Anti-bacterial methods and materials

Abstract

Staphylococcus aureus virulence genes are identified, thereby allowing the identification of novel anti-bacterial agents that target these virulence genes and their products, and the provision of novel S. aureus mutants useful in vaccines.

Description

[0001] The invention relates generally to the identification of genes responsible for the virulence of Staphylococcus bacteria, thereby allowing the identification of new anti-bacterial agents that target these virulence genes and their products and the provision of novel S. aureus mutants useful in vaccines.

BACKGROUND OF THE INVENTION

[0002] The staphylococci, of which Staphylococcus aureus is the most important human pathogen, are hardy, gram-positive bacteria that colonize the skin of most humans. Staphylococcal strains that produce coagulase are designated S. aureus; other clinically important coagulase-negative staphylococci are S. epidermidis and S. saprophyticus. When the skin or mucous membrane barriers are disrupted, staphylococci can cause localized and superficial infections that are commonly harmless and self-limiting. However, when staphylococci invade the lymphatics and the blood, potentially serious complications may result, such as bacteremia, septic shock, and serious metastatic infections, including endocarditis, arthritis, osteomyelitis, pneumonia and abscesses in virtually any organ. Certain strains of S. aureus produce toxins that cause skin rashes, food poisoning, or multisystem dysfunction (as in toxic shock syndrome). S. aureus and S. epidermidis together have become the most common cause of nosocomial non-urinary tract infection in U.S. hospitals. They are the most frequently isolated pathogens in both primary and secondary bacteremias and in cutaneous and surgical wound infections. See generally Harrison's Principles of Internal Medicine, 13th ed., Isselbacher et al., eds., McGraw-Hill, New York (1994), particularly pages 611-617.

[0003] Transient colonization of the nose by S. aureus is seen in 70 to 90 percent of people, of which 20 to 30 percent carry the bacteria for relatively prolonged periods of time. Independent colonization of the perineal area occurs in 5 to 20 percent of people. Higher carriage rates of S. aureus have been documented in persons with atopic dermatitis, hospital employees, hospitalized patients, patients whose care requires frequent puncture of the skin, and intravenous drug abusers.

[0004] Infection by staphylococci usually results from a combination of bacterial virulence factors and a diminution in host defenses. Important microbial factors include the ability of the staphylococcus to survive under harsh conditions, its cell wall constituents, the production of enzymes and toxins that promote tissue invasion, its capacity to persist intracellularly in certain phagocytes, and its potential to acquire resistance to antimicrobials. Important host factors include an intact mucocutaneous barrier, an adequate number of functional neutrophils, and removal of foreign bodies or dead tissue.

[0005] Cell wall components of S. aureus include a large peptidoglycan complex that confers rigidity on the organism and enables it to survive under unfavorable osmotic conditions, a unique teichoic acid linked to peptidoglycan, and protein A, which is found both attached to peptidoglycan over the outermost parts of the cell and released in soluble form. Proteins designated femA and femB are involved in the formation of cell wall peptidoglycan pentaglycine cross-bridges and are factors in methicillin resistance. [Berger-Bachi et al., Mol. Gen. Genet., 219:263-269 (1989).] S. aureus also has specific receptors for laminin and fibronectin that may mediate the organism's spread through the bloodstream to other tissues. Both peptidoglycan and teichoic acid are capable of activating the complement cascade via the alternative pathway. S. aureus also appears to activate tissue factor in the coagulation pathway.

[0006] Certain enzymes produced by S. aureus may play a role in virulence. Catalase degrades hydrogen peroxide and may protect the organism during phagocytosis. Coagulase is present in both soluble and cell-bound forms and causes plasma to clot by formation of thrombin-like material. The high correlation between coagulase production and virulence suggests that this substance is important in the pathogenesis of staphylococcal infections, but its precise role as a determinant of pathogenicity has not been determined. Many strains also produce hyaluronidase, an enzyme that degrades hyaluronic acid in the connective tissue matrix and that may promote spreading of infection. A trypsin-like protease from some strains enhances influenza virus infection by proteolytic cleavage of the viral precursor hemagglutinin into its active fragments and may contribute to the morbidity of such coinfections.

[0007] S. aureus produces numerous extracellular exotoxins that have been implicated in disease processes. The exfoliatin toxins A and B, the staphylococcal enterotoxins, and the toxic shock syndrome toxin, TSST-1, belong to the growing family of microbial superantigens that activate T cells and monocytes/macrophages, resulting in the production of cytokines that mediate local or systemic effects depending on the amount of toxin formed, the immune status of the host, and the access of the toxin to the circulation. The exfoliatin toxins mediate the dermatologic manifestations of the staphylococcal scalded-skin syndrome and bullous impetigo. These toxins cause intraepidermal cleavage of the skin at the stratum granulosum, leading to bullae formation and denudation. Seven distinct enterotoxins (A, B, C1, C2, C3, D, and E) have been implicated in food poisoning due to S. aureus. These toxins enhance intestinal peristalsis and appear to induce vomiting by a direct effect on the central nervous system. Toxic shock syndrome (TSS) is most commonly mediated by TSST-1, which is present in 5 to 25 percent of clinical isolates of S. aureus. TSS is also mediated less frequently by enterotoxin B and, rarely, enterotoxin C1.

[0008] S. aureus produces other toxins whose role in virulence is incompletely understood. Four different red blood cell hemolysins, which are designated alpha, beta, gamma, and delta toxins, have been identified. Alpha toxin also causes necrosis of the skin when injected subcutaneously into animals, while delta toxin also inhibits water absorption in the intestines and may play a role in the acute watery diarrhea seen in some cases of staphylococcal infection. Leukocidin lyses granulocyte and macrophage membranes by producing membrane pores permeable to cations.

[0009] The agr, xpr, sae and sar genes have been identified as being involved in the regulation of staphylococcal exotoxins. See U.S. Pat. No. 5,587,228 and International Patent Publication Nos. WO 96/10579 and WO 97/11690. Of interest is the report in WO 97/11690 of screening for inhibitors of these regulatory systems.

[0010] Staphylococci can invade the skin or mucosa through plugged hair follicles and sebaceous glands or areas traumatized by bums, wounds, abrasions, insect bites, or dermatitis. Staphylococci often colonize prosthetic devices and intravenous catheters; S. aureus infection of the vascular access site is a major cause of morbidity and death among patients on hemodialysis. Colonization and invasion of the lungs may occur with endotracheal intubation, or when the lungs' clearance mechanisms are depressed, e.g., after viral infections, after aspiration, or in patients with cystic fibrosis. Mucosal damage to the gastrointestinal tract following cytotoxic chemotherapy or radiotherapy predisposes to invasion from that site.

[0011] Once the skin or mucosa have been breached, local bacterial multiplication is accompanied by inflammation, neutrophil accumulation, tissue necrosis, thrombosis and fibrin deposition at the site of infection. Later, fibroblasts create a relatively avascular wall about the area. When host mechanisms fail to contain the cutaneous or submucosal infection, staphylococci may enter the lymphatics and the bloodstream. Common sites of metastatic spread include the lungs, kidneys, cardiac valves, myocardium, liver, spleen, bones and brain.

[0012] Bacteremia due to S. aureus may arise from any local infection, at either extravascular (cutaneous infections, burns, cellulitis, osteomyelitis, arthritis) or intravascular foci (intravenous catheters, dialysis access sites, intravenous drug abuse). Rarely, patients with bacteremia die within 12 to 24 hours with high fever, tachycardia, cyanosis, and vascular collapse. Disseminated intravascular coagulation may produce a disease mimicking meningococcemia. Commonly, the disease progresses more slowly, with hectic fever and metastatic abscess formation.

[0013] A major complication of S. aureus bacteremia is endocarditis. S. aureus is the second most common cause of endocarditis and the most common cause among drug addicts. The disease is typically acute, with high fever, progressive anemia, and frequent embolic and extracardiac septic complications. Valve ring and myocardial abscesses are common. The mortality rate is 20 to 30 percent.

[0014] Staphylococcal scalded-skin syndrome (SSSS) is a generalized exfoliative dermatitis that is a complication of infection by exfoliatin toxin-producing strains of S. aureus. The disease typically occurs in newborns (Ritter's disease) and in children under the age of five. A scarlatiniform rash begins in the perioral area, becomes generalized over the trunk and extremities, and finally desquamates. The disease may consist of rash alone (staphylococcal scarlet fever), or large, flaccid bullae develop that may be localized (more common in adults) or generalized. The bullae burst, resulting in red, denuded skin resembling a burn. Most adults with SSSS are immunosuppressed or have renal insufficiency. Blood cultures are frequently positive, and mortality is significant.

[0015] Toxic shock syndrome (TSS) is a multisystem disease mediated by toxins (generally TSST-1, and less frequently enterotoxins B and Cl) produced by certain strains of S. aureus. It was first described in children, but in 1980 became epidemic among young women, with onset during menstruation. The diagnosis of TSS is based on clinical criteria that include high fever, a diffuse rash that desquamates on the palms and soles over the subsequent one or two weeks, hypotension that may be orthostatic, and evidence of involvement in three or more organ systems. Such involvement commonly includes gastrointestinal dysfunction (vomiting or diarrhea), renal or hepatic insufficiency, mucous membrane hyperemia, thrombocytopenia, myalgias with elevated creatine phosphokinase (CK) levels, and disorientation with a normal cerebrospinal fluid examination. The mortality rate of TSS is three percent.

[0016] S. aureus causes approximately three percent of community-acquired bacterial pneumonias. This disease occurs sporadically except during influenza outbreaks, when staphylococcal pneumonia is relatively more common, although still less frequent than pneumococcal pneumonia. Primary staphylococcal pneumonia in infants and children frequently presents with high fever and cough. Multiple thin-walled abscesses are seen on the chest X-ray, and empyema formation is common. In older children and healthy adults, staphylococal pneumonia is generally preceded by an influenza-like respiratory infection. Onset of staphylococcal involvement is abrupt, with chills, high fever, progressive dyspnea, cyanosis, cough, pleural pain, and sometimes bloody sputum. Staphylococcal pneumonia is seen more frequently in patients with cystic fibrosis, in intubated patients in intensive care units and in debilitated patients who are prone to aspiration.

[0017] S. aureus is responsible for the majority of cases of acute osteomyelitis. Although the disease is most common in people under the age of 20, it is becoming increasingly prevalent in adults over 50, particularly with involvement of the spine. A primary portal of entry is frequently not identified, although many patients give a history of preceding trauma to the involved area. Once established, infection spreads through the bone to the periosteum or along the marrow cavity. Rarely, the joint capsule is penetrated, producing pyogenic arthritis. Osteomyelitis in children may present as an acute process beginning abruptly with chills, high fever, nausea, vomiting, and progressive pain at the site of bony involvement.

[0018] S. aureus causes 1 to 9 percent of cases of bacterial meningitis and 10 to 15 percent of brain abscesses. Most commonly, the bacteria are spread from a focus outside the central nervous system, typically from infective endocarditis, by extension from a paraspinal or parameningeal abscess, or by nosocomial infection following neurosurgical procedures. Over 50 percent of epidural abscesses are due to S. aureus; up to half of these cases may be associated with vertebral osteomyelitis. Patients present with either acute or chronic back pain, usually with low-grade fever and malaise. The onset of radicular pain is an ominous sign that the disease may progress to neurologic dysfunction and ultimate paralysis.

[0019] Antimicrobial resistance by staphylococci favors their persistence in the hospital environment. Over 90 percent of both hospital and community strains of S. aureus causing infection are resistant to penicillin. This resistance is due to the production of &bgr;-lactamases enzymes; the genes for these enzymes are usually carried by plasmids. Infections due to organisms with such acquired resistance can sometimes be treated with penicillinase-resistant &bgr;-lactam antimicrobial agents. However, the true penicillinase-resistant S. aureus organisms, called methicillin-resistant S. aureus (MRSA), are resistant to all the &bgr;-lactam antimicrobials as well as the cephalosporins. MRSA resistance is chromosomally mediated and involves production of an altered penicillin-binding protein (PBP 2a or PBP 2′) with a low binding affinity for &bgr;-lactams. MRSA frequently also have acquired plasmids mediating resistance to erythromycin, tetracycline, chloramphenicol, clindamycin, and aminoglycosides. MRSA have become increasingly common worldwide, particularly in tertiary-care referral hospitals. In the United States, approximately 5 percent of hospital isolates of S. aureus are methicillin-resistant.

[0020] Thus, there continues to exist a need for new agents useful for treating bacterial infections, particularly those caused by antibiotic-resistant bacteria, and for methods of identifying such new agents. Such methods ideally would identify agents that are unrelated to existing antimicrobials and that target different aspects of staphylococcal invasion of and replication in the host, compared to existing antimicrobials.

SUMMARY OF THE INVENTION

[0021] The present invention relates generally to the identification of genes responsible for the virulence of Staphylococcus bacteria, thereby allowing the identification of new anti-bacterial agents that target these virulence genes and their products and the provision of novel S. aureus mutants useful in vaccines.

[0022] According to one aspect of the present invention, methods are provided for identifying anti-bacterial agents that target the function of staphylococcal virulence genes or gene products. Such methods include assaying potential agents for the ability to interfere with expression of virulence gene products represented by the DNA sequences set forth in any one of SEQ ID NOS: 1 through 94, or assaying potential agents for the ability to interfere with the function of a bacterial protein encoded in whole or in part by a DNA sequence set forth in any one of SEQ ID NOS: 1 through 94 or the complementary strand thereof, followed by identifying agents that are positive in such assays.

[0023] The use of a number of different assays is contemplated according to this aspect of the invention. When the function of the virulence gene product is known or predicted by sequence similarity to a known gene product, potential inhibitors can be screened in enzymatic or other types of assays keyed to the function of the gene product. When the virulence gene product is known or predicted by sequence similarity to a known gene product to interact with another protein or nucleic acid, inhibitors of this interaction can be screened directly in binding assays or using the two-hybrid assay. Other assays may be used when a ligand for the virulence gene product is not known, including two-hybrid screening assays that identify gene products that interact with target protein, assays that identify ligands of target protein through measuring of direct binding of test ligand to target protein, and assays that identify ligands of target proteins through affinity ultrafiltration with ion spray mass spectroscopy/HPLC methods or other physical and analytical methods.

[0024] In another aspect of this invention, methods are provided for assaying potential agents for the ability to interfere with expression of or function of virulence gene products, wherein the virulence genes encoding these products are obtainable by identification through signature-tagged mutagenesis as defined herein and exemplified in Example 1.

[0025] According to a further aspect of this invention, novel anti-bacterial agents identified by the methods described herein are provided, as well as methods for treating a subject suffering from infection with staphylococci involving administration of such novel anti-bacterial agents. In particular, agents that interfere with the expression of virulence gene products include anti-sense polynucleotides that are complementary to the virulence gene sequences. Agents that interfere with the function of virulence gene products include variants of virulence gene products, ligands of these virulence gene products and variants thereof, and enzyme inhibitors (where the product is an enzyme).

[0026] Yet a further aspect of this invention provides Staphylococcus aureus organisms containing a functional mutation in a gene represented by any one of SEQ ID NOS: 1 through 94, said functional mutation resulting in a reduction in virulence of the organism. Also contemplated are vaccine compositions comprising such mutated S. aureus organisms, optionally comprising a suitable adjuvant and a pharmaceutically acceptable diluent or carrier.

[0027] Numerous additional aspects and advantages of the invention will become apparent to those skilled in the art upon consideration of the following detailed description of the invention which describes presently prepared embodiments thereof.

DETAILED DESCRIPTION OF THE INVENTION

[0028] “Virulence genes,” as used herein, are genes whose function or products are required for successful establishment and/or maintenance of bacterial infection in a host animal. Thus, virulence genes and/or the proteins encoded thereby are involved in pathogenesis in the host organism, but may not be necessary for growth in vitro. Since antibiotics are typically screened in vitro, identification of these in vivo virulence genes provides a means for discovering new antimicrobials with different targets and mechanisms of action compared to existing antibiotics. There may be 50 to 100 virulence genes in S. aureus [see Groisman and Ochman, Trends Microbiol. Sci., 2:289-294 (1984) (discussing Salmonella virulence genes); Muhldorfer and Hacker, Microb. Pathogenesis, 16:171-181 (1994) (discussing E. coli virulence genes].

[0029] “Signature-tagged mutagenesis,” as used herein, is a method generally described in International Patent Publication No. WO 96/17951, incorporated herein by reference, and includes, for example, a method for identifying S. aureus genes required for virulence in a murine model of bacteremia. In this method, each insertional mutation carries a different DNA signature tag which allows mutants to be differentiated from each other. The tags comprise 40-bp variable central regions flanked by invariant “arms” of 20-bp which allow the central portions to be co-amplified by polymerase chain reaction (PCR). Tagged mutant strains are assembled in microtitre dishes, then combined to form the “inoculum pool” for infection studies. At an appropriate time after inoculation, bacteria are isolated from the animal and pooled to form the “recovered pool.” The tags in the recovered pool and the tags in the inoculum pool are separately amplified, labelled, and then used to probe filters arrayed with the different tags representing the mutants in the inoculum. Mutants with attenuated virulence are those with tags that give hybridization signals when probed with tags from the inoculum pool but not when probed with tags from the recovered pool.

[0030] Signature-tagged mutagenesis allows a large number of insertional mutant strains to be screened simultaneously in a single animal for loss of virulence. Screening thirteen pools of 96 mutant S. aureus strains resulted in the identification of 50 strains with reduced virulence, many of which were confirmed to be attenuated in virulence by subsequent analysis of individual mutants. The nucleotide sequences of the regions flanking the transposon insertion points of these mutants were analyzed by searching DNA and protein sequence databases to identify the genes inactivated by the insertion of the transposon.

[0031] On the basis of these searches many of the virulence genes may be grouped into different classes. The first class encodes proteins involved in cell surface metabolism (e.g., P2C73, P11C29, P13C83, P9B65, P10B89). Both femA and femB, which are involved in the formation of cell wall peptidoglycan pentaglycine cross bridges, were identified as virulence genes. Mutant P2C73 contains a transposon insertion in a previously unknown gene that shares significant similarity to femB. Mutant P14C15 contains a transposon insertion in a gene whose product is similar to aspartate semialdehyde dehydrogenase (Asd) from different bacteria, with the highest level of similarity to Asd from Bacillus subtilis. Asd is a key enzyme in the biosynthesis of methionine, threonine, isoleucine, lysine and diaminopimelic acid (DAP), which is an important component of cell wall peptidoglycan.

[0032] The second class encodes enzymes involved in cellular biosynthetic pathways (e.g., P9B74, P5C4, P9B66, P14C15, P13B26, P7C18, P15C31, P10B18, P6B18, P10B66, P10C34, P12C3). Deduced protein products of two genes (mutants P7C18 and P13B26) show strong similarity to B. subtilis LysA and ThrB. These enzymes, like Asd, are involved in aspartate metabolism. LysA is diaminopimelate decarboxylase, which converts diaminopimelate to lysine, and ThrB phosphorylates homoserine before conversion into threonine. Transposon insertions were also obtained in genes homologous to Methanococcus jannaschii trpA, Lactococcus lactis trpB and L. lactis trpD. These genes encode enzymes of the tryptophan biosynthetic pathway: the alpha chain of tryptophan synthetase, the beta chain of tryptophan synthetase, and anthranilate phosphoribosyltransferase, respectively. The gene mutated in P15C31 is a homolog of L. lactis purL encoding phosphoribosylformylglycinamidine decarboxylase, an enzyme of the purine biosynthetic pathway. Mutant P9B66 contains an insertion in a gene whose product is similar to peptide methionine sulphoxide reductases.

[0033] A third class of genes are those encoding components of the TCA cycle (e.g., mutants P4C27, P4C52, P10B2, P10C20, P12C32). Strains P10B2 and P12C32 carry mutations in genes for a subunit of the oxoglutarate dehydrogenase complex and aconitase, respectively.

[0034] The fourth class is composed of genes whose products are similar to a oligopeptide transport proteins of the ATP-binding cassette (ABC) transporter superfamily (e.g., mutants P7C26, P10C15, P5C3, P11C66, P5C34). Oligopeptide transport is important for peptide utilization and the proteolytic system in lactococci. In Group A streptococci, Opp proteins are involved not only in obtaining nutrients but also in adherence, protease production and processing of secreted proteins.

[0035] The fifth class of genes are involved in cellular regulatory and repair processes (e.g., mutants P4C15, P13B74, P13C72, P10B30, P6C63, P14B25). Mutant P4C15 and P6C63 contain insertions in S. aureus MarR/LuxR-like regulatory proteins. MarR and LuxR belong to a family of transcription regulators and these MarR/LuxR-like proteins likely have a similar function in S. aureus. In Streptococcus pneumoniae, Neisseria gonorrhoeae and Escherichia coli this enzyme helps to maintain surface adhesins in their functional oxidative state. Mutant P10B30 is associated with a transposon insertion in a gene with a product similar to the ATP-dependent Clp protease of E. coli. The Clp stress response system for intracellular protein degradation is widely conserved in bacteria and components of the system are important for virulence of Listeria monocytogenes and S. typhimurium. Mutants P13B74 and P13C72 have stem-loop termination sequences which possibly function in transcription termination.

[0036] The identification of these genes as virulence genes renders them useful in methods of identifying new anti-bacterial agents according to the present invention. Such methods include assaying potential agents for the ability to interfere with expression of virulence gene products represented by the DNA sequences set forth in any one of SEQ ID NOS: 1 through 94 (i.e., the genes represented by DNA sequences of SEQ ID NOS: 1 through 94 encode the virulence gene product, or the DNA sequences of SEQ ID NOS: 1 through 94 are adjacent to the gene encoding the virulence gene product, or are involved in regulation of expression of the virulence gene product), or assaying potential agents for the ability to interfere with the function of a bacterial protein encoded in whole or in part by a DNA sequence set forth in any one of SEQ ID NOS: 1 through 94 or the complementary strand thereof, followed by identifying agents that are positive in such assays. Polynucleotides and polypeptides useful in these assays include not only the genes and encoded polypeptides as disclosed herein, but also variants thereof that have substantially the same activity as the wild-type genes and polypeptides. “Variants,” as used herein, includes polynucleotides or polypeptides which contain one or more deletions, insertions or substitutions, as long as the variant retains substantially the same activity of the wild-type polynucleotide or polypeptide. With regard to polypeptides, deletion variants are contemplated to include fragments lacking portions of the polypeptide not essential for biological activity, and insertion variants are contemplated to include fusion polypeptides in which the wild-type polypeptide or fragment thereof have been fused to another polypeptide.

[0037] The virulence genes may be cloned by PCR, using S. aureus genomic DNA as the template. For ease of inserting the gene into expression vectors, PCR primers are chosen so that the PCR-amplified gene has a restriction enzyme site at the 5′ end preceding the initiation codon ATG, and a restriction enzyme site at the 3′ end after the termination codon TAG, TGA or TAA. If desirable, the codons in the gene are changed, without changing the amino acids, according to E. coli codon preference described by Grosjean and Fiers, Gene, 18:199-209 (1982), and Konigsberg and Godson, Proc. Natl. Acad. Sci. (USA), 80:687-691 (1983). Optimization of codon usage may lead to an increase in the expression of the gene product when produced in E. coli. If the gene product is to be produced extracellularly, either in the periplasm of E. coli or other bacteria, or into the cell culture medium, the gene is cloned without its initiation codon and placed into an expression vector behind a signal sequence. For example, cloning and expression of the femA gene is described in Example 3 below.

[0038] To simplify the protein purification process, a purification tag may be added either at the 5′ or 3′ end of the gene coding sequence. Commonly used purification tags include a stretch of six histidine residues (U.S. Pat. Nos. 5,284,933 and 5,310,663), a streptavidin-affinity tag described by Schmidt and Skerra, Protein Engineering, 6:109-122 (1993), a FLAG peptide [Hopp et al., Biotechnology, 6:1205-1210 (1988)], glutathione S-transferase [Smith and Johnson, Gene, 67:31-40 (1988)], and thioredoxin [LaVallie et al., Bio/Technology, 11:187-193 (1993)]. To remove these peptide or polypeptides, a proteolytic cleavage recognition site may be inserted at the fusion junction. Commonly used proteases are factor Xa, thrombin, and enterokinase.

[0039] Proteins are produced in any number of well-known prokaryotic or eukaryotic expression systems using known promoters, vectors, and hosts. Any suitable host cell may be used for expression of the gene product, such as E. coli, other bacteria, including Bacillus and S. aureus, yeast, including Pichia pastoris and Saccharomyces cerevisiae, insect cells, or mammalian cells, including CHO cells, utilizing suitable vectors known in the art. Proteins may be produced directly or fused to a peptide or polypeptide, and either intracellularly or extracellularly by secretion into the periplasmic space of a bacterial cell or into the cell culture medium. Secretion of a protein requires a signal peptide (also known as pre-sequence); a number of signal sequences from prokaryotes and eukaryotes are known to function for the secretion of recombinant proteins. During the protein secretion process, the signal peptide is removed by signal peptidase to yield the mature protein.

[0040] The virulence gene products produced by the methods described above are used in high throughput assays to screen for inhibitory agents. The sources for potential agents to be screened are chemical compound libraries, fermentation media of Streptomycetes, other bacteria and fungi, and cell extracts of plants and other vegetations. For proteins with known enzymatic activity, assays are established based on the activity, and a large number of potential agents are screened for ability to inhibit the activity. For proteins that interact with another protein or nucleic acid, binding assays are established to measure such interaction directly, and the potential agents are screened for ability to inhibit the binding interaction.

[0041] Alternatively, such binding interactions are evaluated indirectly using the yeast two-hybrid system described in Fields and Song, Nature, 340:245-246 (1989), and Fields and Stemglanz, Trends in Genetics, 10:286-292 (1994), both of which are incorporated herein by reference. The two-hybrid system is a genetic assay for detecting interactions between two proteins or polypeptides. It can be used to identify proteins that bind to a known protein of interest, or to delineate domains or residues critical for an interaction. Variations on this methodology have been developed to clone genes that encode DNA-binding proteins, to identify peptides that bind to a protein, and to screen for drugs. The two-hybrid system exploits the ability of a pair of interacting proteins to bring a transcription activation domain into close proximity with a DNA-binding domain that binds to an upstream activation sequence (UAS) of a reporter gene, and is generally performed in yeast. The assay requires the construction of two hybrid genes encoding (1) a DNA-binding domain that is fused to a protein X, and (2) an activation domain fused to a protein Y. The DNA-binding domain targets the first hybrid protein to the UAS of the reporter gene; however, because most proteins lack an activation domain, this DNA-binding hybrid protein does not activate transcription of the reporter gene. The second hybrid protein, which contains the activation domain, cannot by itself activate expression of the reporter gene because it does not bind the UAS. However, when both hybrid proteins are present, the noncovalent interaction of protein X and protein Y tethers the activation domain to the UAS, activating transcription of the reporter gene. When the virulence gene product (protein X, for example) is already known to interact with another protein or nucleic acid (protein Y, for example), this assay can be used to detect agents that interfere with the interaction of X and Y. Expression of the reporter gene is monitored as different test agents are added to the system; the presence of an inhibitory agent results in lack of a reporter signal.

[0042] When the function of the virulence gene product is unknown and no ligands are known to bind the gene product, the yeast two-hybrid assay can also be used to identify proteins that bind to the gene product. In an assay to identify proteins that bind to protein X (the target protein), a large number of hybrid genes each containing a different protein Y are produced and screened in the assay. Typically, Y is encoded by a pool of plasmids in which total cDNA or genomic DNA is ligated to the activation domain. This system is applicable to a wide variety of proteins, and it is not even necessary to know the identity or function of protein Y. The system is highly sensitive and can detect interactions not revealed by other methods; even transient interactions may trigger transcription to produce a stable mRNA that can be repeatedly translated to yield the reporter protein.

[0043] Other assays may be used to search for agents that bind to the target protein. One such screening method to identify direct binding of test ligands to a target protein is described in U.S. Pat. No. 5,585,277, incorporated herein by reference. This method relies on the principle that proteins generally exist as a mixture of folded and unfolded states, and continually alternate between the two states. When a test ligand binds to the folded form of a target protein (i.e., when the test ligand is a ligand of the target protein), the target protein molecule bound by the ligand remains in its folded state. Thus, the folded target protein is present to a greater extent in the presence of a test ligand which binds the target protein, than in the absence of a ligand. Binding of the ligand to the target protein can be determined by any method which distinguishes between the folded and unfolded states of the target protein. The function of the target protein need not be known in order for this assay to be performed. Virtually any agent can be assessed by this method as a test ligand, including, but not limited to, metals, polypeptides, proteins, lipids, polysaccharides, polynucleotides and small organic molecules. For example, use of femA in this method of screening for potential ligands is described in Example 3 below.

[0044] Another method for identifying ligands for a target protein is described in Wieboldt et al., Anal. Chem., 69:1683-1691 (1997), incorporated herein by reference. This technique screens combinatorial libraries of 20-30 agents at a time in solution phase for binding to the target protein. Agents that bind to the target protein are separated from other library components by centrifugal ultrafiltration. The specifically selected molecules that are retained on the filter are subsequently liberated from the target protein and analyzed by HPLC and pneumatically assisted electrospray (ion spray) ionization mass spectroscopy. This procedure selects library components with the greatest affinity for the target protein, and is particularly useful for small molecule libraries.

[0045] The inhibitors/binders identified by the initial screens are evaluated for their effect on virulence in in vivo mouse models of S. aureus infections. Models of bacteremia, endocarditis, septic arthritis, soft tissue abscess or pneumonia may be utilized. Inhibitors/binders that interfere with bacterial virulence are capable of preventing the establishment of an infection or reversing the outcome of an infection once it is established.

[0046] The identification of S. aureus virulence genes also provides for microorganisms exhibiting reduced virulence, which are useful in vaccines. Such microorganisms include the S. aureus mutants generated in Example 1 below and other S. aureus mutants containing at least one functional mutation in a gene represented by any one of SEQ ID NOS: 1 through 94. The reduced virulence of these organisms and their immunogenicity may be confirmed by administration to a subject. While it is possible for an avirulent microorganism of the invention to be administered alone, one or more of such mutant microorganisms are preferably administered in a vaccine composition containing suitable adjuvant(s) and pharmaceutically acceptable diluent(s) or carrier(s). The carrier(s) must be “acceptable” in the sense of being compatible with the avirulent microorganism of the invention and not deleterious to the subject to be immunized. Typically, the carriers will be water or saline which will be sterile and pyrogen free. The subject to be immunized is a subject needing protection from a disease caused by a virulent form of S. aureus.

[0047] Any adjuvant known in the art may be used in the vaccine composition, including oil-based adjuvants such as Freund's Complete Adjuvant and Freund's Incomplete Adjuvant, mycolate-based adjuvants (e.g., trehalose dimycolate), bacterial lipopolysaccharide (LPS), peptidoglycans (i.e., mureins, mucopeptides, or glycoproteins such as N-Opaca, muramyl dipeptide [MDP], or MDP analogs), proteoglycans (e.g., extracted from Klebsiella pneumoniae), streptococcal preparations (e.g., OK432), Biostim™ (e.g., 01K2), the “Iscoms” of EP 109 942, EP 180 564 and EP 231 039, aluminum hydroxide, saponin, DEAE-dextran, neutral oils (such as miglyol), vegetable oils (such as arachis oil), liposomes, Pluronic® polyols or the Ribi adjuvant system (see, for example GB-A-2 189 141). Recently, an alternative adjuvant consisting of extracts of Amycolata, a bacterial genus in the order Actinomycetales, has been described in U.S. Pat. No. 4,877,612. Additionally, proprietary adjuvant mixtures are commercially available. The adjuvant used will depend, in part, on the recipient organism. The amount of adjuvant to administer will depend on the type and size of animal. Optimal dosages may be readily determined by routine methods.

[0048] The vaccine compositions optionally may include pharmaceutically acceptable (i.e., sterile and non-toxic) liquid, semisolid, or solid diluents that serve as pharmaceutical vehicles, excipients, or media. Any diluent known in the art may be used. Exemplary diluents include, but are not limited to, polyoxyethylene sorbitan monolaurate, magnesium stearate, methyl- and propylhydroxybenzoate, talc, alginates, starches, lactose, sucrose, dextrose, sorbitol, mannitol, gum acacia, calcium phosphate, mineral oil, cocoa butter, and oil of theobroma.

[0049] The vaccine compositions can be packaged in forms convenient for delivery. The compositions can be enclosed within a capsule, sachet, cachet, gelatin, paper or other container. These delivery forms are preferred when compatible with entry of the immunogenic composition into the recipient organism and, particularly, when the immunogenic composition is being delivered in unit dose form. The dosage units can be packaged, e.g., in tablets, capsules, suppositories or cachets.

[0050] The vaccine compositions may be introduced into the subject to be immunized by any conventional method including, e.g., by intravenous, intradermal, intramuscular, intramammary, intraperitoneal, or subcutaneous injection; by oral, sublingual, nasal, anal, vaginal, or transdermal delivery; or by surgical implantation, e.g., embedded under the splenic capsule or in the cornea. The treatment may consist of a single dose or a plurality of doses over a period of time.

[0051] It will be appreciated that the vaccine of the invention may be useful in the fields of human medicine and veterinary medicine. Thus, the subject to be immunized may be a human or an animal, for example, cows, sheep, pigs, horses, dogs and cats, and poultry such as chickens, turkeys, ducks and geese.

[0052] Other aspects and advantages of the present invention will be understood upon consideration of the following illustrative examples. Example 1 addresses identification of S. aureus genes associated with virulence by generating S. aureus mutants that contain a chromosomal insertion of a signature-tagged transposon and identifying the mutants with reduced virulence. Example 2 addresses confirmation of the attenuated virulence of individual mutants. Example 3 addresses use of the virulence genes and gene products in assays for screening potential agents for anti-bacterial activity.

EXAMPLE 1

Identification of S. aureus Genes Associated with Virulence

[0053] S. aureus genes associated with virulence were identified by signature-tagged mutagenesis as follows, generally according to International Patent Publication No. WO 96/17951 and Hensel et al., Science, 269:400-403 (1995).

[0054] A. Construction of Plasmid pID408

[0055] A temperature-sensitive shuttle plasmid pID408 was constructed for use in transferring the signature-tagged transposons into S. aureus. DNA restriction digestions and ligations were performed as described by Sambrook et al., Molecular cloning: a laboratory manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). A 6.5 kb BamHI fragment of pTV32ts [described in Youngman, in Plasmids: a practical approach, K. Hard, ed., Oxford: IRL Press, pages 79-103 (1985); obtained from J. Iandolo, Department of Diagnostic Medicine, College of Veterinary Medicine, Manhattan, Kans.] carrying the temperature-sensitive replicon pE194ts and a chloramphenicol (cm) resistance gene (cmR) was inserted into the BamHI site of plasmid pSP72 (Promega), forming pID402. Plasmid pID402 was digested with SmaI and self-ligated to remove a small fragment containing a BamHI site between the SmaI sites, resulting in pID405. A DNA fragment of pBR322 (New England BioLabs) containing the ampicillin resistance gene (ampR)/ori/rop region (corresponding to bases 1904-4359 of pBR322) was prepared by polymerase chain reaction (PCR) amplification using primers pBR1 (5′-GGAGCTCACTAGTCGGAGGCATCAGTGACC-3′, SEQ ID NO: 95) and pBR2 (5′-GGGATCCCATGAGAATTCTTGAAGACG-3′, SEQ ID NO: 96). Primer pBR1 contains sites for SacI and SpeI, and pBR2 contains sites for BamHI and EcoRI. The PCR product was digested with BamRI and SacI and ligated to the BamHI/SacI-digested fragment of pID405 (carrying replicon pE194ts and cmR) to create pID406, in which the ampR/ori region of pSP72 is replaced with the replicon of pBR322. Finally, a 6.5 kb BamHI-EcoRI fragment from pTV9 [described in Youngman, in Plasmids: a practical approach, K. Hard, ed., Oxford: IRL Press, pages 79-103 (1985)], containing transposon Tn917 and its erythromycin (erm) resistance gene (ermR), was ligated with BamHI and EcoRI digested pID406, resulting in plasmid pID408. The origin of replication from pBR322 allows pID408 to replicate in E. coli, and the temperature-sensitive replicon pE194ts (from pTV32ts) allows replication in S. aureus at 32° C.

[0056] B. Cloning and Selection of Signature Tags

[0057] DNA signature tags were prepared as described by Hensel et al., Science, 269:400-403 (1995) and inserted into the transposon Tn917 carried by pID408 as follows. Oligonucleotides tags in pool RT1 (5′-C T A G G T A C C T A C A A C C T C A A G C T T-[N K]20-AAGCTTGGTTAGAATGGGTACCATG-3′, SEQ ID NO: 97, where N is A, C, G or T, and K is G or T were synthesized on an oligonucleotide synthesizer (Applied Biosystems). The 80 bp tags from oligonucleotide pool RT1 were PCR-amplified from the using primers P10 (5′-CTAGAATTCTACAACCTCAAGCTT-3′, SEQ ID NO: 98) and P11 (5′-AAGCTTGGTTAGAATGGAATTCATG-3′, SEQ ID NO: 99). The PCR-amplified tags were digested with EcoRI, gel-purified, and ligated with EcoRI digested, dephosphorylated pID408, to form plasmids containing uniquely signature-tagged Tn917 transposons. The ligated DNA was transformed into S. aureus strain RN4220 (a restriction defective strain derived from NCTC 8325-4 and described in Youngman, in Plasmids: a practical approach, K. Hard, ed., Oxford: IRL Press, pages 79-103 (1985) by electroporation. Electroporation was performed by the method of Schenk and Laddaga, FEMS Microbiol. Lett., 94:133-138 (1992), with the following modifications: electrotransformed bacteria were plated on non-selective brain-heart infusion (BH, Difco) agar plates (1.5% agar), grown at 32° C. for 8 to 12 hours and then replicated using an Accutran Replica Plater (Schleicher and Schuell) onto BHI agar plates containing 20 &mgr;g/ml erm and 20 &mgr;g/ml cm, and grown at 32° C. overnight.

[0058] A total of 400 ermR, cmR transformants were then screened to identify 150 tags that amplified and labelled efficiently. The 150 transformants were each cultured in 10 ml BHI broth containing 20 &mgr;g/ml erm and 20 &mgr;g/ml cm at 32° C. overnight. Plasmid DNA was extracted from each culture using a Qiagen Plasmid Miniprep Kit according to the manufacturer's protocol except that the bacterial cells were lysed by lysostaphin (Sigma; 200 mg/ml) at 37° C. for 30 min. in the P1 solution of the Qiagen miniprep kit. An aliquot of each plasmid DNA preparation (1 &mgr;g) was transferred onto a Hybond N+ membrane (Amersham) by using a Bio-Dot Microfiltration Apparatus according to the manufacturer's protocol (Bio-Rad) to give 75 different plasmids per membrane. The membranes were then transferred to Whatman 3MM paper saturated with denaturing solution (0.5 N NaOH, 1.5 M NaCl), incubated for 5 min. then transferred to another piece of Whatman 3MM paper saturated with neutralizing solution (1.5 M NaOH, 0.5 M Tris-Cl pH 7.4) for 5 min. After neutralization, the membranes were dried at 80° C. for 10 min and the DNA cross-linked by UV light using a Stratalinker (Stratagene). The signature tags from the 150 transformants were also labelled for use as probes. Aliquots of the plasmid preparations were combined to form four pools of 37, 37, 38 and 38 plasmids. The DNA signature tags from these four pools were PCR-amplified with primers P12 (5′-GAATTCCATTCTAAC-3′, SEQ ID NO: 100) and P13 (5′-ATTCCATTCTAACCAAGC-3′, SEQ ID NO: 101) according to Hensel et al., Science, 269:400-403 (1995). These PCR products were gel-purified, subjected to a digoxygenin (DIG)-labelling PCR using a PCR DIG Probe Synthesis Kit as described by the manufacturer (Boehringer Mannheim). The DIG-labelled PCR products were hybridized separately with the membranes according to the method described in the DIG Probe Synthesis Kit, to identify tags that gave strong hybridization signals, but which did not cross-hybridize with tags in the other pools. From these experiments, a total of 96 plasmids were chosen on the basis of labelling efficiency of tags and lack of cross-hybridization.

[0059] C. Generation of the S. aureus Mutant Bank

[0060] The 96 plasmids containing uniquely signature tagged-transposons were used to generate S. aureus mutants with a chromosomal transposon insertion. A series of identical membranes for dot-blot hybridizations were prepared by transferring 1 &mgr;g of each of the 96 plasmids onto Hybond N+ membranes using the Bio-Dot Microfiltration Apparatus. The 96 plasmids were separately transformed into S. aureus strain RN6390 by electroporation [Schenk and Laddaga, FEMS Microbiol. Lett., 94:133-138 (1992)]. Electrotransformed bacteria were plated directly on BHI agar plates containing 20 &mgr;g/ml cm and 20 &mgr;g/ml erm at 32° C. overnight. A single colony from each transformation was transferred into each well of a microtitre dish containing 200 &mgr;l BHI broth, 20 &mgr;g/ml erm and 20 &mgr;g/ml cm. The microtitre dish was incubated at 32° C. overnight. Glycerol was added to each well to give a final concentration of 50% and the plates were stored at −80° C. This collection of 96 transformants was designated the master pool and was used for all subsequent mutagenesis.

[0061] To generate 96 different Tn917 mutants, bacteria from the master pool were replicated using a microtitre dish replicator (Sigma) into the wells of a new microtitre dish containing 200 &mgr;l BHI broth and 20 &mgr;g/ml erm. This dish was incubated at 43° C. overnight and then bacteria from each well were streaked on BHI agar containing 20 &mgr;g/ml erm and incubated at 43° C. overnight to obtain single colonies. Approximately five different ermR colonies obtained from each well were transferred onto BHI agar containing 20 &mgr;g/ml cm and incubated at 32° C., and onto BHI agar containing 20 &mgr;g/ml erm and incubated at 43° C., to screen for cmS colonies. ErmR, cmS colonies should lack the plasmid and carry a chromosomal insertion of Tn917. Individual ermR, cmS colonies from each of the 96 wells were transferred into a new 96 well microtitre dish with BHI broth containing 20 &mgr;g/ml erm and grown overnight at 43° C. for use as inoculum. These 96 mutants, taken together, form one “inoculum pool.” Mutant pools were also stored at −80° C. in 50% glycerol.

[0062] To verify that ermR, cmS colonies lack the plasmid and carry a single chromosomal insertion of Tn917, chromosomal DNA samples from individual mutant strains and from a pool of 46 colonies that had been cultured separately were digested with EcoRI and subjected to Southern analysis using a fragment of the &bgr;-lactamase gene as a probe. For each of 12 separately analyzed mutants, a single hybridizing fragment of different size was observed in each lane. A large number of hybridizing fragments were observed in the lane containing DNA from 46 mutants. These results indicate that the majority of Tn917 insertions occur singly and at different locations in the S. aureus chromosome.

[0063] D. Infection Studies to Identify Mutants with Reduced Virulence

[0064] The “inoculum pool” of 96 S. aureus mutants containing chromosomal transposon insertions was evaluated for attenuated virulence in a mouse model of bacteremia. After overnight incubation at 43° C., the 96 different mutants from individual wells of the microtitre dish were pooled together and washed twice with BHI broth by centrifugation at 4000×g for 10 min and resuspended in BHI broth. The OD620 was determined using a spectrophotometer (OD620 of 1.6×109 colony forming units (CFU)/ml) [Cheung et al., J. Bacteriol., 177:3220-3226 (1995).]. The bacterial suspension was diluted to approximately 5×106 CFU/ml and then mixed with an equal volume of pre-autoclaved 4% (w/v) Brewer's yeast (Sigma) in BHI broth. A total of 0.2 ml of this mixture, containing approximately 5×105 CFU bacteria, was injected intraperitoneally into a CD-1 mouse (approximately 25 g in weight). The number of CFU in the inoculum was verified by viable counts after plating a diluted aliquot of the inoculum to BHI agar. Two to four mice were inoculated with each pool. 48 hours after inoculation, bacteria were recovered from the spleens of the animals as described by Hensel et al., Science, 269:400-403 (1995) and pooled to form the “recovered pool.” Each recovered pool was made from at least 10,000 bacterial colonies. The signature tags present in the recovered pools were compared with the signature tags present in the inoculum pools by PCR amplifying the tags using primers P12 and P13 (described in section B above), DIG labelling the tags, and hybridizing the labelled tags to the 96 plasmids which had been transferred to Hybond N+ membranes using the Bio-Dot Microfiltration Apparatus as described above in section C.

[0065] E. Virulence Gene Identification and DNA Sequencing

[0066] A total of 13 pools, each comprising 96 S. aureus Tn917 mutants, were screened as described above for loss of virulence in mice. From these, 50 mutants were identified whose tags hybridized strongly to probes from the inoculum pools but weakly to probes from the corresponding recovery pools.

[0067] To clone the chromosomal DNA flanking the transposon insertion points of these 50 mutants, 3-5 &mgr;g of S. aureus chromosomal DNA from each mutant was isolated as described by Pospiech and Neumann, Trends Genetc., 11:217-218 (1995) and completely digested with HindIII. Half of the digested DNA was then subjected to Southern hybridization analysis using the pBR322 fragment of pID408 as a probe to determine the size of the DNA fragment carrying this part of the transposon. The rest of the DNA was resuspended in 200 &mgr;l of ligation buffer (Gibco-BRL) and self-ligated overnight at 16° C. The ligated products were transformed into E. coli DH5a (Gibco) and plated onto Luria Bertani (LB) agar containing 50 &mgr;g/ml ampicillin, and incubated at 37° C. overnight. A single ampR colony from each transformation was grown up in LB broth containing 100 &mgr;g/ml amp. Plasmid DNA was extracted using a Qiagen plasmid miniprep kit. Chromosomal DNA flanking the transposon was obtained using primer pseq-1 (5′-TGAACTGCCACTGTAGAGAGA-3′, SEQ ID NO: 102) based on the erm-proximal end of Tn917, and sequenced (for a stretch of several hundred nucleotides) using a Model 373A Sequencing System (Applied Biosystems). The sequence obtained is indicated in Table 1 below with reference to the corresponding nucleotides of the SEQ ID NO:______.

[0068] These DNA sequences were analyzed by searching the S. aureus database from Human Genome Sciences and the European Molecular Biology Laboratory and Genbank DNA and Protein Databases using the BLAST and FASTA network service at the Human Genome Mapping Project Recourse Centre, Hinxton, UK. Results of the searches done to date in identifying the virulence genes and their possible function are shown in Table 1. Table 1 below displays the signature tag identification number, the SEQ ID NO: corresponding to each virulence gene (and the nucleotide positions within the SEQ ID NO: that correspond to the actual stretch of DNA that was sequenced), the possible function of the gene, and the LD50 of the knockout mutant as determined in Example 2 below.

EXAMPLE 2

Assessment of Virulence of S. aureus Knockout Mutants

[0069] The virulence of individual knockout mutants, identified in Example 1 as having reduced virulence when tested in pools of 96 mutants, was assessed by carrying out an LD50 determination for each mutant. Confirmation that a given mutation is in a virulence gene may be obtained by comparing the parent and mutated bacterial strains in terms of whether both strains are equally effective in establishing an infection with the same consequences for the host animal. In practice, this may be done by comparing LD50 values (the number of bacteria required to produce a 50% mortality rate in the animals under standardized conditions) between the wild-type strain and the mutant derivative strain. If the LD50 values are within standard error of each other then the mutation is not in or does not affect a virulence gene. If significant differences occur between the wild-type and the mutant strain, where the mutant strain is significantly less able to cause lethal infection, then the mutation is in a virulence gene or dramatically affects a virulence gene.

[0070] Briefly, LD50 determinations were conducted as follows. CF1 female mice weighing between 19 and 22 grams were injected intraperitoneally with a set concentration of either wild-type or mutant S. aureus in 0.2 ml of BHI broth containing 4% (w/v) dried brewer's yeast as an adjuvant for establishment of infection. The amount of brewer's yeast may vary from 0-8% dependent upon the bacteria being utilized in the infection. A single LD50 determination utilizes five log-dilutions of bacteria (103 to 107), with each log-dilution being tested in 10 mice. The actual number of bacteria employed was estimated in each LD50 determination by a plate count conducted on the bacterial stock to determine the number of CFU of bacteria. Following infection, the mice were monitored daily for mortality for a period of at least one week. At the end of the observation period the LD50 was determined using probit analysis on the mortality data. The LD50 value of the wild-type S. aureus strain RN6390 ranges from 1.4×104 to 1.4×105. The LD50 values for the virulence gene mutants are shown in Table 1 below. 1 TABLE 1 VIRULENCE GENE SEQUENCES AND POSSIBLE FUNCTION Position SEQ ID of DNA NO: sequence LD50 of SIGNA- (DNA; obtained IDENTIFICATION knockout TURE amino in OF POSSIBLE mutant TAG ID acid) Example1 FUNCTION OF GENE (#CFU)* p2c73 SEQ ID 517-756 FemA/B like with ˜40% >6.8 × NO: 1; identity 108 2 p2c90 SEQ ID 281-431 Unknown; near Opp operon NO: 3 p9b74 SEQ ID 593-711 Tryptophan synthase alpha NO: 4; chain TrpA 5 p11c29 SEQ ID 1107-1260 FemB NO: 6; 7 p13c83 SEQ ID 1107-1260 FemB  3.9 × NO: 6; 105 7 p4c15 SEQ ID 360-654 MarR/LuxR-like regulatory NO: 8; protein 9 & 10 p6c63 SEQ ID 388-659 MaxR/LuxR-like regulatory >5.4 × NO: 8; protein 108 9 & 10 p5c4 SEQ ID 192-481 41% identity to nitrate NO: 11; reductase NirQ 12 p9b66 SEQ ID 221-474 Peptide methionine  4.0 × NO: 13; sulfoxide reductase 104 14 p7c26 SEQ ID  44-410 Oligopeptide transporter NO: 15; OppF 16 p10c15 SEQ ID 562-825 Oligopeptide transporter >2.6 × NO: 17 OppD 108 & 19; 18 & 20 p13b74 SEQ ID all Possible stem-loop termina-  8.8 × NO: 21 tion sequence; no obvious 104 ORF p13c72 SEQ ID all Possible stem-loop termina- NO: 21 tion sequence; no obvious ORF p14c15 SEQ ID  669-1009 C-term of aspartokinase 2 NO: 22; alpha subunit and N-term of 23 & 24 aspartate semialdeyde de- hydrogenase Asd; both involved in homoserine synthesis p13b26 SEQ ID 442-819 homoserine kinase  7.7 × NO: 25; 104 26 p7c18 SEQ ID 667-847 diaminopimelate de- NO: 27; carboxylase LysA; lysine 28 synthesis p15c31 SEQ ID 1594-2018 phosphoribosylformyl- NO: 29; glyinamide decarboxylase 30 PurL; purine synthesis p10b18 SEQ ID  3-404 tryptophan synthase alpha >5.2 × NO: 31; chain trpA 108 32 p6b18 SEQ ID  3-404 tryptophan synthase alpha NO: 31; chain trpA 32 p10b66 SEQ ID  30-282 tryptophan synthase beta >4.2 × NO: 33; chain trpB 106 34 p10c34 SEQ ID 609-817 Anthranilate   >4 × NO: 35; phosphoribosyl transferase 106 36 TrpD; tryptophan synthesis p4c27 SEQ ID 1130-1254 dihydrolipoamide succinyl NO: 37; transferase component(e2) 38 of 2-oxoglutarate dehydro- genase complex in TCA cycle p4c52 SEQ ID 498-738 dihydrolipoamide succinyl NO: 39; transferase component(e2) 40 of 2-oxoglutarate dehydro- genase complex in TCA cycle p10b2 SEQ ID  880-1159 dihydrolipoamide succinyl >2.6 × NO: 41; transferase component(e2) 108 42 of 2-oxoglutarate dehydro- genase complex in TCA cycle p10c20 SEQ ID all Sequence 3′ to the  3.7 × NO: 43 dihydrolipoamide succinyl 105 transferase component(e2) of 2-oxoglutarate dehydro- genase complex in TCA cycle; no obvious ORF p12c32 SEQ ID 188-438 Alpha-ketoglutarate >1.0 × NO: 44; dehydrogenase (e1) of the 106 45 2-oxoglutarate dehydro- genase complex in TCA cycle; acetyl CoA synthase p10b30 SEQ ID 2419-2574 Heat shock protein ClpB  1.4 × NO: 46; 104 47 p13c3 SEQ ID 454-765 35% identity to hypo-  1.8 × NO: 48; thetical 45.9 kDa protein 104 49 from B. subtilis ImpB/ MucB/SamB family p4b3 SEQ ID  790-1203 Unknown; homology to NO: 50; hypothetical proteins from 51 B. subtilis YAAD and YAAE p4c63 SEQ ID 576-806 Unknown; metallopeptidase NO: 52; motif 53 p5c3 SEQ ID  1-450 Unknown; membrane trans-  7.1 × NO: 54; porter motif 104 55 p8d26 SEQ ID  32-262 Unknown; 38% identity to NO: 56 C. elegans ORF & 58; 57 & 59 p9b65 SEQ ID  1-361 sodium/proton dependent >9.2 × NO: 60; alanine carrier protein 108 61 p10b32 SEQ ID 205-296 Unknown NO: 62; 63 p10b85 SEQ ID  38-212 Unknown NO: 64 p10b89 SEQ ID  1-205 Unknown; prokaryotic >2.2 × NO: 65; membrane lipoprotein lipid 108 66 attachment motif p10c30 SEQ ID  730-1041 Unknown; sensor-type  8.8 × NO: 67; protein motif 105 68 p10c52 SEQ ID  1-262 Unknown NO: 69; 70 p10d9 SEQ ID 422-639 Unknown; enterotoxin-like NO: 71; motif 72 p11c12 SEQ ID  1-150 Unknown; 40% identity to >4.2 × NO: 73; Mycoplasma mycoides 106 74 hypothetical protein in ffh 5′ region q01444 p11c66 SEQ ID 292-529 Unknown; near Opp operon NO: 75 & 77; 76 & 78 p5c34 SEQ ID 1180-1236 glycine betaine transporter; NO: 79; region 55% identity to B. 80 subtilis p54417 p10c18 SEQ ID  1-477 Unknown-potential ORF in NO: 81 120 bp p12c3 SEQ ID  1-318 acetyl-CoA synthetase; NO: 82; region 59% identity to B. 83 subtilis p39062 p14b25 SEQ ID  1-148 Unknown; exonuclease- NO: 84; like; 25% identity to E. coli 85 p13458; contains ATP binding motif p14b74 SEQ ID 243-624 Unknown; 51% identity to NO: 86; hypothetical 45.9 kd 87 protein(YQJW) from B. subtilis p54560 p14c13 SEQ ID  1-441 Unknown; near Opp operon NO: 88 p15b9 SEQ ID 654-867 Unknown; 41% identity to NO: 89; hypothetical 33.7 kd protein 90 (YHCT) from B. subtilis p54604 p15b32 SEQ ID 286-370 Unknown; similar to orf1 NO: 91; 5′ of acvB of Agro. 92 tumefaciens a36922 p15c4 SEQ ID  25-192 4-oxalocrotonate NO: 93; tautomerase; 42% identity 94 to Pseudo. putida a43397 *The LD50 for wild-type S. aureus RN6390 is normally 1.4 × 104 to 1.4 × 105.

EXAMPLE 3

Use of Virulence Gene Products in Screen for Anti-Bacterial Agents

[0071] The virulence genes and their gene products are utilized in assays for identifying new anti-bacterial agents against S. aureus. The genes are cloned, the proteins encoded by the genes are produced and purified, high throughput assays are established to screen for inhibitors, and the inhibitors identified in the primary screen are evaluated in secondary assays. The cloning and expression of FemA, and its use in screening potential inhibitory agents, is described below.

[0072] A. Cloning of FemA Gene

[0073] DNA restriction digestions and ligations are performed as described by Sambrook et al., Molecular cloning: a laboratory manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). Cloning of the S. aureus femA gene [Berger-Bachi et al., Mol. Gen. Genet., 219:263-269 (1989)] for intracellular expression in E. coli is carried out as follows. To clone the gene with six histidine residues at the 3′-terminus, the following two oligonucleotides primers, 5′-GGCCATCGATAATGAAATTAATTAACGAGAGACAAATAGG-3′, SEQ ID NO: 103, and 5′-GGCCGGATCCCTAGTGATGGTGATGGTGATGAAAAATTCTGTCTTTAACT TTTTT-3′, SEQ ID NO: 104, are used to PCR amplify the gene from S. aureus genomic DNA. The resulting femA gene has a ClaI site at 5′-end and a BamHI site at 3′-end for cloning into E. coli expression vectors. For secretion of the femA gene with six histidine residues at the 3′-terminus into the periplasm of E. coli, PCR amplification using the following two oligonucleotide primers, 2 5′-GGCCGGTACCAAATTAATTAACGAGAGACAAATAGG-3′, and SEQ ID NO: 105 5′GGCCGGATCCCTAGTGATGGTGATGGTGATGAAAAATTCTGTCTTTAACTTTTTT-3′, SEQ ID NO: 106

[0074] results in a fragment with a KpnI site at the 5′-end and a BamHI site at the 3′-end. The approximately 1.3 kb PCR fragment may be sequenced directly, or after cloning into an expression vector, to confirm the sequence of the femA gene and its flanking regions.

[0075] B. Recombinant FemA Protein Production and Purification

[0076] Expression of femA in E. coli is carried out as follows. The E. coli expression vector pSRtac-pelB contains the synthetic tac promoter and the signal sequence of PelB [Lei et al., J. Bact., 169:4379-4383 (1987)], with transcription terminators upstream and downstream to minimize transcription read through. For intracellular expression, the femA gene generated by PCR as described above in section A with ClaI and BamHI sites at the termini is cloned into pSRtac-pelB digested with ClaI and BamHI (replacing the PelB signal sequence). For secretion into periplasm, the femA gene generated by PCR as described above in section A with KpnI and BamHI sites at the termini is cloned into pSRtac-pelB digested with KpnI and BamHI, directly downstream from the pelB signal sequence. E. coli are transformed with the expression vector containing the femA gene. To induce the tac promoter and optimize expression level, the transformed bacteria are incubated with IPTG (isopropylthio-&bgr;-galactoside) at concentrations ranging from 2×10−3 M to 1×10−5 M, at cell growth temperatures between 27° C. to 42° C. in rich medium or minimal medium.

[0077] The recombinant FemA thus produced contains six histidine residues at the C-terminus and can be purified via the affinity of histidine to nickel. Chromatography may be carried out with the metal chelating resin Ni-nitrilotriacetic acid (Ni-NTA) (available from Qiagen, Chatsworth, Calif.) under native or denaturing conditions.

[0078] C. High Throughput Assays Using FemA for Screening Potential Inhibitors

[0079] The screening method described in U.S. Pat. No. 5,585,277 is used as follows to establish a high throughput assay to identify ligands that bind to FemA. The test ligand and femA are combined under conditions (e.g., temperature, pH, salt concentration, time) appropriate for detecting binding of femA to a ligand. If too little target protein is unfolded, the observed signal will occur at too low a level or rate to be conveniently measured. The conditions are optimized using known methods. Binding of a test ligand to femA is assessed in one of several ways: by determining the extent to which folded femA is present in the test ligand-femA combination, by determining the extent to which unfolded femA is present in the test ligand-femA combination, or by determining the ratio of folded femA to unfolded femA in the combination. There are numerous methods to carry out these determinations. For example, proteolysis may be used. A protease which acts preferentially on unfolded femA is combined with the test ligand-femA combination, and after an appropriate period of incubation, the difference between intact or degraded femA in the presence and in the absence of the test ligand is determined. The addition of a test ligand which binds the folded femA, thus stabilizing it in the protease-resistant form, changes the rate of proteolysis. A wide variety of known proteases, such as trypsin, chymotrypsin, V8 protease, elastase, carboxypeptidase, proteinase K, thermolysin and subtilisin, can be used. As another example, the binding of the test ligand to the femA is assessed through the use of antibodies that specifically bind to the protein only in the unfolded state. There are numerous methods known in the art for producing antibodies to a particular protein.

[0080] D. In vivo Assays to Evaluate Inhibitors

[0081] The inhibitors/binders identified by the initial screens such as the one described in section C above are evaluated for their effect on virulence in mouse models of S. aureus infection. Mice are infected with 100 LD50's of the wild-type bacteria and treated with varying doses of the test inhibitory agent. The ED50 of the test inhibitory agent (the amount in milligrams of drug per kilogram of body weight required to cure 50% of infected animals) is determined. Each trial contains two control groups, a negative control group given an LD50 dose of bacteria and no test inhibitory agent (which ensures that the infecting dose is operationally close to 100 LD50's), and a positive control group given a 100 LD50 dose of bacteria and an ED50 dose of a known and effective antibiotic for that bacterial infection (which confirms that the infection can be cured under appropriate conditions).

[0082] Five dosage levels of test inhibitory agent, utilizing serial two-fold dilutions, are employed. An exemplary dosage scheme begins with a minimum of 6.25 mg of drug per kg of body weight per dose, and ranges up to a maximum dose of 100 mg/kg. Each dosage level is tested in six mice and deaths following infection and treatment are monitored for at least 6 days. At the end of the test period, probit analysis is employed to determine the ED50 value of the inhibitor or the amount of drug in milligrams of drug per kilogram of body weight required to reverse virulence so as to result in only 50% mortality of infected animals in the test. In tests designed to detect the prevention of infection by interference with virulence factors, the first dose of the inhibitor is given one hour prior to infection, and then four and eight hours post infection. In tests designed to detect virulence inhibitors which reverse the outcome of infection, the inhibitor is administered one and four hours post infection on the first day of infection and once in the morning and afternoon (separated by 6-8 hours) on the second and third days following infection. Inhibitory agents that successfully prevent the establishment of an infection or reverse the outcome of an infection once established are identified.

[0083] Numerous modifications and variations of the above-described invention are expected to occur to those of skill in the art. Accordingly, only such limitations as appear in the appended claims should be placed thereon.

Claims

1. A method of identifying an anti-bacterial agent comprising the steps of assaying potential agents for the ability to interfere with expression of virulence gene products represented by the DNA sequences set forth in any one of SEQ ID NOS: 1 through 94, and identifying an agent that interferes with expression of said virulence gene products.

2. A method of identifying an anti-bacterial agent comprising the steps of assaying potential agents for the ability to interfere with the function of a bacterial protein encoded in whole or in part by a DNA sequence set forth in any one of SEQ ID NOS: 1 through 94 or the complementary strand thereof, and identifying an agent that interferes with the function of said bacterial protein.

3. The method of claim 2 wherein the protein is involved in cell surface metabolism and is encoded by the DNA sequence of any one of SEQ ID NOS: 1, 6, 60 and 65 (corresponding to signature tag identification numbers P2C73, P11C29, P13C83, P9B65 and P10B89).

4. The method of claim 2 wherein the protein is an enzyme involved in a cellular biosynthetic pathway and is encoded by the DNA sequence of any one of SEQ ID NOS: 4, 11, 13, 22, 25, 27, 29, 31, 33, 35 and 82 (corresponding to signature tag identification numbers P9B74, P5C4, P9B66, P14C15, P13B26, P7C18, P15C31, P10B18, P6B18, P10B66, P10C34 and P12C3).

5. The method of claim 2 wherein the protein is a component of the TCA cycle and is encoded by the DNA sequence of any one of SEQ ID NOS: 37, 39, 41, 43 and 44 (corresponding to signature tag identification numbers P4C27, P4C52, P10B2, P10C20 and P12C32).

6. The method of claim 2 wherein the protein is an oligopeptide transport proteins and is encoded by the DNA sequence of any one of SEQ ID NOS: 15, 17, 19, 54, 75, 77 and 79 (corresponding to signature tag identification numbers P7C26, P10C15, P5C3, P11C66 and P5C34).

7. The method of claim 2 wherein the protein is involved in cellular regulatory and repair processes and is encoded by the DNA sequence of any one of SEQ ID NOS: 8, 21, 46 and 84 (corresponding to signature tag identification numbers P4C15, P6C63, P13B74, P13C72, P10B30 and P14B25).

8. The method of any one of claims 1 through 7 wherein the assay used is an enzyme assay.

9. The method of any one of claims 1 through 7 wherein the assay used is a binding assay.

10. The method of any one of claims 1 through 7 wherein the assay used is a two-hybrid screening assay.

11. The method of any one of claims 1 through 7 wherein the assay is being used to screen for a ligand by binding to target protein.

12. The method of any one of claims 1 through 7 wherein the assay used is an affinity ultrafiltration assay.

13. A Staphylococcus aureus organism containing a functional mutation in a gene represented by any one of SEQ ID NOS: 1 through 94, said functional mutation resulting in a reduction in virulence of the organism.

14. A vaccine composition comprising the S. aureus organism of claim 13.