Mycobacterium tuberculosis DNA sequences encoding immunostimulatory peptides and methods for using same

Abstract

Nucleotide sequences isolated from Mycobacterium tuberculosis are disclosed. These sequences encode immunostimulatory peptides. Also disclosed are vaccine preparations formulated using these peptides.

Description

CROSS REFERENCE TO RELATED CASES

[0001] This application is a continuation-in-part of co-pending U.S. application No. 08/990,823, filed Dec. 15, 1997, which is incorporated herein by reference. The 08/990,823 application claims priority from PCT application No. U.S. 96/10375, filed Jun. 14, 1996, which claims priority from U.S. Provisional application No.60/000,254, filed Jun. 15, 1995, all of which are incorporated herein by reference.

I. BACKGROUND

[0002] A. The Rise of Tuberculosis

[0003] Over the past few years the editors of the Morbidity and Mortality Weekly Report have chronicled the unexpected rise in tuberculosis cases. It has been estimated that one billion people are infected with M. tuberculosis worldwide, with 7.5 million active cases of tuberculosis. Even in the United States, tuberculosis continues to be a major problem especially among the homeless, Native Americans, African-Americans, immigrants, and the elderly. HIV-infected individuals represent the newest group to be affected by tuberculosis. Of the 88 million new cases of tuberculosis expected in this decade, approximately 10% will be attributable to HIV infection.

[0004] The emergence of multi-drug resistant strains of M. tuberculosis has complicated matters further and even raises the possibility of a new tuberculosis epidemic. In the U.S. about 14% of M. tuberculosis isolates are resistant to at least one drug, and approximately 3% are resistant to at least two drugs. M. tuberculosis strains have even been isolated that are resistant to all seven drugs in the repertoire of drugs commonly used to combat tuberculosis. Resistant strains make treatment of tuberculosis extremely difficult: for example, infection with M. tuberculosis strains resistant to isoniazid and rifampin leads to mortality rates of approximately 90% among HIV-infected individuals. The mean time to death after diagnosis in this population is 4-16 weeks. One study reported that, of nine immunocompetent health care workers and prison guards infected with drug-resistant M. tuberculosis, five died. The expected mortality rate for infection with drug-sensitive M. tuberculosis is 0%.

[0005] The unrelenting persistence of mycobacterial disease worldwide, the emergence of a new, highly susceptible population, and the recent appearance of drug-resistant strains point to the need for new and better prophylactic and therapeutic treatments of mycobacterial diseases.

[0006] B. Tuberculosis and the Immune System

[0007] Infection with M. tuberculosis can take on many manifestations. The growth in the body of M. tuberculosis and the pathology that it induces is largely dependent on the type and vigor of the immune response. From mouse genetic studies it is known that innate properties of the macrophage play a large role in containing disease, Skamene, Ref Infect. Dis. 11:S394-S399, 1989. Initial control of M. tuberculosis may also be influenced by reactive T &ggr;&dgr; cells. However, the major immune response responsible for containment of M. tuberculosis is via helper T cells (Th1) and to a lesser extent cytotoxic T cells, Kaufmann, Current Opinion in Immunology 3:465-470, 1991. Evidence suggests that there is very little role for the humoral response. The ratio of responding Th1 to Th2 cells has been proposed to be involved in the phenomenon of suppression.

[0008] Th1 cells are thought to convey protection by responding to M. tuberculosis T cell epitopes and secreting cytokines, particularly INF-&ggr;, that stimulate macrophages to kill M. tuberculosis. While such an immune response normally clears infections by many facultative intracellular pathogens, such as Salmonella, Listeria, or Francisella, it is only able to contain the growth of other pathogens such as M. tuberculosis and Toxoplasma. Hence, it is likely that M. tuberculosis has the ability to suppress a clearing immune response, and mycobacterial components such as lipoarabinomannan are thought to be potential agents of this suppression. Dormant M. tuberculosis can remain in the body for long periods of time and can emerge to cause disease when the immune system wanes due to age or other effects such as infection with HIV-1.

[0009] Historically it has been thought that one needs replicating mycobacteria in order to effect a protective immunization. An hypothesis explaining the molecular basis for the effectiveness of replicating mycobacteria in inducing protective immunity has been proposed by Orme and co-workers, Orme et al., Journal of Immunology 148:189-196, 1992. These scientists suggest that antigens are pinocytosed from the mycobacterial-laden phagosome and used in antigen presentation. This hypothesis also explains the basis for secreted proteins effecting a protective immune response.

[0010] Antigens that stimulate T cells from mice infected with M. tuberculosis or from PPD-positive humans are found in both the whole mycobacterial cells and also in the culture supernatants, Orme et al., Journal of Immunology 148:189-196, 1992; Daugelat et al., J. Infect. Dis. 166:186-190, 1992; Barnes et al., J. Immunol. 143:2656-2662, 1989; Collins et al., Infect. Immun. 56:1260-1266, 1988; Lamb et al., Rev. Infect. Dis. 11:S443-S447, 1989; and Hubbard et al., Clin. exp. Immunol. 87:94-98, 1992. Recently Pal and Horwitz, Infect. Immun. 60:4781-4792, 1992, induced partial protection in guinea pigs by vaccinating with M. tuberculosis supernatant fluids. Similar results were found by Andersen using a murine model of tuberculosis, Andersen, Infection & Immunity 62:2536, 1994. Other studies include Hubbard et al., Clin. exp. Immunol. 87:94-98, 1992, and Boesen et al., Infection and Immunity 63:1491-1497, 1995. Although these works are far from definitive, they do strengthen the notion that protective epitopes can be found among secreted proteins and that a non-living vaccine can protect against tuberculosis.

II. SUMMARY OF THE INVENTION

[0011] For the purposes of vaccine development one needs to find epitopes that confer protection but do not contribute to pathology. An ideal vaccine would contain a cocktail of T-cell epitopes that preferentially stimulate Th1 cells and are bound by different MHC haplotypes. Although such vaccines have never been made, there is at least one example of a synthetic T-cell epitope inducing protection against an intracellular pathogen, Jardim et al., J. Exp. Med. 172:645-648, 1990.

[0012] It is an object of this invention to provide M. tuberculosis DNA sequences that encode bacterial peptides having an immunostimulatory activity. Such immunostimulatory peptides will be useful in the treatment, diagnosis, and prevention of tuberculosis.

[0013] The present invention provides inter alia, DNA sequences isolated from Mycobacterium tuberculosis. Peptides encoded by these DNA sequences stimulate the production of the macrophage-stimulating cytokine, gamma interferon (“INF-&ggr;”), in mice. Critically, the production of INF-&ggr; by CD4 cells in mice correlates with maximum expression of protective immunity against tuberculosis, Orme et al., J. Immunology 151:518-525, 1993. Furthermore, in human patients with active “minimal” or “contained” tuberculosis, it appears that the containment of the disease may be attributable, at least in part, to the production of CD4 Th- 1 -like lymphocytes that release INF-&ggr;, Boesen et al., Infection and Immunity 63:1491-1497, 1995.

[0014] Hence, the DNA sequences provided by this invention encode peptides that can of stimulate T-cells to produce INF-&ggr;. That is, these peptides act as epitopes for CD4 T-cells in the immune system. Studies have demonstrated that peptides isolated from an infectious agent and which are shown to be T-cell epitopes can protect against the disease caused by that agent when administered as a vaccine, Mougneau et al., Science 268:536-566, 1995 and Jardim et al., J. Exp. Med. 172:645-648, 1990. For example, T-cell epitopes from the parasite Leishmania major have been shown to be effective when administered as a vaccine, Jardim et al., J. Exp. Med. 172:645-648, 1990; Mougneau et al., Science 268:536-566, 1995; and Yang et al., J. Immunology 145:2281-2285, 1990. Therefore, the immunostimulatory peptides (T-cell epitopes) encoded by the DNA sequences according to the invention may be used, in purified form, as a vaccine against tuberculosis.

[0015] As noted, the nucleotide sequences of the present invention encode immunostimulatory peptides. In a number of instances, these nucleotide sequences are only a part of a larger open reading frame (ORF) of an M. tuberculosis operon. The present invention enables the cloning of the complete ORF using standard molecular biology techniques, based on the nucleotide sequences provided herein. Thus, the present invention encompasses both the nucleotide sequences disclosed herein and the complete M. tuberculosis ORFs to which they correspond. However, it is noted that since each of the nucleotide sequences disclosed herein encodes an immunostimulatory peptide, the use of larger peptides encoded by the complete ORFs is not necessary for the practice of the invention. Indeed, it is anticipated that, in some instances, proteins encoded by the corresponding ORFs may be less immunostimulatory than the peptides encoded by the nucleotide sequences provided herein.

[0016] According to one aspect of the present invention, immunostimulatory preparations are provided comprising at least one peptide encoded by the DNA sequences presented herein. Such a preparation may include the purified peptide or peptides and one or more pharmaceutically acceptable adjuvants, diluents, and/or excipients.

[0017] According to another aspect of the invention, vaccines are provided comprising one or more peptides encoded by nucleotide sequences provided herein. Such a vaccine may include one or more pharmaceutically acceptable excipients, adjuvants, and/or diluents.

[0018] According to another aspect of the present invention, antibodies are provided that are specific for immunostimulatory peptides encoded by a nucleotide sequence according to the present invention. Such antibodies may be used to detect the presence of M. tuberculosis antigens in medical specimens, such as blood or sputum. Thus, these antigens may be used to diagnose tuberculosis infections.

[0019] The present invention also encompasses the diagnostic use of purified peptides encoded by nucleotide sequences according to the present invention. Thus5 the peptides may be used in a diagnostic assay to detect the presence of antibodies in a medical specimen, which antibodies bind to the M. tuberculosis peptide and indicate that the subject from which the specimen was removed was previously exposed to M. tuberculosis.

[0020] The present invention also provides improved methods of performing the tuberculin skin test to diagnose exposure of an individual to M. tuberculosis. In this improved skin test, purified immunostimulatory peptides encoded by the nucleotide sequences of this invention are employed. Preferably, this skin test is performed with one set of the immunostimulatory peptides, while another set of the immunostimulatory peptides is used to formulate vaccine preparations. In this way, the tuberculin skin test will be useful in distinguishing between subjects infected with tuberculosis and subjects who have simply been vaccinated. In this manner, the present invention may overcome a serious limitation inherent in the present BCG vaccine/tuberculin skin test combination.

[0021] Other aspects of the present invention include the use of probes and primers derived from the nucleotide sequences disclosed herein to detect the presence of M. tuberculosis nucleic acids in medical specimens.

[0022] A further aspect of the present invention is the discovery that a significant proportion of the immunostimulatory peptides is homologous to proteins known to be located in bacterial cell-surface membranes. This discovery suggests that membrane-bound peptides, particularly those from M. tuberculosis, may be a new source of antigens for use in vaccine preparations.

III. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] FIG. 1 shows the deduced amino acid sequence of the full-length MTB2-92 protein. The nucleic acid sequence is contained within SEQ ID NO: 67, the amino acid sequence is shown in SEQ ID NO: 113.

IV. DESCRIPTION OF THE INVENTION

[0024] A. Definitions

[0025] Particular terms and phrases used herein have the meanings set forth below.

[0026] “Specific binding agent.” An agent that binds substantially only to a defined target. Thus, a Mycobacterium tuberculosis specific binding agent binds substantially only cellular components derived from Mycobacterium tuberculosis. These cellular components include both extracellular and intracellular, proteins, glycoproteins, sugars, and lipids, that are found in Mycobacterium tuberculosis isolates. As used herein, the term “Mycobacterium tuberculosis specific binding agent” can be an anti-Mycobacterium tuberculosis antibody or other agent that binds substantially only to Mycobacterium tuberculosis.

[0027] The term “anti- Mycobacterium tuberculosis antibodies” encompasses monoclonal and polyclonal antibodies that are specific for Mycobacterium tuberculosis, i.e., which bind substantially only to Mycobacterium tuberculosis when assessed using the methods described below, as well as immunologically effective portions (“fragments”) of such antibodies. Immunologically effective portions of the antibodies include Fab, Fab′, F(ab′)2, Fabc, and Fv portions (for a review, see Better and Horowitz, Methods Enzymol., 178:476-496, 1989). Anti- Mycobacterium tuberculosis antibodies may also be produced using standard procedures described in a number of texts, including Harlow and Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, 1988.

[0028] “Sequence Identity.” The similarity between two nucleic acid sequences, or two amino acid sequences is expressed in terms of the level of sequence identity shared between the sequences. Sequence identity is typically expressed in terms of percentage identity; the higher the percentage, the more similar the two sequences are.

[0029] Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math., 2:482, 1981; Needleman & Wunsch, J. Mol. Biol., 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA, 85:2444, 1988; Higgins & Sharp, Gene, 73:237-244, 1988; Higgins & Sharp, CABIOS, 5:151-153, 1989; Corpet et al., Nucleic Acids Research, 16:10881-10890, 1988; Huang, et al., Computer Applications in the Biosciences, 8:155-165, 1992; and Pearson et al., Methods in Molecular Biology, 24:307-331, 1994. Altschul et al., J. Mol. Biol., 215:403-410, 1990, presents a detailed consideration of sequence alignment methods and homology calculations.

[0030] The NCBI Basic Local Alignment Search Tool (BLAST™ Altschul et al. J. Mol. Biol., 215:403-410, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, Md.) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. It can be accessed at http//www.ncbi.nlm.nih.gov/BLAST/. A description of how to determine sequence identity using this program is available at http://www.ncbi.nlm.nih.gov/BLAST/blast_help.html.

[0031] For comparisons of amino acid sequences of greater than about 30 amino acids, the “Blast 2 sequences” function in the BLAST program is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per-residue gap cost of 1). When aligning short peptides (fewer than about 30 amino acids), the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). Proteins with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least 45%, at least 50%, at least 60%, at least 80%, at least 85%, at least 90%, or at least 95% sequence identity.

[0032] “Isolated.” An “isolated” nucleic acid has been substantially separated or purified away from other nucleic acid sequences in the cell of the organism in which the nucleic acid naturally occurs, i.e., other chromosomal and extrachromosomal DNA and RNA. The term “isolated” thus encompasses nucleic acids purified by standard nucleic acid purification methods. The term also embraces nucleic acids prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.

[0033] The nucleic acids of the present invention comprise at least a minimum length able to hybridize specifically with a target nucleic acid (or a sequence complementary thereto) under stringent conditions as defined below. The length of a nucleic acid of the present invention is preferably 15 nucleotides or greater in length, although a shorter nucleic acid may be employed as a probe or primer if it is shown to specifically hybridize under stringent conditions with a target nucleic acid by methods well known in the art. The phrase a “peptide of the present invention” means a peptide encoded by a nucleic acid molecule as defined in this paragraph.

[0034] “Probes” and “primers.” Nucleic acid probes and primers may be readily prepared based on the nucleic acid sequences provided by this invention. A “probe” comprises an isolated nucleic acid attached to a detectable label or reporter molecule. Typical labels include radioactive isotopes, ligands, chemiluminescent agents, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, e.g., in, Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, and Ausubel et al. (ed.); Current Protocols in Molecular Biology, Greene Publishing and Wiley-Interscience, New York (with periodic updates), 1987.

[0035] “Primers.” Primers are short nucleic acids, preferably DNA oligonucleotides 15 nucleotides or more in length, that are annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, then extended along the target DNA strand by a DNA polymerase enzyme. Primer pairs can be used for amplification of a nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other nucleic-acid amplification methods known in the art.

[0036] As noted, probes and primers are preferably 15 nucleotides or more in length, but, to enhance specificity, probes and primers of 20 or more nucleotides may be preferred.

[0037] Methods for preparing and using probes and primers are described, for example, in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; Ausubel et al. (ed.), Current Protocols in Molecular Biology, Greene Publishing and Wiley-Interscience, New York (with periodic updates), 1987; and Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press: San Diego, 1990. PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, © 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.).

[0038] “Substantial similarity.” A first nucleic acid is “substantially similar” to a second nucleic acid if, when optimally aligned (with appropriate nucleotide insertions or deletions) with the second nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 75%-90% of the nucleotide bases, and preferably greater than 90% of the nucleotide bases. (“Substantial sequence complementarity” requires a similar degree of sequence complementarity.) Sequence similarity can be determined by comparing the nucleotide sequences of two nucleic acids using sequence analysis software such as the Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, Madison, Wis.

[0039] “Operably linked.” A first nucleic acid sequence is “operably” linked with a second nucleic acid sequence whenever the first nucleic acid sequence is placed in a functional relationship with the nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.

[0040] “Recombinant.” A “recombinant” nucleic acid has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.

[0041] “Stringent Conditions” and “Specific.” The nucleic acid probes and primers of the present invention hybridize under stringent conditions to a target DNA sequence, e.g., to a full length Mycobacterium tuberculosis gene that encodes an immunostimulatory peptide.

[0042] The term “stringent conditions” is functionally defined with regard to the hybridization of a nucleic-acid probe to a target nucleic acid (i.e., to a particular nucleic acid sequence of interest) by the hybridization procedure discussed in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, at pages 9.52-9.55, 9.47-9.52 and 9.56-9.58; Kanehisa, Nuc. Acids Res. 12:203-213, 1984; and Wetmur et al., J. Mol. Biol. 31:349-370, 1968.

[0043] Nucleic-acid hybridization is affected by such conditions as salt concentration, temperature, or organic solvents, in addition to the base composition, length of the complementary strands, and the number of nucleotide-base mismatches between the hybridizing nucleic acids, as will be appreciated readily by those skilled in the art.

[0044] In preferred embodiments of the present invention, stringent conditions are those under which DNA molecules with more than 25% sequence variation (also termed “mismatch”) will not hybridize. Such conditions are also referred to as conditions of 75% stringency (since hybridization will occur only between molecules with 75% sequence identity or greater). In more preferred embodiments, stringent conditions are those under which DNA molecules with more than 15% mismatch will not hybridize (conditions of 85% stringency). In most preferred embodiments, stringent conditions are those under which DNA molecules with more that 10% mismatch will not hybridize (i.e., conditions of 90% stringency).

[0045] When referring to a probe or primer, the term “specific for (a target sequence)” indicates that the probe or primer hybridizes under stringent conditions substantially only to the target sequence in a given sample comprising the target sequence.

[0046] “Purified.” A “purified” peptide is a peptide that has been extracted from the cellular environment and separated from substantially all other cellular peptides. As used herein, the term “peptide” includes peptides, polypeptides and proteins. In preferred embodiments, a “purified” peptide is a preparation in which the subject peptide comprises 80% or more of the protein content of the preparation. For certain uses, such as vaccine preparations, even greater purity may be necessary.

[0047] “Immunostimulatory.” The phrase “immunostimulatory peptide” as used herein refers to a peptide that is capable of stimulating INF-&ggr; production in the assay described in section B.5. below. In preferred embodiments, an immunostimulatory peptide is capable of inducing greater than twice the background level of this assay determined using T-cells stimulated with no antigens or negative control antigens. Preferably, the immunostimulatory peptides are capable of inducing more than 0.01 ng/mL of INF-&ggr; in this assay system. In more preferred embodiments, an immunostimulatory peptide is one capable of inducing greater than 10 ng/mL of INF-&ggr; in this assay system.

[0048] B. Materials and Methods

[0049] 1. Standard Methodologies

[0050] The present invention utilizes standard laboratory practices for the cloning, manipulation, and sequencing of nucleic acids, purification and analysis of proteins, and other molecular biological and biochemical techniques, unless otherwise stipulated. Such techniques are explained in detail in standard laboratory manuals such as Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, and Ausubel et al. (ed.), Current Protocols in Molecular Biology, Greene Publishing and Wiley-Interscience, New York (with periodic updates), 1987.

[0051] Methods for chemical synthesis of nucleic acids are discussed, for example, in Beaucage et al., Tetra. Letts. 22:1859-1862, 1981, and Matteucci et al., J. Am. Chem. Soc. 103:3185, 1981. Chemical synthesis of nucleic acids can be performed, for example, on commercial automated oligonucleotide synthesizers.

[0052] 2. Isolation of Mycobacterium Tuberculosis DNA Sequences Encoding Immunostimulatory Proteins

[0053] Mycobacterium tuberculosis DNA was obtained by the method of Jacobs et al., Methods In Enzymology 204:537-555, 1991. Samples of the isolated DNA were partially digested with one of the following restriction enzymes HinPI, HpaII, AciI, TaqI, BsaHI, and NarI. Digested fragments of 2-5 kb were purified from agarose gels and then ligated into the BstBI site in front of the truncated phoA gene in one or more of the three phagemid vectors pJDT1, pJDT2, and pJDT3.

[0054] A schematic representation of the phagemid vector pJDT2 is provided in Mdluli et al., Gene 155:133-134, 1995. The pJDT vectors were specifically designed for cloning and selecting genes encoding cell wall-associated, cytoplasmic membrane associated, periplasmic, or secreted proteins (and especially for cloning such genes from GC-rich genomes, such as the Mycobacterium tuberculosis genome). The vectors have a BstBI cloning site in frame with the bacterial alkaline phosphatase gene (phoA) such that cloning of an in-frame sequence into the cloning site will result in the production of a fusion protein. The phoA gene encodes a version of the alkaline phosphatase that lacks a signal sequence; hence, only if the DNA cloned into the BstBI site includes a signal sequence or a transmembrane sequence can the fusion protein be secreted to the medium or inserted into cytoplasmic membrane, periplasm, or cell wall. Those clones encoding such fusion proteins may be detected by plating clones on agar plates containing the indicator 5-bromo-4-chloro-3-indolyl phosphate (XP). Alkaline phosphatase cleaves XP to release a blue-colored product. Hence, those clones containing alkaline phosphatase fusion proteins with the enzymatic portion lying outside the cytoplasmic membrane will produce the blue color.

[0055] The three vectors in this series (pJDT1, pJDT2, and pJDT3) have the BstBI restriction sites located in different reading frames with respect to the phoA gene. This increases the likelihood of cloning any particular gene in the correct orientation and reading frame for expression by a factor of three. Mdluli et al., Gene 155:133-134, 1995, describes pJDT vectors in detail.

[0056] 3. Selection of Secreted Fusion Proteins

[0057] The recombinant clones described above were transformed into E. coli and plated on agar plates containing the indicator 5-bromo-4-chloro-3-indolyl phosphate. Production of blue pigmentation, produced as a result of the action of alkaline phosphatase on the indicator, indicated the presence of secreted cytoplasmic membrane periplasmic, cell wall-associated, or outer membrane fusion proteins (because the bacterial alkaline phosphatase gene in the vector lacks a signal sequence and could not otherwise escape the bacterial cell). A similar technique has been used to identify M. tuberculosis genes encoding exported proteins by Lim et al., J. Bact. 177:59-65, 1995.

[0058] Those clones producing blue pigmentation were picked and grown in liquid culture to facilitate the purification of the alkaline phosphatase fusion proteins. These recombinant clones were designated according to the restriction enzyme used to digest the Mycobacterium tuberculosis DNA (thus, clones designated A#2-1, A#2-2, etc., were produced using Mycobacterium tuberculosis DNA digested with AciI).

[0059] 4. Purification of Secreted Fusion Proteins

[0060] PhoA fusion proteins were extracted from the selected E. coli clones by cell lysis and purified by SDS polyacrylamide gel electrophoresis. Essentially, individual E. coli clones were grown overnight at 30° C. with shaking in 2 mL LB broth containing ampicillin, kanamycin, and IPTG. The cells were precipitated by centrifugation and resuspended in 100 &mgr;L Tris -EDTA buffer. To this mixture was added 100 &mgr;L lysis buffer (1% SDS, 1 mMEDTA, 25 mM DTT, 10% glycerol and 50 mM tris-HCl, pH 7.5). DNA released from the cells was sheared by passing the mixture through a small-gauge syringe needle. The sample was then heated for 5 minutes at 100° C. and loaded onto an SDS PAGE gel (12 cm×14 cm×1.5 mm, made with 4% (w/v) acrylamide in the stacking section and 10% (w/v) acrylamide in the separating section). Several samples from each clone were loaded onto each gel.

[0061] The samples were electrophoresed by application of 200 volts to the gel for 4 hours. Subsequently, the proteins were transferred to a nitrocellulose membrane by Western blotting. A strip of nitrocellulose was cut off to be processed with antibody, and the remainder of the nitrocellulose was set aside for eventual elution of the protein. The strip was incubated with blocking buffer and then with anti-alkaline phosphatase primary antibody, followed by incubation with anti-mouse antibody conjugated with horseradish peroxidase. Finally, the strip was developed with the NEN DuPont Renaissance™ kit to generate a luminescent signal. The migratory position of the PhoA fusion protein, as indicated by the luminescent label, was measured with a ruler, and the corresponding region of the undeveloped nitrocellulose blot was excised.

[0062] This region of nitrocellulose containing the PhoA fusion protein was then incubated in 1 mL 20% acetronitrile at 37° C. for 3 hours. Subsequently, the mixture was centrifuged to remove the nitrocellulose, and the liquid was transferred to a new test tube and lyophilized. The resulting protein pellet was dissolved in 100 &mgr;L of endotoxin-free, sterile water and precipitated with acetone at −20° C. After centrifugation the bulk of the acetone was removed and the residual acetone was allowed to evaporate. The protein pellet was re-dissolved in 100 &mgr;L of sterile phosphate buffered saline.

[0063] This procedure can be scaled up by modification to include IPTG induction 2 hours prior to cell harvesting, washing nitrocellulose membranes with PBS prior to acetonitrile extraction, and lyophilization of acetonitrile-extracted and acetone-precipitated protein samples.

[0064] 5. Determination of Immunostimulatory Capacity in Mice

[0065] The purified alkaline phosphatase—Mycobacterium tuberculosis fusion peptides encoded by the recombinant clones were then tested for their ability to stimulate INF-&ggr; production in mice. The test used to determine INF-&ggr; stimulation was essentially as described by Orme et al., J. Immunology 151:518-525, 1993.

[0066] Essentially, the assay method is as follows: The virulent strain M. tuberculosis Erdman is grown in Proskauer Beck medium to mid-log phase, then aliquoted and frozen at −70° C. for use as an inoculant. Cultures of this bacterium are grown and harvested, and mice are inoculated with 1×105 viable bacteria suspended in 200 &mgr;L sterile saline via a lateral tail vein on the first day of the test.

[0067] Bone marrow-derived macrophages are used in the test to present the bacterial alkaline phosphatase—Mycobacterium tuberculosis fusion protein antigens. These macrophages are obtained by harvesting cells from mouse femurs and culturing the cells in Dulbecco's modified Eagle medium as described by Orme et al., J. Immunology 151:518-525, 1993. Eight to ten days later, up to ten &mgr;g of the fusion peptide to be tested is added to the macrophages, and the cells are incubated for 24 hours.

[0068] The CD4 cells are obtained by harvesting spleen cells from the infected mice and then pooling and enriching for CD4 cells by removal of adherent cells by incubation on plastic Petri dishes, followed by incubation for 60 minutes at 37° C. with a mixture of J11d.2, Lyt-2.43, and GL4 monoclonal antibody (mAb) in the presence of rabbit complement to deplete B cells and immature T cells, CD8 cells, and &ggr;&dgr; cells, respectively. The macrophages are overlaid with 106 of these CD4 cells, and the medium is supplemented with 5U interleukin-2 (IL-2) to promote continued T cell proliferation and cytokine secretion. After 72 hours, cell supernatants are harvested from sets of triplicate wells and assayed for cytokine content.

[0069] Cytokine levels in harvested supernatants are assayed by sandwich ELISA as described by Orme et al., J. Immunology 151:518-525, 1993.

[0070] 6. Determination of Immunostimulatory Capacity in Humans

[0071] The purified alkaline phosphatase—Mycobacterium tuberculosis fusion peptides encoded by the recombinant clones or by synthetic peptides are tested for their ability to induce INF-&ggr; production by human T cells in the following manner.

[0072] Blood from tuberculin-positive people (producing a tuberculin-positive skin test) is collected in EDTA-coated tubes to prevent clotting. Mononuclear cells are isolated using a modified version of the separation procedure provided with the NycoPrep™ 1.077 solution (Nycomed Pharma AS, Oslo, Norway). Briefly, the blood is diluted in an equal volume of a physiologic solution, such as Hanks Balanced Salt solution (HBS S), and then gently layered atop the Nycoprep solution in a 2-to-1 ratio in 50 mL tubes. The tubes are centrifuged at 800×g for 20 minutes, and the mononuclear cells are then removed from the interface between the Nycoprep solution and the sample layer. The plasma is removed from the top of the tube and filtered through a 0.2-micron filter. The plasma is then added to the tissue culture media. The mononuclear cells are washed twice by a procedure in which the cells are diluted in a physiologic solution, such as HBSS or RPMI 1640, and centrifuged at 400×g for 10 minutes. The mononuclear cells are then resuspended to the desired concentration in tissue culture media (RPMI 1640 containing 10% autologous serum, HEPES, non-essential amino acids, antibiotics and polymixin B). The mononuclear cells are then cultured in 96-well microtiter plates.

[0073] Peptides or PhoA fusion proteins are then added to individual wells in the 96-well plate, and cells are then placed in an incubator (37° C., 5% CO2). Samples of the supernatants (tissue culture media from the wells containing the cells) are collected at various time points (from 3 to 8 days) after the addition of the peptides or PhoA fusion proteins. The immune responsiveness of T cells to the peptides and PhoA fusion proteins is assessed by measuring the production of cytokines (including INF-&ggr;).

[0074] Cytokines are measured using an Enzyme Linked Immunosorbent Assay (ELISA), the details of which are described in the Cytokine ELISA Protocol in the PharMingen catalog (PharMingen, San Diego, Calif.). To measure the presence of human INF-&ggr;, wells of a 96-well microtiter plate are coated with a “capture antibody” (e.g., anti-human INF-&ggr; antibody). The sample supernatants are then added to individual wells. Any INF-&ggr; present in the sample binds to the capture antibody. The wells are then washed. A “detection antibody” (e.g., anti-human INF-&ggr; antibody), conjugated to biotin, is added to each well, and binds to any INF-&ggr; bound to the capture antibody. Any unbound detection antibody is washed away. An avidin-linked horseradish peroxidase enzyme is added to each well (avidin binds tightly to the biotin on the detection antibody). Any excess unbound enzyme is washed away. Finally, a chromogenic substrate for the enzyme is added and the intensity of the colour reaction that occurs is quantified using an ELISA plate reader. The amount of the INF-&ggr; in the sample supernatants is determined by comparison with a standard curve using known amounts of human INF-&ggr;.

[0075] Measurement of other cytokines, such as IL-2 and interleukin-4 (IL-4), can be determined using the same protocol, with the appropriate substitution of reagents (monoclonal antibodies and standards).

[0076] 7. DNA Sequencing

[0077] The sequencing of the alkaline phosphatase fusion clones was undertaken using the AmpliCycle™ thermal sequencing kit (Perkin Elmer, Applied Biosystems Division, 850 Lincoln Centre Drive, Foster City, Calif. 94404, U.S.A.), using a primer designed to read out of the alkaline phosphatase gene into the Mycobacterium tuberculosis DNA insert, or primers specific to the cloned sequences.

[0078] C. Results

[0079] 1. Immunostimulatory Capacity

[0080] More than 300 fusion clones were tested for their ability to stimulate INF-&ggr; production. Of these, 80 clones initially were designated to have some ability to stimulate INF-&ggr; production. Tables 1 and 2 show the data obtained for these 80 clones. Clones listed in Table 1 showed the greatest ability to stimulate INF-&ggr; production (greater than 10 ng/mL of INF-&ggr;), while clones listed in Table 2 stimulated the production of between 2 ng/mL and 10 ng/mL of INF-&ggr;. Background levels of INF-&ggr; production (i.e., levels produced without any added M. tuberculosis antigen) were subtracted from the levels produced by the fusions to obtain the figures shown in these tables. 1 TABLE 1 Immunostimulatory AP-fusion clones SEQ ID Sanger ID of Mtb NO: Name INF gene Functional Identification 2 AciI#1-152 >40,000 MTCY16By.09 glycerol-3-phosphate binding periplasmic protein precursor 4 AciI#1-247 >40,000 MTC1364.18 fatty acid transport protein 65,66 AciI#1-264 >40,000 MTCY78.03c unknown 62 AciI#1-435 >40,000 MTCY13D12.28 EmbA 75 HinP#1-27 >20,000 MTV023.04c 67 HinP#2-92 >20,000 MTCY190.11c cytochrome c oxidase subunit II 110 HinP#2-145 >20,000 MTV018.38c 52 HinP#2-150 >20,000 MTCY190.11c COXII (same as 2-92) 48 HinP#1-200 >20,000 MTV003.08 54 HinP#3-30 >20,000 MTCY19H5.30c 6 AciI#2-2 >20,000 MTV003.10c lipoprotein, penicillin binding protein 7 AciI#2-23 >20,000 MTCY13E10.15c 11 AciI#2-506 >20,000 MTCY253.27c -glutamyl transpeptidase precursor 13 AciI#2-511 >20,000 MTCY50.08c unknown 15 AciI#2-639 >20,000 MTCY02B12.02 unknown 16 AciI#2-822 >20,000 MTV004.48 unknown 68 AciI#2-823 >20,000 MTCY77.20 unknown membrane protein 61 AciI#2-825 >20,000 MTCY31.03c 71 AciI#2-827 >20,000 MTCY01B2.15c cytochrome d (ubiquinol) oxidase (appC) 22 AciI#2-898 >20,000 MTV005.02 27 AciI#2-1084 >20,000 MTV023.03c 34 AciI#3-47 >20,000 MTCY50.02 oppA-like 36 AciI#3-133 >20,000 MTCY22G8 complement of ORF designated 38 AciI#3-166 >20,000 MTCY20H10.03 unknown/ contains potential membrane spanning region 39 AciI#3-167 >20,000 MTC128.14 unknown 41 AciI#3-206 >20,000 MTCY270.17 ftsQ 69 HinP#1-31 14,638 MTV025.111 19kDa Antigen 47 HinP#1-144 13,546 MTC128.11 unknown 70 HinP#1-3 11,550 MTV023.04c same as HinP1-27 111 AciI#1-486 11,416 MTCY13D12.26 embC (LysR family) 5 AciI#1-426 11,135 MTV025.013c dppB (peptide transport permease) 23 AciI#2-916 10,865 MTCY21D4.03c unknown (signal peptide) Abbreviations: INF: pg/mL of INF-&ggr; produced using fusion to stimulate immune T-cells. Sanger/TGIR ID of M. tuberculosis gene: matches produced from BLAST search of TIGR and Sanger Center databases. For Sanger matches, the information prior to the decimal point (e.g., MTCY21D4) identifies the cosmid clone and the numbers after the decimal point (e.g., .03) indicate the matching ORF within that cosmid; “c”: indicates that the clone matched with the complement of that cosmid ORF sequence.

[0081] 2 TABLE 2 Immunostimulatory AP-fusion clones SEQ ID Clone Sanger/TIGR ID of NO: Name INF Mtb gene Functional Identification 1 AciI#1-62 3,126 MTCY190.11c COXII (same as 2-92) 8 AciI#2-26 3,089 MTV023.02c 9 AciI#2-35 3,907 MTV023.05c 76 AciI#2-147 5,464 same as H2-147 or H1-200 12 AciI#2-508 7,052 MTCY20G9.23 14 AciI#2-523 2,479 MTCY427.10c unknown 72 AciI#2-834 5,942 MTV016.33c 17 AciI#2-854 5,560 MTCY339.08c unknown 18 AciI#2-872 2,361 MTCY22D7.18c cstA - like 73 AciI#2-874 2,171 MTCY190.20 membrane protein 19 AciI#2-884D 2,729 MTCY21D4.03c 21 AciI#2-894 3,396 MTV002.33c PPE family 24 AciI#2-1014 6,302 MTCY21D4.03C same as 2-916 74 AciI#2-1018 4,642 MTCY270.11 MURF 25 AciI#2-1025 3,582 MTCY359.10 unknown membrane protein 26 AciI#2-1035 3,454 MTCY04D9.11c similar to penicillin binding proteins 28 AciI#2-1089 8,974 MTCY39.39 mpt 64 29 Acii#2-1090 7,449 MTCY04C12.18c unknown membrane protein 30 AciI#2-1104 5,148 MTCY359.13 Precursor of Apa wag43 locus 31 AciI#3-9 3,160 MTCY164.01 Unknown 32 AciI#3-12 3,891 MTV003.10c penicillin binding protein 33 AciI#3-15 4,019 MTCY20H10.03 35 AciI#3-78 2,905 MTC128.14 same as A3-167 37 AciI#3-134 3,895 MTCY22G8.04 same as A3-133 40 AciI#3-204 4,774 MTCY50.02 same as A3-47 42 AciI#3-214 7,333 MTCY33.38 unknown 112 AciI#3-243 2,857 MTCY50.02 43 AciI#3-281 2,943 MTCY19H5.32c 44 Bsa HI#1-21 8,122 M bovis clone 45 HinP#1-12 2,905 MTCY49.31c unknown 49 HinP#2-23 2,339 MTCY0033.38 same as A30214 46 HinP#1-142 6,258 MTCY02B10.27c unknown 50 HinP#2-143 3,689 MTCY274.09c unknown, thioredoxin-like 51 HinP#2-145A 2,314 53 HinP#3-28 2,980 MTV009.03c LppS 55 HinP#3-34 2,564 MTCY25D10.07 unknown 56 HinP#3-41 3,296 P31953 Antigen 85c, 85b & 85a precursor P31952 P17944 57 HpaII#1-3 2,360 MTCY190.11c COXII 58 HpaII#1-8 2,048 MTCY432 unknown 59 HpaII#1-10 4,178 MTCY39.39 same as A2-1089 60 HpaII#1-13 3,714 MTCY16B7.47 unknown partial ORF Abbreviations: INF: pg/mL of INF-&ggr; produced using fusion to stimulate immune T-cells. Sanger/TGIR ID of M tuberculosis gene: matches produced from BLAST search of TIGR and Sanger Center databases. For Sanger matches, the information prior to the decimal point (e.g., MTCY21D4) identifies the cosmid clone and the numbers after the decimal point (e.g., .03) indicate the matching ORF within that cosmid; “c” indicates that the clone matched with the complement of that cosmid ORF sequence.

[0082] 2. DNA Sequencing and Determination of Open Reading Frames

[0083] DNA sequence data for the sequences of the Mycobacterium tuberculosis DNA present in the clones shown in Tables 1 and 2 are shown in the accompanying Sequence Listing. The sequences are believed to represent the respective coding strands of the Mycobacterium DNA. In most instances, these sequences represent only partial sequences of the respective immunostimulatory peptides and, in turn, only partial sequences of respective Mycobacterium tuberculosis genes. However, each of the clones from which these sequences were derived encodes, by itself, at least one immunostimulatory T-cell epitope. As discussed in part V, below, one of ordinary skill in the art, given the information provided herein, readily can obtain the immunostimulatory peptides and corresponding full-length M. tuberculosis genes using standard techniques. Accordingly, the nucleotide sequences of the present invention encompass not only those respective sequences presented in the sequence listings, but also the respective complete nucleotide sequence encoding the respective immunostimulatory peptides as well as the corresponding M. tuberculosis genes. The nucleotide abbreviations employed in the sequence listings are as follows in Table 3: 3 TABLE 3 Symbol Meaning A A; adenine C C; cytosine G G; guanine T T; thymine U U; uracil M A or C R A or G W A or T/U S C or G Y C or T/U K G or T/U V A or C or G; not T/U H A or C or T/U; not G D A or g or T/U; not C B C or g or T/U; not A N (A or C or g or T/U) or (unknown or other or no base) — indeterminate (indicates an unreadable sequence compression)

[0084] The DNA sequences obtained were then analyzed with respect to the G+C content as a function of codon position over a window of 120 codons using the ‘FRAME’ computer program, Bibb et al., Gene 30:157-166, 1984. This program uses the bias of these nucleotides for each of the codon positions to identify the correct reading frame. As shown in Tables 1 and 2, the sequences were also analyzed using the BLAST™ program on the TIGR™ database at the NCBI website (http://www.ncbi.gov/cgi-bin/BLAST/nph-tigrbl) and the Sanger Center website database (http://www/sanger.ac.uk/Projects/M_tuberculosis/blast_server.shtml). These sequence comparisons permitted identification of matches with reported sequences to be identified and, for matches on the Sanger database, the identification of the open reading frame.

[0085] The sequence information revealed that a number of the clones contained an number of potentially overlapping sequences or sequences from the same gene, as noted below: 4 Clone Overlapping Sequence(s) HinP#1-27 HinP#1-3 HinP#2-92 HinP#2-150, Aci#1-62, HpaII#1-3 HinP#1-200 AciI#2-147, H#2-147 AciI#2-639 AciI#2-676 AciI#3-47 AciI#3-204, AciI#3-243 AciI#3-133 AciI#3-134 AciI#3-166 AciI#3-15 AciI#3-167 AciI#3-78 AciI#2-916 AciI#2-1014 AciI#2-1089 HpaII#1-10 AciI#3-243 AciI#3-47, AciI#3-204 Hinp#2-23 AciI#3-214

[0086] 3. Identification of T Cell Epitopes in the Immunostimulatory Peptides

[0087] The “T-Site” program, by Feller, D. C. and de la Cruz, V. F., MedImmune Inc., 19 Firstfield Rd., Gaithersburg, Md. 20878, U.S.A., was used to predict T- cell epitopes from the determined coding sequences. The program uses a series of four predictive algorithms. In particular, peptides were designed against regions indicated by the algorithm “A” motif which predicts alpha-helical periodicity, Margalit et al., J. Immunol. 138:2213, 1987, and amphipathicity. Peptides were also designed against regions indicated by the algorithm “R” motif which identifies segments that display a similarity to motifs known to be recognized by MHC class I and class II molecules, Rothbard and Taylor, EMBO J. 7:93, 1988. The other two algorithms identify classes of T-cell epitopes recognized in mice.

[0088] 4. Synthesis of Synthetic Peptides Containing T Cell Epitopes in Identified Immunostimulatory Peptides

[0089] A series of staggered peptides were designed to overlap regions indicated by the T-site analysis. These were synthesized by Chiron Mimotopes Pty. Ltd. (11055 Roselle St., San Diego, Calif. 92121, U.S.A.).

[0090] Peptides designed from sequences described in this application include: 5 Peptide Sequence Peptide Name SEQ. ID NO:. HinP#1-200 (6 peptides) VHLATGMAETVASFSPS HPI1-200/2 77 REVVHLATGMAETVASF HPI1-200/3 78 RDSREVVHLATGMAETV HPI1-200/4 79 DFNRDSREVVHLATGMA HPI1-200/5 80 ISAAVVTGYLRWTTPDR HPI1-200/6 81 AVVFLCAAAISAAVVTG HPI1-200/7 82 AciI#2-827 (14 peptides) VTDNPAWYRLTKFFGKL CD-2/1/96/1 83 AWYRLTKFFGKLFLINF CD-2/1/96/2 84 KFFGKLFLINFAIGVAT CD-2/1/96/3 85 FLINFAIGVATGIVQEF CD-2/1/96/4 86 AIGVATGIVQEFQFGMN CD-2/1/96/5 87 TGIVQEFEFGMNWSEYS CD-2/1/96/6 88 EFQFGMNWSEYSRFVGD CD-2/1/96/7 89 MNWSEYSRFVGDVFGAP CD-2/1/96/8 90 WSEYSRFVGDVFGAPLA CD-2/1/96/9 91 EYSRFVGDVFGAPLAME CD-2/1/96/10 92 SRFVGDVFGAPLAMESL CD-2/1/96/11 93 WIFGWNRLPRLVHLACI CD-2/1/96/12 94 WNRLPRLVHLACIWIVA CD-2/1/96/13 95 GRAELSSIVVLLTNNTA CD-2/1/96/14 96 HinP#1-3 (2 peptides) GKTYDAYFTDAGGITPG HPI1-3/2 97 YDAYFTDAGGITPGNSV HPI1-3/3 98 HinP#1-3/HinP#1-200 combined peptides WPQGKTYDAYFTDAGGI (HinP#1-3) HPI1-3/1 (combined) 99 ATGMAETVASFSPSEGS (HinP+1901 -200) 100 AciI#2-823 (1 peptide) GWERRLRHAVSPKDPAQ AI2-823/1 101 HinP#1-31 (4 peptides) TGSGETTTAAGTTASPG HPI1-31/1 102 GAAILVAGLSGCSSNKS HPI1-31/2 103 AVAGAAILVAGLSGCSS HPI1-31/3 104 LTVAVAGAAILVAGLSG HPI1-31/4 105

[0091] These synthetic peptides were resuspended in phosphate-buffered saline to be tested to confirm their ability to function as T cell epitopes using the procedure described in part IV(B)(6), above.

[0092] 5. Confirmation of Immunostimulatory Capacity Using T Cells From Tuberculosis Patients

[0093] The synthetic peptides described above, along with a number of the PhoA fusion proteins shown to be immunostimulatory in mice, were tested for their ability to stimulate production of INF-&ggr; in T-cells from tuberculin-positive people using the methods described in part IV(B)(6), above. For each assay, 5×105 mononuclear cells were stimulated with up to 1 &mgr;g/mL M. tuberculosis peptide or up to 50 ng/mL PhoA fusion protein. M. tuberculosis filtrate proteins, Con A and PHA, were employed as positive controls. An assay was run with medium alone to determine background levels, and PhoA protein was employed as a negative control.

[0094] The results, shown in Table 4 below, indicate that all of the peptides tested stimulated INF-&ggr; production from T-cells of a particular subject. 6 TABLE 4 Concentration of Concentration of JNF-&ggr; Peptide or PhoA INF-&ggr; minus background Fusion Protein Name (pg/mL) (pg/mL) CD-2/1/96/1 256.6 153.3 CD-2/1/96/9 187.6 84.3 CD-2/1/96/10 134.0 30.7 CD-2/1/96/11 141.6 38.3 CD-2/1/96/14 310.2 206.9 HPI1-3/2 136.3 23.0 HPI1-3/3 264.2 160.9 AciI 2-898 134.0 30.7 Acil 3-47 386.8 283.5 M tuberculosis filtrate 256.6 153.3 proteins (10 &mgr;g/mL) M tuberculosis filtrate 134.0 30.7 proteins (5 &mgr;g/mL) Con A (10 &mgr;g/mL) 2839 2 735.7 PHA (1%) 10378 10 274.7 PhoA control 26.7 0 (10 &mgr;g/mL) Background 103.3 0

[0095] V. Cloning of Full-Length Mycobacterium Tuberculosis ORFs Containing T-Cell Epitopes

[0096] Most the sequences presented represent only part of a larger M. tuberculosis ORF. If desired, the full-length M. tuberculosis ORFs that include these provided nucleotide sequences can be readily obtained by one of ordinary skill in the art, based on the sequence data provided herein.

[0097] A. General Methodologies

[0098] Methods for obtaining full-length genes based on partial sequence information are standard in the art and are particularly simple for prokaryotic genomes. By way of example, the full-length ORFs corresponding to the DNA sequences presented herein may be obtained by creating a library of Mycobacterium tuberculosis DNA in a plasmid, bacteriophage, or phagemid vector and screening this library with a hybridization probe using standard colony hybridization techniques. The hybridization probe consists of an oligonucleotide derived from a DNA sequence according to the present invention labeled with a suitable marker to enable detection of hybridizing clones. Suitable markers include radio nucleotides, such as 32p and non-radioactive markers such as biotin-avidin enzyme linked systems. Methods for constructing suitable libraries, production and labeling of oligonucleotide probes, and colony hybridization are standard laboratory procedures and are described in standard laboratory manuals such as in Sambrook et al. (ed.), Molecular Cloning. A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, and Ausubel et al. (ed.), Current Protocols in Molecular Biology, Greene Publishing and Wiley-Interscience, New York (with periodic updates), 1987.

[0099] Having identified a clone that hybridizes with the oligonucleotide, the clone is identified and sequenced using standard methods such as described in Chapter 13 of reference Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. Determination of the translation-initiation point of the DNA sequence enables the ORF to be located.

[0100] An alternative approach to cloning the full-length ORFs corresponding to the DNA sequences provided herein is the use of the polymerase chain reaction (PCR). In particular, the inverse polymerase chain reaction (IPCR) is useful to isolate DNA sequences flanking a known sequence. Methods for amplifying of flanking sequences by IPCR are described in Chapter 27 of Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press, San Diego, 1990, and in Earp et al., Nucleic Acids Research 18:3721-3729, 1990.

[0101] Accordingly, the present invention encompasses small oligonucleotides included in the DNA sequences presented in the respective Sequence Listings. These small oligonucleotides are useful as hybridization probes and PCR primers that can be employed to clone the corresponding full-length Mycobacterium tuberculosis ORFs. In preferred embodiments, these oligonucleotides will comprise at least 15 contiguous nucleotides of a DNA sequence set forth in the Sequence Listing, and in more preferred embodiments, such oligonucleotides will comprise at least 20 contiguous nucleotides of a DNA sequence as set forth in the respective Sequence Listing.

[0102] One skilled in the art will appreciate that hybridization probes and PCR primers are not required to exactly match the target gene sequence to which they anneal. Therefore, in another embodiment, the oligonucleotides can comprise a sequence of at least 15 nucleotides and preferably at least 20 nucleotides, the oligonucleotide sequence being substantially similar to a respective DNA sequence set forth in the respective Sequence Listing. Preferably, such oligonucleotides will share at least about 75%-90% sequence identity with a respective DNA sequence set forth in the respective Sequence Listing and more preferably the shared sequence identity will be greater than 90%.

[0103] B. Example—Cloning of the Full-Length ORF Corresponding to Clone HinP #2-92

[0104] Using the techniques described below, the full-length gene corresponding to the clone HinP #2-92 was obtained. This gene, herein termed mtb2-92, includes an open-reading frame of 1089 bp (identified based on the G+C content relating to codon position). The alternative ‘GTG’ start codon was used, and this was preceded (8 base pairs upstream) by a Shine-Dalgarno motif. The gene mtb2-92 encodes a protein (termed MTB2-92) containing 363 amino acid residues with a predicted molecular weight of 40,436 Da.

[0105] Sequence homology comparisons of the predicted amino acid sequence of MTB2-92 with known proteins in the database indicated similarity to the cytochrome c oxidase subunit II of many different organisms. Cytochrome c oxidase is part of the electron transport chain, in which the subunits I and II form the functional core of the enzyme complex. 1. Cloning the Full-Length Gene Corresponding to HinP #2-92

[0106] The plasmid pHin2-92 was restricted with either BamHI or EcoRI and then subcloned into the vector M13. The inserted DNA fragments were sequenced under the direction of M13 universal sequencing primers, Yanisch-Perron et al., Gene 33:103-119, 1985, using the AmpliCycle™ thermal sequencing kit (Perkin Elmer, Applied Biosystems Division, 850 Lincoln Centre Drive, Foster City, Calif. 94404, U.S.A.). The 5′-partial MTB2-92 DNA sequence was aligned using a GeneWorks™ (Intelligenetics, Mountain View, Calif., U.S.A.) program. Based on the sequence data obtained, two oligomers were synthesized. These oligonucleotides 7 (5′CCCAGCTTGTGATACAGGAGG 3′ (SEQ ID NO: 106) and 5′GGCCTCAGCGCGGCTCCGGAGG 3′ (SEQ ID NO: 107))

[0107] represented sequences upstream and downstream, over an 0.8-kb distance, of the sequence encoding the partial MTB2-92 protein in the alkaline phosphatase fusion.

[0108] A Mycobacterium tuberculosis genomic cosmid DNA library was screened using PCR, Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, in order to obtain the full-length gene encoding the MTB2-92 protein. Two hundred and ninety-four bacterial colonies containing the cosmid library were pooled into 10 groups in 100-&mgr;L aliqots of distilled water and boiled for 5 min. The samples were spun in a microfuge at maximal speed for 5 min. The supernatants were decanted and stored on ice prior to PCR analysis. The 100-&mgr;L PCR reaction contained: 10 &mgr;L supernatant containing cosmid DNA, 10 &mgr;L of 10X PCR buffer, 250 &mgr;M dNTPs, 300 nM downstream and upstream primers, and 1 unit Taq DNA polymerase.

[0109] The reactions were heated at 95° C. for 2 min, and 40 cycles of DNA synthesis were performed (95° C. for 30 s, 65° C. for 1 min, 72° C. for 2 min). The PCR products were loaded into a 1% agarose gel in TAE buffer, Sambrook et al. (ed.), Molecular Cloning, A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, for analysis.

[0110] The supernatant, which produced 800-bp PCR products, was then further divided into 10 samples and the PCR reactions were performed again. The colony that resulted in the correctly sized PCR product was then picked. The cosmid DNA from the positive clone (pG3) was prepared using the Wizard™ Mini-Prep Kit (Promega Corp, Madison, Wis., U.S.A.). The cosmid DNA was further sequenced using specific oligonucleotide primers. The deduced amino acid sequence encoded by the MTB2-92 protein is shown in FIG. 1.

[0111] 2. Expression of the Full-Length Gene

[0112] To conveniently purify the recombinant protein, a histidine-tag coding sequence was engineered immediately upstream of the start codon of mtb2-92 using PCR. Two unique restriction enzyme sites for XbaI and HindIII were added to both ends of the PCR product for convenient subcloning. Two oligomers were used to direct the PCR reaction: 8 (5′TCTAGACACCACCACCACCACCACGTGACACCTCGCGGGCCAGGTC 3′ (SEQ ID NO: 108) and 5′AAGCTTCGCCATGCCGCCGGTAAGCGCC 3′ (SEQ ID NO: 109)).

[0113] The 100-&mgr;L PCR reaction contained: 1 &mgr;g pG3 template DNA, 250 nM dNTP's, 300 nM of each primer, 10 &mgr;L of 10X PCR buffer, and 1 unit Taq DNA polymerase. The PCR DNA synthesis cycle was performed as described above.

[0114] The 1.4-kb PCR products were purified and ligated into the cloning vector pGEM-T (Promega). Inserts were removed by digestion using both XbaI and HindIII and the 1.4-kb fragment was directionally subcloned into the XbaI and HindIII sites of pMAL-c2 vector (New England Bio-Labs Ltd., 3397 American Drive, Unit 12, Mississauga, Ontario, L4V 1T8, Canada). The gene encoding MTB2-92 was fused, in frame, downstream of the maltose binding protein (MBP). This expression vector was named pMAL-MTB2-92.

[0115] 3. Purification of the Encoded Protein

[0116] The plasmid pMAL-MTB2-92 was transformed into competent E. coli JM109 cells and a 1-liter culture was grown up in LB broth at 37° C. to an OD550 of 0.5 to 0.6. The expression of the gene was induced by the addition of IPTG (0.5 mM) to the culture medium, after which the culture was grown for another 3 hours at 37° C. with vigorous shaking. Cultures were spun in the centrifuge at 10,000×g for 30 min and the cell pellet was harvested. The cell pellet was re-suspended in 50 mL of 20 mM Tris-HCl, pH 7.2, 200 mM NaCl, 1 mM EDTA supplemented with 10 mM &bgr;-mercaptoethanol and stored at −20° C.

[0117] The frozen bacterial suspension was thawed in cold water (0° C.), placed in an ice bath, and sonicated. The resulting cell lysate was then centrifuged at 10,000×g and 4° C. for 30 min, the supernatant retained, diluted with 5 volumes of buffer A (20 mM Tris-HCl, pH 7.2, 200 mM NaCl, and 1 mM EDTA) and applied to an amylose-resin column (New England Bio-Labs Ltd., 3397 American Drive, Unit 12, Mississauga, Ontario, L4V 1 T8, Canada) that had been pre-equilibrated with buffer A. The column was then washed with buffer A until the eluate reached an A280 of 0.001, at which point the bound MBP-MTB2-92 fusion protein was eluted with buffer A containing 10 mM maltose. The protein purified by the amylose-resin affinity column was about 84 kDa which corresponded to the expected size of the fusion protein (MBP: 42 kDa, MTB2-92 plus the histidine tag: 42 kDa).

[0118] The eluted MBP-MTB2-92 fusion protein was then cleaved with factor Xa to remove the MBP from the MTB2-92 protein. One mL of fusion protein (1 mg/mL) was mixed with 100 &mgr;L of Factor Xa (200 &mgr;g/mL) and kept at room temperature overnight. The mixture was diluted with 10 mL of buffer B (5 mM imidazole, 0.5M NaCl, 20 mM Tris-HCl, pH 7.9, 6M urea) and urea was added to the sample to a final concentration of 6M urea. The sample was loaded onto the Ni-NTA column (QIAGEN, 9600 De Soto Ave., Chatsworth, Calif. 91311, U.S.A.) pre-equilibrated with buffer B. The column was washed with 10 volumes of buffer B and 6 volumes of buffer C (60 mM imidazole, 0.5M NaCl, 20 mM Tris-HCl, pH 7.9, 6M urea). The bound protein was eluted with 6 volumes of buffer D (1M imidazole, 0.5M NaCl, 20 mM Tris-HCl, pH 7.9, 6M urea).

[0119] At each stage of the protein purification, a sample was analyzed by SDS polyacylamide gel electrophoresis, Laemmli, Nature (London) 227:680-685, 1970.

[0120] C. Correction of Sequence Errors

[0121] Some of the sequences presented in the Sequence Listing may contain sequence ambiguities. Sequence ambiguities occur when the results from the sequencing reaction do not clearly distinguish between the individual base pairs. Therefore, substitute abbreviations denoting multiple base pairs are provided in Table 3, supra. These abbreviations denote which of the four bases could possibly be at a position that was found not to give a clear experimental result. Naturally, in order to ensure that the immunostimulatory function is maintained, one would utilize a sequence without such ambiguities. For those sequences containing ambiguities, one would therefore utilize the sequence data provided in the Sequence Listing to design primers corresponding to each terminal of the provided sequence and, using these primers in conjunction with the polymerase chain reaction, synthesize the desired DNA molecule using M. tuberculosis genomic DNA as a template. Standard PCR methodologies, such as those described above, may be used to accomplish this.

[0122] D. Addition Examples of Cloning of Full-Length Mtb-PhoA Fusion Proteins

[0123] Selected mtb-phoA fusions were sequenced using the Taq-Track™ sequencing system (Promega Corp.), and sequencing was directed from a primer located 48 bp upstream of the junction between the M. tuberculosis and phoA DNA. Sequences were compared to the databases of the M. tuberculosis genome projects, Cole et al., Nature 393:537-544, 1998, and the National Centre of Biotechnology Information at the National Library of Medicine (Bethesda, Md.) using the “BLASTX”, “BLASTN”, and “TBLAST” programs, Atschul et al., Nucleic Acids 25:3389-3402, 1997. A determination of signal peptide determination was made using the SignalP neural network trained on Gram-positive data, Neilson et al., Protein Eng. 10: 1-6, 1997.

[0124] Whenever the upstream DNA sequence matched the raw sequence from the database of the M. tuberculosis genome projects, the extent of the reading frame and direction of translation were ascertained using a G+C analysis package, Bibb et al., Gene 30:157-166, 1984. A verification was made of whether the mtb-phoA fusion was in the same reading frame as the predicted ORF. In some cases, the extent of the ORF had already been assigned, and the assessment of the genome project was used for the fusion construction.

[0125] PCR was used to amplify the complete predicted ORFs encoding the proteins identified in the immunogenicity study. Oligodeoxynucleotide primers were designed with restriction sites in order to clone the amplified fragments into expression vectors. Table 5 provides a description the primer sequences used. All PCR reactions were conducted in 20 &mgr;L using a 6:1 Taq polymerase: Pfu polymerase enzyme combination. The reaction mixes contained either 1 &mgr;SL DMSO or 4 &mgr;L of Q solution (proprietary solution available from Qiagen, Dusseldorf, Germany, for denaturation in PCR) as a denaturant. A manual hot start was used for all PCR reactions which consisted of an initial denaturization (95° C., 4 min.) followed by a final extension (72° C., 4 min.). Standard protocols were followed for cloning, Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, and expression of the Mycobacterium tuberculosis proteins as fusions in commercial expression vectors. The different expression vectors used included pMAL-c2 (New England Biolabs, Beverly, Mass.), pGEX-4T3 (Pharmacia, Piscataway, N.J.), and pET-17xb (Novagen, Madison, Wis.). Respectively, these expression vectors enabled the N-terminal fusion of the maltose binding protein (MBP), glutathione S-transferase (GST) or the 260 amino acid T7 gene 10 product (PET) containing the T7•Tag® (Novagen, Madison, Wis.) to the products of the cloned DNA. 9 TABLE 5 Oligonucleotide Primers Used for PCR Amplification SEQ ID Clone Primer Sequence 5′ to 3′ NO: GST- 1-152F GTCAAGGATCCGGCATGGACCCGCTGAACCGCCGAC 142 152 1-152R ATGTCGGGATCCAAGCTTTCGACGGTCGGCGCGTCGGCGCCGGG 143 MBP- 1-264F GCAGATGCATCTAATGGGATCCGCGGAGTATATCTCC 144 264 1-264R GGCGCCGTGGGTGTCAGCGAAGCTTACCTGGTTGTTG 145 PET- 2-23F GGTGCCGAATTCGCGCCGATGCTGGACGCGG 146 23 2-23R ACCCGAATTCCCAAGCTTGCTGCTCAAACCACTGTTCC 147 MBP- 2-506F GCGCCCAAGGGATCCCCGGCTACCATGCCTTCG 148 506 2-506R CTCGAAGGGATCCGCGTTCGTTTGGCCGCCCGC 149 GST- 2-511F GGCAGTGGGATCCGTAGCGGTGCGGCGTAAGGTGCGG 150 511 2-511R GACTTCGTGGATCCGGTCAAGACAAGCTTTGCGGTGATCAAGGCGGCC 151 PET- 2-639F CATGAATGAATTCATCTCACAAGCGTGCGGCTCCCACCGACCC 152 639 2-639R CCTTGGCGAATTCTCAAAGGAAAGCTTCGAAGGCGG 153 GST- 2-822F GGAGTTCGGATCCATCGCCATGCAACTCTCCTCCCGG 154 822 2-822R GGGCAGTGGATCCGTGGTCAGCAAGCTTTCCCTAGAGTTTCGTGCG 155 MBP- 2-825F GTGGCGCCGAATTCAAGCGCGGTGTCGCAACGCTG 156 825 2-825R CGCTTAAGCGCGAAGCTTCGTCGAGCCGCG 157 PET- 2-916F GACCGGAATTCATGATCCAGATCGCGCGCACCTGGCGG 158 916 2-916R AACATGAATTCAAGCTTCGAGGCCGCCGACGAATCCGCTCACCG 159 PET- 2-1084F CGGGTCGCCGAATTCACGCGGAGCCGGGGATTGCGC 160 1084 2-1084R GGCGGAATTCAAGCTTCGGTTCATCCGCCGCCCCCATGC 161 GST- 3-206F CCCCGGGGATCCGGGGGTGCTGGGATGACGG 162 206 3-206R ACGACGGATCCTAAGCTTGCAGGCGCGCCGATACGCGGC 163 GST- 2-827F TCTCCGGGGATCCCAGATGAATGTCGTCGACATTTC 164 827 2-827R GGGTCTCCGGATCCCCCATACCGACATG 165 GST- 1-247F CCGACTCGAGCGGCGGCGCACACACAACGGTC 166 247 1-247R AATCCTCGAGCCCTGCGGTCGCCTTCCGAGCG 167 PET- 3-47F ATCCGGCCCGAATTCGCTGACCGTGGCCAGCGACGA 168 47 3-47R GATCGGGGAGAATTCCGCCGACTTAAGCTTCAGCTGAGCTGG 169

[0126] The different expression vectors used included pMAL-c2 (New England Biolabs), pGEX-4T3 (Pharmacia, Piscataway, N.J.), and pET-17xb (Novagen, Madison, Wis.). These expression vectors enabled the N-terminal fusion of the maltose binding protein (MBP), glutathione S-transferase (GST), or the 260 amino acid T7 gene 10 product (PET) containing the T7•Tagg (Novagen, Madison, Wis.) to be added to the products of the cloned DNA. Table 6 provides a summary of the results from cloning the PCR products into the various vectors described above. 10 TABLE 6 Recombinant Plasmids for Cloning and Expression of the Full-length Proteins Plasmid Expression Cloning Fusion Predicted Mr Construct Vector Sites Sanger ID Product (kDa) pAM23E pET-17xb E MTCY13E10.15c PET-23 124 pAM47E pET-17xb E MTCY50.02 PET-47 94 pAM152E pGEX-4T3 B MTCY16B7.09 GST-152 70 pAM206E pGEX-4T3 B MTCY27O.17 GST-206 60 pAM247E pGEX-4T3 B MTC1364.18 GST-247 78 pAM264E pMAL-c2 B, H MTCY78.03c MBP-264 68 pAM506E pMAL-c2 B MTCY253.27c MBP-506 105 pAM511E pGEX-4T3 B MTCY50.08c GST-511 46 pAM639E pET-17xb B MTCY02B12.02 PET-639 56 pAM822E pGEX-4T3 B MTV004.48 GST-822 50 pAM825E pMAL-c2 E, H MTCY31.03c MBP-825 60 pAM827E pGEX-4T3 B MTCY0IB2.15c GST-827 80 pAM916E pET-17xb E MTCY21D4.03c PET-916 61 pAM1084E pET-17xb E MTV023.03c PET-1084 76 Abbreviations: E: EcoRI; B: BamHI; H: HindIII; X: XhoI; C: complementary direction

[0127] SDS-PAGE and Western Blotting were used to identify the novel antigens expressed by the clones. Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) was carried out using 10% slab gels in a continuous buffer system, Laemmli, Nature (London) 227:680-685, 1970. Proteins were electrophoretically transferred from the gel to a nitrocellulose membrane using standard protocols, Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. Western blots for the GST (Pharmacia), T7 gene 10 (Invitrogen), and MBP (NEB) tagged fusion proteins were conducted as per the suppliers' instructions. The chemiluminescent Renaissance™ system (DuPont NEN Renaissance, NEL-20 1) was used to image bound antibody.

[0128] Subsequently, the following fusion proteins were over-expressed in E. coli BL21 plysS: MBP-264 (SEQ ID NO: 114), PET-23 (SEQ ID NO: 117), MBP-506 (SEQ ID NO: 115), MPB-825 (SEQ ID NO: 116), PET-639 (SEQ ID NO: 119), PET-916 (SEQ ID NO: 120), PET-1084 (SEQ ID NO: 121), PET-47 (SEQ ID NO: 118); in E. coli BL21: GST-152 (SEQ ID NO: 122), GST-822 (SEQ ID NO: 124); and in E. coli SURE: GST-206 (SEQ ID NO: 125). The recombinant fusion proteins MBP-506 (SEQ ID NO: 115), MBP-825 (SEQ ID NO: 116), GST-152 (SEQ ID NO: 122), GST-822 (SEQ ID NO: 124) GST-827 (SEQ ID NO: 126), PET-639 (SEQ ID NO: 119), PET-1084 (SEQ ID NO: 121) formed inclusion bodies that were harvested from the pellet following centrifugation of the bacterial sonicate. The fusion proteins PET-916 and GST-206 were found primarily in the supernatant and underwent considerable breakdown in culture. Protein fractions were checked by SDS-PAGE using Coomassie Blue staining and approximate concentrations were determined by Western blotting.

[0129] An additional fusion protein, GST-247 (SEQ ID NO: 127), was constructed using a different cloning strategy. The PCR product resulting from a reaction using the primers described in Table 5 and the entire MTCI364.18 cds was digested with EcoRI. The resulting fragment was then cloned into pGEX-4T3, with the C-terminus adjacent to the GST sequence. The resulting protein fragment included amino acid 43 to amino acid 514 of the 597 amino acid protein predicted by the genome project.

[0130] The amino acid sequences encoded by nucleic acid sequences described above are also shown in the sequence listing. These amino acid sequences are SEQ ID NOS: 128-141, which correspond to the nucleic acid sequences shown in SEQ ID NOS: 114-127, respectively.

[0131] VI. Expression and Purification of the Cloned Peptides

[0132] The DNA sequences disclosed herein that encode Mycobacterium tuberculosis peptides having an immunostimulatory activity, as well as the corresponding full-length Mycobacterium tuberculosis genes, enable one of ordinary skill in the art to express and purify the peptides encoded by these sequences. Methods for expressing proteins by recombinant means in compatible prokaryotic or eukaryotic host cells are well known in the art and are discussed, for example, in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, and Ausubel et al. (ed.), Current Protocols in Molecular Biology, Greene Publishing and Wiley-Interscience, New York (with periodic updates), 1987. Peptides expressed by the nucleotide sequences disclosed herein are useful for preparing vaccines effective against M. tuberculosis infection, for use in diagnostic assays, and for raising antibodies that specifically recognize M. tuberculosis proteins. One method of purifying the peptides is that presented in part V(B) above.

[0133] The most commonly used prokaryotic host cells for expressing prokaryotic peptides are strains of Escherichia coli, although other prokaryotes, such as Bacillus subtilis, Streptomyces, or Pseudomonas may also be used, as is well known in the art. Partial or full-length DNA sequences, encoding an immunostimulatory peptide according to the present invention, may be ligated into bacterial expression vectors. One aspect of the present invention is thus a recombinant DNA vector including a nucleic acid molecule provided by the present invention. Another aspect is a transformed cell containing such a vector.

[0134] Methods for expressing large amounts of protein from a cloned gene introduced into Escherichia coli (E. coli) may be utilized for the purification of the Mycobacterium tuberculosis peptides. Methods and plasmid vectors for producing fusion proteins and intact native proteins in bacteria are described in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. Such fusion proteins may be made in large amounts, are relatively simple to purify, and can be used to produce antibodies. Native proteins can be produced in bacteria by placing a strong, regulated promoter and an efficient ribosome binding site upstream of the cloned gene. If low levels of protein are produced, additional steps may be taken to increase protein production; if high levels of protein are produced, purification is relatively easy.

[0135] Often, proteins expressed at high levels are found in insoluble inclusion bodies. Methods for extracting proteins from these aggregates are described in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. Vector systems suitable for the expression of lacZ fusion genes include the pUR series of vectors, Ruther et al., EMBO J. 2:1791, 1983; pEX1-3, Stanley and Luzio, EMBO J. 3:1429, 1984; and pMR100, Gray et al., Proc. Natl. Acad. Sci. USA 79:6598, 1982. Vectors suitable for the production of intact native proteins include pKC30, Shimatake and Rosenberg, Nature 292:128, 1981; pKK177-3, Amann and Brosius, Gene 40:183, 1985; and pET-3, Studiar and Moffatt, J. Mol Biol. 189:113, 1986. Fusion proteins may be isolated from protein gels, lyophilized, ground into a powder, and used as antigen preparations.

[0136] Mammalian or other eukaryotic host cells, such as those of yeast, filamentous fungi, plant, insect, amphibian, or avian species, may also be used for protein expression, as is well known in the art. Examples of commonly used mammalian host cell lines are VERO and HeLa cells, Chinese hamster ovary (CHO) cells, and WI38, BHK, and COS cell lines, although it will be appreciated by the skilled practitioner that other prokaryotic and eukaryotic cells and cell lines may be appropriate for a variety of purposes, e.g., to provide higher expression, desirable glycosylation patterns, or other features.

[0137] Additionally, peptides, particularly shorter peptides, may be chemically synthesized, avoiding the need for purification from cells or culture media. It is known that peptides as short as 5 amino acids can act as an antigenic determinant for stimulating an immune response. Such peptides may be administered as vaccines in ISCOMs (Immune Stimulatory Complexes) as described by Janeway & Travers, Immunobiology: The Immune System In Health and Disease 13.21, Garland Publishing, Inc., New York, 1997. Accordingly, one aspect of the present invention includes small peptides encoded by the nucleic acid molecules disclosed herein. Such peptides include at least 5, and preferably 10 or more, contiguous amino acids of the peptides encoded by the disclosed nucleic acid molecules.

[0138] VII. Sequence Variants

[0139] It will be apparent to one skilled in the art that the immunostimulatory activity of the peptides encoded by the DNA sequences disclosed herein lies not in the precise nucleotide sequence of the DNA sequences, but rather in the epitopes inherent in the amino acid sequences encoded by the DNA sequences. It will therefore also be apparent that it is possible to recreate the immunostimulatory activity of one of these peptides by recreating the epitope without necessarily recreating the exact DNA sequence. This can be achieved either by directly synthesizing the peptide (thereby circumventing the need to use the DNA sequences) or, alternatively, by designing a nucleic acid sequence that encodes the epitope, but which differs, by reason of the redundancy of the genetic code, from the sequences disclosed herein.

[0140] Accordingly, the degeneracy of the genetic code further widens the scope of the present invention as it enables major variations in the nucleotide sequence of a DNA molecule while maintaining the amino acid sequence of the encoded protein. The genetic code and variations in nucleotide codons for particular amino acids are presented in Tables 7 and 8, respectively. Based upon the degeneracy of the genetic code, variant DNA molecules may be derived from the DNA sequences disclosed herein using standard DNA mutagenesis techniques, or by synthesis of DNA sequences. 11 TABLE 7 The Genetic Code First Second Pos'n Third Pos'n T C A G Pos'n Phe Ser Tyr Cys T T Phe Ser Tyr Cys C Leu Ser Stop (och) Stop A Leu Ser Stop (amb) Trp G Leu Pro His Arg T C Leu Pro His Arg C Leu Pro Gln Arg A Leu Pro Gln Arg G Ile Thr Asn Ser T A Ile Thr Asn Ser C Ile Thr Lys Arg A Met Thr Lys Arg G Val Ala Asp Gly T G Val Ala Asp Gly C Val Ala Glu Gly A Val (Met) Ala Glu Gly G “Stop (och)” stands for the ochre termination triplet, and “Stop (amb)” for the amber. ATG is the most common initiator codon; GTG usually codes for valine, but it can also code for methionine to initiate an mRNA chain.

[0141] 12 TABLE 8 The Degeneracy of the Genetic Code Number of Total Synonymous Number of Codons Amino Acid Codons 6 Leu, Ser, Arg 18 4 Gly, Pro, Ala, Val, Thr 20 3 Ile 3 2 Phe, Tyr, Cys, His, Gln, 18 Glu, Asn, Asp, Lys 1 Met, Trp 2 Total number of codons for amino acids 61 Number of codons for termination 3 Total number of codons in genetic code 64

[0142] Additionally, standard mutagenesis techniques may be used to produce peptides that vary in amino acid sequence from the peptides encoded by the DNA molecules disclosed herein. However, such peptides will retain the essential characteristic of the peptides encoded by the DNA molecules disclosed herein, i.e., the ability to stimulate INF-&ggr; production. This characteristic can be readily determined by the assay technique described above. Such variant peptides include those with variations in amino acid sequence including minor deletions, additions, and substitutions.

[0143] While the site for introducing an amino acid sequence variation is predetermined, the mutation per se need not be predetermined. For example, in order to optimize the performance of a mutation at a given site, random mutagenesis may be conducted at the target codon or region and the expressed protein variants screened for the optimal combination of desired activity. Techniques for making substitution mutations at predetermined sites in DNA having a known sequence as described above are well known.

[0144] In order to maintain the functional epitope, preferred peptide variants will differ by only a small number of amino acids from the peptides encoded by the DNA sequences disclosed herein. Preferably, such variants will be amino acid substitutions of single residues. Substitutional variants are those in which at least one residue in the amino acid sequence has been removed and a different residue inserted in its place. Such substitutions generally are made in accordance with the following Table 9 when it is desired to finely modulate the characteristics of the protein. Table 9 shows amino acids that may be substituted for an original amino acid in a protein and that are regarded as conservative substitutions. As noted, all such peptide variants are tested to confirm that they retain the ability to stimulate INF-&ggr; production. 13 TABLE 9 Original Residue Conservative Substitutions Ala ser Arg lys Asn gln, his Asp glu Cys ser Gln asn Glu asp Gly pro His asn; gln Ile leu, val Leu ile; val Lys arg; gln; glu Met leu; ile Phe met; leu; tyr Ser thr Thr ser Trp tyr Tyr trp; phe Val ile; leu

[0145] Substantial changes in immunological identity are made by selecting substitutions that are less conservative than those in Table 9, i.e., selecting residues that differ more significantly in their effect on maintaining: (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. The substitutions that, in general, are expected to produce the greatest changes in protein properties are those in which: (a) a hydrophilic residue, e.g., seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histadyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having a side chain, e.g., glycine. However, such variants must retain the ability to stimulate INF-&ggr; production.

[0146] VIII. Use of Cloned Mycobacterium Sequences to Produce Vaccines

[0147] A. Overview

[0148] The purified peptides encoded by the nucleotide sequences of the present invention may be used directly as immunogens for vaccination. The conventional tuberculosis vaccine is the BCG (Bacillus Calmette-Guerin) vaccine, which is a live vaccine comprising attenuated Mycobacterium bovis bacteria. However, the use of this vaccine in a number of countries, including the U.S., has been limited because administration of the vaccine interferes with the use of the tuberculin skin test to detect infected individuals, Wyngaarden et al. (eds.), Cecil Textbook of Medicine, 19th ed., W. B. Saunders, Philadelphia, Pa., pages 1733- 1742, 1992, and section VIII (2) below.

[0149] The present invention provides a possible solution to the problems inherent in the use of the BCG vaccine in conjunction with the tuberculin skin test. The solution is based upon the use of one or more of the immunostimulatory M. tuberculosis peptides disclosed herein as a vaccine and one or more different immunostimulatory M. tuberculosis peptides disclosed herein in the tuberculosis skin test (see section IX (2) below). If the immune system is primed with such a vaccine, the system will be able to resist an infection by M. tuberculosis. However, exposure to the vaccine peptides alone will not induce an immune response to those peptides that are reserved for use in the tuberculin skin test. Thus, the present invention would allow the clinician to distinguish between a vaccinated individual and an infected individual.

[0150] Methods for using purified peptides as vaccines are well known in the art and are described in the following publications: Pal et al., Infect. Immun. 60:4781-4792, 1992 (describing immunization with extra-cellular proteins of Mycobacterium tuberculosis); Yang et al., Immunology 72:3-9, 1991 (vaccination with synthetic peptides corresponding to the amino acid sequence of a surface glycoprotein from Leishmania major); Andersen, Infection & Immunity 62:2536, 1994 (vaccination using short-term culture filtrate containing proteins secreted by Mycobacterium tuberculosis); and Jardim et al., J. Exp. Med. 172:645-648, 1990 (vaccination with synthetic T-cell epitopes derived from Leishmania parasite). Methods for preparing vaccines that contain immunogenic peptide sequences are also disclosed in U.S. Pat. Nos. 4,608,251, 4,601,903, 4,599,231, 4,5995230, 4,596,792 and 4,578,770. The formulation of peptide-based vaccines employing M. tuberculosis peptides is also discussed extensively in International Patent Application No. WO 95/01441.

[0151] As is well known in the art, adjuvants such as Complete Freund's Adjuvant (CFA) and Incomplete Freund's Adjuvant (IFA) may be used in formulations of purified peptides as vaccines. Accordingly, one embodiment of the present invention is a vaccine comprising one or more immunostimulatory M. tuberculosis peptides encoded by genes including a sequence shown in the attached sequence listing, together with a pharmaceutically acceptable adjuvant.

[0152] Additionally, the vaccines may be formulated using a peptide according to the present invention together with a pharmaceutically acceptable excipient such as water, saline, dextrose, or glycerol. The vaccines may also include auxillary substances such as emulsifying agents and pH buffers.

[0153] It will be appreciated by one of ordinary skill in the art that vaccines formulated as described above may be administered in a number of ways including subcutaneously, intra-muscularly, and by intra-venous injection. Doses of the vaccine administered will vary depending on the antigenicity of the particular peptide or peptide combination employed in the vaccine, and characteristics of the animal or human patient to be vaccinated. While the determination of individual doses will be within the skill of the administering physician, it is anticipated that doses of between 1 microgram and 1 milligram will be employed.

[0154] As with many vaccines, the vaccines of the present invention may routinely be administered several times over the course of a number of weeks to ensure that an effective immune response is triggered. As described in International Patent Application No. WO 95/01441, up to six doses of the vaccine may be administered over a course of several weeks, but more typically between one and four doses are administered. Where such multiple doses are administered, they will normally be administered at from two to twelve-week intervals, more usually from three to five-week intervals. Periodic boosters at intervals of 1-5 years, usually three years, will be desirable to maintain the desired levels of protective immunity.

[0155] As described in WO 95/01441, the course of the immunization may be followed by in vitro proliferation assays of PBL (peripheral blood lymphocytes) co-cultured with ESAT6 or ST-CF, and especially by measuring the levels of IFN-released from the primed lymphocytes. The assays are well known and are widely described in the literature, including in U.S. Pat. Nos. 3,791,932; 4,174,384 and 3,949,064.

[0156] To ensure an effective immune response against tuberculosis infection, vaccines according to the present invention may be formulated with more than one immunostimulatory peptide encoded by the nucleotide sequences disclosed herein. In such cases, the amount of each purified peptide incorporated into the vaccine will be adjusted accordingly.

[0157] Alternatively, multiple immunostimulatory peptides may also be administered by expressing the nucleic acids encoding the peptides in a nonpathogenic microorganism, and using the transformed nonpathogenic microorganism as a vaccine. As described in International Patent Application No. WO 95/01441, Mycobacterium bovis BCG may be employed for this purpose although this approach would destroy the advantage outlined above to be gained from using separate classes of the peptides as vaccines and in the skin test. As disclosed in WO 95/01441, an immunostimulatory peptide of M. tuberculosis can be expressed in the BCG bacterium by transforming the BCG bacterium with a nucleotide sequence encoding the M. tuberculosis peptide. Thereafter, the BCG bacteria can be administered in the same manner as a conventional BCG vaccine. In particular embodiments, multiple copies of the M. tuberculosis sequence are transformed into the BCG bacteria to enhance the amount of M. tuberculosis peptide produced in the vaccine strain.

[0158] Finally, a recent development in the field of vaccines is the direct injection of nucleic acid molecules encoding peptide antigens, as described in Janeway & Travers, Immunobiology: The Immune System In Health and Disease, page 13.25, Garland Publishing, Inc., New York, 1997; and McDonnell & Askari, N. Engl. J. Med. 334:42-45, 1996. Thus, plasmids that include nucleic acid molecules described herein, or that include nucleic acid sequences encoding peptides according to the present invention, may be utilized in such DNA vaccination methods.

[0159] B. Pool of 12 M. tuberculosis Protein Confers Immunity

[0160] A guinea pig protection study was undertaken to compare three candidate vaccine preparations with BCG. These included the Antigen 85 complex with IL-2 (Ag 85), a fusion-protein pool of twelve M. tuberculosis proteins in combination with IL-2 (FPP), and a control containing the adjuvant monophosphoryl lipid A (MPL).

[0161] 1. Materials and Methods

[0162] The following fusion proteins were identified and cloned into expression vectors as described supra and then were over-expressed in E. coli BL21 (DE3) plysS (Novagen, Madison, Wis.): MBP-264 (SEQ ID NO: 114), MBP-506 (SEQ ID NO: 115), MBP-825 (SEQ ID NO: 116), PET-23 (SEQ ID NO: 117), PET-47 (SEQ ID NO: 118), PET-639 (SEQ ID NO: 119), PET-916 (SEQ ID NO: 120), PET-1084 (SEQ ID NO: 121); in E. coli BL21: GST-152 (SEQ ID NO: 122), GST-511 (SEQ ID NO: 123), GST-822 (SEQ ID NO: 124); and in E. coli SURE (Stratagene, La Jolla, Calif.): GST-206 (SEQ ID NO: 125).

[0163] The Antigen 85 complex was kindly provided by Dr. John Belisle (Colorado State University, Fort Collins, Colo.) through the TB research materials and vaccine testing contract (NIH, NIAID NOI AI-75320) (Belisle Science 276:1420-1422, 1997).

[0164] Animals. Outbred female Hartley guinea pigs, that were specifically pathogen-free (Charles River Laboratories, North Willmington, Mass.) were held under barrier conditions in an ANL-3 biohazard laboratory. Owing to expense, experimental groups were limited to between three and five animals. They were housed one to a cage and given free access to water and guinea pig chow. Following aerogenic infection with M. tuberculosis H37Rv, the guinea pigs were monitored over a period of 27 weeks. After the first four weeks, the animals were weighed weekly, with the exception of a two-week period, and any animals demonstrating sudden significant weight loss were euthanised.

[0165] Bacterial infection. Guinea pigs were aerogenically infected with between 20 and 50 bacilli of M. tuberculosis H37Rv using a calibrated aerosol generation device (Glas-Col, Terre Haute, Ind.) that delivered the inoculum to each lung.

[0166] Vaccinations. Guinea pigs were immunized subcutaneously two times at a three-week interval using 100 &mgr;g of AG85 complex with 20 &mgr;g Proleukin-PEG IL-2 (Chiron, Emeryville, Calif.) and emulsified in 100 &mgr;g Monophosphoryl Lipid A (MPL; Ribi ImmunoChem Research, Inc., Hamilton, Mont.) adjuvant that had been solubilized in 0.02% triethanolamine and 0.4% dextrose by sonication (MPL-TeoA); and 100 &mgr;g of fusion proteins that had been pooled in equivalent concentrations with 20 &mgr;g PEG IL-2 (Chiron) in 100 &mgr;g MPL-TeoA adjuvant. The positive control, BCG Copenhagen, was injected once intradermally (103 bacilli/guinea pig), corresponding to the second set of injections. Necropsy. Guinea pigs were euthanized by the intraperitoneal injection of 1-3 mL of sodium pentobarbital (Sleepaway, Ft. Dodge, Iowa.). The abdominal and thoracic cavities were opened aseptically and the spleen and right lower lung lobe were homogenised separately in sterile Teflon-glass homogenisers in 4.5 mL of sterile physiological saline. The number of viable M. tuberculosis organisms was determined by inoculating appropriate dilutions onto Middlebrook™ 7H 10 agar plates (Hardy Diagnostics, Santa Maria, Calif.). The colonies were counted after three weeks' incubation at 37° C. Data were expressed as mean log10 number of viable organisms per portion of tissue.

[0167] Histological analysis. Sagital tissue sections were made through the middle of the left lower lobe. The tissue sections were fixed in 10% neutral buffered formalin and stained with hematoxylin and eosin. Prepared tissues were coded prior to evaluation by a board-certified pathologist.

[0168] 2. Results

[0169] Long-term survival assay. The survival of test groups after aerosol infection and their respective weight gain or loss are summarized in Table 10. 14 TABLE 10 Total Weight Change, Survival Length and Bacterial Loads in The Lung and Spleen For Individual Guinea Pigs within Different Vaccination Groups, After Aerogenic Infection with M. tuberculosis. Survival Wt. Bacterial Load Bacterial Load Group No (wks) Change (g) Log10 Lung Log10 Spleen BCG 117 27 159 3.65 4.93 121 27 99 4.13 3.95 130 27 151 4.13 3.65 mean 27.0 ± 0.0136 136 ± 33 3.97 ± 0.16 4.18 ± 0.39 Ag85 155 25 −25 158 27 86 5.91 3.65 162 27 75 5.19 4.19 167 27 86 5.94 3.83 mean 25.2 ± 1.4 35 ± 66 5.68 ± 0.24 3.89 ± 0.16 MPL 170 27 81 5.31 4.95 171 12 −205 >7.0 >7.0 172 9 −231 6.51 6.49 mean 16.0 ± 5.6 −118 ± 173 6.27 ± 0.87 6.15 ± 1.07 FPP 157 15 17 6.58 5.23 166 27 82 5.48 2.65 169 27 133 5.26 0.0* mean 23.0 ± 4.0 77 ± 58 5.77 ± 0.41 2.63 ± 1.51 *minimal number of detectable organisms = 225

[0170] All positive-control animals vaccinated with BCG exhibited consistent weight gain and were healthy when the experiment was curtailed after 27 weeks.

[0171] Three out of five guinea pigs immunized with Ag85 survived to 27 weeks, as did 2 out of 3 pigs vaccinated with the fusion protein mixture. All of these surviving animals showed reasonable weight gain. In contrast, 2 of 3 negative controls exhibited precipitous weight loss and died within the first 17 weeks of the experiment. That animal experienced dramatic weight loss throughout the latter few weeks of the experiment.

[0172] Bacterial Loads. Table 9 shows the individual bacterial loads found in the lung and spleen. Subsequent assessment of bacterial loads indicated that only BCG dramatically reduced bacterial numbers in the lungs. Approximately one-half log reduction in counts were observed in mice administered Ag85 of the fusion protein mixture.

[0173] Dissemination of bacteria to the spleen was reduced in all groups relative to the negative control and the fusion protein pool effected the greatest control on dissemination.

[0174] Comparative Histology. Guinea pigs immunized with BCG exhibited a few discrete granulomas in the lungs with a diffuse interstitial mononuclear cell infiltrate affecting approximately 70% of the lung parenchyma, with no evidence of necrosis, caseation or mineralization. In contrast, guinea pigs in the negative control group had a moderate to severe, multi-focal granulomatous pneumonia with extensive caseation and necrosis throughout the lung parenchyma.

[0175] A mixed response was seen in guinea pigs administered Ag85. In two animals that died before 27 weeks (at 20 and 25 weeks, respectively) a moderate, multi-focal, necrosuppurative granulomatous pneumonia was seen, with scattered aggregates of lymphocytes and areas of mineralization and fibrosis. In the three surviving animals the pathology was less severe, with increased numbers of aggregations of lymphocytes being evident and the granulomatous pneumonia scored as mild to moderate. A similar histological appearance was seen in the lungs of two guinea pigs immunized with fusion proteins that were still alive at 27 weeks.

[0176] IX. Use of Cloned Mycobacterium Sequences in Diagnostic Assays

[0177] Another aspect of the present invention is a composition for diagnosing tuberculosis infection. The composition includes peptides encoded by one or more of the nucleotide sequences of the present invention. The invention also encompasses methods and compositions for detecting the presence of anti-tuberculosis antibodies, tuberculosis peptides, and tuberculosis nucleic acid sequences in body samples. Three examples typify the various techniques that may be used to diagnose tuberculosis infection using the present invention: an in vitro ELISA assay, an in vivo skin test assay, and a nucleic acid amplification assay.

[0178] A. In Vitro Elisa Assay

[0179] One aspect of the invention is an ELISA that detects anti-tuberculosis mycobacterial antibodies in a medical specimen. An immunostimulatory peptide encoded by a nucleotide sequence of the present invention is employed as an antigen and is preferably bound to a solid matrix such as a crosslinked dextran such as SEPHADEX® (Pharmacia, Piscataway, N.J.), agarose, polystyrene, or the wells of a microtiter plate. The polypeptide is admixed with the specimen, such as human sputum, and the admixture is incubated for a sufficient time to allow antimycobacterial antibodies present in the sample to immunoreact with the polypeptide. The presence of the immunopositive immunoreaction is then determined using ELISA.

[0180] In a preferred embodiment, the solid support to which the polypeptide is attached is the wall of a microtiter assay plate. After attachment of the polypeptide, any nonspecific binding sites on the microtiter well walls are blocked with a protein such as bovine serum albumin (BSA). Excess BSA is removed by rinsing and the medical specimen is admixed with the polypeptide in the microtiter wells. After a sufficient incubation time, the microtiter wells are rinsed to remove excess sample and then a solution of a second antibody, capable of detecting human antibodies, is added to the wells. This second antibody is typically linked to an enzyme such as peroxidase, alkaline phosphatase, or glucose oxidase. For example, the second antibody may be a peroxidase-labeled goat anti-human antibody. After further incubation, excess amounts of the second antibody are removed by rinsing and a solution containing a substrate for the enzyme label (such as hydrogen peroxide for the peroxidase enzyme) and a color-forming dye precursor, such as o-phenylenediamine, is added. The combination of mycobacterium peptide (bound to the wall of the well), the human anti-mycobacterial antibodies (from the specimen), the enzyme-conjugated anti-human antibody, and the color substrate produces a color than can be read using an instrument that determines optical density, such as a spectrophotometer. These readings can be compared to a control incubated with water in place of the human body sample, or, preferably, a human body sample known to be free of antimycobacterial antibodies. Positive readings indicate the presence of anti-mycobacterial antibodies in the specimen, which in turn indicate a prior exposure of the patient to tuberculosis.

[0181] B. Example of Elisa Using Eight Full-Length Clones

[0182] The following fusion proteins were over-expressed in E. coli BL21 plysS: MBP-506 (SEQ ID NO: 115), MPB-825 (SEQ ID NO: 116), PET-639 (SEQ ID NO: 119), PET-916 (SEQ ID NO: 120), PET-1084 (SEQ ID NO: 121); in E. coli BL21: GST-152 (SEQ ID NO: 122), GST-822 (SEQ ID NO: 124); and in E. coli SURE: GST-206 (SEQ ID NO: 125). The recombinant fusion proteins MBP-506 (SEQ ID NO: 115), MBP-825 (SEQ ID NO: 116), GST-152 (SEQ ID NO: 122), GST-822 (SEQ ID NO: 124), PET-639 (SEQ ID NO: 119), PET-I 084 (SEQ ID NO: 121) formed inclusion bodies that were harvested from the pellet following centrifugation of the bacterial sonicate. The fusion proteins PET-916 and GST-206 were found primarily in the supernatant and underwent considerable breakdown in culture. Protein fractions were checked by SDS-PAGE using Coomassie Blue staining and approximate concentrations determined by Western blotting.

[0183] ELISA sera were obtained from 38 Brazilian individuals with pulmonary tuberculosis and that were HIV positive (TBH), from 20 individuals with extrapulmonary tuberculosis and that were HIV negative (EP-TB), and from 17 healthy volunteers. Wells were coated with 200 ng of antigen in 50 &mgr;L of coating buffer (15 mM Na2CO3, 35 mM NaHCO3 adjusted to pH 9.6) and incubated for 1 hour. Plates were then aspirated, 250 &mgr;L of blocking buffer (0.5% BSA and 0.1% Thimerosal (Aldrich, Milwaukee, Wis.) in phosphate-buffered saline at pH 7.4) were added to each well, and the plates were incubated for a further 2 hours. Plates were washed six times with 350 &mgr;L/well of washing solution (2mL/L Tween 20 in PBS at pH 7.4) and serum was added at a 1:100 dilution in serum diluting buffer (blocking buffer with 2 mL/L Tween 20). Plates were incubated for 30 minutes and washed as before. 50 &mgr;L of a 1:50,000 dilution of HRP-Protein A (ZYMED, VWR) were added to each well. The plates were then incubated for 30 minutes and washed as before. 100 &mgr;L/well of TMB Microwell Peroxidase Substrate (Kirkegaard & Perry Laboratories) was added and the plates were incubated for 15 minutes in the dark. The reaction was stopped with 100 &mgr;L of 0.5M H2SO4 and the plates were read immediately at 450 nm. The mean and standard deviations (SD) were calculated from the sera of uninfected control subjects (n=17) and the cut-off for positive results was calculated as greater than the mean plus 3 SD, and for high level responses, as the mean plus 6 SD.

[0184] Table 11 shows the overall seropositivity results for the nine full-length fusion proteins. When individual sera were considered, in the EP-TB group, 71% of sera contained antibodies against at least one antigen (or 82% if the TB lysate individuals are included) and in the TBH group, 66% of sera contained antibodies against at least one antigen (or 84% if the TB lysate individuals are included). Thus, specific antibody responses can be identified in the majority of the individual sera.

[0185] Measurement of the serum antibodies provides a way to determine the antigen reactivity. For the two groups, the number of serum samples that reacted positively to each antigen, and those which reacted at a high level, are presented in Table 11. For patients with EP-TB, antibodies against GST-822 were found in 60% of individual sera and a third of these were high-level responses. Specific antibody responses to three other antigens (PET-639, MBP-825, and MBP-506) of between 35% and 45% were also found in the EP-TB group. The other five antigens, as well as the M. tuberculosis lysate, elicited responses in fewer sera from EP-TB patients (35% or less).

[0186] For patients with TBH, antibodies against MBP-506 were found in 61% of individual sera and over two thirds of these were high-level responses. GST-822 was recognized in 42% of sera and almost two-thirds of the specific antibody responses were at a high level. The other six antigens, as well as the M. tuberculosis lysate, elicited responses in fewer sera from EP-TB patients (35% or less).

[0187] This study demonstrated that most of the patients infected with M. tuberculosis produced serum antibodies to a variety of antigens. As has been seen for individuals with pulmonary TB, Lyashchenko et al., Infect. Immun. 66:3936-3940, 1998, sera responses confirm that antigen recognition and strength of response were heterogeneous in both EP-TB and TBH groups. Encouragingly, the majority of sera contained specific antibodies to the small set of antigens tested. This finding suggests that, for these two groups previously considered refractory to serodiagnosis, the combination of only a few well-recognized antigens might greatly improve diagnostic success. MBP-506 and GST-822, the two highly reactive and most frequently recognized antigens identified in this study, are potentially valuable candidates for inclusion in a serodiagnostic test. 15 TABLE 11 Antigen Recognition by Serum Antibodies in TB Patients Number (%) of responders EP-TB HIV +, TB+ Antigen Totala High levelb Totala High levelb TB lysate  5 (25%) 4 20%) 13 34%)  6 (30%) PET-1084  0 (0%) 0 (0%)  4 11%)  1 (3%) PET-47  5 (25%) 1 (5%)  8 21%)  3 (8%) PET-916  3 (15%) 3 15%) 11 29%)  4 (11%) PET-639  8 (40%) 2 10%)  5 13%)  4 (11%) MBP-825  7 (35%) 1 (5%) 10 26%)  5 (13%) MBP-506  9 (45%) 3 15%) 23 61%) 16 (42%) GST-822 12 (60%) 4 20%) 16 42%) 10 (26%) GST-206  3 (15%) 2 10%)  5 13%)  3 (8%) GST-152  2 (10%) 1 (5%)  2 (5%)  0 (0%) a TB patients having antibody levels greater or equal to cut-off, determined from negative control sera. b TB patients having antibody levels greater or equal to cut-off plus 3 SD, determined from negative control sera.

[0188] C. Skin Test Assay

[0189] Alternatively, the presence of tuberculosis antibodies in a patient's body may be detected using an improved form of the tuberculin skin test, employing immunostimulatory peptides of the present invention. Conventionally, this test produces a positive result in one of the following conditions: the current presence of M. tuberculosis in the patient's body after exposure of the patient to M. tuberculosis and prior BCG vaccination. As noted above, if one group of immunostimulatory peptides is reserved for use in vaccine preparations, and another group reserved for use in the improved skin test, then the skin test will not produce a positive response in individuals whose only exposure to tuberculosis antigens was via the vaccine. Accordingly, the improved skin test would be able to properly distinguish between infected individuals and vaccinated individuals.

[0190] The tuberculin skin test consists of an injection of proteins from M. tuberculosis that are injected intradermally. The test is described in detail in Wyngaarden et al. (eds.), Cecil Textbook of Medicine, W. B. Saunders, Philadelphia, Pa., 1992. If the subject has reactive T-cells to the injected protein, then the cells will migrate to the site of injection and cause a local inflammation. This inflammation, which is generally known as delayed type hypersensitivity (DTH) is indicative of circulating M. tuberculosis antibodies in the patient. Purified immunostimulatory peptides according to the present invention may be employed in the tuberculin skin test using the methods described in Wyngaarden et al. (eds.), Cecil Textbook of Medicine, W. B. Saunders, Philadelphia, Pa., 1992.

[0191] D. Nucleic Acid Amplification

[0192] One aspect of the invention includes nucleic acid primers and probes derived from the sequences set forth in the attached sequence listing, as well as primers and probes derived from the full-length genes that can be obtained using these sequences. These primers and probes can be used to detect the presence of M. tuberculosis nucleic acids in body samples and thus to diagnose infection. Methods for making primers and probes based on these sequences are described in section V, above.

[0193] The detection of specific nucleic acid sequences of a pathogen in human body samples by polymerase chain reaction (PCR) amplification is discussed in detail in Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press: San Diego, 1990, in particular, part four of that reference. To detect M. tuberculosis sequences, primers based on the sequences disclosed herein would be synthesized, such that PCR amplification of a sample containing M. tuberculosis DNA would result in an amplified fragment of a predicted size. If necessary, the presence of this fragment following amplification of the sample nucleic acid can be detected by dot blot analysis (see chapter 48 of Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press: San Diego, 1990). PCR amplification employing primers based on the sequences disclosed herein may also be employed to quantify the amount of M. tuberculosis nucleic acid present in a particular sample (see chapters 8 and 9 of Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press: San Diego, 1990). Reverse-transcription PCR using these primers may also be utilized to detect the presence of M. tuberculosis RNA, indicative of an active infection.

[0194] Alternatively, probes based on the nucleic acid sequences described herein may be labeled with suitable labels (such as 32P or biotin-avidin enzyme linked systems) and used in hybridization assays to detect the presence of M. tuberculosis nucleic acid in provided samples.

[0195] X. Use of Cloned Mycobacterium Sequences to Raise Antibodies

[0196] Monoclonal antibodies may be produced to the purified M. tuberculosis peptides for diagnostic purposes. Substantially pure M. tuberculosis peptide suitable for use as an immunogen is isolated from transfected or transformed cells as described above. The concentration of protein in the final preparation is adjusted, for example, by concentration on an Amicon filter device, to the level of a few milligrams per milliliter. Monoclonal antibody to the protein can then be prepared as described below.

[0197] A. Monoclonal Antibody Production by Hybridoma Fusion

[0198] Monoclonal antibody to epitopes of the M. tuberculosis peptides identified and isolated as described herein can be prepared from murine hybridomas according to the classical method of Kohler and Milstein, Nature, 256:495, 1975, or derivative methods thereof. Briefly, a mouse is repetitively inoculated with a few micrograms of the selected purified protein over a period of a few weeks. The mouse is then sacrificed, and the antibody-producing cells of the spleen isolated. The spleen cells are fused with mouse myeloma cells by means of polyethylene glycol, and the excess unfused cells are destroyed by growth of the system on selective media comprising aminopterin (HAT media). The successfully fused cells are diluted and aliquots of the dilution placed in wells of a microtiter plate where growth of the culture is continued. Antibody-producing clones are identified by detection of antibody in the supernatant fluid of the wells by immunoassay procedures, such as ELISA, as originally described by Engvall, Enzymol,. 70:419, 1980, and derivative methods thereof. Selected positive clones can be expanded and their monoclonal antibody product harvested for use. Detailed procedures for monoclonal antibody production are described in Harlow and Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988.

[0199] B. Antibodies Raised Against Synthetic Peptides

[0200] An alternative approach to raising antibodies against the M. tuberculosis peptides is to use synthetic peptides synthesized on a commercially available peptide synthesizer based upon the amino acid sequence of the peptides predicted from nucleotide sequence data.

[0201] In a preferred embodiment of the present invention, monoclonal antibodies that recognize a specific M. tuberculosis peptide are produced. Optimally, monoclonal antibodies will be specific to each peptide, i.e., such antibodies recognize and bind one M. tuberculosis peptide and do not substantially recognize or bind to other proteins, including those found in healthy human cells.

[0202] The determination that an antibody specifically detects a particular M. tuberculosis peptide is made by any one of a number of standard immunoassay methods; for instance, the Western blotting technique, Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. To determine that a given antibody preparation (such as one produced in a mouse) specifically detects one M. tuberculosis peptide by Western blotting, total cellular protein is extracted from a sample of human sputum from a healthy patient and from sputum from a patient suffering from tuberculosis. As a positive control, total cellular protein is also extracted from M. tuberculosis cells grown in vitro. These protein preparations are then electrophoresed on a sodium dodecyl sulfate polyacrylamide gel. Thereafter, the proteins are transferred to a membrane (for example, nitrocellulose) by Western blotting, and the antibody preparation is incubated with the membrane. After washing the membrane to remove non-specifically bound antibodies, the presence of specifically bound antibodies is detected by the use of an anti-mouse antibody conjugated to an enzyme such as alkaline phosphatase. Application of the substrate 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium results in the production of a dense blue compound by immuno-localized alkaline phosphatase. Antibodies that specifically detect the M. tuberculosis protein will, by this technique, be shown to bind to the M. tuberculosis-extracted sample at a particular protein band (which will be localized at a given position on the gel determined by its molecular weight) and to the proteins extracted from the sputum from the tuberculosis patient. No significant binding will be detected to proteins from the healthy patient sputum. Non-specific binding of the antibody to other proteins may occur and may be detectable as a weak signal on the Western blot. The non-specific nature of this binding will be recognized by one skilled in the art by the weak signal obtained on the Western blot relative to the strong primary signal arising from the specific antibody-tuberculosis protein binding. Preferably, no antibody would be found to bind to proteins extracted from healthy donor sputum.

[0203] Antibodies that specifically recognize a M. tuberculosis peptide encoded by the nucleotide sequences disclosed herein are useful in diagnosing the presence of tuberculosis antigens in patients.

[0204] All publications and published patent documents cited in this specification are incorporated herein by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0205] Having illustrated and described the principles of the invention in multiple embodiments and examples, it should be apparent to those skilled in the art that the invention can be modified in arrangement and detail without departing from such principles. Therefore, the invention encompasses all modifications coming within the spirit and scope of the following claims.

Claims

1. An isolated immunostimulatory peptide selected from the group consisting of:

(a) an amino acid sequence selected from the group consisting of SEQ ID NOS: 126-138 and fragments thereof;

(b) amino acid sequences that differ from those specified in (a) by one or more conservative amino acid substitutions; and

(c) amino acid sequence having at least 60% sequence identity to the sequences specified in (a) or (b).

2. An isolated nucleic acid molecule, encoding an immunostimulatory peptide according to claim 1.

3. A method of stimulating an immune response, comprising administering to a subject one or more of the immunostimulatory peptides of claim 1.

4. A method of detecting a Mycobacterium tuberculosis specific binding agent, comprising:

(a) contacting a sample, suspected of containing a Mycobacterium tuberculosis specific binding agent, with one or more of the immunostimulatory peptides of claim 1;

(b) allowing a complex comprising the immunostimulatory peptide and the specific binding agent to form; and

(c) detecting the presence of the complex.

5. The method of claim 4, wherein the immunostimulatory peptide is selected from the group consisting of SEQ ID NOS: 126-138, and fragments thereof.

6. An immunostimulatory preparation, comprising one or more of the immunostimulatory peptides of claim 1.

7. The immunostimulatory preparation of claim 6, further comprising a pharmaceutically acceptable excipient, diluent, adjuvant, or a mixture thereof.

8. An isolated immunostimulatory peptide, comprising an amino acid sequence selected from the group consisting of SEQ ID NOS: 126-138.

9. A composition, comprising a Mycobacterium tuberculosis specific binding agent that specifically binds to the isolated immunostimulatory peptide of claim 1.

10. The composition of claim 9, wherein the Mycobacterium tuberculosis specific binding agent further comprises at least one polyclonal antiserum.

11. The composition of claim 10, wherein the Mycobacterium tuberculosis specific binding agent further comprises a monoclonal antibody.

12. A method for determining whether a subject has been previously infected with Mycobacterium tuberculosis, the method comprising:

(a) administering to a subject one or more of the immunostimulatory peptides of claim 1; and

(b) detecting an immune response in the subject.