Genotyping human UDP-glucuronsyltransferase 2B15 (UGT2B15) genes

Abstract

Genetic polymorphisms are identified in the human STP2 gene that alter STP2-dependent drug metabolism. Nucleic acids comprising the polymorphic sequences are used to screen patients for altered metabolism for STP2 substrates, potential drug-drug interactions, and adverse/side effects, as well as diseases that result from environmental or occupational exposure to toxins. The nucleic acids are used to establish animal, cell and in vitro models for drug metabolism.

Description

INTRODUCTION

[0001] Sulfonation is an important pathway in the biotransformation of many drugs, xenobiotics, neurotransmitters, and steroid hormones. Many of the sulfonation reactions for pharmacologic agents are performed by a group of enzymes known as phenol transferases. The phenol sulfotransferase gene family consists to three members located on chromosome 16. A single gene (STM) encodes the thermolabile monoamine-metabolizing form. Two thermostable phenol-metabolizing enzymes are encoded by STP1 and STP2. Substrates for STP1 and STP2 include minoxidil, acetaminophen, and para-nitrophenol. Alterations in phenol sulfotransferase activity have been correlated with individual variation in sulfonation of acetaminophen (Reiter and Weinshilboum (1982) Clin. Pharm.) and predisposition to diet-induced migraine headaches.

[0002] The STP2 gene spans approximately 5.1 kb and contains nine exons that range in length from 74 to 347 bp. Exons IA and IB are noncoding and represent two different cDNA 5′-untranslated region sequences. The two apparent 5′-flanking regions of the STP2 gene contain no canonical TATA boxes, but do contain CCAAT elements. STP2 has been localized to human chromosome 16.

[0003] Since rates of metabolism of drugs, toxins, etc. can depend on the amounts and kinds of phenol sulfotransferase in tissues, variation in biological response may be determined by the profile of expression of phenol sulfotransferases in each person. Analysis of genetic polymorphisms that lead to altered expression and/or enzyme activity are therefore of interest.

SUMMARY OF THE INVENTION

[0004] Genetic sequence polymorphisms are identified in the STP2 gene. Nucleic acids comprising the polymorphic sequences are used in screening assays, and for genotyping individuals. The genotyping information is used to predict an individuals' rate of metabolism for STP2 substrates, potential drug-drug interactions, and adverse/side effects. Specific polynucleotides include the polymorphic STP2 sequences set forth in SEQ ID NOs:63-100.

[0005] The nucleic acid sequences of the invention may be provided as probes for detection of STP2 locus polymorphisms, where the probe comprises a polymorphic sequence of SEQ ID NOs:63- 1 10. The sequences may further be utilized as an array of oligonucleotides comprising two or more probes for detection of STP2 locus polymorphisms.

[0006] Another aspect of the invention provides a method for detecting in an individual a polymorphism in STP2 metabolism of a substrate, where the method comprises analyzing the genome of the individual for the presence of at least one STP2 polymorphism; wherein the presence of the predisposing polymorphism is indicative of an alteration in STP2 expression or activity. The analyzing step of the method may be accomplished by detection of specific binding between the individual's genomic DNA with an array of oligonucleotides comprising STP2 locus polymorphic sequences. In other embodiments, the alteration in STP2 expression or activity is tissue specific, or is in response to a STP2 modifier that induces or inhibits STP2 expression.

Database References for Nucleotide Sequences

[0007] Genbank accession no. U34804 provides the sequence of the STP2 gene.

BRIEF DESCRIPTION OF THE SEQUENCE LISTING

[0008] STP2 Reference Sequences. SEQ ID NO: 1 lists the sequence of the reference STP2 gene. The exons are as follows: exon 1A (nt 2591-2664); exon 1B (nt 3180-3526); exon 2 (nt 3726-3877); exon 3 (nt 3985-4110); exon 4 (nt 4196-4293); exon 5 (nt 6088-6214); exon 6 (6310-6404); exon 7 (nt 7214-7394); exon 8 (nt 7517-7712). The mRNA sequence is set forth in SEQ ID NO:2, and the encoded amino acid sequence in SEQ ID NO:3.

[0009] Primers. The PCR primers for amplification of polymorphic sequences are set forth as SEQ ID NOs:4-17. The primers used in sequencing isolated polymorphic sequences are presented as SEQ ID NOs: 18-46. The primers used in Taqman assays are listed as SEQ ID NO:47-62.

[0010] Polymorphisms. Polymorphic sequences of STP2 are presented as SEQ ID NOs:63-110.

DESCRIPTION OF THE SPECIFIC EMBODIMENTS

[0011] Pharmacogenetics is the linkage between an individual's genotype and that individual's ability to metabolize or react to a therapeutic agent. Differences in metabolism or target sensitivity can lead to severe toxicity or therapeutic failure by altering the relation between bioactive dose and blood concentration of the drug. Relationships between polymorphisms in metabolic enzymes or drug targets and both response and toxicity can be used to optimize therapeutic dose administration.

[0012] Genetic polymorphisms are identified in the STP2 gene. Nucleic acids comprising the polymorphic sequences are used to screen patients for altered metabolism for STP2 substrates, potential drug-drug interactions, and adverse/side effects, as well as diseases that result from environmental or occupational exposure to toxins. The nucleic acids are used to establish animal, cell culture and in vitro cell-free models for drug metabolism.

Definitions

[0013] It is to be understood that this invention is not limited to the particular methodology, protocols, cell lines, animal species or genera, constructs, and reagents described, as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.

[0014] As used herein the singular forms “a”, “and”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a construct” includes a plurality of such constructs and reference to “the STP2 nucleic acid” includes reference to one or more nucleic acids and equivalents thereof known to those skilled in the art, and so forth. All technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs unless clearly indicated otherwise.

[0015] STP2 reference sequence. The sequence of the STP2 gene may be accessed through Genbank as previously cited, and is provided in SEQ ID NO:1 and SEQ ID NO:2 (CDNA sequence). The amino acid sequence of STP2 is listed as SEQ ID NO:3. These sequences provide a reference for the polymorphisms of the invention. The nucleotide sequences provided herein differ from the published sequence at certain positions throughout the sequence. Where there is a discrepancy the provided sequence is used as a reference.

[0016] The term “wild-type” may be used to refer to the reference coding sequences of STP2, and the term “variant”, or “STP2v” to refer to the provided variations in the STP2 sequence. Where there is no published form, such as in the intron sequences, the term wild-type may be used to refer to the most commonly found allele. It will be understood by one of skill in the art that the designation as “wild-type” is merely a convenient label for a common allele, and should not be construed as conferring any particular property on that form of the sequence.

[0017] STP2 polymorphic sequences. It has been found that specific sites in the STP2 gene sequence are polymorphic, i.e. within a population, more than one nucleotide (G, A, T, C) is found at a specific position. Polymorphisms may provide functional differences in the genetic sequence, through changes in the encoded polypeptide, changes in mRNA stability, binding of transcriptional and translation factors to the DNA or RNA, and the like. The polymorphisms are also used as single nucleotide polymorphisms to detect association with, or genetic linkage to phenotypic variation in activity and expression of STP2.

[0018] SNPs are generally biallelic systems, that is, there are two alleles that an individual may have for any particular marker. SNPs, found approximately every kilobase, offer the potential for generating very high density genetic maps, which will be extremely useful for developing haplotyping systems for genes or regions of interest, and because of the nature of SNPs, they may in fact be the polymorphisms associated with the disease phenotypes under study. The low mutation rate of SNPs also makes them excellent markers for studying complex genetic traits.

[0019] Single nucleotide polymorphisms are provided in the STP2 promoter, intron and exon sequences. Table 4 and the corresponding sequence listing provide both forms of each polymorphic sequence. For example, SEQ ID NO:99 and 100 are the alternative forms of a single polymorphic site. The provided sequences also encompass the complementary sequence corresponding to any of the provided polymorphisms.

[0020] In order to provide an unambiguous identification of the specific site of a polymorphism, sequences flanking the polymorphic site are shown in Table 4, where the 5′ and 3′ flanking sequence is non-polymorphic, and the central position, shown in bold, is variable. It will be understood that there is no special significance to the length of non-polymorphic flanking sequence that is included, except to aid in positioning the polymorphism in the genomic sequence. The STP2 exon sequences have been published, and therefore one of each pair of sequences in Table 4 is a publically known sequence.

[0021] As used herein, the term “STP2 gene” is intended to generically refer to both the wild-type and variant forms of the sequence, unless specifically denoted otherwise. As it is commonly used in the art, the term “gene” is intended to refer to the genomic region encompassing 5′ UTR, exons, introns, and 3′ UTR. Individual segments may be specifically referred to, e.g. exon 2, intron 5, etc. Combinations of such segments that provide for a complete STP2 protein may be referred to generically as a protein coding sequence.

[0022] Nucleic acids of interest comprise the provided STP2v nucleic acid sequence(s), as set forth in Table 4. Such nucleic acids include short hybridization probes, protein coding sequences, variant forms of STP2 CDNA, segments, e.g. exons, introns, etc., and the like. Methods of producing nucleic acids are well-known in the art, including chemical synthesis, cDNA or genomic cloning, PCR amplification, etc.

[0023] For the most part, DNA fragments will be of at least 15 nt, usually at least 20 nt, often at least 50 nt. Such small DNA fragments are useful as primers for PCR, hybridization screening, etc. Larger DNA fragments, i. e. greater than 100 nt are useful for production of the encoded polypeptide, promoter motifs, etc. For use in amplification reactions, such as PCR, a pair of primers will be used. The exact composition of primer sequences is not critical to the invention, but for most applications the primers will hybridize to the subject sequence under stringent conditions, as known in the art.

[0024] The STP2 nucleic acid sequences are isolated and obtained in substantial purity, generally as other than an intact or naturally occurring mammalian chromosome. Usually, the DNA will be obtained substantially free of other nucleic acid sequences that do not include a STP2 sequence or fragment thereof, generally being at least about 50%, usually at least about 90% pure and are typically “recombinant”, i.e. flanked by one or more nucleotides with which it is not normally associated on a naturally occurring chromosome.

[0025] For screening purposes, hybridization probes of the polymorphic sequences may be used where both forms are present, either in separate reactions, spatially separated on a solid phase matrix, or labeled such that they can be distinguished from each other. Assays may utilize nucleic acids that hybridize to one or more of the described polymorphisms.

[0026] An array may include all or a subset of the polymorphisms listed in Table 4. One or both polymorphic forms may be present in the array, for example the polymorphism of SEQ ID NO:37 and 38 may be represented by either, or both, of the listed sequences. Usually such an array will include at least 2 different polymorphic sequences, i.e. polymorphisms located at unique positions within the locus, and may include as many all of the provided polymorphisms. Arrays of interest may further comprise sequences, including polymorphisms, of other genetic sequences, particularly other sequences of interest for pharmacogenetic screening, e.g. STP1; UGT1, UGT2, cytochrome oxidases, etc. The oligonucleotide sequence on the array will usually be at least about 12 nt in length, may be the length of the provided polymorphic sequences, or may extend into the flanking regions to generate fragments of 100 to 200 nt in length. For examples of arrays, see Ramsay (1998) Nat. Biotech. 16:40-44; Hacia et al. (1996) Nature Genetics 14:441-447; Lockhart et al. (1996) Nature Biotechnol. 14:1675-1680; and De Risi et al. (1996) Nature Genetics 14:457-460.

[0027] Nucleic acids may be naturally occurring, e.g. DNA or RNA, or may be synthetic analogs, as known in the art. Such analogs may be preferred for use as probes because of superior stability under assay conditions. Modifications in the native structure, including alterations in the backbone, sugars or heterocyclic bases, have been shown to increase intracellular stability and binding affinity. Among useful changes in the backbone chemistry are phosphorothioates; phosphorodithioates, where both of the non-bridging oxygens are substituted with sulfur; phosphoroamidites; alkyl phosphotriesters and boranophosphates. Achiral phosphate derivatives include 3′-O′-5′-S-phosphorothioate, 3′-S-5′-O- phosphorothioate, 3′-CH2-5′-O-phosphonate and 3′-NH-5′-O-phosphoroamidate. Peptide nucleic acids replace the entire ribose phosphodiester backbone with a peptide linkage.

[0028] Sugar modifications are also used to enhance stability and affinity. The a-anomer of deoxyribose may be used, where the base is inverted with respect to the natural b-anomer. The 2′-OH of the ribose sugar may be altered to form 2′-O- methyl or 2′-O-allyl sugars, which provides resistance to degradation without comprising affinity.

[0029] Modification of the heterocyclic bases must maintain proper base pairing. Some useful substitutions include deoxyuridine for deoxythymidine; 5-methyl-2′- deoxycytidine and 5-bromo-2′-deoxycytidine for deoxycytidine. 5- propynyl-2′- deoxyuridine and 5-propynyl-2′-deoxycytidine have been shown to increase affinity and biological activity when substituted for deoxythymidine and deoxycytidine, respectively.

[0030] STP2 polypeptides. A subset of the provided nucleic acid polymorphisms in STP2 exons confer a change in the corresponding amino acid sequence. Using the amino acid sequence provided in SEQ ID NO:3 as a reference, the amino acid polymorphisms of the invention include pro→leu, pos. 19; ala→val, pos. 136; asn→thr, pos. 235; glu→lys, pos 282; and atruncated formresulting from a stop codon at exon 5, position 447. Polypeptides comprising at least one of the provided polymorphisms (STP2v polypeptides) are of interest. The term “STP2v polypeptides” as used herein includes complete STP2 protein forms, e.g. such splicing variants as known in the art, and fragments thereof, which fragments may comprise short polypeptides, epitopes, functional domains; binding sites; etc.; and including fusions of the subject polypeptides to other proteins or parts thereof. Polypeptides will usually be at least about 8 amino acids in length, more usually at least about 12 amino acids in length, and may be 20 amino acids or longer, up to substantially the complete protein.

[0031] The STP2 genetic sequence, including polymorphisms, may be employed for polypeptide synthesis. For expression, an expression cassette may be employed, providing for a transcriptional and translational initiation region, which may be inducible or constitutive, where the coding region is operably linked under the transcriptional control of the transcriptional initiation region, and a transcriptional and translational termination region. Various transcriptional initiation regions may be employed that are functional in the expression host. The polypeptides may be expressed in prokaryotes or eukaryotes in accordance with conventional ways, depending upon the purpose for expression. Small peptides can also be synthesized in the laboratory.

[0032] Substrate. A substrate is a chemical entity that is modified by STP2, usually under normal physiological conditions. Although the duration of drug action tends to be shortened by metabolic transformation, drug metabolism is not “detoxification”. Frequently the metabolic product has greater biologic activity than the drug itself. In some cases the desirable pharmacologic actions are entirely attributable to metabolites, the administered drugs themselves being inert. Likewise, the toxic side effects of some drugs may be due in whole or in part to metabolic products.

[0033] Substrates of interest may be drugs, xenobiotics, neurotransmitters, steroid hormones, etc. STP2 preferentially catalyzes the sulfonation of ‘simple’ planar phenols. Substrates include minoxidil, acetaminophen, para-nitrophenol, N-hydroxy 4-aminobiphenyl, etc.

[0034] Modifier. A modifier is a chemical agent that modulates the action of STP2, either through altering its enzymatic activity (enzymatic modifier) or through modulation of expression (expression modifier, e.g., by affecting transcription or translation). In some cases the modifier may also be a substrate. Inhibitors include N-ethylmaleimide; phenylglyoxal; 2,6-dichloro-4-nitrophenol; p-nitrophenol; quercetin and other flavonoids, e.g. fisetin, galangin, myricetin, kaempferol, chrysin, apigenin; and phenols such as curcumin, genistein, ellagic acid. Steroids, e.g. estradiol benzoate, testosterone proprionate may affect activity and/or expression.

[0035] Pharmacokinetic parameters. Pharmacokinetic parameters provide fundamental data for designing safe and effective dosage regimens. A drug's volume of distribution, clearance, and the derived parameter, half-life, are particularly important, as they determine the degree of fluctuation between a maximum and minimum plasma concentration during a dosage interval, the magnitude of steady state concentration and the time to reach steady state plasma concentration upon chronic dosing. Parameters derived from in vivo drug administration are useful in determining the clinical effect of a particular STP2 genotype.

[0036] Expression assay. An assay to determine the effect of a sequence polymorphism on STP2 expression. Expression assays may be performed in cell-free extracts, or by transforming cells with a suitable vector. Alterations in expression may occur in the basal level that is expressed in one or more cell types, or in the effect that an expression modifier has on the ability of the gene to be inhibited or induced. Expression levels of a variant alleles are compared by various methods known in the art. Methods for determining promoter or enhancer strength include quantitation of the expressed natural protein; insertion of the variant control element into a vector with a reporter gene such as b-galactosidase, luciferase, chloramphenicol acetyltransferase, etc. that provides for convenient quantitation; and the like.

[0037] Gel shift or electrophoretic mobility shift assay provides a simple and rapid method for detecting DNA-binding proteins (Ausubel, F.M. et al. (1989) In: Current Protocols in Molecular Biology, Vol. 2, John Wiley and Sons, New York). This method has been used widely in the study of sequence-specific DNA-binding proteins, such as transcription factors. The assay is based on the observation that complexes of protein and DNA migrate through a nondenaturing polyacrylamide gel more slowly than free DNA fragments or double-stranded oligonucleotides. The gel shift assay is performed by incubating a purified protein, or a complex mixture of proteins (such as nuclear or cell extract preparations), with an end-labeled DNA fragment containing the putative protein binding site. The reaction products are then analyzed on a nondenaturing polyacrylamide gel. The specificity of the DNA-binding protein for the putative binding site is established by competition experiments using DNA fragments or oligonucleotides containing a binding site for the protein of interest, or other unrelated DNA sequences.

[0038] Expression assays can be used to detect differences in expression of polymorphisms with respect to tissue specificity, expression level, or expression in response to exposure to various substrates, and/or timing of expression during development. For example, since STP2 is expressed in liver, polymorphisms could be evaluated for expression in tissues other than liver, or expression in liver tissue relative to a reference STP2 polypeptide.

[0039] Substrate screening assay. Substrate screening assays are used to determine the metabolic activity of a STP2 protein or peptide fragment on a substrate. Many suitable assays are known in the art, including the use of primary or cultured cells, genetically modified cells (e.g., where DNA encoding the STP2 polymorphism to be studied is introduced into the cell within an artificial construct), cell-free systems, e.g. microsomal preparations or recombinantly produced enzymes in a suitable buffer, or in animals, including human clinical trials. Where genetically modified cells are used, since most cell lines do not express STP2 activity (liver cells lines being the exception), introduction of artificial construct for expression of the STP2 polymorphism into many human and non-human cell lines does not require additional modification of the host to inactivate endogenous STP2 expression/activity. Clinical trials may monitor serum, urine, etc. levels of the substrate or its metabolite(s).

[0040] Typically a candidate substrate is input into the assay system, and the oxidation to a metabolite is measured over time. The choice of detection system is determined by the substrate and the specific assay parameters. Assays are conventionally run, and will include negative and positive controls, varying concentrations of substrate and enzyme, etc. Exemplary assays may be found in the literature, for examples see Chou et al. (1995) Carcinogenesis 16:413-417; Walle and Walle (1991) Drug Metab. Dispos. 19:448-453; and Falany et al. (1990) Arch. Biochem. Biophys. 278:312-318.

[0041] Genotyping: STP2 genotyping is performed by DNA or RNA sequence and/or hybridization analysis of any convenient sample from a patient, e.g. biopsy material, blood sample (serum, plasma, etc.), buccal cell sample, etc. A nucleic acid sample from an individual is analyzed for the presence of polymorphisms in STP2, particularly those that affect the activity or expression of STP2. Specific sequences of interest include any polymorphism that leads to changes in basal expression in one or more tissues, to changes in the modulation of STP2 expression by modifiers, or alterations in STP2 substrate specificity and/or activity.

[0042] Linkage Analysis: Diagnostic screening may be performed for polymorphisms that are genetically linked to a phenotypic variant in STP2 activity or expression, particularly through the use of microsatellite markers or single nucleotide polymorphisms (SNP). The microsatellite or SNP polymorphism itself may not phenotypically expressed, but is linked to sequences that result in altered activity or expression. Two polymorphic variants may be in linkage disequilibrium, i.e. where alleles show non-random associations between genes even though individual loci are in Hardy-Weinberg equilibrium.

[0043] Linkage analysis may be performed alone, or in combination with direct detection of phenotypically evident polymorphisms. The use of microsatellite markers for genotyping is well documented. For examples, see Mansfield et al. (1994) Genomics 24:225-233; and Ziegle et al. (1992) Genomics 14:1026-1031. The use of SNPs for genotyping is illustrated in Underhill et al. (1996) Proc Natl Acad Sci U S A 93:196-200.

[0044] Transgenic animals. The subject nucleic acids can be used to generate genetically modified non-human animals or site specific gene modifications in cell lines. The term “transgenic” is intended to encompass genetically modified animals having a deletion or other knock-out of STP2 gene activity, having an exogenous STP2 gene that is stably transmitted in the host cells, or having an exogenous STP2 promoter operably linked to a reporter gene. Transgenic animals may be made through homologous recombination, where the STP2 locus is altered. Alternatively, a nucleic acid construct is randomly integrated into the genome. Vectors for stable integration include plasmids, retroviruses and other animal viruses, YACs, and the like. Of interest are transgenic mammals, e.g. cows, pigs, goats, horses, etc., and particularly rodents, e.g. rats, mice, etc.

[0045] Genetically Modified Cells. Primary or cloned cells and cell lines are modified by the introduction of vectors comprising STP2 gene polymorphisms. The gene may comprise one or more variant sequences, preferably a haplotype of commonly occurring combinations. In one embodiment of the invention, a panel of two or more genetically modified cell lines, each cell line comprising a STP2 polymorphism, are provided for substrate and/or expression assays. The panel may further comprise cells genetically modified with other genetic sequences, including polymorphisms, particularly other sequences of interest for pharmacogenetic screening, e.g. STP 1; UGT 1, UGT2, cytochrome oxidases, etc.

[0046] Vectors useful for introduction of the gene include plasmids and viral vectors, e.g. retroviral-based vectors, adenovirus vectors, etc. that are maintained transiently or stably in mammalian cells. A wide variety of vectors can be employed for transfection and/or integration of the gene into the genome of the cells. Alternatively, micro-injection may be employed, fusion, or the like for introduction of genes into a suitable host cell.

Genotyping Methods

[0047] The effect of a polymorphism in the STP2 gene sequence on the response to a particular substrate or modifier of STP2 is determined by in vitro or in vivo assays. Such assays may include monitoring the metabolism of a substrate during clinical trials to determine the STP2 enzymatic activity, specificity or expression level. Generally, in vitro assays are useful in determining the direct effect of a particular polymorphism, while clinical studies will also detect an enzyme phenotype that is genetically linked to a polymorphism.

[0048] The response of an individual to the substrate or modifier can then be predicted by determining the STP2 genotype, with respect to the polymorphism. Where there is a differential distribution of a polymorphism by racial background, guidelines for drug administration can be generally tailored to a particular ethnic group.

[0049] The basal expression level in different tissue may be determined by analysis of tissue samples from individuals typed for the presence or absence of a specific polymorphism. Any convenient method may be use, e.g. ELISA, RIA, etc. for protein quantitation, northern blot or other hybridization analysis, quantitative RT-PCR, etc. for mRNA quantitation. The tissue specific expression is correlated with the genotype.

[0050] The alteration of STP2 expression in response to a modifier is determined by administering or combining the candidate modifier with an expression system, e.g. animal, cell, in vitro transcription assay, etc. The effect of the modifier on STP2 transcription and/or steady state mRNA levels is determined. As with the basal expression levels, tissue specific interactions are of interest. Correlations are made between the ability of an expression modifier to affect STP2 activity, and the presence of the provided polymorphisms. A panel of different modifiers, cell types, etc. may be screened in order to determine the effect under a number of different conditions.

[0051] A STP2 polymorphism that results in altered enzyme activity or specificity is determined by a variety of assays known in the art. The enzyme may be tested for metabolism of a substrate in vitro, for example in defined buffer, or in cell or subcellular lysates, where the ability of a substrate to be metabolized by STP2 under physiologic conditions is determined. Where there are not significant issues oftoxicity from the substrate or metabolite(s), in vivo human trials may be utilized, as previously described.

[0052] The genotype of an individual is determined with respect to the provided STP2 gene polymorphisms. The genotype is useful for determining the presence of a phenotypically evident polymorphism, and for determining the linkage of a polymorphism to phenotypic change.

[0053] A number of methods are available for analyzing nucleic acids for the presence of a specific sequence. Where large amounts of DNA are available, genomic DNA is used directly.

[0054] Alternatively, the region of interest is cloned into a suitable vector and grown in sufficient quantity for analysis. The nucleic acid may be amplified by conventional techniques, such as the polymerase chain reaction (PCR), to provide sufficient amounts for analysis. The use of the polymerase chain reaction is described in Saiki et al. (1985) Science 230:1350-1354, and a review of current techniques may be found in Sambrook et al. Molecular Cloning: A Laboratory Manual, CSH Press 1989, pp. 14.2-14.33. Amplification may be used to determine whether a polymorphism is present, by using a primer that is specific for the polymorphism. Alternatively, various methods are known in the art that utilize oligonucleotide ligation as a means of detecting polymorphisms, for examples see Riley et al. (1990) Nucleic Acids Res 18:2887-2890; and Delahunty et al. (1996) Am J Hum Genet 58:1239-1246.

[0055] A detectable label may be included in an amplification reaction. Suitable labels include fluorochromes, e.g. fluorescein isothiocyanate (FITC), rhodamine, Texas Red, phycoerythrin, allophycocyanin, 6-carboxyfluorescein (6-FAM), 2′,7′-dimethoxy-4′,5′-dichloro-6-carboxyfluorescein (JOE), 6-carboxy-X-rhodamine (ROX), 6-carboxy-2′,4′,7′,4,7-hexachlorofluorescein (HEX), 5-carboxyfluorescein (5-FAM) or N,N,N′,N′-tetramethyl-6-carboxyrhodamine (TAMRA), radioactive labels, e.g. 32P, 35S, 3H; etc. The label may be a two stage system, where the amplified DNA is conjugated to biotin, haptens, etc. having a high affinity binding partner, e.g. avidin, specific antibodies, etc., where the binding partner is conjugated to a detectable label. The label may be conjugated to one or both of the primers. Alternatively, the pool of nucleotides used in the amplification is labeled, so as to incorporate the label into the amplification product.

[0056] The sample nucleic acid, e.g. amplified or cloned fragment, is analyzed by one of a number of methods known in the art. The nucleic acid may be sequenced by dideoxy or other methods. Hybridization with the variant sequence may also be used to determine its presence, by Southern blots, dot blots, etc. The hybridization pattern of a control and variant sequence to an array of oligonucleotide probes immobilized on a solid support, as described in U.S. Pat. No. 5,445,934, or in W095/35505, may also be used as a means of detecting the presence of variant sequences. Single strand conformational polymorphism (SSCP) analysis, denaturing gradient gel electrophoresis (DGGE), mismatch cleavage detection, and heteroduplex analysis in gel matrices are used to detect conformational changes created by DNA sequence variation as alterations in electrophoretic mobility. Alternatively, where a polymorphism creates or destroys a recognition site for a restriction endonuclease (restriction fragment length polymorphism, RFLP), the sample is digested with that endonuclease, and the products size fractionated to determine whether the fragment was digested. Fractionation is performed by gel or capillary electrophoresis, particularly acrylamide or agarose gels.

[0057] In one embodiment of the invention, an array of oligonucleotides are provided, where discrete positions on the array are complementary to one or more of the provided polymorphic sequences, e.g. oligonucleotides of at least 12 nt, frequently 20 nt, or larger, and including the sequence flanking the polymorphic position. Such an array may comprise a series of oligonucleotides, each of which can specifically hybridize to a different polymorphism. For examples of arrays, see Hacia et al. (1996) Nat Genet 14:441-447 and DeRisi et al. (1996) Nat Genet 14:457-460.

[0058] The genotype information is used to predict the response of the individual to a particular STP2 substrate or modifier. Where an expression modifier inhibits STP2 expression, then drugs that are a STP2 substrate will be metabolized more slowly if the modifier is co-administered. Where an expression modifier induces STP2 expression, a co-administered substrate will typically be metabolized more rapidly. Similarly, changes in STP2 activity will affect the metabolism of an administered drug. The pharmacokinetic effect of the interaction will depend on the metabolite that is produced, e.g. a prodrug is metabolized to an active form, a drug is metabolized to an inactive form, an environmental compound is metabolized to a toxin, etc. Consideration is given to the route of administration, drug-drug interactions, drug dosage, etc.

EXPERIMENTAL

[0059] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the subject invention, and are not intended to limit the scope of what is regarded as the invention. Efforts have been made to ensure accuracy with respect to the numbers used (e.g. amounts, temperature, concentrations, etc.) but some experimental errors and deviations should be allowed for. Unless otherwise indicated, parts are parts by weight, molecular weight is average molecular weight, temperature is in degrees centigrade; and pressure is at or near atmospheric.

[0060] Materials and Methods

[0061] DNA samples. Blood specimens from approximately 300 individuals were collected after obtaining informed consent. All samples were stripped of personal identifiers to maintain confidentiality. The only data associated with a given blood sample was gender and self-reported major racial group designations in the United States (Caucasian, Hispanic, African American). Genomic DNA was isolated from these samples using standard techniques. gDNA was either stored as concentrated solutions or stored dried in microtiter plates for future use.

[0062] PCR amplifications. The primers used to amplify the coding regions and the promoter region of the STP2 gene from 200 ng of human gDNA are shown in Table 1. Primers were designed based upon publicly available genomic sequence provided by Heretal. (1996) Genomics 33:409-420. 100 ng of gDNA from 2 individuals was amplified with the Perkin Elmer GeneAmp PCR kit according to manufacturer's instructions in 100 &mgr;l reactions with Taq Gold DNA polymerase, with two exceptions. Boehringer-Mannheim Expand High Fidelity PCR System kit was used to amplify the promoter region and exon 1A. Magnesium concentrations for each PCR reaction was optimized empirically, and are shown in Table 1. 1 TABLE 1 PCR primers and Mg++ concentrations. Forward/ SEQ Region Reverse ID Forward Primer (5′ 3′) [Mg++] Promoter F 4. CCCAAATACAGGTGTTCC 2mM R 5. GGAGCAGAGCAAGGATC Exon 1A F 6. TTCTTCTAGGATCTTCTATCG 2mM R 7. ACTCAGCAAAAGGAGGAT   Exon 1B F 8. TTAGAGATGGGGTCTTCC 2mM R 9. GGGCGAGAGATGTCC Exon2 F 10. GGAGAGGAGCCTACTGG 2mM R 11. AGTCTGAGGTGAGCAT Exons 3&4 F 12. GCCTCAGTGACTTCCCT 3mM R 13. TTTGGAAGAGACTTATCTGG Exons 5&6 F 14. GCAGGACTTTGGCTTT 2mM R 15. GACTCAGGCACAGGAG Exons 7&8 F 16. GACCATCCCAGTCCTT 2mM R 17. CCCCAACGACACAGG

[0063] Thermal cycling was performed in a GeneAmp PCR System 9600 PCR machine (Perkin Elmer) with an initial denaturation step at 95° C. for 10 min, followed by 35 cycles of denaturation at 95° C. for 30 sec, primer annealing at 60° C. for 45 sec, and primer extension at 72° C. for 2 min, followed by final extension at 72° C. for 5 min, with the following exceptions. 40 cycles were used to amplify exon 1B and to co-amplify exons 7 and 8. Cycling conditions for the promoter region and exon 1A were an initial denaturation at 95° C. for 2 min, followed by 40 cycles of denaturation at 94° C. for 30 sec, primer annealing at 60° C. for 45 sec, and primer extension at 68° C. for 4 min, followed by a final extension at 68° C. for 7 min.

[0064] DNA sequencing. PCR products from 32 individuals, approximately ⅓ from each of the 3 major racial groups (see above), were spin column purified using Microcon -100 columns. Cycle sequencing was performed on the GeneAmp PCR System 9600 PCR machine (Perkin Elmer) using the ABI Prism dRhodamine Terminator Cycle Sequencing Ready Reaction Kit according to the manufacturer's directions. Oligonucleotide primers used for the sequencing reactions are listed in 2 TABLE 2 Sequencing primers. Forward/ Region Reverse SEQ ID Forward Primer (5′ 3′) Promoter (1) F 18. TGGAGCCCGTCTTGG R 19. CAGCAGTTTCACTTGACC Promoter (2) F 20. TGCCACCCCCTGCT R 21. AGGCTGCTCCCCTG Promoter (3) F 22. GGGCTCACGCAACC R 23. GCAGGTACTTTTCTTTCCA Exon1A(1) F 24. TTCTTCTAGGATCTTCTATCG R 25. TTTTTGAGGTGTCACTGG Exon 1A (2) F 26. CCCACACAAGACCCAC R 27. GCTTCTGGAATGTTGG Exon 1A (3) R 28. CGGAAAAAAAAAAAGGAAG Exon 1B (1) F 29. CAATGCTGCCCAGA R 30. GCTCCACTGAGGAACCT Exon 1B (2) F 31. GGAGAGGAGCCTACTGG R 32. TACCACCATCACAACAGC Exon 2 F 33. CTGAAAGCAAGAAATCCAC R 34. AGGCTGAGGTGAGCAT Exons 3&4 F 35. GCGGTGACCTGGAA R 36. TTTGGAAGAGACTTATCTGG Exons 5&6 (1) F 37. CTGACTTGCCCCTACCT R 38. TAGCCACCACCCCTTA Exons 5&6 (2) F 39. CCAAAGTGTACCCTGACC R 40. AGCCTGCTGCCACA Exons 7&8 (1) F 41. GACCATCCCAGTCCTT R 42. CAAACCCCCGTGCT Exons 7&8 (2) F 43. CTGTGGACCTCTTGGTTG R 44. CACAAATCATACTTTATTCTGG Exons 7&8 (3) F 45. CGATGCGGACTATGG R 46. CCCCAACGACACAGG

[0065] Eight &mgr;l sequencing reactions were subjected to 30 cycles at 96° C. for 20 sec, 50° C. for 20 sec, and 60° C. for 4 min, followed by ethanol precipitation. Samples were evaporated to dryness at 50° C. for ˜15 min and resuspended in 2 &mgr;l of loading buffer (5:1 deionized formamide:50 mM EDTA pH 8.0), heated to 65° C. for 5 min, and electrophoresed through 4% polyacrylamide/6M urea gels in an ABI 377 Nucleic Acid Analyzer according to the manufacturer's instructions for sequence determination. All sequences were determined from both the 5′ and 3′ (sense and antisense) direction. Each sequencing reaction was performed with 2 individuals' DNA pooled together. The 16 electropherograms were analyzed by comparing peak heights, looking for ˜25% reduction in peak size and/or presence of extra peaks as an indication of heterozygosity. If polymorphisms were identified, pools were subsequently split and resequenced for confirmation.

[0066] Population genotyping. High-throughput genotyping using TaqMan technology (ABI) was performed using standard techniques (Livak et al. (1995) PCR Methods and Applications 4:357-362) on the samples described above for 3 STP2 polymorphisms. Oligonucleotide PCR primers and probes used for genotyping are shown in Table 3. Polymorphisms for which allele frequencies were determined are marked with an asterisk (*) in Table 4. 3 TABLE 3 TaqMan primers and probes. SEQ ID Description Primers 47. STP2-136A primer GGTGCTGGGGTTGAGTCTTCTG 48. STP2-136A1a probe CAAAGGATGTGGCGGTTTCCTACTAC C 49. STP2-136B primer ACACCTTCCTTCCTCCCATCAAG 50. STP2-136Val probe CGCAAAGGATGTGGTGGTTTCCTACT AC 51. STP2-235A primer GGAGACTGTGGACCTCATGGTTGA 52. STP2-235Asn probe TAGTTGGTCATAGGGTTCTTCTTCAT CTCCTT 53. STP2-235B primer CCGGCACCTACCTTTCCTCAT 54. STP2-235Thr probe TAGTTGGTCATAGGGGTCTTCTTCAT CTCC 55. STP2-282A primer AGCTTTGCTCCCTGCCTTCCT 56. STP2-282Glu probe CTGCCATCTTCTCCGCATAGTCCG 57. STP2-282B primer GGAACCCCTCTCACAGCTCAGA 58. STP2-282Lys probe TGCCATCTTCTTCGCATAGTCCGC 59. STP2-447A primer GGTGCTGGGGTTGAGTCTTCTG 60. STP2-DelA447 probe ATGGCCAAAGTGTACCCTCACCCTG 61. STP2-447B primer ACACCTTCCTTCCTCCCATCAAG 62. STP2-InsA447 probe CATGGCCAAAGTGTAACCCTCACCC

[0067] Assay name is given by locus and position. Primer names are abbreviated locus-position and letter designations representing forward (A) and reverse (B) primers. Probes are abbreviated locus-position and 3 letter nucleic acid designations representing the nucleic acid alteration in the coding strand of the genomic DNA. Positions at which probes detect nucleic acid variations are shown in bold.

[0068] Results

[0069] Eight exons, the promoter region, 3′ and 5′ untranslated regions from the human STP2 gene were resequenced in 32 individuals representing three major ethnic groups (Caucasian, Hispanic, and African American). The polymorphisms are listed in Table 4. 4 TABLE 4 Newly identified STP2 gene polymorphisms. SEQ Location; ID Polymorphism Sequence AA change 3′end; 99 63. CCAGCTCCTCAACTTGCCCTG 64. CCAGCTCCTCTACTTGCCCTG 3′UTR; 7 65. GTGAGAGGGGTTCCTGGAGTC 66. GTGAGAGGGGCTCCTGGAGTC Promoter;−603 67. CATGAAGCTGGGGCTGGCTCC 68. CATGAAGCTGAGGCTGGCTCC Promoter;−833 69. CTCGTGCCCAGCTTGACCCTG 70. CTCGTGCCCAACTTGACCCTG Promoter;−1005 71. GGGATTCCTCAGGGGCACAGA 72. GGGATTCCTCCGGGGCACAGA Promoter;−1306 73. ACAGCGCCATGTTGCTTCTGG 74. ACAGCGCCATATTGCTTCTGG 5′UTR-A; 36 75. CAGCCACTGCGGGCGAGGAGG 76. CAGCCACTGCAGGCGAGGAGG 5′UTR-A;51 77. AGGAGGGCACAAGGCCAGGTT 78. AGGAGGGCACGAGGCCAGGTT 5′UTR-B; 183 79. GGGGAACATCGGGGAGAGGAG 80. GGGGAACATCAGGGAGAGGAG Exon 5*; 447 81. CCAAAGTGTACCCTCACCCT INS STOP 82. CCAAAGTGTAACCCTCACCCTINS STOP Exon 5*; 136 83. AAGGATGTGGCGGTTTCCTAC ALA-VAL (nt 307) 84. AAGGATGTGGTGGTTTCCTAC ALA-VAL Exon 7*; 235 85. ATGAAGAAGAACCCTATGACC ASN-THR (nt 705) 86. ATGAAGAAGACCCCTATGACC ASN-THR Exon 8*; 282 87. GGACTATGCGGAGAAGATGGC GLU-LYS (nt 845) 88. GGACTATGCGAAGAAGATGGC GLU-LYS Exon 2; 19 89. AAGGGGGTCCCGCTCATCAAG PRO-LEU (nt 56) 90. AAGGGGGTCCTGCTCATCAAG PRO-LEU Intron 1A; 88 91. CTCTGCTATCTCTGCCCTCTC 92. CTCTGCTATCCCTGCCCTCTC Intron 2; 34 93. CTCTCCCAGGTGGCAGTCCCC 94. CTCTCCCAGGCGGCAGTCCCC Intron 4; −71 95. CCTTTGCCAAACCAAGAGATG DEL A 96. CCTTTGCCAACCAAGAGATG DEL A Intron 5; −19 97. GTGTCGGCACTCCCTGCCCGC 98. GTGTCGGCACCCCCTGCCCGC Intron 6; 93 99. CCTCCCTGGGCGGCCCCTCCA 100. CCTCCCTGGGTGGCCCCTCCA Promoter; −547 101. TTGTTCTATGGATCCATGCTC 102. TTGTTCTATGCATCCATGCTC Promoter;−453 103. CATGGGCTGCTGGAGGCCTGT 104. CATGGGCTGCCGGAGGCCTGT Promoter;−425 105. ACTGGGCCAGGACCCCTGGCA 106. ACTGGGCCAGAACCCCTGGCA Promoter;−358 107. CCTGCCTATCCCAGCTTTCTC 108. CCTGCCTATCTCAGCTTTCTC Promoter;−355 109. GCCTATCCCATCTTTCTCCTC 110. GCCTATCCCAGCTTTCTCCTC

[0070] Genotyping of 95 individuals from each of 3 broadly defined racial groups (African Americans, Hispanic Americans, and Caucasian Americans) for three polymorphisms produced the allele and genotype frequencies shown in Table 5. 5 TABLE 5 Allele and Genotype Population Frequencies. Locus Calc name Start Position Population Allele Freq Genotype Freq STP2 STP2_Ala136Val_AfAm 0 African Americans, California STP2_Ala136 = 0.997 STP2_136Ala/Ala = 0.995 STP2_Val136 = 0.003 STP2_136Ala/Val = 0.005 STP2_136Val/Val = 0 STP2 STP2_Ala136Val_Cauc2 0 Caucasian, USA STP2_Ala136 = 1 STP2_136Ala/Ala = 1 STP2_Val136 = 0 STP2_136Ala/Val = 0 STP2_136Val/Val = 0 STP2 STP2_Ala136Val_Cauc 0 Caucasians, California STP2_Ala136 = 1 STP2_136Ala/Ala = 1 STP2_Val136 = 0 STP2_136Ala/Val = 0 STP2_136Val/Val = 0 STP2 STP2_Ala136Val_Chin 0 Chinese, California STP2_Ala136 = 1 STP2_136Ala/Ala = 1 STP2_Val136 = 0 STP2_136Ala/Val = 0 STP2_136Val/Val = 0 STP2 STP2_Ala136Val_Hisp 0 Hispanics, California STP2_Ala136 = 1 STP2_136Ala/Ala = 1 STP2_Val136 = 0 STP2_136Ala/Val = 0 STP2_136Val/Val = 0 STP2 STP2_Ala136Val_Japn 0 Japanese, California STP2_Ala136 = 1 STP2_136Ala/Ala = 1 STP2_Val136 = 0 STP2_136Ala/Val = 0 STP2_136Val/Val = 0 STP2 STP2_insA447_AfAm 0 African Americans, California STP2_delA447 = 0.981 STP2_447delA/delA = 0.963 STP2_insA447 = 0.019 STP2_447delA/insA = 0.037 STP2_447insA/insA = 0 STP2 STP2_insA447_Cauc2 0 Caucasian, USA STP2_delA447 = 1 STP2_447delA/delA = 1 STP2_insA447 = 0 STP2_447delA/insA = 0 STP2_447insA/insA = 0 STP2 STP2_insA447_Cauc 0 Caucasians, California STP2_delA447 = 1 STP2_447delA/delA = 1 STP2_insA447 = 0 STP2_447delA/insA = 0 STP2_447insA/insA = 0 STP2 STP2_insA447_Chin 0 Chinese, California STP2_delA447 = 1 STP2_447delA/delA = 1 STP2_insA447 = 0 STP2_447delA/insA = 0 STP2_447insA/insA = 0 STP2 STP2_insA447_Hisp 0 Hispanics, California STP2_delA447 = 0.995 STP2_447delA/delA = 0.989 STP2_insA447 + 0.005 STP2_447delA/insA = 0.011 STP2_447insA/insA = 0 STP2 STP2_insA447_Japn 0 Japanese, California STP2_delA447 = 1 STP2_447delA/delA = 1 STP2_insA447 = 0 STP2_447delA/insA = 0 STP2_447insA/insA = 0 STP2 STP2_Asn235Thr_AfAm 0 African Arnericans, California STP2_Asn235 = 0.749 STP2_235Asn/Asn = 0.562 STP2_Thr235 = 0.251 STP2_235Asn/Thr = 0.373 STP2_235Thr/Thr = 0.065 STP2 STP2_Asn235Thr_Cauc2 0 Caucasian, USA STP2_Asn235 = 0.753 STP2_235Asn/Asn = 0.565 STP2_Thr235 = 0.247 STP2_235Asn/Thr = 0.376 STP2_235Thr/Thr = 0.059 STP2 STP2_Asn235Thr_Cauc 0 Caucasians, California STP2_Asn235 = 0.649 STP2_235Asn/Asn = 0.42 STP2_Thr235 = 0.351 STP2_235Asn/Thr = 0.458 STP2_235Thr/Thr = 0.122 STP2 STP2_Asn235Thr_Chin 0 Chinese, California STP2_Asn235 = 0.934 STP2_235Asn/Asn = 0.882 STP2_Thr235 = 0.066 STP2_235Asn/Thr = 0.105 STP2_235Thr/Thr = 0.013 STP2 STP2_Asn235Thr_Hisp 0 Hispanic, California STP2_Asn235 = 0.623 STP2_235Asn/Asn = 0.385 STP2_Thr235 = 0.377 STP2_235Asn/Thr = 0.476 STP2_235Thr/Thr = 0.139 STP2 STP2_Asn235Thr_Japn 0 Japanese, California STP2_Asn235 = 0.855 STP2_235Asn/Asn = 0.75 STP2_Thr235 = 0.145 STP2_235Asn/Thr = 0.211 STP2_235Thr/Thr = 0.039 STP2 STP2_Glu282Lys_AfAm 0 African Americans, California STP2_Glu282 = 0.949 STP2_828Glu/Glu = 0.899 STP2_Lys282 = 0.051 STP2_282Glu/Lys = 0.101 STP2_282Lys/Lys = 0 STP2 STP2_Glu282Lys_Cauc2 0 Caucasian, USA STP2_Glu282 = 1 STP2_282Glu/Glu = 1 STP2_Lys282 = 0 STP2_282Glu/Lys = 0 STP2_282Lys/Lys = 0 STP2 STP2_Glu282Lys_Cauc 0 Caucasians, California STP2_Glu282 = 0.997 STP2_282Glu/Glu = 0.995 STP2_Lys282 = 0.003 STP2_282Glu/Lys = 0.005 STP2_282Lys/Lys = 0 STP2 STP2_Glu282Lys_Chin 0 Chinese, California STP2_Glu282 = 1 STP2_282Glu/Glu = 1 STP2_Lys282 = 0 STP2_282Glu/Lys = 0 STP2_282Lys/Lys = 0 STP2 STP2_Glu282Lys_Hisp 0 Hispanic, California STP2_Glu282 = 0.992 STP2_282Glu/Glu = 0.984 STP2_Lys282 = 0.008 STP2_282Glu/Lys = 0.016 STP2_282Lys/Lys = 0 STP2 STP2_Glu282Lys_Japn 0 Japanese, California STP2_Glu282 = 1 STP2_282Glu/Glu = 1 STP2_Lys282 = 0 STP2_282Glu/Lys = 0 STP2_282Lys/Lys = 0 Polymorphism name includes gene abbreviation followed by nucleotide designation for allele 1, then nucleotide number, then nucleotide designation for allele 2. Population abbreviations are as follows: AfAm = African Americans; BAH = Caucasians from the United States; Cauc = Caucasians from California; Hisp = Hispanic from California. Allele name are designated by nucleotide and position. Genotypes are designated by position and 2 nucleotides representing each of the chromosomes in a given individual.

[0071] Each of the polymorphisms identified in this study are unique and newly described. Several of the nucleotide base changes result in amino acid changes that may alter enzyme activity by any of a number of possible mechanisms. The changes in the 5′ and 3′ UTRs may alter regulation of transcription or transcript stability. Promoter region alterations may result in altered regulation or efficiency of transcription.

[0072] All of these polymorphisms have utility. As the human genome project progresses, polymorphisms within every human gene must be identified in order to perform whole genome association studies that will be necessary for identifying genetic etiologies of complex diseases. These polymorphisms are useful for association studies.

[0073] All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention.

[0074] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

Claims

1. An isolated nucleic acid molecule comprising a STP2 sequence polymorphism, as part of other than a naturally occurring chromosome.

2. A nucleic acid probe for detection of STP2 locus polymorphisms, comprising a polymorphic sequence listed in Table 4.

3. A nucleic acid probe according to claim 2, wherein said probe is conjugated to a detectable marker.

4. An array of oligonucleotides comprising:

two or more probes for detection of STP2 locus polymorphisms, said probes comprising at least one form of a polymorphic sequence listed in Table 4.

5. A method for detecting in an individual a polymorphism in STP2 metabolism of a substrate, the method comprising:

analyzing the genome of said individual for the presence of at least one STP2 polymorphism listed in Table 4; wherein the presence of said predisposing polymorphism is indicative of an alteration in STP2 expression or activity.

6. A method according to claim 5, wherein said analyzing step comprises detection of specific binding between the genomic DNA of said individual with an array of oligonucleotides comprising:

two or more probes for detection of STP2 locus polymorphisms, said probes comprising at least one form of a polymorphic sequence listed in Table 4.

7. A method according to claim 5, wherein said alteration in STP2 expression is tissue specific.

8. A method according to claim 5, wherein said alteration in STP2 expression is in response to a STP2 modifier.

9. A method according to claim 8, wherein said modifier induces STP2 expression.

10. A method according to claim 8, wherein said modifier inhibits STP2 expression.