) is measured on a Chromameter CR-200. The maximum a* value is 60. Values below that indicate a less intensive red colour (i.e. less plaque present). An a* value of zero indicated no red colouring (i.e. no plaque). A plaque inhibition effect is expressed as a relative figure based on the value of a* for a non-treated biofilm being 100%.

EXAMPLES Example 1

[0168] Binding of Purified Mutanase to Mutan

[0169] The binding of purified T. harzianum CBS 243.71 mutanase (SEQ ID NO: 2) to mutan was investigated by incubating mutanase in varying concentration with 1 mg/ml mutan in 10 mM Britton-Robinson buffer, pH 7, at 4° C. for 1 hour while stirring. The samples were then centrifuged at 15,000 g for 2.5 minutes and filtered through 0.45 micrometer filters (Millipore). The residual activity was measured in the supernatant. The binding isotherm obtained can be filted to simple Langmuir binding and an affinity constant and a max adsorption constant can be obtained. FIG. 1 displays the result of the test. As can be seen the mutanase binds to mutan.

Example 2

[0170] Construction of the Recombinant Mutanase Expression Vector pMT1796

[0171] A cDNA clone encoding mutanase was identified in a Trichoderma harzianum CBS 243.71 library by hybridization with a fragment of the mutanase gene amplified by PCR using primers based on the mutanase sequence shown in SEQ ID NO: 1.

[0172] DNA sequence analysis of the isolated clone, pHD414+mut, showed that it indeed encoded the mutanase gene, and that the 5′ end of the construct contained a long leader sequence. To remove this leader, pHD414+mut was restricted with the enzymes EcoRi, Nail and Xhol. From this digestion a 3499 nt (nucleotide) vector fragment and a 610 nt NarliXhol fragment were isolated. These two fragments were then ligated with linker #1 (see above) and a 618 nt EcoRl/BamHI fragment from pHan37 containing the TAKA:TPI promoter, giving plasmid pJW99. HD414+mut was next digested with Xhol and Sphl, and a 1790 nt fragment encoding amino acids 35-598 of the mutanase gene was isolated.

[0173] This fragment was ligated with linker #2 (see above) and pJW99 that had been linearized i′ E with the restriction enzymes Xbal and Xhol. The resulting plasmid, pMT1802, contains the T. harzianum mutanase gene under the control of the TAKA:TPI promoter. Plasmid pMT1796 is identical to pMT1802 except that E36 of the mutanase protein has been changed to K36 by replacing the Xhol/Kpnl fragment of pMT1802 with a PCR amplified fragment containing the desired mutation.

[0174] This PCR fragment was created in a two step procedure as reported in Ho, et al. (1989), Gene, 77, p. 51-59, using the following primers: 7 Primer 1 (SEQ ID NO: 8) (nt 2751 5′-CAGCGTCCACATCACGAGC nt 2769); and Primer 2 (SEQ ID NO: 9) (nt 3306 5′-GAAGAAGCACGTTTCTCGAGAGACCG nt 3281); Primer 3 (SEQ ID NO: 10) (nt 3281 5′-CGGTCTCTGAGAAACGTGCTTCTTC nt 3306) and Primer 4 (SEQ ID NO: 11) (nt 4266 5′-GCCACTTCCGTTATTAGCC nt 4248); nucleotide numbers refer to the pMT1802 plasmid (See SEQ ID NO: 12).

Example 3

[0175] Construction of Recombinant MBD-Lipase Hybrid A. oryzae Expression Plasmid pJW105

[0176] Construction of pJW 104 (DNA construct with a mutan binding domain)

[0177] pJW104 containing an internal deletion of the mutanase coding region encompassing amino acids 32-536 (nt 94-1608) was constructed as follows:

[0178] The mutanase expression plasmid, pMT1796 (described in Example 2), contains two unique restriction sites which were used in the construction of pJW104: a Xhol site that sits 6 nucleaotides 5′ to the first codon of the mature protein and an Xbal site that immediately follows that stop codon (see FIG. 2).

[0179] A primer, Primer C (SEQ ID NO: 3), was made. The 3′ end of this primer consists of 21 nucleotides matching the sequence of the mutanase gene corresponding to amino acids 537 to 543 in the sense direction. The 5′ end of the primer harbors a Xhol site. 8 Primer C: 5′ CATACTCGAGAAACGT GCC AGC AGC ACG CCG CCA TCG 3′         Xho I Ala Ser Ser Thr Pro Pro Ser 537

[0180] Another primer, Primer D (SEQ ID NO: 4), was made. This primer match a sequence of pMT1796 downstream from the Xbal site, and oriented in the opposite direction of primer C. Primer D:

[0181] 5′ GATTACAATCACATGACTTGGC 3′

[0182] pMT 1796 was PCR amplified using the primers C and D. Digestion of the 433 nt amplicon with Xhol and Xbal yielded a fragment of 290 nt that was cloned into pMT1796 that had been linearized with these same two enzymes. Altered regions of pJW104 were DNA sequences to confirm the presence of the deletion and to check the integrity of the mutanase gene.

[0183] Construction of pJW105

[0184] To create pJW105, three DNA fragments (shown in FIG. 3) were ligated: a vector fragment from pMT1796, a fragment containing the amino portion of the Humicola lanuginosa lipase gene, and a PCR amplicon containing the in-frame fusion between the COOH terminus of the Humicola lanuginosa lipase gene and the MBD of T. harzianum mutanase. pMT1796 contains two unique restriction enzyme sites, a BamHl fragment that sits at the 3′ end of the TAKA promoter just before the initiating Met and a Nael site that sits over codons 425 and 426 in the COOH terminus of mutanase gene. Digestion of the plasmid with these two enzymes gives a 4359 nt fragment that was gel purified. The Humicola lanuginosa lipase gene portion of the construct is a 727 nt BamHI/BstXl restriction fragment from the expression plasmid pAHL. The unique BamHI site within this plasmid lies immediately 5′ to the start codon of the gene, and the unique BstXI site lies over codons 214-216 of the mature Humicola lanuginosa lipase protein. The final piece of the construct was created using overlap-PCR-extension (Ho et al. (1989), Gene, 77, 51-59) with two rounds of PCR amplification and the primers E, F, G and further Primer D (see above):

[0185] Primer E (SEQ ID NO: 5): 9 5′ CGGAACACTCTACCGCATTACC 3′ Primer F (SEQ ID NO: 6): 5′ CGGCGTGCTGCTGGCAGGAAGACATGTCCCAATTAAC 3′, Primer G (SEQ ID NO: 7) 5′ GTTAATTGGGACATGTCTTCCTGCCAGCAGCACGCCG 3′

[0186] Primers F and G overlap the Humicola lanuginosa lipase/mutanase fusion of the construct. First round amplification consisted of two separate reactions one of which paired primers E and F with the lipase plasmid pAHL, and the second that paired primers G and D with the mutanase plasmid pMT1796. This reaction yielded fragments of 237 and 449 nt, respectively. Second round amplification paired primers E and D with 0.25 ml of the reaction mixtures from the amplification round 1. The resulting 670 nt fragment was digested with BstXl and Nael, gel purified and ligated together with the vector fragment and the 727 nt BamHI/BstXl fragment from the lipase gene. The protein coding region of the resulting plasmid, pJW105, was DNA sequenced.

[0187] The DNA and amino acid sequence of the MBD-lipase hybrid is shown in SEQ ID NO: 13 and 14, respectively.

Example 4

[0188] Expression of Recombinant MBD-lipase Hybrid in Aspergillus oryzae

[0189] 0.1 ug pJW105 was transformed into A. oryzae strain JaL125 using a PEG-mediated protocol (see EP 238,023) and a DNA mixture containing 0.5 microgram of a plasmid encoding the gene that confers resistance to the herbicide Basta. Transformants were selected on minimal plates containing 0.5% basta and 50 mM urea as a nitrogen source.

[0190] Shake Flask Cultures

[0191] Transformed colonies were spore purified twice on selection media and spores were harvested. A 20 ml universal container (Nunc, cat #364211) containing 10 ml YPM (2% maltose, 1% bactopeptone and 0.5% yeast extract) was inoculated with spores and grown for 5 days with shaking at 30° C. The supernatant was harvested after 5 days growth.

[0192] SDS-PAGE and protein transfers were performed using standard protocols.

Example 5

[0193] Purification of the Recombinant MBD-lipase Hybrid

[0194] Purification of the recombinant MBD-lipase hybrid from the A. oryzae JaL125 fermentation broth was performed as follows: Filtered fermentation broth was incubated with 5% mutan in 0.1% sodium acetate, pH 5.5, for 30 minutes while stirring. The sample was centrifuged for 10 minutes at 10,000 g. The precipitate was re-suspended in 1 ml 0.1 M sodium acetate, pH 5.5, and centrifuged. This step was repeated 3 times before eluting the MBD with water (MilliQ-filtered). The eluate was concentrated on an Amicon cell (YM10 membrane). The fusion protein (i.e. the MBD hybrid) was further purified by gel filtration using a Superdex75 16/60 column (Pharmacia) in 0.1 M sodium acetate, pH 6 hybrid.

Example 6

[0195] Binding of Recombinant MBD-lipase Hybrid to Mutan

[0196] The binding of purified MBD-lipase hybrid (SEQ ID NO: 14) to mutan is investigated using the procedure described in Example 1.

Example 7

[0197] Expression of Recombinant Single Unit MBD in Aspergillus oryzae

[0198] Expression of the A. oryzae expression plasmid pJW104 coding for the single unit MBD of the T. harzianum mutanase was carried out as described in Example 4.

Example 8

[0199] Purification of the Recombinant Single Unit MBD

[0200] Isolated MBD was purified by incubating 30 ml fermentation broth of A. orzyae expressing the C-terminal domain of the mutanase with 3 ml 5% mutan in 0.1 sodium acetate, pH 5.5, for minutes while stirring.

[0201] The sample was centrifuged for 10 minutes at 10,000 g. The precipitate was re-suspended in 1 ml 0.1 M sodium acetate, pH 5.5, and centrifuged. This step was repeated 3 times before eluting the MBD with water (MilliQ-filtered). Purified MBD appeared at a molecular weight around 10 kDa in westerns.

Example 9

[0202] Immuno Detection of MBD

[0203] The MBD can be detected by Mancini immuno diffusion. 12 ml of 1% agarose in 20 mM Tris-Maleate, pH 7, at 56° C. was added 100 &mgr;l of mutanase antibodies raised in rabbits. The solution was poured onto GelBond Film. 10 &mgr;l samples were added to each well and the gel was left over night at room temperature. The gel was then washed in 0.5% NaCl and 3 times in water before drying. The gel was stained in 0.5% Coomassie Brilliant Blue 45% ethanol, 10% acetic acid for 1 minute and de-stained in 25% ethanol, 10% acetic acid.

Example 10

[0204] Western Analysis of MBD, Catalytic Domain and Humicola lanuginosa Lipase-MBD Fusion Protein

[0205] SDS-PAGE was performed using a Tricine 16% gel from Novex (for the MBD) or Tris-Glycine 4-20% (Novex) (for higher Mw proteins). The proteins were blotted onto a Millipore Immobolin PSQ PVDF membrane in 10 mM glycine, 20% methanol, pH 11.8 at 175 mA for 3 hours. Standards and controls were Coomassie stained (see Example 9) while the rest of the membrane was blocked with 4.875 ml Tween20 in 245 ml washing solution (30.3 g Tris base, 43.8 g NaCl, 2.5 ml Tween20 in 5 liters water) for 3 minutes before washing with the washing solution. The membrane was then reacted with 50 &mgr;l of the detecting antibodies (mutanase antibodies raised in rabbits) diluted to 50 ml with washing solution and washed 4 times with washing solution before incubating with peroxidase-conjugated swine immunoglobulins to rabbit immunoglobulins (50 &mgr;l in 50 ml washing solution). The membrane was washed again with washing solution and once with 50 mM sodium acetate, pH 5, and stained with carbazol (2 ml 3-amino-9-ethylcarbazol in 48 ml acetate buffer added 25 &mgr;l 30% H2O2). The membrane was then washed in water and fixed in 12.4 g sodium thiosulfate in 1 liter of water.

Example 11

[0206] Isolation of Single Unit MBD of T. harzianum

[0207] Single unit MBD of T. harzianum CBS 243.71 was isolated by proteolytic degradation of mutanase.

[0208] Purified T. harzianum mutanase was digested with chymoptrypsin in a ratio of 1:100 (protease:mutanase) in 0.1 M Tris-HCI buffer, pH 8.5 at 30° C. for 2.5 hours. The resulting digest was investigated using SDS-PAGE (Novex 4-20%). The 42 kDa band observed was blotted onto a Millipore Immobolin pSQ PVDF membrane in 10 mM CAPS, 6% methanol at 175 mA for 3 hours. The membrane was stained with 0.1% Coomassie Brilliant Blue R250 in 60% methanol, 1% acetic acid and de-stained in 40% methanol. The 42 kDa band was subjected to N-terminal amino acid sequencing using the 473A Protein Sequencer from Applied Biosystems according to the manufacturer's description.

[0209] The N-terminal sequence obtained was Ser-Leu-Thr-Ile-Gly-Leu corresponding to a proteolytic cleavage between Phe436 and Ser437 (see SEQ ID NO. 1 or 2) in the mature mutanase. The C-terminal domain obtained by chymotrypsin digestion was shown to bind to mutan by incubating the 50 microliter chymotrypsin digest with 50 microliter 5% mutan in 0.1 M ammonium bicarbonate, pH 8.15 for 30 minutes at 25°0C. The sample was then centrifuged for 5 minutes at 15,000 g and 30 microliter sample was then loaded onto SDS-PAGE (Novex 4-20%). A control without mutan (buffer) was included.

Example 12

[0210] Binding of Purified MBD to Mutan

[0211] The single unit MBD was mixed 1:1 with 0.1 M acetate buffer, pH 5.5 with/without 5% mutan. The samples were incubated for 30 minutes at room temperature before centrifuging the samples 5 minutes at 15,000 g. Ten microliter of supernatant was analyzed by Mancini immuno diffusion. No MBD was detected in the sample pre-incubated with mutan indicating that the single unit MBD binds to mutan.

Example 13

[0212] Catalytic Domain

[0213] Fermentation broth of A. oryzae expressing the N-terminal domain of the mutanase was analyzed for. It was observed that said N-terminal domain has catalytic activity.

[0214] The invention described and claimed herein is not to be limited in scope by the specific embodiments herein disclosed, since these embodiments are intended as illustrations of several aspects of the invention. Any equivalent embodiments are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims.

[0215] Various references are cited herein, the disclosures of which are incorporated by reference in their entireties.

Claims

1. A polypeptide hybrid comprising an amino acid sequence with binding affinity for mutan, said amino acid sequence being bound to an active component useful for oral care purposes.

2. The polypeptide hybrid of claim 1, wherein the active component is an anti-plaque, anti-stain or anti-microbial agent.

3. The polypeptide hybrid of claim 1, wherein the active component is an enzyme selected from the group consisting of oxidases, peroxidases, proteases, lipases, glucosidases, lipases, esterases, deaminases, ureases and polysaccharide hydrolases.

4. The polypeptide hybrid of claim 3, which polypeptide is bound to an enzyme with glycosidase activity.

5. An oral care composition comprising a mutan binding domain (MBD) hybrid or single unit MBD and further ingredients conventionally used in oral care compositions.

6. The oral care composition of claim 5, wherein the MBD hybrid is a polypeptide hybrid according to claim 1.

7. An oral care product comprising an oral care composition of claim 5.

8. The oral care product of claim 7, being a dentifrice.

9. A hybrid comprising:

(a) an amino acid sequence which has binding affinity for mutan and which lacks a functional catalytic domain of a mutanase, linked to
(b) an enzyme selected from the group consisting of deaminases, esterases, glucosidases, lipases, oxidases, peroxidases, polysaccharide hydrolases, proteases, and ureases.

10. The hybrid of claim 9, wherein the enzyme is a glycosidase.

11. An oral care composition comprising (a) a hybrid of claim 9 or a single unit mutan binding domain and (b) further ingredients conventionally used in oral care compositions.

12. An oral care product comprising an oral care composition of claim 11.

13. The oral care product of claim 12, which is a dentifrice.

Patent History
Publication number: 20020085980
Type: Application
Filed: Aug 24, 2001
Publication Date: Jul 4, 2002
Applicant: Novozymes A/S (Bagsvaerd)
Inventor: Claus Crone Fuglsang (Niva)
Application Number: 09938743