Method for typing of HLA alleles
The present invention relates to the typing of HLA alleles. The sequence of exon 2 and exon 3 of the alleles HLA-B*3913, HLA-B*1406, and HLA-B*51new and of exon 2 of the alleles HLA-DRB1*0820, HLA-DRB1*04new and HLA-DRB4*01new are disclosed. The present invention relates to methods for typing of said alleles. According to a preferred embodiment, said typing comprises the following steps: i) amplifying a relevant fragment of said alleles using at least one suitable pair of primers; ii) hybridizing the amplification product of step i) to at least one probe that specifically hybridizes to a target region comprising one or more polymorphic nucleotides in said relevant fragment; iii) determining from the result of step ii) the absence or presence of said alleles in the sample. The present invention further provides primers and probes to be used in said methods for typing. A diagnostic kit comprising said primers and probes is also part of the present invention.
Latest Innogenetics N.V. Patents:
[0001] This invention relates to the typing of human leukocyte antigen (HLA) alleles. More particularly, the present invention relates to the typing of new HLA alleles.
BACKGROUND OF THE INVENTION[0002] The human major histocompatibility complex (MHC) is contained within about 4 Mbp of DNA on the short arm of chromosome 6 at 6p21.3 (Campbell and Trowsdale, 1993). The human MHC is divided into class I, class II and class III regions. The genes of class I and class II encode highly polymorphic cell-surface molecules that bind and present processed antigens in the form of peptides to T-lymphocytes, initiating both cellular and humoral immune responses. The class I molecules, HLA-A, -B, and -C, are found on most nucleated cells. They are cell-surface glycoproteins that bind and present processed peptides derived from endogenously synthesized proteins to CD8+ T-cells. These heterodimers consist of an HLA-encoded &agr;-chain associated with a non-MHC encoded monomorphic polypeptide, &bgr;2-microglobulin (Townsend and Bodmer, 1989, Spencer and Parham, 1996). The class II molecules are encoded in the HLA-D region. These cell-surface glycoproteins consist of HLA-encoded &agr;-, and &bgr;-chains, associated as heterodimers on the cell surface of antigen-presenting cells such as B-cells and macrophages. Class II molecules serve as receptors for processed peptides. However, these peptides are derived predominantly from membrane and extracellular proteins and are presented to CD4+ T-cells. The HLA-D region contains several class II genes and has three main subregions: HLA-DR, -DQ, and -DP. Both the HLA-DQ and -DP regions contain one functional gene for each of their &agr;- and &bgr;-chains. The HLA-DR subregion contains one functional gene for the &agr;-chain; the number of functional genes for the &bgr;-chain varies from one to two according to the haplotype (Andersson et al., 1987; Apple and Erlich, 1996).
[0003] A variety of techniques are currently used to detect HLA polymorphism, including serological, biochemical, T-cell recognition and, most recently, molecular biological methods. Serology remains the mainstay method for HLA typing—especially for class I—for many routine histocompatibility laboratories. The micro-lymphocytotoxicity assay (Kissmeyer et al., 1969; Terasaki and McClelland, 1964) is the standard approach: viable peripheral blood mononuclear cells (class I) or separate B-cells (class II) are mixed with antisera (polyclonal or monoclonal) of known HLA specificity.
[0004] Detection of polymorphism can be achieved by looking at the different amino acid composition of HLA molecules through biochemical techniques such as one-dimensional isoelectric focusing (IEF; Yang, 1987). This method relies on amino acid substitutions contributing to changes in charge of the HLA molecule.
[0005] Another HLA typing method is the mixed lymphocyte reaction (MLR). Concurrent to observations being made using HLA-specific antisera, it was noted that lymphocytes from two unrelated sources, when mixed in culture, would proliferate (Hirschorn et al., 1963).
[0006] Analysis of HLA specificities from DNA provided a new approach to defining their polymorphic differences. Rather than looking at differences in the expressed molecule, polymorphism is characterized at the nucleotide level.
[0007] An important and powerful development in the field of molecular biology has been the polymerase chain reaction (PCR, Mullis et al., 1986; Mullis and Faloona, 1987). In tissue typing, PCR is used to amplify the polymorphic regions of HLA genes. This HLA PCR product can then be analysed for its polymorphic differences, to establish the tissue type. A number of such approaches have been developed, including hetero duplex analysis of PCR products (Clay et al., 1994), single-stranded conformational polymorphism analysis of the PCR product (PCR-SSCP; Yoshida et al., 1992), sequence-based typing (SBT; Santamaria et al., 1992 and 1993), the use of sequence specific primers in PCR reaction (PCR-SSP; Olerup and Zetterquist, 1991), the use of PCR in combination with sequence-specific oligonucleotide probing (PCR-SSOP; Saiki et al., 1986) or probing by reverse dot-blot (Saiki et al., 1989). These approaches, used singly or in combination, have all been applied as DNA-based methods for tissue-typing of class I and class II HLA specificities.
[0008] For class I alleles, hypervariable regions are found at different degrees in both exon 2 and exon 3, which encode the peptide binding groove of the class I molecule. Polymorphism within class II is contained mainly within defined hypervariable regions in exon 2. These polymorphisms make differentiation between alleles achievable through hybridization with relevant probes.
AIMS OF THE INVENTION[0009] It is an aim of the present invention to provide a method for typing of the alleles HLA-DRB1*0820, HLA-DRB1*04new, HLA-DRB4*01new, HLA-B*3913, HLA-B*1406 and/or HLA-B*51new.
[0010] It is a more specific aim of the present invention to provide a method for typing of said alleles, with said method comprising an amplification step and a hybridization step.
[0011] It is also an aim of the present invention to provide primers for said amplification step.
[0012] It is also an aim of the present invention to provide probes for said hybridization step.
[0013] It is also an aim of the present invention to provide a diagnostic kit enabling said method for typing.
[0014] It is another aim of the present invention to provide a method for detection of the protein fragments encode by the HLA-DRB1*0820, HLA-DRB1*04new, HLA-DRB4*01new, HLA-B*3913, HLA-B*1406 and/or HLA-B*51new genes.
[0015] It is another aim of the present invention to provide an antiserum or a ligand for use in the detection of said protein fragments.
[0016] It is another aim of the present invention to provide a diagnostic kit for the detection of said protein fragment.
DETAILED DESCRIPTION OF THE INVENTION[0017] The present invention discloses the sequence of exon 2 of the HLA allele DRB1*0820. This sequence is identified by SEQ ID NO 1 and is shown below. 1 5 10 15 20 (47) CA CGT TTC TTG GAG TAC TCT ACG TCT GAG TGT CAT TTC TTC AAT GGG (SEQ ID NO 1) 25 30 35 (92) ACG GAG CGG GTG CGG TTC CTG GAC AGA TAC TTC TAT AAC CAA GAG 40 45 50 (137) GAG TAC GTG CGC TTC GAC AGC GAG GTG GGG GAG TAG CGG GCG GTG 55 60 65 (182) ACG GAG CTG GGG CGG CCT GAT GCC GAG TAG TGG AAC AGC CAG AAG 70 75 80 (227) GAG TTC GTG GAA GAG AGG CGG GCC CTG GTG GAC ACC TAC TGC AGA 85 90 GAG AAG TAC GGG GTT GTG GAG AGC TTC AGA GTG GAG GGG CGA
[0018] The sequence is shown from 5′ to 3′ and runs from codon 5 to codon 94 of exon 2. The numbering of the codons is indicated. The nucleotide positions are indicated between brackets. This sequence has been submitted to the EMBL database and was assigned the accession number AJ000927. The allele DRB1*0820 is a novel allele that has not been previously described.
[0019] The present invention also discloses the sequence of exon 2 of the HLA allele DRB1*04new. This sequence is identified by SEQ ID NO 50 and is shown below. 2 6 10 15 20 (43) T TTC TTG GAG CAG GTT AAA CCT GAG TGT CAT TTC TTC AAC GGG (SEQ ID NO 50) 25 30 35 (88) ACG GAG CGG GTG GGG TTC CTG GAC AGA TAG TTC TAT CAC CAA GAG 40 45 50 (133) GAG TAC GTG CGC TTG GAC AGC GAC GTG GGG GAG TAG CGG GCG GTG 55 60 65 (178) ACG GAG CTG GGG CGG CCT GAT GCC GAG TAC TGG AAC AGC GAG AAG 70 75 80 (223) GAG CTG GTG GAG GAG AAG GGG CCC GCG GTG GAG ACC TAC TGG AGA 85 GAG AAG TAG GGG GTT GGT GA
[0020] The sequence is shown from 5′ to 3′ and runs from codon 6 to codon 87 of exon 2. The numbering of the codons is indicated. The nucleotide positions are indicated between brackets.
[0021] This sequence has been submitted to the EMBL database and was assigned the accession number AJ133492. The allele DRB1*04new is a novel allele that has not been previously described.
[0022] The present invention also discloses the sequence of exon 2 of the HLA allele DRB4*01new. This sequence is identified by SEQ ID NO 67 and is shown below. 3 5 10 15 20 (47) CA GGT TTG TTG GAG CAG GCT AAG TGT GAG TGT CAT TTG GTG AAT GGG (SEQ ID NO 67) 25 30 35 (92) ACG GAG GGA GTG TGG AAC CTG ATC AGA TAC ATC TAT AAC CAA GAG 40 45 50 (137) GAG TAC GGG GGG TAC AAC AGT GAT CTG GGG GAG TAG GAG GGG GTG 55 60 65 (182) AGG GAG GTG GGG GGG CCT GAC GCT GAG TAG TGG AAC AGG GAG AAG 70 75 80 (227) GAG CTG CTG GAG CGG AGG CGG GCC GAG GTG GAG ACC TAG TGC AGA 85 90 95 (270) TAG AAG TAG GGG GTT GTG GAG AGC TTC AGA GTG GAG CGG GGA G
[0023] The sequence is shown from 5′ to 3′ and runs from codon 5 to codon 95 of exon 2. The numbering of the codons is indicated. The nucleotide positions are indicated between brackets. This sequence has been submitted to the EMBL database and was assigned the accession number AJ131789. The allele DRB4*01new is a novel allele that has not been previously described.
[0024] Having knowledge of this sequence information, the skilled man will be able to devise methods that enable typing of said allele. The present invention thus relates to a method for typing of the alleles HLA-DRB1*0820, HLA-DRB1*04new and/or HLA-DRB4*01new in a sample.
[0025] According to a preferred embodiment, the present invention relates to a method for typing of the alleles HLA-DRB1*0820, HLA-DRB1*04new and/or HLA-DRB4*01new in a sample, with said method comprising:
[0026] i) amplifying a fragment comprising all or part of exon 2 of said allele using at least one suitable pair of primers,
[0027] ii) hybridizing the amplified product of step i) to a set of probes, with the probes of said set specifically hybridizing to target regions comprising one or more polymorphic nucleotides in exon 2 of said allele,
[0028] iii) determining from the result of step ii) the presence or absence of the alleles HLA-DRB1*0820, HLA-DRB1*04new and/or HLA-DRB4*01new in the sample.
[0029] The primers used in this method may be generic primers, i.e. primers that hybridize to target regions that are conserved, at least towards their 3′-end, amongst all members of a group of alleles (e.g. the DPB group or the DQB group or the DRB group) and thus will lead to amplification of all alleles within this group. Alternatively the primers may be subgroup-specific, i.e. primers that hybridize to target sequences that are only present in a subgroup of alleles. Such subgroup-specific primers can be used separately, or more than one 5′-primer or more than one 3′-end primer can be used together in a mix. Such a mix is sometimes called a multiplex primer. Different types of primers may be used in combination, e.g. a multiplex 5′-primer may be used with a generic 3′-primer, etc.
[0030] According to a more preferred embodiment, the present invention relates to a method as defined above, further characterized in that the pimers used for the amplification of exon 2 of DRB1*0820, HLA-DRB1*04new and/or HLA-DRB4*01new are chosen from Table 1. 4 TABLE 1 Primers for amplification of exon2 of the HLA-allele DRB1*0820, the HLA-allele DRB1*04new and/or the HLA-allele DRB4*01new. Primer Position1 and sequence SEQ ID NO DRBp5′ gen intron-GATCCTTCGTGTCCCCACAGCACG-6 SEQ ID NO 3 tl,43 DRBp5′ intron intron-ACCGGATCCTTCGTGTCCCCACAG-5 SEQ ID NO 53 DRBp5′ DR3, 8, intron-CCCCACAGCACGTTTCTTGGAGTACTC-11 SEQ ID NO 4 11, 12, 13, 14 DRBp5′ DR1, 7 intron-TGTCCCCACAG CA CGT TTC TTG TG-9 SEQ ID NO 5 DRBp5′ DR4 6-T TTC TTG GAG GAG GTT AAA C-13 SEQ ID NO 6 DRBp5′ DR4 5-A CGT TTG TTG GAG GAG GTT AAA C-13 SEQ ID NO 52 DRBp5′ DR9 5-CA CGT TTC TTG AAG GAG GAT AAG TT-13 SEQ ID NO 7 DRBp5′ DR10 intron-CACAG CA CGT TTC TTG GAG G-10 SEQ ID NO 8 DRBp5′ DR15, 16 8-CTG TGG GAG CCT AAG AGG-13 SEQ ID NO 9 DRB4p5′ 9-TAAGTGTGAGTCTGATTTG-17 SEQ ID NO 54 DRBp3′ gen 94-TCGCCGCTGCACTGTGAAGCTC-87 SEQ ID NO 10 DRBp3′ DRB1 intron-ATTGGGGGGCGGCGCT-intron SEQ ID NO 11 DRB3′ cod86V 92-CTGCACTGTCAAGCTGTCCA-86 SEQ ID NO 12 DRBp3′ intron intron-CCGGGGGTCCACCATGCTCAC-95 SEQ ID NO 107 1The numbers before and after the sequences indicate the codons where the 5′-ends and the 3′-ends of the primers are located. “Intron” means that the 5′-end and/or the 3′-end is/are located in an intron.
[0031] SEQ ID NO 3 and SEQ ID NO 53 are generic primers that have a target region covering the junction of intron 1 and exon 2. This target region is conserved amongst all DRB alleles (DRB1, DRB3, DRB4 and DRB5). SEQ ID NOs 4 to 9 and SEQ ID NOs 4, 5, 52, 7, 8, 9 constitute multiplex primer mixes, which hybridize to the subclasses DR1, DR3, DR4, DR7, DR8, DR9, DR10, DR11, DR12, DR13, DR14, DR15 and DR16. Together these subclasses constitute the group of DRB1 alleles. SEQ ID NO 4 is the only member of these primer mixes that specifically hybridizes to the allele HLA-DRB1 *0820. SEQ ID NOs 6 and 52 are the only members of the primer mixes that specifically hybridize to the allele HLA-DRB1*04new. SEQ ID NO 54 specifically hybridizes to the allele HLA-DRB4. These specific primers can be used separately or in a mix such as described above. SEQ ID NO 10 is a generic primer that has its target region at codon 94 to codon 87 in exon 2. This target region is conserved amongst all DRB alleles. SEQ ID NO 11 is situated in intron 2, and hybridizes to all DRB 1 alleles. The target region of SEQ ID NO 12 is situated at codon 92 to codon 86. Codon 86 is a dimorphic codon that either encodes a Val or a Gly. SEQ ID NO 12 hybrizes to the codon encoding Val. SEQ ID NO 107 is situated in intron 2 and hybridizes to all DRB alleles.
[0032] According to another more preferred embodiment, the present invention relates to a method as defined above, further characterized in that said polymorphic nucleotides have the following positions in SEQ ID NO 1 and SEQ ID NO 67:
[0033] 9, 12, 13, 15, 16, 17, 18, 19, 22, 23, 24, 25, 26, 27, 29, 33, 35, 44, 61, 64, 65, 67, 69, 71, 75, 76, 78, 81, 84, 89, 92, 95, 96, 97, 99, 100, 104, 106, 127, 136, 146, 156, 157, 158, 160, 161, 162; 165, 166, 186, 194, 195, 196, 197, 198, 199, 203, 205, 207, 208, 209, 217, 218, 219, 220, 221, 237, 239, 241, 244, 245, 251, 257; and
[0034] the following positions in SEQ ID NO 50:
[0035] 5, 8, 9, 11, 12, 13, 14, 15, 18, 19, 20, 21, 22, 23, 25, 29, 31, 40, 57, 60, 61, 63, 65, 67, 71, 72, 74, 77, 80, 85, 88, 91, 92, 93, 95, 96, 100, 102, 123, 132, 142, 152, 153, 154, 156, 157, 158, 161, 162, 182, 190, 191, 192, 193, 194, 195, 199, 201, 203, 204, 205, 213, 214, 215, 216, 217, 233, 235, 237, 240, 241.
[0036] These nucleotides are shown in boldface in the sequences above (SEQ ID NOs 1, 50 and 67).
[0037] According to an even more preferred embodiment, the present invention relates to a method as defined above, further characterized in that said probes that specifically hybridize to a target region comprising one or more polymorphic nucleotides in exon 2 of the allele DRB1*0820, are chosen from Table 2. 5 TABLE 2 Oligonucleotide probes that can be used for typing of the HLA-allele DRB1*0820. Ref. No Position1 and sequence SEQ ID NO 9 9-G TAC TCT ACG TCT GAG TG-15 SEQ ID NO 13 26 54-G CCT GAT GCC GAG TAC TGG-61 SEQ ID NO 14 25 64-AG AAG GAC TTC CTG GAA GA-70 SEQ ID NO 15 21 69-A GCC AGG CGG GCC CTG GTG GA- SEQ ID NO 16 76 44 84-GGG GTT GTG GAG AGC-88 SEQ ID NO 17 17-TTC TTC AAT GGG ACG GAG-22 SEQ ID NO 18 26-TTC CTG GAC AGA TAG TTC-31 SEQ ID NO 19 34-CAA GAG GAG TAG GTG CGC-39 SEQ ID NO 20 45-GGG GAG TAG CGG GCG GTG-50 SEQ ID NO 21 1The sequences are given from 5′ to 3′. The numbers before and after the sequences indicate the codons where the 5′-ends and the 3′-ends of the probes are located.
[0038] According to another even more preferred embodiment, the present invention relates to a method as defined above, further characterized in that said probes that specifically hybridize to a target region comprising one or more polymorphic nucleotides in exon 2 of the allele DRB1*04new, are chosen from Table 3. 6 TABLE 3 Oligonucleotide probes that can be used for typing of the HLA-allele DRB1*04new Ref. No Position1 and sequence SEQ ID NO 15 70-CAG AAG CGG GCC GCG-74 SEQ ID NO 55 24 32-AT CAC CAA GAG GAG TAC GTG-38 SEQ ID NO 56 27 81-CAC AAC TAC GGG GTT GGT GA-87 SEQ ID NO 57 36 55-G CCT GAT GCC GAG TAC TGG-61 SEQ ID NO 58 49 73-GCC GCG GTG GAC AGC-77 SEQ ID NO 59 63 63-C CAG AAG GAC CTC CTG GA-69 SEQ ID NO 60 73 28-C AGA TAC TTC TAT CAC CAA GA- SEQ ID NO 61 35 1The sequences are given from 5′ to 3′. The numbers before and after the sequences indicate the codons where the 5′-ends and the 3′-ends of the probes are located.
[0039] According to another even more preferred embodiment, the present invention relates to a method as defined above, further characterized in that said probes that specifically hybridize to a target region comprising one or more polymorphic nucleotides in exon 2 of the allele DRB4*01new, are chosen from Table 4. 7 TABLE 4 Oligonucleotide probes that can be used for typing of the HLA-allele DRB4*04new. Ref. No Position1 and sequence SEQ ID NO 15 72-GG GCC GAG GTG GAC A-77 SEQ ID NO 62 36 63-C CAG AAG GAC CTC CTG GA-69 SEQ ID NO 63 44 84-GGG GTT GTG GAG AGC-88 SEQ ID NO 64 60 35-GAG GAG TAC GCG CGC T-40 SEQ ID NO 65 62 22-GAG CGA GTG TGG AAC C-27 SEQ ID NO 66 1The sequences are given from 5′ to 3′. The numbers before and after the sequences indicate the codons where the 5′-ends and the 3′-ends of the probes are located.
[0040] These probes hybridize to target regions comprising polymorphic nucleotides in exon 2. The set of probes with SEQ ID NOs 13 to SEQ ID NO 17 yield a unique hybridization pattern for the allele DRB1*0820, that allows discrimination of this allele from all other DRB1 alleles at the allelic level. The set of probes with SEQ ID NO 55 to SEQ ID NO 61 yield a unique hybridization pattern for the allele DRB1*04new, that allows discrimination of this allele from all other DRB1 alleles at the allelic level. The set of probes with SEQ ID NO 62 to SEQ ID NO 66 yield a unique hybridization pattern for the allele DRB4*01new, that allows discrimination of this allele from all other DRB4 alleles at the allelic level. At present, 215 different DRB1 alleles and 8 different DRB4 alleles have been described (http://www.ebi.ac.uk/imgt/hla/). The probes with SEQ ID NOs 13 to 17 and 55 to 66 are part of the DRB decoder kit (2nd generation) of Innogenetics NV (Ghent, Belgium), which comprises 62 probes. SEQ ID NOs 13 to 17 constitute a subgroup of probes of this kit that specifically hybridize to the allele DRB1*0820. SEQ ID NOs 55 to 61 constitute a subgroup of probes of this kit that specifically hybridize to the allele DRB1*04new. SEQ ID NOs 62 to 66 constitute a subgroup of probes of this kit that specifically hybridize to the allele DRB4*01new. The probes with SEQ ID NOs 13 to 17 and 55 to 66 have been optimized to function in combination at the same conditions in a LiPA assay (see below).
[0041] The skilled man will recognize that the probes and primers with SEQ ID NOs 3 to 21 and 52 to 66 may be adapted by addition or deletion of one or more nucleotides at their extremities. Such adaptations may be required, for instance, if the conditions of amplification or hybridization are changed, or if the amplified material is RNA instead of DNA, as is the case in the NASBA system. Different techniques can be applied to perform the methods of the present invention. These techniques may comprise immobilizing the HLA polynucleic acids, possibly after amplification, on a solid support and performing hybridization with labelled oligonucleotide probes. Alternatively, the probes may be immobilized on a solid support and hybridization may be performed with labelled HLA polynucleic acids, possibly after amplification. This technique is called reverse hybridization. A convenient reverse hybridization technique is the line probe assay (LiPA). This assay uses oligonucleotide probes immobilized as parallel lines on a solid support strip (Stuyver et al., 1993). It is to be understood that any other technique for detection of the above-mentioned HLA allele is also covered by the present invention.
[0042] The present invention also relates to any primer or any probe as indicated above, for use in a method for typing of the alleles HLA-DRB1*0820, HLA DRB1*04new and/or HLA-DRB4*01new. The invention further relates to an isolated polynucleic acid, defined by SEQ ID NOs 1, 50 and 67, corresponding to exon 2 of the allele HLA-DRB1 *0820, HLA DRB1*04new and HLA-DRB4*01new, respectively. The invention also relates to any fragment thereof that can be used as a primer or as a probe in a method for typing of said allele.
[0043] Furthermore, having access to the isolated polynucleic acids defined by SEQ ID NO 1, a man skilled in the art will be able to isolate the complete HLA-DRB1*0820 gene from a human genomic library. Having access to the isolated polynucleic acid defined by SEQ ID NO 50, a man skilled in the art will be able to isolate the complete HLA-DRB1*04new gene from a human genomic library. Having access to the isolated polynucleic acid defined by SEQ ID NO 67, a man skilled in the art will be able to isolate the complete HLA-DRB4*01new gene from a human genomic library. This can be done by screening of the library with the polynucleic acid defined by respectively SEQ ID NO 1, SEQ ID NO 50 or SEQ ID NO 67 or suitable fragments thereof as a hybridisation probe. The present invention thus also relates to the complete HLA-DRB1*0820 gene, the complete HLA-DRB1*04new gene and the complete HLA-DRB4*01new gene.
[0044] According to another preferred embodiment, the present invention relates to a diagnostic kit enabling typing of the alleles HLA-DRB1*0820, HLA-DRB1*04new and/or HLA-DRB4*01new, with said kit comprising at least one primer and/or at least one probe as indicated above. Optionally, this kit may also comprise an enzyme and/or reagents enabling the amplification step and/or reagents enabling the hybridization step.
[0045] According to another preferred embodiment, the present invention relates to the protein fragment that is encoded by SEQ ID NO 1. The sequence of this fragment can be obtained by converting the nucleic acid sequence of SEQ ID NO 1 into the corresponding amino acid sequence, whereby the reading frame to be used is as indicated above. The amino acid sequence is shown below as SEQ ID NO 2. 8 (SEQ ID NO 2) R F L E Y S T S E C H F F N G T E R V R F L D R Y F Y N Q E E Y V R F D S D V G E Y R A V T E L G R P D A E Y W N S Q K D F L E D R R A L V D T Y C R H N Y G V V E S F T V Q R R
[0046] According to another preferred embodiment, the present invention relates to the protein fragment that is encoded by SEQ ID NO 50. The sequence of this fragment can be obtained by converting the nucleic acid sequence of SEQ ID NO 50 into the corresponding amino acid sequence, whereby the reading frame to be used is as indicated above. The amino acid sequence is shown below as SEQ ID NO 51. 9 (SEQ ID NO 51) F L E Q V K P E C H F F N G T E R V R F L D R Y F Y H Q E E Y V R F D S D V G E Y R A V T E L G R P D A E Y W N S Q K D L L E Q K R A A V D T Y C R H N Y G V G
[0047] According to another preferred embodiment, the present invention thus also relates to a method for detection of the protein fragments identified as SEQ ID NO 2 and/or SEQ ID NO 51 in a sample. Said method may be one of the well-known serological methods mentioned above (Terasaki and McClelland, 1964, Kissmeyer et al., 1969).
[0048] In accordance the present invention also relates to an antiserum or a ligand binding to the protein fragment according to the invention. The term “a ligand” refers to any molecule able to bind the protein fragment of the present invention. The latter term specifically refers to polyclonal and/or monoclonal antibodies specifically raised (by any method known in the art) against the protein fragment of the present invention and also encompasses any antibody-like, and other, constructs as described in detail in WO 98/58965 to Lorré et al.
[0049] The present invention further relates to a kit for the detection of one or more of the protein fragments of the invention, comprising at least an antiserum or a ligand as described above.
[0050] The present invention also discloses the sequence of exon 2 and of exon 3 of the HLA allele B*3913. These sequences are identified by SEQ ID NOs 22 and 23 and are shown below. 10 10 20 30 40 50 60 GCTCCCACTC CATGAGGTAT TTCTACACCT CCGTGTCCCG GCCCGGCCGC GGGGAGCCCG (SEQ ID NO 22) 70 80 90 100 110 120 GCTTCATCTC AGTGGGCTAC GTGGACGACA CGCAGTTCGT GAGGTTCGAC AGCGACGCCG 130 140 150 160 170 180 CGAGTCCGAG AGAGGAGCCG CGGGCGCCGT GGATAGAGCA GGAGGGGCCG GAGTATTGGG 190 200 210 220 230 240 ACCGGGAGAC ACAGATCTCC AAGACCAACA CACAGACTTA CCGAGAGAGC CTGCGGAACC 250 260 270 TGCGCGGCTA GTACAACCAG AGCGAGGCCG exon 2 10 20 30 40 50 60 GGTCTCACAC CCTCCAGAGG ATGTACGGCT GCGACGTGGG GCCGGACGGG CGCCTCCTCC (SEQ ID NO 23) 70 80 90 100 110 120 GCGGGCATAA CCAGTTCGCC TACGACGGCA AGGATTACAT CGCCCTGAAC GAGGACCTGA 130 140 150 160 170 180 GCTCCTGGAC CGCGGCGGAC ACCGCGGCTC AGATCACCCA GCGCAAGTGG GAGGCGGCCC 190 200 210 220 230 240 GTGTGGCGGA GCAGCTGAGA ACCTACCTGG AGGGCACGTG CGTGGAGTGG CTCCGCAGAT 250 260 270 ACCTGGAGAA CGGGAAGGAG ACGCTGCAGC GCGCGG exon 3
[0051] These sequences are shown from 5′ to 3′. These sequences have been submitted to the EMBL database and were assigned the accession number AJ223282. The allele HLA-B*3913 is a novel allele that has not been previously described.
[0052] The present invention also discloses the sequence of exon 2 and of exon 3 of the HLA allele B*1406. These sequences are identified by SEQ ID NOs 72 and 73 and are shown below. 11 10 20 30 40 50 60 GCTCCCACTC CATGAGGTAT TTCTACACCG CCGTGTCCCG GCCCGGCCGC GGGGAGCCCC (SEQ ID NO 72) 70 80 90 100 110 120 GCTTCATCTC AGTGGGCTAC GTGGACGACA CGCAGTTCGT GAGGTTCGAC AGCGACGCCG 130 140 150 160 170 180 CGAGTCCGAG AGAGGAGCCG CGGGCGCCGT GGATAGAGCA GGAGGGGCCG GAATATTGGG 190 200 210 220 230 240 ACCGGAACAC ACAGATCTGC AAGACCAACA CACAGACTGA CCGAGAGAGC CTGCGGAACC 250 260 270 TGCGCGGCTA CTACAACCAG AGCGAGGCCG exon 2 10 20 30 40 50 60 GGTCTCACAC CCTCCAGAGG ATGTACGGCT GCGACGTGGG GCCGGACGGG CGCCTCCTCC (SEQ ID NO 73) 70 80 90 100 110 120 GCGGGTATAA CCAGTTCGCC TACGACGGCA AGGATTACAT CGCCCTGAAC GAGGACCTGA 130 140 150 160 170 180 GCTCCTGGAC CGCGGCGGAC ACCGCGGCTC AGATCACCCA GCGCAAGTGG GAGGCGGCCC 190 200 210 220 230 240 GTGAGGCGGA GCAGCTGAGA GCCTACCTGG AGGGCACGTG CGTGGAGTGG CTCCGCAGAC 250 260 270 ACCTGGAGAA CGGGAAGGAG ACGCTGCAGC GCGCGG exon 3
[0053] These sequences are shown from 5′ to 3′. These sequences have been submitted to the EMBL database and were assigned the accession numbers AJ131193 for exon 2 and AJ131194 for exon 3. The allele HLA-B*1406 is a novel allele that has not been previously described.
[0054] The present invention also discloses the sequence of exon 2 and of exon 3 of the HLA allele B*51new. These sequences are identified by SEQ ID NOs 74 and 75 and are shown below. 12 10 20 30 40 50 60 GCTCCCACTC CATGAGGTAT TTCTACACCG CCATGTCCCG GCCCGGCCGC GGGGAGCCCC (SEQ ID NO 74) 70 80 90 100 110 120 GCTTCATTGC AGTGGGCTAC GTGGACGACA CCCAGTTCGT GAGGTTCGAC AGCGACGCCG 130 140 150 160 170 180 CGAGTCCGAG GACGGAGCCC CGGGCGCCAT GGATAGAGCA GGAGGGGCCG GAGTATTGGG 190 200 210 220 230 240 ACCGGAACAC ACAGATCTTC AAGACCAACA CACAGACTTA CCGAGAGAAC CTGCGGATCG 250 260 270 CGCTCCGCTA CTACAACCAG AGCGAGGCCG exon 2 10 20 30 40 50 60 GGTCTCACAC TTGGCAGACG ATGTATGGCT GCGACGTGGG GCCGGACGGG CGCCTCCTCC (SEQ ID NO 75) 70 80 90 100 110 120 CCGGGCATAA CCAGTACGCC TACGACGGCA AAGATTACAT CGCCCTGAAC GAGGACCTGA 130 140 150 160 170 180 GCTCCTGGAC CGCGGCGGAC ACCGCGGCTC AGATCACCCA GCGCAAGTGG GAGGCGGCCC 190 200 210 220 230 240 GTGAGGCGGA GCAGCTGAGA GCCTACCTGG AGGGCCTGTG CGTGGAGTGG CTCCGCAGAC 250 260 270 ACCTGGAGAA CGGGAAGGAG TCGCTGCAGC GCGCGG exon3
[0055] These sequences are shown from 5′ to 3′. The allele HLA-B*51new is a novel allele that has not been previously described.
[0056] Having knowledge of this sequence information, the skilled man will be able to devise methods that enable typing of said alleles. The present invention thus relates to a method for typing of the alleles HLA-B*3913, HLA-B*1406 and/or HLA-B*51new in a sample.
[0057] According to a preferred embodiment, the present invention relates to a method for typing of the alleles HLA-B*3913, HLA-B*1406 and/or HLA-B*51new in a sample, with said method comprising:
[0058] i) amplifying a fragment of said allele comprising all or part of exon 2 and/or all or part of exon 3 of said allele using at least one suitable pair of primers;
[0059] ii) hybridizing the amplification product of step i) to at least one probe that specifically hybridizes to a target region comprising one or more polymorphic nucleotides in exon 2 or in exon 3 of said allele;
[0060] iii) determining from the result of step ii) the presence or absence of the allele HLA-B*3913, HLA-B*1406 and/or HLA-B*51new in the sample.
[0061] The primers used in this method may be generic primers, i.e. primers that hybridize to target regions that are conserved, at least towards their 3′-end, amongst all alleles of a given locus (e.g. the HLA-A alleles or the HLA-B alleles or the HLA-C alleles) and thus will lead to amplification of all alleles of this locus. Alternatively the primers may be subgroup-specific, i.e. primers that hybridize to target sequences that are only present in a subgroup of alleles. These subgroup-specific primers can be used separately, or more than one 5′-primer or more than one 3′-end primer can be used together in a mix. Such a mix is sometimes called a multiplex primer. Different types of primers may be used in combination, e.g. a multiplex 5′-primer may be used with a generic 3′-primer.
[0062] According to a more preferred embodiment, the present invention relates to a method as defined above, further characterized in that the primers used are chosen from Table 5. 13 TABLE 5 Primers for amplification of exon2/exon 3 of the HLA-allele B*3913, the HLA-allele B*1406 and/or the HLA-allele B*51new. Name Sequence SEQ ID NO IBPIN1 GGGAGGAGCGAGGGGACCSCAC SEQ ID NO 26 (S = G OR C) IBPIN3 GGAGGCCATCCCCGGCGACCTAT SEQ ID NO 27
[0063] IBPIN1 is a 5′-primer, located upstream of exon 2 and IBPIN3 is a 3′-primer, located downstream of exon 3. These are generic primers, enabling amplification of a fragment of all 274 HLA-B alleles that are presently known (http://www.ebi.ac.uk/imgt/hla/).
[0064] According to another more preferred embodiment, the present invention relates to a method as defined above, further characterized in that:
[0065] said polymorphic nucleotides have the following positions in exon 2:
[0066] 11, 24, 30, 33, 44, 46, 68, 69, 71, 88, 92, 94, 102, 120, 131, 132, 133, 136, 140, 149, 153, 155, 161, 173, 174, 183, 186, 188, 190, 193, 196, 197, 198, 199, 200, 204, 205, 207, 208, 209, 210, 212, 219, 226, 228, 229, 236, 238, 240, 241, 244, 246, 268, and/or
[0067] said polymorphic nucleotides have the following positions in exon 3:
[0068] 2, 10, 11, 12, 13, 14, 18, 19, 20, 26, 36, 44, 54, 66, 68, 69, 75, 76, 77, 92, 120, 134, 141, 142, 145, 156, 159, 163, 169, 184, 195, 196, 197, 201, 214, 216, 217, 227, 228, 229, 240.
[0069] These polymorphic nucleotides are shown in boldface in the sequences above (SEQ ID NOs 22 and 23, SEQ ID NOs 72 and 73, and SEQ ID NOs 74 and 75).
[0070] According to another even more preferred embodiment, the present invention relates to a method as defined above, further characterized in that said probes that specifically hybridize to a target region comprising one or more polymorphic nucleotides in exon 2 or exon 3 of the allele HLA-B*3913, are chosen from Table 6. 14 TABLE 6 Oligonucleotide probes that can be used for typing of the HLA-allele B *3913. Reference Sequence1 SEQ ID NO 56 GGGACACGGAGGTGTAGA SEQ ID NO 28 92 CCGGCCCGGCCGCGGG SEQ ID NO 29 2 GCTTCATCTCAGTGGGCT SEQ ID NO 30 HC GTTCGTGAGGTTCGACA SEQ ID NO 31 7 GAGTCCGAGAGAGGAGCCG SEQ ID NO 32 87 GGGCGGAGTATTGGGAC SEQ ID NO 33 10 GGACCGGGAGACACAGAT SEQ ID NO 34 13 AGATCTCCAAGACCAAC SEQ ID NO 35 18 CACAGACTTACCGAGAG SEQ ID NO 36 19 ACGGAGAGAGCCTGCGG SEQ ID NO 37 50 CGGAACCTGCGCGGCTA SEQ ID NO 38 26 AGAGGATGTACGGCTGC SEQ ID NO 39 GACGTGGGGCCGGACG SEQ ID NO 40 91 GACGGGCGCCTCCTCCG SEQ ID NO 41 28 TCCTCCGCGGGCATAACCAG SEQ ID NO 42 53 GGGCATAACCAGTTCGCCT SEQ ID NO 43 90 GAGGACCTGAGCTCCTGG SEQ ID NO 44 38 CGGCCCGTGTGGCGGAG SEQ ID NO 45 88 GCAGCTGAGAACCTACCT SEQ ID NO 46 36 TGGAGGGCACGTGCGTG SEQ ID NO 47 CGTGGAGTGGCTCCGC SEQ ID NO 48 TCCGCAGATACCTGGAGA SEQ ID NO 49 1The sequences are given from 5′ to 3′.
[0071] These probes hybridize to target regions comprising polymorphic nucleotides in exon 2 or exon 3 of the allele B*3913. All probes are sense probes, i.e. hybridizing to the anti-sense strand, except the probe with SEQ ID NO 28, which is an anti-sense probe. The probes with SEQ ID NOs 28 to 49 have been optimized to function under the same conditions in a LiPA assay (see below).
[0072] According to another even more preferred embodiment, the present invention relates to a method as defined above, further characterized in that said probes that specifically hybridize to a target region comprising one or more polymorphic nucleotides in exon 2 or exon 3 of the allele HLA-B*1406, are chosen from Table 7. 15 TABLE 7 Oligonucleotide probes that can be used for typing of the HLA-allele B*1406. Reference Sequence1 SEQ ID NO B75 TCTACACCGCCGTGTCC SEQ ID NO 76 B92 CCGGCCCGGCCGCGGG SEQ ID NO 29 B2 GCTTCATCTCAGTGGGCT SEQ ID NO 30 B85 GCGACGCCGCGAGTCCGA SEQ ID NO 77 B7 GAGTCCGAGAGAGGAGCCG SEQ ID NO 32 B98 GGCCGGAATATTGGGAC SEQ ID NO 78 B9 GGACCGGAACACACAG SEQ ID NO 79 B16 ACAGATCTGCAAGACCA SEQ ID NO 80 B17 ACAGACTGACCGAGAG SEQ ID NO 81 B19 ACCGAGAGAGCCTGCGG SEQ ID NO 37 B56 GGAACCTGCGCGGCTACTA SEQ ID NO 82 B26 AGAGGATGTACGGCTG SEQ ID NO 83 B89 CGACGTGGGGCCGGACG SEQ ID NO 84 B91 GACGGGCGCCTCCTCCG SEQ ID NO 41 B63 GGGTATAACCAGTTCGCCT SEQ ID NO 85 B90 AGGACCTGAGCTCCTGG SEQ ID NO 86 B31 GCCCGTGAGGCGGAGC SEQ ID NO 87 B66 GCAGCTGAGAGCCTACCT SEQ ID NO 88 B36 TGGAGGGCACGTGCGTG SEQ ID NO 47 B88 CGTGGAGTGGCTCCGC SEQ ID NO 48 B70 CCGCAGACACCTGGAGA SEQ ID NO 89 1The sequences are given from 5′ to 3′.
[0073] These probes hybridize to target regions comprising polymorphic nucleotides in exon 2 or exon 3 of the allele B*1406. All probes are sense probes, i.e. hybridizing to the anti-sense strand. The probes with SEQ ID NOs 30, 32, 79, 80, 81, 37, 82, 83, 87, 47 and 89 have been optimized to function under the same conditions in a LiPA assay (see below).
[0074] According to another even more preferred embodiment, the present invention relates to a method as defined above, further characterized in that said probes that specifically hybridize to a target region comprising one or more polymorphic nucleotides in exon 2 or exon 3 of the allele HLA-B*51new, are chosen from Table 8. 16 TABLE 8 Oligonucleotide probes that can be used ror typing of the HLA-allele B*51new. Reference Sequence1 SEQ ID NO B3 GCTTCATTGCAGTGGGCT SEQ ID NO 90 B6 CGAGTCCGAGGACGGAGCCCCGG SEQ ID NO 91 B9 GGACCGGAACACACAG SEQ ID NO 79 B14 CAGATCTTCAAGACCAAC SEQ ID NO 92 B18 CACACAGACTTACCGAGAG SEQ ID NO 93 B51 CGAGAGAACCTGCGGATC SEQ ID NO 94 B55 CGGATCGCGCTCGGCTA SEQ ID NO 95 B73 TCTACACCGCCATGTCC SEQ ID NO 96 B85 GCGACGCCGCGAGTCCG SEQ ID NO 97 B87 GGCCGGAGTATTGGGAC SEQ ID NO 33 B23 ACACTTGGCAGACGATG SEQ ID NO 98 B31 GCCCGTGAGGCGGAGC SEQ ID NO 87 B35 GGAGGGCCTGTGCGTG SEQ ID NO 99 B60 CATAACCAGTACGCCTACG SEQ ID NO 100 B70 CCGCAGACACCTGGAGA SEQ ID NO 89 B88 GTGGAGTGGCTCCGC SEQ ID NO 101 B89 CGACGTGGGGCCGGACG SEQ ID NO 84 B90 GAGGACCTGAGCTCCTGG SEQ ID NO 44 B91 GACGGGCGCCTCCTCC SEQ ID NO 102 1The sequences are given from 5′ to 3′.
[0075] These probes hybridize to target regions comprising polymorphic nucleotides in exon 2 or exon 3 of the allele B*51new. All probes are sense probes, i.e. hybridizing to the anti-sense strand, except the probe with SEQ ID NO 97, which is an anti-sense probe. The probes with SEQ ID NOs 90, 91, 79, 92, 93, 98, 87, 99, 94, 95, 100 and 89 have been optimized to function under the same conditions in a LiPA assay (see below).
[0076] The skilled man will recognize that the probes and primers with SEQ ID NOs 26 to 49 and SEQ ID NOs 76 to 102 may be adapted by addition or deletion of one or more nucleotides at their extremities. Such adaptations may be required, for instance, if the conditions of amplification or hybridization are changed, or if the amplified material is RNA instead of DNA, as is the case in the NASBA system.
[0077] Different techniques can be applied to perform the methods of the present invention. These techniques may comprise immobilizing the HLA polynucleic acids, possibly after amplification, on a solid support and performing hybridization with labelled oligonucleotide probes. Alternatively, the probes may be immobilized on a solid support and hybrization may be performed with labelled HLA polynucleic acids, possibly after amplification. This technique is called reverse hybridization. A convenient reverse hybridization technique is the line probe assay (LiPA). This assay uses oligonucleotide probes immobilized as parallel lines on a solid support strip (Stuyver et al., 1993). It is to be understood that any other technique for detection of the above-mentioned HLA allele is also covered by the present invention.
[0078] The present invention also relates to any primer or any probe as indicated above, for use in a method for typing of the alleles HLA-B*3913, HLA-B*1406 and/or HLA-B*51new. The invention further relates to an isolated polynucleic acid, defined by SEQ ID NO 22, corresponding to exon 2 of the allele HLA-B*3913, and to an isolated polynucleic acid, defined by SEQ ID NO 23, corresponding to exon 3 of said allele, or to any fragment of said polynucleic acids that can be used as a primer or as a probe in a method for typing of said allele. The invention also relates to an isolated polynucleic acid, defined by SEQ ID NO 72, corresponding to exon 2 of the allele HLA-B*1406, and to an isolated polynucleic acid, defined by SEQ ID NO 73, corresponding to exon 3 of said allele, or to any fragment of said polynucleic acids that can be used as a primer or as a probe in a method for typing of said allele. The invention also relates to an isolated polynucleic acid, defined by SEQ ID NO 74, corresponding to exon 2 of the allele HLA-B*51new, and to an isolated polynucleic acid, defined by SEQ ID NO 75, corresponding to exon 3 of said allele, or to any fragment of said polynucleic acids that can be used as a primer or as a probe in a method for typing of said allele.
[0079] Furthermore, having access to the isolated polynucleic acids defined by SEQ ID NO 22 and SEQ ID NO 23, a man skilled in the art will be able to isolate the complete HLA-B*3913 gene from a human genomic library. Having access to the isolated polynucleic acids defined by SEQ ID NO 72 and SEQ ID NO 73, a man skilled in the art will be able to isolate the complete HLA-B*1406 gene from a human genomic library. Having access to the isolated polynucleic acids defined by SEQ ID NO 74 and SEQ ID NO 75, a man skilled in the art will be able to isolate the complete HLA-B*51new gene from a human genomic library This can be done by screening of the library with respectively the polynucleic acids defined by SEQ ID NO 22 or 23, the polynucleic acids defined by SEQ ID NO 72 or 73, or the polynucleic acids defined by SEQ ID NO 74 or 75, or by any suitable fragments thereof as a hybridisation probe. The present invention thus also relates to the complete HLA-B*3913, HLA-B*1406 and HLA-B*51new gene.
[0080] According to another preferred embodiment, the present invention relates to a diagnostic kit enabling typing of the alleles HLA-B*3913, HLA-B1406 and/or HLA-B*51new, with said kit comprising at least one primer and/or at least one probe as indicated above. Optionally, this kit may also comprise an enzyme and/or reagents enabling the amplification step and/or reagents enabling the hybridization step.
[0081] According to another preferred embodiment, the present invention relates to the protein fragments that are encoded by SEQ ID NO 22 or SEQ ID NO 23. The sequence of these fragments can be obtained by converting the nucleic acid sequences of SEQ ID NOs 22 or 23 into the corresponding amino acid sequences. The amino acid sequences are shown below as SEQ ID NOs 24 and 25 respectively. 17 (SEQ ID NO 24) GSHSMRYFYT SVSRPGRGEP RFISVGYVDD TQFVRFDSDA ASPREEPRAP WIEQEGPEYW DRETQISKTN TQTYRESLRN LRGYYNQSEA (SEQ ID NO 25) GSHTLQRMYG CDVGPDGRLL RGHNQFAYDG KDYIALNEDL SSWTAADTAA QTTQRKWEAA RVAEQLRTYL EGTCVEWLRR YLENGKETLQ RA
[0082] According to another preferred embodiment, the present invention relates to the protein fragments that are encoded by SEQ ID NO 72 or SEQ ID NO 73. The sequence of these fragments can be obtained by converting the nucleic acid sequences of SEQ ID NOs 72 or 73 into the corresponding amino acid sequences. The amino acid sequences are shown below as SEQ ID NOs 103 and 104, respectively. 18 (SEQ ID NO 103) GSHSMRYSYT AVSRPGRGEP RFISVGYVDD TQFVRFDSDA ASPREEPRAP WIEQEGPEYW DRNTQTCKTN TQTDRESLRN LRGYYNQSEA (SEQ ID NO 104) GSHTLQRNYG CDVGPDGRLL RGYNQFAYDG KDYIALNEDL SSWTAADTAA QITQRKWEAA REAEQLRAYL EGTCVEWLRR HLENGKETLQ PA
[0083] According to another preferred embodiment, the present invention relates to the protein fragments that are encoded by SEQ ID NO 74 or SEQ ID NO 75. The sequence of these fragments can be obtained by converting the nucleic acid sequences of SEQ ID NOs 74 or 75 into the corresponding amino acid sequences. The amino acid sequences are shown below as SEQ ID NOs 105 and 106 respectively. 19 (SEQ ID NO 105) GSHSMRYFYT ANSRPGRGEP RFIAVGYVDD TQFVRFDSDA ASPRTEPRAP WIEQEGPEYW DRNTQTFKTN TQTYRENLRT ALRYYNQSEA (SEQ ID NO 106) GSHTWQTMYG CDVGPDGRLL PGHNQYAYDG KDYIALNEDL SSWTAADTAA QITQRKWEAA REAEQLRAYL EGLGVEWLRR HLENGKESLQ RA
[0084] Accordingly, the present invention also relates to a method for detection of one or more of the protein fragments identified as SEQ ID NOs 24, 25, 103, 104, 105 and/ or 106 in a sample, Said method may be one of the well-known serological methods mentioned above (Terasaki and McClelland, 1964, Kissmeyer et al., 1969).
[0085] In accordance the present invention also relates to an antiserum or a ligand binding to a polypeptide according of the invention. The term “a ligand” refers to any molecule able to bind the polypeptides of the present invention. The latter term specifically refers to polyclonal and/or monoclonal antibodies specifically raised (by any method known in the art) against the polypeptides of the present invention and also encompasses any antibody-like, and other, constructs as described in detail in WO 98/58965 to Lorré et al.
[0086] The present invention further relates to a kit for the detection of a polypeptide of the invention, comprising at least an antiserum or a ligand as described above.
DEFINITIONS[0087] The following definitions and explanations will permit a better understanding of the present invention.
[0088] The target material in the samples to be analysed may either be DNA or RNA, e.g. genomic DNA, messenger RNA or amplified versions thereof. These molecules are in this application also termed “polynucleic acids”.
[0089] Well-known extraction and purification procedures are available for the isolation of RNA or DNA from a sample (e.g. in Sambrook et al.,1989).
[0090] A “polymorphic nucleotide” refers to a nucleotide of the sequence of a given HLA allele that differs from at least one of the nucleotides that are found at the corresponding position in other HLA alleles of the same locus.
[0091] The term “typing” of an HLA-allele refers to identification of the allele, i.e. detection of the allele and discrimination of the allele from other alleles of the same locus.
[0092] The term “probe” according to the present invention refers to a single-stranded oligonucleotide which is designed to specifically hybridize to HLA polynucleic acids. Preferably, the probes of the invention are about 5 to 50 nucleotides long, more preferably from about 10 to 25 nucleotides. Particularly preferred lengths of probes include 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides. The nucleotides as used in the present invention may be ribonu cleotides, deoxyribonucleotides and modified nucleotides such as inosine or nucleotides containing modified groups which do not essentially alter their hybridization characteristics.
[0093] The term “primer” refers to a single stranded oligonucleotide sequence capable of acting as a point of initiation for synthesis of a primer extension product which is complementary to the nucleic acid strand to be copied. The length and the sequence of the primer must be such that they allow to prime the synthesis of the extension products. Preferably the primer is about 5-50 nucleotides long. Specific length and sequence will depend on the complexity of the required DNA or RNA targets, as well as on the conditions at which the primer is used, such as temperature and ionic strength. It is to be understood that the primers of the present invention may be used as probes and vice versa, provided that the experimental conditions are adapted.
[0094] The expression “suitable primer pair” in this invention refers to a pair of primers allowing specific amplification of a HLA polynucleic acid fragment.
[0095] The term “target region” of a probe or a primer according to the present invention is a sequence within the HLA polynucleic acids to which the probe or the primer is completely complementary or partially complementary (i.e. with some degree of mismatch). It is to be understood that the complement of said target sequence is also a suitable target sequence in some cases.
[0096] “Specific hybridization” of a probe to a target region of the HLA polynucleic acids means that said probe forms a duplex with part of this region or with the entire region under the experimental conditions used, and that under those conditions said probe does not form a duplex with other regions of the polynucleic acids present in the sample to be analysed.
[0097] “Specific hybridization” of a primer to a target region of the HLA polynucleic acids means that, during the amplification step, said primer forms a duplex with part of this region or with the entire region under the experimental conditions used, and that under those conditions said primer does not form a duplex with other regions of the polynucleic acids present in the sample to be analysed. It is to be understood that “duplex” as used hereby, means a duplex that will lead to specific amplification.
[0098] “Specific amplification” of a fragment of the HLA polynucleic acids means amplification of the fragment for which the primers were designed, and not of any other fragment of the polynucleic acids present in a sample.
[0099] The fact that amplification primers do not have to match exactly with the corresponding target sequence in the template to warrant proper amplification is amply documented in the literature (Kwok et al., 1990). However, when the primers are not completely complementary to their target sequence, it should be taken into account that the amplified fragments will have the sequence of the primers and not of the target sequence. Primers may be labelled with a label of choice (e.g. biotine). The amplification method used can be either polymerase chain reaction (PCR; Saiki et al., 1988), ligase chain reaction (LCR; Landgren et al., 1988; Wu and Wallace, 1989; Barany, 1991), nucleic acid sequence-based amplification (NASBA; Guatelli et al., 1990; Compton, 1991), transcription-based amplification system (TAS; Kwoh et al., 1989), strand displacement amplification (SDA; Duck, 1990) or amplification by means of Q&bgr; replicase (Lomeli et al., 1989) or any other suitable method to amplify nucleic acid molecules known in the art.
[0100] Probe and primer sequences are represented throughout the specification as single stranded DNA oligonucleotides from the 5′ to the 3′ end. It is obvious to the man skilled in the art that any of the below-specified probes can be used as such, or in their complementary form, or in their RNA form (wherein T is replaced by U).
[0101] The probes according to the invention can be prepared by cloning of recombinant plasmids containing inserts including the corresponding nucleotide sequences, if need be by excision of the latter from the cloned plasmids by use of the adequate nucleases and recovering them, e.g. by fractionation according to molecular weight. The probes according to the present invention can also be synthesized chemically, for instance by the conventional phospho-triester method.
[0102] The oligonucleotides used as primers or probes may also comprise nucleotide analogues such as phosphorothiates (Matsukura et al., 1987), alkylphosphorothiates (Miller et al., 1979) or peptide nucleic acids (Nielsen et al., 1991; Nielsen et al., 1993) or may contain intercalating agents (Asseline et al., 1984). As most other variations or modifications introduced into the original DNA sequences of the invention these variations will necessitate adaptions with respect to the conditions under which the oligonucleotide should be used to obtain the required specificity and sensitivity. However the eventual results of hybridization will be essentially the same as those obtained with the unmodified oligonucleotides. The introduction of these modifications may be advantageous in order to positively influence characteristics such as hybridization kinetics, reversibility of the hybrid-formation, biological stability of the oligonucleotide molecules, etc.
[0103] The term “solid support” can refer to any substrate to which an oligonucleotide probe can be coupled, provided that it retains its hybridization characteristics and provided that the background level of hybridization remains low. Usually the solid substrate will be a microtiter plate, a membrane (e.g. nylon or nitrocellulose) or a microsphere (bead) or a chip. Prior to application to the membrane or fixation it may be convenient to modify the nucleic acid probe in order to facilitate fixation or improve the hybridization efficiency. Such modifications may encompass homopolymer tailing, coupling with different reactive groups such as aliphatic groups, NH2 groups, SH groups, carboxylic groups, or coupling with biotin, haptens or proteins.
[0104] The term “labelled” refers to the use of labelled nucleic acids. Labelling may be carried out by the use of labelled nucleotides incorporated during the polymerase step of the amplification such as illustrated by Saiki et al. (1988) or Bej et al. (1990) or labelled primers, or by any other method known to the person skilled in the art. The nature of the label may be isotopic (32P, 35S, etc.) or non-isotopic (biotin, digoxigenin, etc.).
[0105] The “biological sample” may be for instance blood, mouth swab or any other sample comprising genomic DNA.
[0106] For designing probes with desired characteristics, the following useful guidelines known to the person skilled in the art can be applied.
[0107] Because the extent and specificity of hybridization reactions such as those described herein are affected by a number of factors, manipulation of one or more of those factors will determine the exact sensitivity and specificity of a particular probe, whether perfectly complementary to its target or not. The importance and effect of various assay conditions are explained further herein.
[0108] The stability of the [probe: target] nucleic acid hybrid should be chosen to be compatible with the assay conditions. This may be accomplished by avoiding long AT-rich sequences, by terminating the hybrids with G:C base pairs, and by designing the probe with an appropriate Tm. The beginning and end points of the probe should be chosen so that the length and % GC result in a Tm about 2-10° C. higher than the temperature at which the final assay will be performed. The base composition of the probe is significant because G-C base pairs exhibit greater thermal stability as compared to A-T base pairs due to additional hydrogen bonding. Thus, hybridization involving complementary nucleic acids of higher G-C content will be more stable at higher temperatures.
[0109] Conditions such as ionic strength and incubation temperature under which a probe will be used should also be taken into account when designing a probe. It is known that the degree of hybridization will increase as the ionic strength of the reaction mixture increases, and that the thermal stability of the hybrids will increase with increasing ionic strength. On the other hand, chemical reagents, such as formamide, urea, DMSO and alcohols, which disrupt hydrogen bonds, will increase the stringency of hybridization. Destabilization of the hydrogen bonds by such reagents can greatly reduce the Tm. In general, optimal hybridization for synthetic oligonucleotide probes of about 10-50 bases in length occurs approximately 5° C. below the melting temperature for a given duplex. Incubation at temperatures below the optimum may allow mismatched base sequences to hybridize and can therefore result in reduced specificity.
[0110] It is desirable to have probes which hybridize only under conditions of high stringency. Under high stringency conditions only highly complementary nucleic acid hybrids will form; hybrids without a sufficient degree of complementarity will not form. Accordingly, the stringency of the assay conditions determines the amount of complementarity needed between two nucleic acid strands forming a hybrid. The degree of stringency is chosen such as to maximize the difference in stability between the hybrid formed with the target and the non-target nucleic acid.
[0111] Regions in the target DNA or RNA which are known to form strong internal structures inhibitory to hybridization are less preferred. Likewise, probes with extensive self-complementarity should be avoided. As explained above, hybridization is the association of two single strands of complementary nucleic acids to form a hydrogen bonded double strand. It is implicit that if one of the two strands is wholly or partially involved in a hybrid that it will be less able to participate in formation of a new hybrid. There can be intramolecular and intermolecular hybrids formed within the molecules of one type of probe if there is sufficient self complementarity. Such structures can be avoided through careful probe design. By designing a probe so that a substantial portion of the sequence of interest is single stranded, the rate and extent of hybridization may be greatly increased. Computer programs are available to search for this type of interaction. However, in certain instances, it may not be possible to avoid this type of interaction.
[0112] Standard hybridization and wash conditions are disclosed in the Materials & Methods section of the Examples. Other conditions are for instance 3× SSC (Sodium Saline Citrate), 20% deionized FA (Formamide) at 50° C. Other solutions (SSPE (Sodium saline phosphate EDTA), TMAC (Tetramethyl ammonium Chloride), etc.) and temperatures can also be used provided that the specificity and sensitivity of the probes is maintained. When needed, slight modifications of the probes in length or in sequence have to be carried out to maintain the specificity and sensitivity required under the given circumstances.
[0113] The term “hybridization buffer” means a buffer allowing a hybridization reaction between the probes and the polynucleic acids present in the sample, or the amplified products, under the appropriate stringency conditions.
[0114] The term “wash solution” means a solution enabling washing of the hybrids formed under the appropriate stringency conditions.
FIGURE AND TABLE LEGENDS[0115] FIG. 1 represents a drawing of the result of a LiPA experiment enabling typing of the HLA allele DRB1*0820. The numbers refer to probes of the DRB decoder 2nd generation kit (Innogenetics NV, Ghent, Belgium). The amplification and hybridization steps were performed as described in example 2.
[0116] FIG. 2 represents a drawing of the result of a LiPA experiment enabling typing of the HLA allele DRB1*04new. The numbers refer to probes of the DRB decoder 2nd generation kit (Innogenetics NV, Ghent, Belgium). The amplification and hybridization steps were performed as described in example 4.
[0117] FIG. 3 represents a drawing of the result of a LiPA experiment enabling typing of the HLA allele DRB4*01new. The numbers refer to probes of the DRB decoder 2nd generation kit (Innogenetics NV, Ghent, Belgium). The amplification and hybridization steps were performed as described in example 6.
[0118] FIG. 4 represents a drawing of the result of a LiPA experiment enabling typing of the allele HLA-B*3913. The numbers refer to probes present in the LiPA HLA-B kit (Innogenetics NV, Ghent, Belgium). The experiment was performed as described in example 8.
[0119] FIG. 5 represents a drawing of the result of a LiPA experiment enabling typing of the allele HLA-B*1406. The numbers refer to probes present in the LiPA HLA-B kit (Innogenetics NV, Ghent, Belgium). The experiment was performed as described in example 10.
[0120] FIG. 6 represents a drawing of the result of a LiPA experiment enabling typing of the allele HLA-B*51new. The numbers refer to probes present in the LiPA HLA-B kit (Innogenetics NV, Ghent, Belgium). The experiment was performed as described in example 12.
[0121] Table 1. Primers used for the amplification of exon 2 of the HLA-allele DRB1*0820, the HLA-allele DRB1*04new and/or the HLA-allele DRB4*01new. The numbers before and after the sequences indicate the codons where the 5′-ends and the 3′-ends of the primers are located. “Intron” means that the 5′-end and/or the 3′-end is/are located in an intron.
[0122] Table 2. Oligonucleotide probes that can be used for typing of the HLA-allele DRB1 *0820. The first column shows reference numbers for some of the probes. The sequences are given from 5′ to 3′. The numbers before and after the sequences indicate the codons where the 5′-ends and the 3′-ends of the probes are located.
[0123] Table 3. Oligonucleotide probes that can be used for typing of the HLA-allele DRB1*04new. The first column shows reference numbers for the probes. The sequences are given from 5′ to 3′. The numbers before and after the sequences indicate the codons where the 5′-ends and the 3′-ends of the probes are located.
[0124] Table 4. Oligonucleotide probes that can be used for typing of the HLA-allele DRB4*01new. The first column shows reference numbers for the probes. The sequences are given from 5′ to 3′. The numbers before and after the sequences indicate the codons where the 5′-ends and the 3′-ends of the probes are located.
[0125] Table 5. Primers used for the amplification of exon2/exon 3 of the HLA-allele B*3913, the HLA-allele B*1406 and/or the HLA-allele B*51new.
[0126] Table 6. Oligonucleotide probes that can be used for typing of the HLA-allele B*3913. The first column shows reference numbers for some of the probes. The sequences are given from 5′ to 3′.
[0127] Table 7. Oligonucleotide probes that can be used for typing of the HLA-allele B*1406. The first column shows reference numbers for the probes. The sequences are given from 5′ to 3′.
[0128] Table 8. Oligonucleotide probes that can be used for typing of the HLA-allele B*51new. The first column shows reference numbers for the probes. The sequences are given from 5′ to 3′.
EXAMPLES Example 1 Sequence Determination of the Allele HLA-DRB1*0820[0129] The allele DRB1*0820 was present in a blood sample from a Caucasian donor. The sample was collected by Dr. Bart Vandekerckhove of the Laboratorium Immunohematologie at the Bloedtransfusiecentrum Oost-Vlaanderen in Belgium. Polynucleic acids were prepared from the blood sample by use of the QIAamp Blood Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. An amplification step was performed with the multiplex primer mix consisting of primers with SEQ ID NOs 4 to 9 as the 5′-primer and DRBP3′gen (SEQ ID NO 10) as the 3′-end primer. The PCR reaction cycle was composed of the following steps:
[0130] 5 min at 95° C.
[0131] 35 times (30 s at 95° C.; 20 s at 58° C.; 30 s at 72° C.)
[0132] 10 min at 72° C.
[0133] The PCR reaction was carried out in 10 mM Tris.HCl pH 8.3; 50 mM KCl, 1.5 mM MgCl2; 0.001% (w/v) gelatine; 200 &mgr;M dATP, dGTP, dCTP, dTTP (final concentrations) and 20 pmol of each primer and 1 U AmpliTaq (Applied Biosystems, Foster City, Calif., USA). Nucleotide sequence analysis was performed by use of an automated DNA sequencer Model 373A (Applied Biosystems, Foster City, Calif., USA) with fluorescence-labelled dideoxy nucleotides (Prism™ Ready Reaction Dye Terminator Cycle Sequencing Kit; Applied Biosystems, Foster City, Calif., USA). The primers used for the sequencing reaction were the same as for the amplification step. The following sequence, corresponding to exon 2 of the allele DRB1*0820 was obtained: 20 (SEQ ID NO 1) CA CGT TTC TTG GAG TAC TCT ACG TCT GAG TGT CAT TTC TTC AAT GGG ACG GAG CGG GTG CGG TTC CTG GAC AGA TAC TTC TAT AAC CAA GAG GAG TAC GTG CGC TTC GAC AGC GAC GTG GGG GAG TAC CGG GCG GTG ACG GAG CTG GGG CGG CCT GAT GCC GAG TAC TGG AAC AGC CAG AAG GAC TTC CTG GAA GAC AGG CGG GCC CTG GTG GAC ACC TAC TGC AGA CAC AAC TAC GGG GTT GTG GAG AGC TTC ACA GTG CAG CGG CGA
Example 2 Typing of the Allele DRB1*0820[0134] The following method for typing of the allele DRB1*0820 in a sample is based on the LiPA technology (Stuyver et al, 1993). DNA is extracted from a blood sample with the QIAamp Blood Kit, as indicated in example 1. For the amplification step different primer mixes may be used: either a generic primer pair (such as SEQ ID NO 3 and SEQ ID NO 10), or a multiplex primer (such as the mix composed of primers with SEQ ID NO 4 to SEQ ID NO 9) combined with a generic primer (such as SEQ ID NO 10) or a generic primer combined with a primer encompassing the dimorphic codon 86 (such as SEQ ID NO 3 with SEQ ID NO 12). The amplification reaction is carried out in 10 mM Tris.HCl pH 8.3, 50 mM KCl; 1.5 mM MgCl2; 0.001% (w/v) gelatine; 200 &mgr;M dATP, dGTP, dCTP, dTTP (final concentrations) and 20 pmol of each primer and 1 U AmpliTaq (Applied Biosystems, Foster City, Calif., USA). The PCR reaction is composed of 1 step of 5 min at 95° C., 35 cycles of three steps (30 s at 95° C., 20 s at 58° C., 30 s at 72° C.) and 1 step of 10 min at 72° C. The allele DRB1*0820 can subsequently be typed by a reverse hybridization step to a panel of oligonucleotide probes that are immobilized on a nitro-cellulose strip. A set of probes composed of the probes with SEQ ID NO 13 to SEQ ID NO 17 is sufficient to enable differentiation between the allele DRB1*0820 and any other presently known DRB1 allele at the allelic level. However, in clinical samples two different DRB1 alleles are present, which complicates the analysis and necessitates the use of a larger number of probes. Typing is even further complicated by the fact that also associated DRB alleles exist (DRB3, DRB4, DRB5), which show extensive sequence homology with the DRB1 alleles. In FIG. 1, for instance, an amplification reaction was carried out with the generic primers DRBp5′gen (SEQ ID NO 3) and DRBp3′gen (SEQ ID NO 10), under the conditions outlined above. The amplified product was subjected to a reverse hybridization assay, by use of the DRB decoder 2nd generation kit (Innogenetics NV, Ghent, Belgium) according to the manufacturer's protocol. This kit comprises a panel of 62 oligonucleotide probes, including the probes with SEQ ID NOs 13 to 17 of Table 2. FIG. 1 shows the result of the hybridization assay. The numbers indicate the different probes that are present on the strip. From this result it can be determined that the allele DRB1*0820 is present in the sample, in combination with the previously described alleles DRB1*04012 and the associated alleles DRB4*01011 and DRB4*0103. (These associated alleles have identical sequences in exon 2). The amplified nucleic acid fragment of allele DRB1 *0820 hybridizes to the probes (lines) 9, 21, 25, 26 and 44 on the strip (corresponding to SEQ ID NOs 13, 16, 15, 14 and 17 respectively).
Example 3 Sequence Determination of the Allele HLA-DRB1*04new[0135] The allele DRB1*04new was present in a blood sample from a Caucasian donor. The sample was collected by Dr. P. Jindra of the Hematologicko-onkologicke odd. in Plzen, Czech Republic. Polynucleic acids were prepared from the blood sample by use of the QIAamp Blood Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol.
[0136] In a first experiment, exon 2 was cloned in the pGEMt-vector (Promega, Madison, Wis., USA) after amplification with primer DRBp5′gen (SEQ ID NO 3) as the 5′-primer and DRBp3′gen (SEQ ID NO 10) as the 3′-primer. The PCR reaction cycle was composed of the following steps:
[0137] 5 min at 95° C.
[0138] 35 times (30 s at 95° C., 20 s at 58° C.; 30 s at 72° C.)
[0139] 10 min at 72° C.
[0140] The PCR reaction was carried out in 10 mM Tris.HCl pH 8.3; 50 mM KCl; 1.5 mM MgCl2; 0.001% (w/v) gelatine; 200 &mgr;M dATP, dGTP, dCTP, dTTP (final concentrations) and 20 pmol of each primer and 1 U AmpliTaq (Applied Biosystems, Foster City, Calif., USA). Nucleotide sequence analysis was performed by use of an automated DNA sequencer Model 373A (Applied Biosystems, Foster City, Calif., USA) with fluorescence-labelled dideoxy nucleotides (Prism™ Ready Reaction Dye Terminator Cycle Sequencing Kit; Applied Biosystems, Foster City, Calif., USA). The primers used for the sequencing reaction were the SP6 and T7 primers provide by Eurogentec (Seraing, Belgium). The following sequence, corresponding to exon 2 of the allele DRB1*04new was obtained: 21 (SEQ ID NO 68) G ATC CTT CGT GTC CCC ACA GCA CGT TTC TTG GAG CAG GTT AAA CCT GAG TGT CAT TTC TTC AAC GGG ACG GAG CGG GTG CGG TTC CTG GAC AGA TAC TTC TAT CAC CAA GAG GAG TAC GTG CGC TTC GAC AGC GAC GTG GGG GAG TAC CGG GCG GTG ACG GAG CTG GGG CGG CCT GAT GCC GAG TAC TGG AAC AGC CAG AAG GAC CTC CTG GAG CAG AAG CGG GCC GCG GTG GAC ACC TAC TGC AGA CAC AAC TAC GGG GTT GGT GAG AGC TTC ACA GTG CAG CGG CGA
[0141] The position of the generic primers used for the amplification of exon 2 is shown in bold.
[0142] In a second experiment, exon 2 was amplified with primer DRBp5′DR4 (SEQ ID NO 52) as the 5′-primer and DRBp3′gen (SEQ ID NO 10) as the 3′-primer. The PCR reaction cycle was composed of the following steps:
[0143] 5 min at 95° C.
[0144] 35 times (30 s at 95° C.; 20 s at 58° C.; 30 s at 72° C.)
[0145] 10 min at 72° C.
[0146] The PCR reaction was carried out in 10 mM Tris.HCl pH 8.3; 50 mM KCl; 1.5 mM MgCl2; 0.001% (w/v) gelatine, 200 &mgr;M dATP, dGTP, dCTP, dTTP (final concentrations) and 20 pmol of each primer and 1 U AmpliTaq (Applied Biosystems, Foster City, Calif., USA). Nucleotide sequence analysis was performed by use of an automated DNA sequencer Model 373A (Applied Biosystems, Foster City, Calif., USA) with fluorescence-labelled dideoxy nucleotides (Prism™ Ready Reaction Dye Terminator Cycle Sequencing Kit; Applied Biosystems, Foster City, Calif., USA). The primers used for the sequencing reaction were the same as for the amplification step. The following sequence, corresponding to exon 2 of the allele DRB1*04new was obtained: 22 (SEQ ID NO 69) A CGT TTC TTG GAG CAG GTT AAA CCT GAG TGT CAT TTC TTC AAC GGG ACG GAG CGG GTG CGG TTC CTG GAC AGA TAC TTC TAT CAC CAA GAG GAG TAC GTG CGC TTC GAC AGC GAC GTG GGG GAG TAC CGG GCG GTG ACG GAG CTG GGG CGG CCT GAT GCC GAG TAC TGG AAC AGC CAG AAG GAC CTC CTG GAG CAG AAG CGG GCC GCG GTG GAC ACC TAC TGC AGA CAC AAC TAC GGG GTT GGT GAG AGC TTC ACA GTG CAG CGG CGA
[0147] The position of the primers used for the amplification of exon 2 is shown in bold.
Example 4 Typing of the Allele DRB1*04new[0148] The following method for typing of the allele DRB1*04new in a sample is based on the LiPA technology (Stuyver et al, 1993). DNA is extracted from a blood sample with the QIAamp Blood Kit, as indicated in example 3. For the amplification step different primer mixes may be used: either a generic primer pair (such as SEQ ID NO 3 and SEQ ID NO 10), or a multiplex primer (such as the mix composed of primers with SEQ ID NO 4 to SEQ ID NO 9 or the mix composed of primers with SEQ ID NOs 4, 5, 52, 7, 8 and 9) combined with a generic primer (such as SEQ ID NO 10) or a generic primer combined with a primer encompassing the dimorphic codon 86 (such as SEQ ID NO 3 with SEQ ID NO 12). The amplification reaction is carried out in 10 mM Tris.HCl pH 8.3; 50 mM KCl; 1.5 mM MgCl2; 0.001% (w/v) gelatine; 200 &mgr;M dATP, dGTP, dCTP, dTTP (final concentrations) and 20 pmol of each primer and 1 U AmpliTaq (Applied Biosystems, Foster City, Calif., USA). The PCR reaction is composed of 1 step of 5 min at 95° C., 35 cycles of three steps (30 s at 95° C., 20 s at 58° C., 30 s at 72° C.) and 1 step of 10 min at 72° C. The allele DRB1*04new can subsequently be typed by a reverse hybridization step to a panel of oligonucleotide probes that are immobilized on a nitro-cellulose strip. A set of probes composed of the probes with SEQ ID NO 55 to SEQ ID NO 61 is sufficient to enable differentiation between the allele DRB1*04new and any other presently known DRB1 allele at the allelic level. However, in clinical samples two different DRB1 alleles are present, which complicates the analysis and necessitates the use of a larger number of probes. Typing is even further complicated by the fact that also associated DRB alleles exist (DRB3, DRB4, DRB5), which show extensive sequence homology with the DRB1 alleles. In FIG. 2, for instance, an amplification reaction was carried out with the generic primers DRBp5′gen (SEQ ID NO 3) and DRBp3′gen (SEQ ID NO 10), under the conditions outlined above. The amplified product was subjected to a reverse hybridization assay, by use of the DRB decoder 2nd generation kit (Innogenetics NV, Ghent, Belgium) according to the manufacturer's protocol. This kit comprises a panel of 62 oligonucleotide probes, including the probes with SEQ ID NOs 55 to 61 of Table 3. FIG. 2 shows the result of the hybridization assay. The numbers indicate the different probes that are present on the strip. From this result it can be determined that the allele DRB1*04new (lines 12, 26, 36, 37, 42, 43, 56) is present in the sample, in combination with the previously described alleles DRB1*1104 (lines 2, 9, 25, 30, 33, 44, 56) and two of the associated alleles DRB4*01011 (lines 15, 36, 41, 44, 60, 62) and DRB3*0202 (lines 6, 26, 36, 43, 60). The amplified nucleic acid fragment of allele DRB1*04new hybridizes to the probes (lines) 12, 26, 36, 37, 42, 43 and 56 on the strip (corresponding to SEQ ID NOs 55, 58, 60, 61, 56, 57 and 59 respectively).
Example 5 Sequence Determination of the Allele HLA-DRB4*01new[0149] The allele DRB4*01new was present in a blood sample from a Caucasian donor. The sample was collected by Dr. Bohuslava Jilkova of the HLA-Laboratory in Hradec Kralove, Czech Republic. Polynucleic acids were prepared from the blood sample by use of the QIAamp Blood Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol.
[0150] In a first experiment, exon 2 was cloned in the pGEMt-vector (Promega, Madison, Wis., USA) after amplification with primer DRBp5′intron (SEQ ID NO 53) as the 5′-primer and DRBp3′intron (SEQ ID NO 107) as the 3′-primer. The PCR reaction cycle was composed of the following steps:
[0151] 5 min at 95° C.
[0152] 35 times (30 s at 95° C.; 20 s at 58° C.; 30 s at 72° C.)
[0153] 10 min at 72° C.
[0154] The PCR reaction was carried out in 10 mM Tris.HCl pH 8.3; 50 mM KCl; 1.5 mM MgCl2; 0.001% (w/v) gelatine; 200 &mgr;M dATP, dGTP, dCTP, dTTP (final concentrations) and 20 pmol of each primer and 1 U AmpliTaq (Applied Biosystems, Foster City, Calif., USA). Nucleotide sequence analysis was performed by use of an automated DNA sequencer Model 373A (Applied Biosystems, Foster City, Calif., USA) with fluorescence-labelled dideoxy nucleotides (Prism™ Ready Reaction Dye Terminator Cycle Sequencing Kit; Applied Biosystems, Foster City, Calif., USA). The primers used for the sequencing reaction were the SP6 and T7 primers provide by Eurogentec (Seraing, Belgium). The following sequence, corresponding to exon 2 of the allele DRB4*01new was obtained: 23 AC CGG ATC CTT CGT GTC CCC ACA GCA CGT TTC TTG GAG CAG GCT AAG TGT (SEQ ID NO 70) GAG TGT CAT TTC CTC AAT GGG ACG GAG CGA GTG TGG AAC CTG ATC AGA TAC ATC TAT AAC CAA GAG GAG TAC GCG CGC TAC AAC AGT GAT CTG GGG GAG TAC CAG GCG GTG ACG GAG CTG GGG GGG CCT GAC GCT GAG TAC TGG AAC AGC CAG AAG GAC CTC CTG GAG CGG AGG CGG GCC GAG GTG GAC ACC TAC TGC AGA TAC AAC TAC GGG GTT GTG GAG AGC TTC ACA GTG CAG CGG CGA GGT GAG CAT GGT GGA GGG CGG G
[0155] The position of the primers used for the amplification of exon 2 is shown in bold.
[0156] In a second experiment, exon 2 was amplified with primer DRB4p5′ (SEQ ID NO 54) as the 5′-primer and DRBp3′gen (SEQ ID NO 10) as the 3′-primer. The PCR reaction cycle was composed of the following steps:
[0157] 5 min at 95° C.
[0158] 35 times (30 s at 95° C.; 20 s at 58° C.; 30 s at 72° C.)
[0159] 10 min at 72° C.
[0160] The PCR reaction was carried out in 10 mM Tris.HCl pH 8.3, 50 mM KCl; 1.5 mM MgCl2; 0.001% (w/v) gelatine; 200 &mgr;M dATP, dGTP, dCTP, dTTP (final concentrations) and 20 pmol of each primer and 1 U AmpliTaq (Applied Biosystems, Foster City, Calif., USA). Nucleotide sequence analysis was performed by use of an automated DNA sequencer Model 373A (Applied Biosystems, Foster City, Calif., USA) with fluorescence-labelled dideoxy nucleotides (Prism™ Ready Reaction Dye Terminator Cycle Sequencing Kit; Applied Biosystems, Foster City, Calif., USA). The primers used for the sequencing reaction were the same as for the amplification step. The following sequence, corresponding to exon 2 of the allele DRB1*04new was obtained: 24 TAA GTG TGA GTG TCA TTT CCT CAA TGG GAC GGA GCG AGT GTG GAA CCT GAT (SEQ ID NO 71) CAG ATA CAT CTA TAA CCA AGA GGA GTA CGC GCG CTA CAA CAG TGA TCT GGG GGA GTA CCA GGC GGT GAC GGA GCT GGG GCG GCC TGA CGC TGA GTA CTG GAA CAG CCA GAA GGA CCT CCT GGA GCG GAG GCG GGC CGA GGT GGA CAC CTA CTG CAG ATC AAC TAC GGG GTT GTG GAG AGC TTC ACA GTG CAG CGG CGA
[0161] The position of the primers used for the amplification of exon 2 is shown in bold.
Example 6 Typing of the Allele DRB4*01new[0162] The following method for typing of the allele DRB4*01new in a sample is based on the LiPA technology (Stuyver et al, 1993). DNA is extracted from a blood sample with the QIAamp Blood Kit, as indicated in example 5. For the amplification step different combinations of 5′ and 3′ primers can be used: for example, either a generic primer pair (such as SEQ ID NO 3 and SEQ ID NO 10 or SEQ ID NO 53 and SEQ ID NO 107), or a specific primer, such as SEQ ID NO 54, possibly in a mix composed of other 5′ primers used for the amplification of different DRB alleles (e.g. SEQ ID NO 4 to 9) combined with a generic primer (such as SEQ ID NO 10 or 107) or a generic primer combined with a primer encompassing the dimorphic codon 86 (such as SEQ ID NO 3 with SEQ ID NO 12). The amplification reaction is carried out in 10 mM Tris.HCl pH 8.3; 50 mM KCl; 1.5 mM MgCl2; 0.001% (w/v) gelatine; 200 &mgr;M dATP, dGTP, dCTP, dTTP (final concentrations) and 20 pmol of each primer and 1 U AmpliTaq (Applied Biosystems, Foster City, Calif., USA). The PCR reaction is composed of 1 step of 5 min at 95° C., 35 cycles of three steps (30 s at 95° C., 20 s at 58° C., 30 s at 72° C.) and 1 step of 10 min at 72° C. The allele DR-B4*01new can subsequently be typed by a reverse hybridization step to a panel of oligonucleotide probes that are immobilized on a nitro-cellulose strip. A set of probes composed of the probes with SEQ ID NO 62 to SEQ ID NO 66 is sufficient to enable differentiation between the allele DRB4*01new and any other presently known DRB4 allele at the allelic level. Typing is even further complicated by the fact that also DRB 1 alleles and other associated alleles exist (DRB3, DRB4, DRB5), which show extensive sequence homology with the DRB4 alleles. This complicates the analysis and necessitates the use of a larger number of probes. In FIG. 3, for instance, an amplification reaction was carried out with the generic primers DRBp5′gen (SEQ ID NO 3) and DRBp3′gen (SEQ ID NO 10), under the conditions outlined above. The amplified product was subjected to a reverse hybridization assay, by use of the DRB decoder 2nd generation kit (Innogenetics NV, Ghent, Belgium) according to the manufacturer's protocol. This kit comprises a panel of 62 oligonucleotide probes, including the probes with SEQ ID NOs 62 to 66 of Table 4. FIG. 3 shows the result of the hybridization assay. The numbers indicate the different probes that are present on the strip. From this result it can be determined that the allele DRB4*01new is present in the sample, in combination with the previously described alleles DRB1 *0403 (lines 15, 20, 26, 36, 37, 42, 44), DRB1*1301 (lines 9, 16, 23, 26, 28, 30, 44, 56) and DRB3*0206 (lines 6, 26, 36, 43). The amplified nucleic acid fragment of allele DRB4*01new hybridizes to the probes (lines) 15, 36, 44, 60 and 62 on the strip (corresponding to SEQ ID NOs 62, 63, 64, 65 and 66 respectively).
Example 7 Sequence Determination of the Allele HLA-B*3913[0163] The allele B*3913 was present in a blood sample from a Brazilian Caucasian donor. The sample was collected by Dr. M E Moraes of the Lab de Immunogenética, HSE/INCA, Rio De Janeiro, Brazil. Polynucleic acids were prepared from the blood sample by use of the QIAamp Blood Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. An amplification step was performed with primers IBPIN1 and IBPIN3. The PCR reaction consisted of the following steps:
[0164] 1 min at 96° C.
[0165] 5 times (30 s at 95° C.; 50 s at 64° C.; 50 s at 72° C.)
[0166] 5 times (30 s at 95° C.; 50 s at 62° C.; 50 s at 72° C.)
[0167] 10 times (30 s at 95° C.; 50 s at 60° C.; 50 s at 72° C.)
[0168] 15 times (30 s at 95° C.; 50 s at 55° C.; 50 s at 72° C.)
[0169] 10 min at 72° C.
[0170] The amplification reaction was carried out in 50 mM Tris-HCl pH 9.2, 16 mM (NH4)2SO4, 200 &mgr;M dNTPs, 2.5 U Taq polymerase, 1.5 mM MgCl2, 15 pmole of each primer and 0.1 to 0.5 &mgr;g DNA. Nucleotide sequence analysis was performed by use of an automated DNA sequencer Model 373A (Applied Biosystems, Foster City, Calif., USA) with fluorescence-labelled dideoxy nucleotides (Prism™ Ready Reaction Dye Terminator Cycle Sequencing Kit; Applied Biosystems, Foster City, Calif., USA). The primers used for the sequencing reaction were the same as for the amplification step. The following sequences, corresponding to exon 2 and exon 3 of the allele B*3913 were obtained: 25 GCTCCCACTCCATGAGGTATTTCTACACCTCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGC (SEQ ID NO 22) TTCATCTCAGTGGGCTACGTGGACGACACGCAGTTCGTGAGGTTCGACAGCGACGCCGCGAG TCCGAGAGAGGAGCCGCGGGCGCCGTGGATAGAGCACGAGGGGCCGGAGTATTGGGACCGGG AGACACAGATCTCCAAGACCAACACACAGACTTACCGAGAGAGCCTGCGGAACCTGCGCGGC TACTACAACCAGAGCGAGGCCG exon 2 GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGC (SEQ ID NO 23) GGGCATAACCAGTTCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTC CTGGACCGCGGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGG CGGAGCAGCTGAGAACCTACCTGGAGGGCACGTGCGTGGAGTCGCTCCGCAGATACCTGGAG AACGGGAAGGAGACGCTGCAGCGCGCGG exon 3
Example 8 Typing of the Allele B*3913[0171] The following method, that may be used to type the allele B*3913 in a sample, is based on the LiPA technology (Stuyver et al, 1993). Nucleic acids are extracted from a blood sample with the QIAamp Blood Kit, as indicated in example 7. For the amplification step the primer pair IBPIN1 (SEQ ID NO 26) and IBPIN3 (SEQ ID NO 27) is used. The PCR reaction is performed under the same conditions as in example 7. The allele BLA-B*3913 can subsequently be typed by a reverse hybridization step to a panel of oligonucleotide probes that are immobilized on a nitro-cellulose strip. For instance, FIG. 4 shows the result of a reverse hybidization assay according to the LiPA technique. After an amplification step as described above, the amplified nucleic acids were hybridized to a panel of 60 probes by use of the LiPA HLA-B kit (Innogenetics NV, Ghent, Belgium) according to the manufacturer's protocol. From the result shown in FIG. 4, it can be derived that the sample contained the allele HLA-B*3913, in combination with the known allele HLA-B*52012 The numbers in FIG. 4 indicate probes that are present on the strip (note that these probes are not the same probes as those in FIGS. 1-3). The amplified nucleic acid fragment of allele HLA-B*3913 hybridizes to the following probes (lines) on the strip: 2 (SEQ ID NO 30), 7 (SEQ ID NO 32), 10 (SEQ ID NO 34), 13 (SEQ ID NO 35), 18 (SEQ ID NO 36), 19 (SEQ ID NO 37), 26 (SEQ ID NO 39), 28 (SEQ ID NO 42), 36 (SEQ ID NO 47), 38 (SEQ ID NO 45), 50 (SEQ ID NO 38), 53 (SEQ ID NO 43) and 56 (SEQ ID NO 28).
Example 9 Sequence Determination of the Allele HLA-B*1406[0172] The allele B*1406 was present in a blood sample from a Belgian Caucasian donor. The sample was collected by Dr. M P Emonds of the Bloodtransfusion Center, Leuven, Belgium. Polynucleic acids were prepared from the blood sample by use of the QIAamp Blood Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. An amplification step was performed with primers IBPIN1 and IBPIN3. The PCR reaction consisted of the following steps:
[0173] 1 min at 96° C.
[0174] 5 times (30 s at 95° C.; 50 s at 64° C.; 50 s at 72° C.)
[0175] 5 times (30 s at 95° C.; 50 s at 62° C.; 50 s at 72° C.)
[0176] 10 times (30 s at 95° C.; 50 s at 60° C.; 50 s at 72° C.)
[0177] 15 times (30 s at 95° C.; 50 s at 55° C.; 50 s at 72° C.)
[0178] 10 min at 72° C.
[0179] The amplification reaction was carried out in 50 mM Tris-HCl pH 9.2, 16 mM (NH4)2SO4, 200 &mgr;M dNTPs, 2.5 U Taq polymerase, 1.5 mM MgCl2, 15 pmole of each primer and 0.1 to 0.5 &mgr;g DNA. Nucleotide sequence analysis was performed by use of an automated DNA sequencer Model 373A (Applied Biosystems, Foster City, Calif., USA) with fluorescence-labelled dideoxy nucleotides (Prism™ Ready Reaction Dye Terminator Cycle Sequencing Kit; Applied Biosystems, Foster City, Calif., USA). The primers used for the sequencing reaction were the same as for the amplification step. The following sequences, corresponding to exon 2 and exon 3 of the allele B*1406 were obtained: 26 GCTCCCACTCCATGAGGTATTTCTACACCGCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGC (SEQ ID NO 72) TTCATCTCAGTGGGCTACGTGGACGACACGCAGTTCGTGAGGTTCGACAGCGACGCCGCGAG TCCGAGAGAGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAATATTGGGACCGGA ACACACAGATCTGCAAGACCAACACACAGACTGACCGAGAGAGCCTGCGGAACCTGCGCGGC TACTACAACCAGAGCGAGGCCG exon 2 GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCGGC (SEQ ID NO 73) GGGTATAACCAGTTCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTC CTGGACCGCGGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGG CGGAGCAGCTGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGACACCTGGAG AACGGGAAGGAGACGCTGCAGCGCGCGG exon 3
Example 10 Typing of the Allele B*1406[0180] The following method, that may be used to type the allele B*1406 in a sample, is based on the LiPA technology (Stuyver et al, 1993). Nucleic acids are extracted from a blood sample with the QIAamp Blood Kit, as indicated in example 9. For the amplification step the primer pair IBPIN1 (SEQ ID NO 26) and IBPIN3 (SEQ ID NO 27) is used. The PCR reaction is performed under the same conditions as in example 9. The allele HLA-B*1406 can subsequently be typed by a reverse hybridization step to a panel of oligonucleotide probes that are immobilized on a nitro-cellulose strip. For instance, FIG. 5 shows the result of a reverse hybidization assay according to the LiPA technique. After an amplification step as described above, the amplified nucleic acids were hybridized to a panel of 60 probes by use of the LiPA HLA-B kit (Innogenetics NV, Ghent, Belgium) according to the manufacturer's protocol. From the result shown in FIG. 5, it can be derived that the sample contained the allele HLA-B*1406. The numbers in FIG. 5 indicate probes that are present on the strip (note that these probes are not the same probes as those in FIGS. 1-3). The amplified nucleic acid fragment of allele HLA-B*1406 hybridizes to the following probes (lines) on the strip: 2 (SEQ ID NO 30), 7 (SEQ ID NO 32), 9 (SEQ ID NO 79), 16 (SEQ ID NO 80), 17 (SEQ ID NO 81), 19 (SEQ ID NO 37), 26 (SEQ ID NO 83), 31 (SEQ ID NO 87), 36 (SEQ ID NO 47), 50 (SEQ ID NO 82) and 55 (SEQ ID NO 89).
Example 11 Sequence Determination of the Allele HLA-B*51new[0181] The allele B*51new was present in a blood sample from a Brazilian Caucasian donor. The sample was collected by Dr. M E Moraes of the Lab de Immunogenética, HSE/INCA, Rio De Janeiro, Brazil. Polynucleic acids were prepared from the blood sample by use of the QIAamp Blood Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. An amplification step was performed with primers IBPIN1 and IBPIN3. The PCR reaction consisted of the following steps:
[0182] 1 min at 96° C.
[0183] 5 times (30 s at 95° C.; 50 s at 64° C.; 50 s at 72° C.)
[0184] 5 times (30 s at 95° C.; 50 s at 62° C.; 50 s at 72° C.)
[0185] 10 times (30 s at 95° C.; 50 s at 60° C.; 50 s at 72° C.)
[0186] 15 times (30 s at 95° C.; 50 s at 55° C.; 50 s at 72° C.)
[0187] 10 min at 72° C.
[0188] The amplification reaction was carried out in 50 mM Tris-HCl pH 9.2, 16 mM (NH4)2SO4, 200 &mgr;M dNTPs, 2.5 U Taq polymerase, 1.5 mM MgCl2, 15 pmole of each primer and 0.1 to 0.5 &mgr;g DNA. Nucleotide sequence analysis was performed by use of an automated DNA sequencer Model 373A (Applied Biosystems, Foster City, Calif., USA) with fluorescence-labelled dideoxy nucleotides (Prism™ Ready Reaction Dye Terminator Cycle Sequencing Kit; Applied Biosystems, Foster City, Calif., USA). The primers used for the sequencing reaction were the same as for the amplification step. The following sequences, corresponding to exon 2 and exon 3 of the allele B*51new were obtained: 27 GCTCCCACTCCATGAGGTATTTCTACACCGCCGTGTGCCGGCGGGGCCGCGGGGAGCCCCGC (SEQ ID NO 74) TTCATCTCAGTGGGCTACGTGGACGAGACGCAGTTCGTGAGGTTCGACAGCGACGCCGCGAG TCCGAGAGAGGAGCCGCGGGGGCCGTGGATAGAGCAGGAGGGGCCGGAATATTGGGACCGGA ACACACAGATCTGCAAGACCAACACACAGACTGACCGAGAGAGCCTGCGGAACCTGCGCGGC TACTACAACCAGAGCGAGGCCG exon 2 GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGC (SEQ ID NO 75) GGGTATAACCAGTTCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTC CTGGACCGCGGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGG CGGAGCAGCTGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGACACCTGGAG AACGGGAAGGAGACGCTGCAGCGCGCGG exon 3
Example 12 Typing of the Allele B*51new[0189] The following method, that may be used to type the allele B*1406 in a sample, is based on the LiPA technology (Stuyver et al, 1993). Nucleic acids are extracted from a blood sample with the QIAamp Blood Kit, as indicated in example 11. For the amplification step the primer pair IBPIN1 (SEQ ID NO 26) and IBPIN3 (SEQ ID NO 27) is used. The PCR reaction is performed under the same conditions as in example 11. The allele HLA-B*51new can subsequently be typed by a reverse hybridization step to a panel of oligonucleotide probes that are immobilized on a nitro-cellulose strip. For instance, FIG. 6 shows the result of a reverse hybidization assay according to the LiPA technique. After an amplification step as described above, the amplified nucleic acids were hybridized to a panel of 60 probes by use of the LiPA HLA-B kit (Innogenetics NV, Ghent, Belgium) according to the manufacturer's protocol. From the result shown in FIG. 6, it can be derived that the sample contained the allele HLA-B*51new, in combination with the known allele HLA-B*1501. The numbers in FIG. 6 indicate probes that are present on the strip (note that these probes are not the same probes as those in FIGS. 1-3). The amplified nucleic acid fragment of allele HLA-B*51new hybridizes to the following probes (lines) on the strip: 3 (SEQ ID NO 90), 6 (SEQ ID NO 91), 9 (SEQ ID NO 79), 14 (SEQ ID NO 92), 18 (SEQ ID NO 93), 23 (SEQ ID NO 98), 31 (SEQ ID NO 87), 35 (SEQ ID NO 99), 46 (SEQ ID NO 94), 49 (SEQ ID NO 95), 52 (SEQ ID NO 100), 55 (SEQ ID NO 89).
REFERENCES[0190] Andersson G, Larhammar D, Widmark E, Servenius B, Peterson P A and Rask L, (1987) Class II genes of the human major histocompatibility complex. Organization and evolutionary relationship of the DRbeta genes. J. Biol. Chem 262:8748-8758.
[0191] Apple R J and Erlich H A (1996) HLA classII genes: structure and diversity. Chapter 5 HLA and MHC: genes, molecules and function. BIOS Scientific Publishers Ltd., Oxford, UK.
[0192] Asseline U, Delarue M, Lancelot G, Toulme F and Thuong N (1984) Nucleic acid-binding molecules with high affinity and base sequence specificity: intercalating agents covalently linked to oligodeoxynucleotides. Proc. Natl. Acad. Sci. USA 81:3297-3301.
[0193] Barany F (1991) The ligase chain reaction in a PCR world. PCR Methods Appl. 1:5-16.
[0194] Bej A, Mahbubani M, Miller R, Di Cesare J, Haff L and Atlas R (1990) Multiplex PCR amplification and immobilized capture probes for detection of bacterial pathogens and indicators in water. Mol. Cell Probes 4:353-365.
[0195] Campbell R D and Trowsdale J (1993) Map of the human MHC. Immunology Today 14:349-352.
[0196] Clay T M, Culpan D, Howell W M, Sage D A, Bradley B A and Bidwell J L (1994) UHG crossmatching. A comparison with PCR-SSO typing in the selection of HLA-DPB-compatible bone marrow donors. Transplantation 58: 200-207.
[0197] Compton J (1991) Nucleic acid sequence-based amplification. Nature 350: 91-92.
[0198] Duck P (1990) Probe amplifier system based on chimeric cycling oligonucleotides. Biotechniques 9: 142-147.
[0199] Guatelli J, Whitfield K, Kwoh D, Barringer K, Richman D and Gengeras T (1990) Isothermal, in vitro amplification of nucleic acids by a multienzyme reaction modeled after retroviral replication. Proc. Natl. Acad. Sci. USA 87: 1874-1878.
[0200] Hirschorn K, Bach F, Kolodny R L and Firschen I L (1963) Immune response and mitotis of human peripheral blood lymphocytes in vitro. Science 142: 1185-1187.
[0201] Kissmeyer N F, Svejgaard A and Hauge M (1969) The HLA system defined with lymphocytoyoxic and platelet antibodies in relation to kidney transplantation. Transplant. Proc. 1: 357-361.
[0202] Kwoh D, Davis G, Whitfield K, Chappelle H, Dimichele L and Gingeras T (1989) Transcription-based amplification system and detection of amplified human immunodeficiency virus type I with a bead-based sandwich hybridization format. Proc. Natl. Acad. Sci. USA 86: 1173-1177.
[0203] Kwok S, Kellogg D, McKinney N, Spasic D, Goda L, Levenson C and Sinisky J (1990) Effects of primer-template mismatches on the polymerase chain reaction: Human immunodeficiency virus type 1 model studies. Nucl. Acids Res. 18: 999-1005.
[0204] Landgren U, Kaiser R, Sanders J and Hood L (1988) A ligase-mediated gene detection technique Science 241:1077-1080.
[0205] Lomeli H, Tyagi S, Pritchard C, Lisardi P and Kramer F (1989) Quantitative assays based on the use of replicatable hybridization probes. Clin. Chem. 35: 1826-1831.
[0206] Matsukura M, Shinozuka K, Zon G, Mitsuya H, Reitz M, Cohen J and Broder S (1987) Phosphorothioate analogs of oligodeoxynucleotides: inhibitors of replication and cytopathic effects of human immunodeficiency virus. Proc. Natl. Acad. Sci. USA 84: 7706-7710.
[0207] Miller P, Yano J, Yano E, Carroll C, Jayaram K and Ts'o P (1979) Nonionic nucleic acid analogues. Synthesis and characterization of dideoxyribonucleoside methylphosphonates. Biochemistry 18: 5134-5143.
[0208] Mullis K, Faloona F, Scharf S, Saiki R, Horn G and Erlich H (1986) Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Gold Spring Harb. Symp. Quant. Biol. 1: 263-273.
[0209] Mullis K B and Faloona F A (1987) Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155: 335-350.
[0210] Nielsen P, Egholm M, Berg R and Buchardt O (1991) Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide. Science 254:1497-1500.
[0211] Nielsen P, Egholm M, Berg R, Buchardt O (1993) Sequence specific inhibition of DNA restriction enzyme cleavage by PNA. Nucleic-Acids-Res. 21:197-200.
[0212] Olerup O and Zetterquist H (1991) HLA-DRB1*01 subtyping by allele-specific PCR amplification: a sensitive, specific and rapid technique. Tissue Antigens 37: 197-204.
[0213] Saiki R K, Bugawan T L, Horn G, T Mullis K B and Erlich H A (1986) Analysis of enzymatically amplified beta-globin and HLA-DQ alpha DNA with allele-specific oligonucleotide probes. Nature 324: 163-166.
[0214] Saiki R K, Gelfand D H, Stoffel S, Scharf S J, Higuchi R, Horn G T, Mullis K B and Erlich H A (1988) Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239: 487-491.
[0215] Saiki R K, Walsh P S, Levenson C H and Erlich H A (1989) Genetic analysis of amplified DNA with immobilizes sequence-specific oligonucleotide probes. Proc. Natl. Acad. Sci. USA 86: 6230-6234.
[0216] Sambrook J, Fritsch E, Maniatis T (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA.
[0217] Santamaria P, Boyce-Jacino M T, Lindstrom A L, Barbosa J J, Faras A J and Rich S S (1992) HLA class II “typing”: direct sequencing of DRB, DQB and DQA genes. Hum. Immunol. 33: 69-81.
[0218] Santamaria P, Lindstrom A L, Boyce J M, Jacino M T, Myster S H, Barbosa J J, Faras A J and Rich S S (1993) HLA class I sequence-based typing. Hum. Immunol. 37: 39-50.
[0219] Spencer W R and Parham P (1996) HLA class I genes: structure and diversity. Chapter 4. HLA and MHC: genes, molecules and function. BIOS Scientific Publishers Ltd., Oxford, UK.
[0220] Stuyver L, Rossau R, Wyseur A, Duhamel M, Vanderborght B, Van Heuverswyn H and Maertens G (1993) Typing of hepatitis C virus isolates and characterization of new subtypes using a line probe assay. J. Gen. Virol. 74: 1093-1102.
[0221] Terasaki P H and McClelland J D (1964) Microdoplet assay of human serum cytotoxins. Nature 204: 998-1007.
[0222] Townsend A and Bodmer H (1989) Antigen recognition by Class I-restricted T lymphocytes. Annu. Rev. Immunol. 7: 601-624.
[0223] Wu D and Wallace B (1989) The ligation amplification reaction (LAR)—amplification of specific DNA sequences using sequential rounds of template-dependent ligation. Genomics 4: 560-569.
[0224] Yang S Y (1987) A standardised method for detection of HLA-A and HLA-B alleles by one-dimensional isoelectric focusing (IEF) gel electrophoresis. Immunobiology of HLA. Histocompatibility testing (ed. B Dupont). Springer-Verlag, New York, USA. pp. 332-335.
[0225] Yoshida M, Kimura A, Numano F and Sasazuki T (1992) Polymerase-chain-reaction-based analysis of polymorphism in the HLA-B gene. Hum. Immunol. 34: 257-266.
Claims
1. A method for determining the presence or absence of an allele selected from the group consisting of HLA-B*3913, HLA-B*1406 and HLA-B*51new in a sample, wherein exon 2 of said alleles is defined by SEQ ID NO: 22, 72 and 74 respectively, and exon 3 of said allclos is defined by SEQ ID NO: 23, 73 and 75 respectively, wherein said method comprises:
- a) obtaining nucleic acids from the sample,
- b) amplifying nucleic acids comprising part or all of exon 2 and/or part or all of exon 3 of said allele obtained from the sample using at least one suitable pair of primers, and
- c) analyzing me amplified nucleic acids for the presence or absence of HLA-B*3913, HLA B*1406 find/or HLA-B*515 respectively.
2. The method according to claim 1, wherein the analysis of the amplified nucleic acids comprises:
- a) hybridizing the amplified nucleic acids to a set of probes which specifically hybridize to target regions within the nucleic adds, which regions comprise one or more polymorphic nucleotides in exon 2 and/or exon 3 of said allele; and
- b) determining the absence or presence of the allele HLA-B*3913, HLA-B*1406 and/or HLA-B*51new.
3. The method according to claim 2, wherein said one or more polymorphic nucleotides has a position within exon 2 selected from the group consisting of nucleoude positions:
- 11, 24, 30, 33, 44, 46, 68, 69, 71, 88, 92, 94, 102, 120, 131, 132, 133, 136, 140, 149, 153, 155, 161, 173, 174, 183, 186, 188, 190, 193, 196, 197, 198, 199, 200, 204, 205, 207, 208, 209, 210, 212, 219, 226, 228, 229, 236, 238, 240, 241, 244, 246 and 268, and/or
- a position within exon 3 selected from the group consisting of nucleotide positions:
- 2, 10, 11, 12, 13, 14, 18, 19, 20, 26, 36, 44, 54, 66, 68, 69, 75, 76, 77, 92, 120, 134, 141, 142, 145, 156, 159, 163, 169, 184, 195, 196, 197, 201, 214, 216, 217, 227, 22S, 229 and 240.
4. The method according to claim 1, wherein said primers comprise a nucleotide sequence selected from the group consisting of SEQ ID NO: 26 and 27.
5. The method according to claim 2, wherein said probes comprise a nucleotide sequence selected from the group consisting of:
- SEQ ID NO: 28-49 for the typing of HLA-B*3913:
- SEQ ID NO 29, 30, 32, 37, 41, 47, 48 and 16-89 for the typing of HLA-B*1406; and
- SEQ ID NO 33, 44, 79, 84, 87 and 89-102 for the typing of HLA-B*51new.
6. An isolated nucleic acid comprising exon 2 and/or exon 3 of the allele HLA-B*3913, HLA-B*1406 or HLA-B*51new.
7. An isolated nucleic acid comprising a sequence selected from the group consisting of: SEQ ID NO: 22, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 23, SEQ ID NO: 73 and SEQ ID NO: 75.
8. A diagnostic kit for the typing of the alleles HLA-B-i-SQIS, HLA.-B+1406 and/or BLA-B*51 comprising the nucleic acid of claim 7.
Type: Application
Filed: Dec 30, 2002
Publication Date: Sep 25, 2003
Applicant: Innogenetics N.V.
Inventors: Ilse De Canck (Antwerpen), Guy Mersch (Gent), Rudi Rossau (Ekeren)
Application Number: 10334488
International Classification: C12Q001/68; C12P019/34;