Detection of genetic polymorphisms
The present invention relates to genetic polymorphism data, compositions and methods for detecting genetic polymorphisms, methods for evaluating drugs using genetic polymorphisms and screening methods for drugs.
Latest Riken Institute of Physical and Chemical Research Patents:
[0001] The present invention claims priority to Japanese Patent Application Ser. Nos. 2000-399,443 filed Dec. 27, 2000, 2001-135,256 filed May 2, 2001, 2001-256,862 filed Aug. 27, 2001, and 2001-(awaiting serial number) filed December 2001, each of which was filed with the Commissioner of the Japanese Patent Office. Right of priority under 35 U.S.C. 119 is claimed from these Japanese patent applications under the Paris Convention for the Protection of Industrial Property. The present invention also claims priority to PCT application (awaiting serial number) filed Dec. 27, 2001 in the Japanese receiving office. Each of these applications are herein incorporated by reference in their entireties.
FIELD OF THE INVENTION[0002] The present invention relates to genetic polymorphism data, compositions and methods for detecting genetic polymorphisms, methods for evaluating drugs using genetic polymorphisms and screening methods for drugs.
BACKGROUND[0003] Human beings come in all shapes and sizes, and over three billion genetic codes are located in somewhat different sites in each human being. Individual DNA sequence variations in the human genome are known to directly cause specific diseases or conditions, to predispose certain individuals to specific diseases or conditions, and to affect responses of individuals to treatments such as drugs. Such variations also modulate the severity or progression of many diseases. Additionally, DNA sequences vary between populations. Therefore, determining DNA sequence variations in the human genome is useful for making accurate diagnoses, for finding suitable therapies, and for understanding the relationship between genome variations and environmental factors in the pathogenesis of diseases, the prevalence of conditions and the efficacy of therapies. function. Analysis of genetic polymorphisms such as SNPs allows for the selection of drugs and the development of treatment protocols tailored to each individual patient (so-called “personalized” medical treatments). Instead of the using trial-and-error methods of matching patients with the right drugs, doctors may, for example, be able to analyze a patient's genetic profile and prescribe the best available drug therapy from the beginning. Not only would this take the guesswork out of finding the right drug, it would reduce the likelihood of adverse reactions, thus increasing safety.
SUMMARY OF THE INVENTION[0004] The present invention identifies genetic polymorphisms relating to genes associated with drug metabolism. In some embodiments, the present invention provides methods for determining variations in sequences and genes associated with drug-metabolizing enzymes. In preferred embodiments, the present invention provides methods for collecting genetic polymorphism data for use in evaluating the effectiveness and safety of a drug based on the data, and screening drugs using the data. In some preferred embodiments, the polymorphisms of the present invention are used to evaluate a causal relationship between the genetic make-up of a patient and a response to an administered drug.
[0005] The present invention relates to genes encoding enzymes associated with drug metabolism (drug metabolizing enzymes, or DMEs). In particular, the present invention relates to sequence variations associated with variations in DMEs. In some embodiments, variations occur in coding regions of DMEs, such as may alter a function of the DMEs, (e.g., by increasing or decreasing its level of activity, or shifting its activity to an alternative target or function). In other embodiments, the variations occur in non-coding regions of the genome, such as may alter expression of a DME (e.g., increasing or decreasing the amount of an enzyme produced in a cell) or processing of an RNA transcript encoding a DME (e.g., by altering splicing).
[0006] In some embodiments, the present invention provides methods for detecting DME-related sequence variations. In some preferred embodiments, the methods of the present invention are used to create a profile of DME-related polymorphisms in a test subject.
[0007] In other embodiments, the present invention provides isolated nucleic acid sequences encoding variant DMEs. For example, the present invention provides a recombinant DNA vector comprising DNA having a nucleotide sequence encoding a variant DME, the nucleotide sequence comprising a sequence including, but not limited to, SEQ ID NOS:1-3360 and 3361-7669, and substantially similar sequences. In a preferred embodiment, the invention provides a host cell transformed with a recombinant DNA vector comprising DNA having a nucleotide sequence encoding a variant DME. The invention is not limited by the nature of the host cell employed. The art is well aware of expression vectors suitable for the expression of nucleotide sequences encoding variant DMEs that can be expressed in a variety of prokaryotic and eukaryotic host cells. In some preferred embodiments, the host cell is a eukaryotic cell grown in culture, such as for use in in vitro drug screening (e.g., by monitoring the expression of genes associated with the pathways targeted by a particular test drug). In other preferred embodiments, the host cell is in vivo.
[0008] The present invention provides systems and methods for detection of polymorphisms associated with genes encoding enzymes associated with drug metabolism. The present invention is not limited in the nature of the detection assay used for detection or identification of such polymorphisms. Such detection assays include, but are not limited to, hybridization methods and array technologies (e.g., technologies available from Aclara BioSciences, Haywood, Calif.; Affymetrix, Santa Clara, Calif.; Agilent Technologies, Inc., Palo Alto, Calif.; Aviva Biosciences Corp., San Diego, Calif.; Caliper Technologies Corp., Palo Alto, Calif.; Celera, Rockville, Md.; CuraGen Corp., New Haven, Conn.; Hyseq Inc., Sunnyvale, Calif.; Illumina, Inc., San Diego, Calif.; Incyte Genomics, Palo Alto, Calif.; Motorola BioChip Systems; Nanogen, San Diego, Calif.; Orchid BioSciences, Inc., Princeton, N.J.; Applera Corp., Foster City, Calif.; Rosetta Inpharmatics, Kirkland, Wash.; and Sequenom, San Diego, Calif.); polymerase chain reaction-based methods (e.g.,TAQMAN, Applera Corp., GENECODE system, EraGen, Middleton, Wis.); branched hybridization methods; enzyme mismatch cleavage methods; NASBA; sandwich hybridization methods; methods employing molecular beacons; ligase chain reactions, and the like.
[0009] Methods of the present invention find application in improving the drug discovery and approval processes. For example, the costs and risks of drug development may be reduced if only those persons capable of responding to a drug are selected for clinical trials. In addition, previously failed drug candidates may be revived as they are matched with more appropriate patient populations. Decreases in the number of adverse drug reactions, the number of failed drug trials, the time it takes to get a drug approved, the length of time patients are on medication, the number of medications patients must take to find an effective therapy, and an increase in the range of possible drug targets will promote a net decrease in the cost of health care.
[0010] Thus, in some embodiments, the present invention provides a method of identifying individuals having a polymorphism, comprising providing nucleic acid from a subject; and detecting the presence of at least one polymorphism in said nucleic acid, said at least one polymorphism including, but not limited to, polymorphisms found in SEQ ID Nos:1-3360 and 3361-7669. In some embodiments, the method further provides the step of providing a prognosis (e.g., a genotype relative risk or a population attributable risk) to the subject based on the presence or absence of the at least one polymorphism. In some embodiments, the detecting step is carried out using a detection assay including, but not limited to, a hybridization assay, a TAQMAN assay, an invasive cleavage assay, use of mass spectroscopy, a microarray, a polymerase chain reaction, a rolling circle extension assay, a sequencing assay, a hybridization assay employing a probe complementary to a polymorphism, a bead array assay, a primer extension assay, an enzyme mismatch cleavage assay, a branched hybridization assay, a NASBA assay, a molecular beacon assay, a cycling probe assay, a ligase chain reaction assay, and a sandwich hybridization assay.
[0011] The present invention also provides a nucleic acid (e.g., a gene, a probe, a primer, etc.) comprising a sequence selected from the group consisting of SEQ ID NO:1-3360 and 3361-7669 or complements thereof. In some embodiments, the nucleic acid molecule comprises a label. In some embodiments, the nucleic acid is attached to a solid support (e.g., as part of a microarray). The present invention also provides vectors comprising the nucleic acid and host cell comprising the vector, as well as polypeptide encoded by the nucleic acid. Methods of producing and purifying polypeptides are well known in the art.
[0012] The present invention further provides kits for detecting a polymorphism, comprising at least one reagent that specifically detects a polymorphism in a sequence including, but not limited to, SEQ ID Nos:1-3360 and 3361-7669. In some embodiments, the kit further comprising instructions for determining whether the subject is at increased risk of having a drug metabolism disorder. In some embodiments, the at least one reagent comprises a nucleic acid probe. The kits can be configured for a variety of uses including, but not limited to, use as an in vitro diagnostic detection assay, an analyte specific reagent detection assay, and a research-use-only detection assay.
[0013] The present invention also provides a method for screening subjects for genetic nmarkers associated with drug metabolizing enzyme(s), comprising: a) providing a biological sample comprising a nucleic acid from a subject; b) testing the nucleic acid for a polymorphism in a genetic marker associated with a drug metabolizing enzyme, said genetic marker comprising one or more nucleotide polymorphisms designated by n, said n selected from a base substitution, an insertion, or a deletion found in a sequence selected from the group consisting of SEQ ID Nos:1-3360 and 3361-7669. The present invention is not limited by the source of the nucleic acid. In some embodiments, the biological sample comprises blood, saliva, amniotic fluid, and tissue. In some embodiments, the subject is a human. In some preferred embodiments, the nucleic acid comprises DNA and/or RNA.
[0014] The present invention further provides a composition comprising an array of detection assays, said array comprising a plurality of drug metabolizing enzyme nucleotide polymorphism detection assays, one or more of said detection assays being capable of detecting one or more nucleotide polymorphisms designated by n in SEQ ID Nos:1-3360 and 3361-7669, wherein n represents a base substitution, insertion, or deletion compared to a wild-type sequence.
[0015] The present invention also provides a composition comprising a detection probe for determining the presense or absence a single nucleotide polymorphism in a gene encoding a drug metabolizing enzyme, said gene comprising a sequence selected from the group consisting of SEQ ID Nos:1-3360 and 3361-7669.
[0016] The present invention further provides a method of determining the effectiveness of or side-effect of a drug or treatment protocol, comprising; a) administering a drug or treatment protocol to one or more subjects; b) obtaining nucleic acid from said one or more subjects; c) using a detection assay to detect the presence of at least one polymorphism in said nucleic acid from said one or more of subjects, said at least one polymorphism selected from the group consisting of polymorphisms found in SEQ ID Nos:1-3360 and 3361-7669; and d) assigning an effectiveness rating, side-effect rating, or score for said drug or treatment protocol based upon a result of one or more said detection assays (See e.g., Toxicology Testing Handbook: Principles, Applications, and Data Interpretation, ed. Jacobson-Kram and Keller, 2001, herein incorporated by reference in its entirety).
[0017] The present invention also provides a method of prescribing a drug to or treatment protocol for a subject, comprising; providing nucleic acid from said subject; using a detection assay to detect the presence of at least one polymorphism in the nucleic acid, said at least one polymorphism selected from the group consisting of polymorphisms found in SEQ ID Nos:1-3360 and 3361-7669; and, prescribing said drug or treatment protocol based upon the result of said detection assay.
[0018] The present invention further provides a method for generating assay data comprising: obtaining a sample from a subject containing nucleic acid; transferring said sample to a laboratory; and receiving data from said laboratory, wherein said data corresponds to the presence of at least one polymorphism in said nucleic acid, said at least one polymorphism selected from the group consisting of polymorphisms found in SEQ ID Nos:1-3360 and 3361-7669. The present further provides data sets generated by this method.
DEFINITIONS[0019] To facilitate an understanding of the present invention, a number of terms and phrases are defined below:
[0020] As used herein, the terms “complementary” or “complementarity” are used in reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) related by the base-pairing rules. For example, for the sequence “5′-A-G-T-3′,” is complementary to the sequence “3′-T-C-A-5′.” Complementarity may be “partial,” in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be “complete” or “total” complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids. Either term may also be used in reference to individual nucleotides, especially within the context of polynucleotides. For example, a particular nucleotide within an oligonucleotide may be noted for its complementarity, or lack thereof, to a nucleotide within another nucleic acid strand, in contrast or comparison to the complementarity between the rest of the oligonucleotide and the nucleic acid strand. Nucleotide analogs used to form non-standard base pairs, whether with another nucleotide analog (e.g., an IsoC/IsoG base pair), or with a naturally occurring nucleotide (e.g., as described in U.S. Pat. No. 5,912,340, herein incorporated by reference in its entirety) are also considered to be complementary to a base pairing partner within the meaning this definition.
[0021] The term “homology” and “homologous” refers to a degree of identity. There may be partial homology or complete homology. A partially homologous sequence is one that is less than 100% identical to another sequence.
[0022] As used herein, the term “hybridization” is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is influenced by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, and the Tm of the formed hybrid. “Hybridization” methods involve the annealing of one nucleic acid to another, complementary nucleic acid, i.e., a nucleic acid having a complementary nucleotide sequence. The ability of two polymers of nucleic acid containing complementary sequences to Find each other and anneal through base pairing interaction is a well-recognized phenomenon. The initial observations of the “hybridization” process by Marmur and Lane, Proc. Natl. Acad. Sci. USA 46:453 (1960) and Doty et al., Proc. Natl. Acad. Sci. USA 46:461 (1960) have been followed by the refinement of this process into an essential tool of modem biology.
[0023] With regard to complementarity, it is important for some diagnostic applications to determine whether the hybridization represents complete or partial complementarity. For example, where it is desired to detect simply the presence or absence of a foreign DNA sequence, it is only important that the hybridization method ensures hybridization when the relevant sequence is present; conditions can be selected where both partially complementary probes and completely complementary probes will hybridize. Other diagnostic applications, however, may require that the hybridization method distinguish between partial and complete complementarity. It may be of interest to detect genetic polymorphisms. For example, human hemoglobin is composed, in part, of four polypeptide chains. Two of these chains are identical chains of 141 amino acids (alpha chains) and two of these chains are identical chains of 146 amino acids (beta chains). The gene encoding the beta chain is known to exhibit polymorphism. The normal allele encodes a beta chain having glutamic acid at the sixth position. The mutant allele encodes a beta chain having valine at the sixth position. This difference in amino acids has a profound (most profound when the individual is homozygous for the mutant allele) physiological impact known clinically as sickle cell anemia. It is well known that the genetic basis of the amino acid change involves a single base difference between the normal allele DNA sequence and the mutant allele DNA sequence.
[0024] The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5′ end of one sequence is paired with the 3′ end of the other, is in “antiparallel association.” Certain bases not commonly found in natural nucleic acids may be included in the nucleic acids of the present invention and include, for example, inosine and 7-deazaguanine. Complementarity need not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs.
[0025] As used herein, the term “Tm” is used in reference to the “melting temperature.” The melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands. Several equations for calculating the Tm of nucleic acids are well known in the art. As indicated by standard references, a simple estimate of the Tm value may be calculated by the equation: Tm=81.5+0.41 (% G+C), when a nucleic acid is in aqueous solution at 1 M NaCl (see e.g., Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization (1985). Other references (e.g., Allawi, H. T. & SantaLucia, J., Jr. Thermodynamics and NMR of internal G.T mismatches in DNA. Biochemistry 36, 10581-94 (1997) include more sophisticated computations which take structural and environmental, as well as sequence characteristics into account for the calculation of Tm.
[0026] As used herein the term “stringency” is used in reference to the conditions of temperature, ionic strength, and the presence of other compounds, under which nucleic acid hybridizations are conducted. With “high stringency” conditions, nucleic acid base pairing will occur only between nucleic acid fragments that have a high frequency of complementary base sequences. Thus, conditions of “weak” or “low” stringency are often required when it is desired that nucleic acids that are not completely complementary to one another be hybridized or annealed together.
[0027] “High stringency conditions” when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42 C in a solution consisting of 5× SSPE (43.8 g/l NaCl, 6.9 g/l NaH2PO4 H2O and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5× Denhardt's reagent and 100 &mgr;g/ml denatured salmon sperm DNA followed by washing in a solution comprising 0.1× SSPE, 1.0% SDS at 42 C when a probe of about 500 nucleotides in length is employed.
[0028] “Medium stringency conditions” when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42 C in a solution consisting of 5× SSPE (43.8 g/l NaCl, 6.9 g/l NaH2PO4 H2O and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5× Denhardt's reagent and 100 &mgr;g/ml denatured salmon sperm DNA followed by washing in a solution comprising 1.0× SSPE, 1.0% SDS at 42 C when a probe of about 500 nucleotides in length is employed.
[0029] “Low stringency conditions” comprise conditions equivalent to binding or hybridization at 42 C in a solution consisting of 5× SSPE (43.8 g/l NaCl, 6.9 g/l NaH2PO4H2O and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.1% SDS, 5× Denhardt's reagent [50× Denhardt's contains per 500 ml: 5 g Ficoll (Type 400, Pharamcia), 5 g BSA (Fraction V; Sigma)] and 100 g/ml denatured salmon sperm DNA followed by washing in a solution comprising 5× SSPE, 0.1% SDS at 42 C when a probe of about 500 nucleotides in length is employed.
[0030] The term “gene” refers to a DNA sequence that comprises control and coding sequences necessary for the production of an RNA having a non-coding function (e.g., a ribosomal or transfer RNA), a polypeptide or a precursor. The RNA or polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence so long as the desired activity or function is retained.
[0031] The term “wild-type” refers to a gene or a gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source. A wild-type gene is that which is most frequently observed in a population and is thus arbitrarily designated the “normal” or “wild-type” form of the gene. In contrast, the term “modified,” “mutant,” or “polymorphic” refers to a gene or gene product that displays modifications in sequence and or functional properties (i.e., altered characteristics) when compared to the wild-type gene or gene product. It is noted that naturally-occurring mutants can be isolated; these are identified by the fact that they have altered characteristics when compared to the wild-type gene or gene product.
[0032] The term “oligonucleotide” as used herein is defined as a molecule comprising two or more deoxyribonucleotides or ribonucleotides, preferably at least 5 nucleotides, more preferably at least about 10-15 nucleotides and more preferably at least about 15 to 30 nucleotides. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotide may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription, PCR, or a combination thereof.
[0033] Because mononucleotides are reacted to make oligonucleotides in a manner such that the 5′ phosphate of one mononucleotide pentose ring is attached to the 3′ oxygen of its neighbor in one direction via a phosphodiester linkage, an end of an oligonucleotide is referred to as the “5′ end” if its 5′ phosphate is not linked to the 3′ oxygen of a mononucleotide pentose ring and as the “3′ end” if its 3′ oxygen is not linked to a 5′ phosphate of a subsequent mononucleotide pentose ring. As used herein, a nucleic acid sequence, even if internal to a larger oligonucleotide, also may be said to have 5′ and 3′ ends. A first region along a nucleic acid strand is said to be upstream of another region if the 3′ end of the first region is before the 5′ end of the second region when moving along a strand of nucleic acid in a 5′ to 3′ direction.
[0034] When two different, non-overlapping oligonucleotides anneal to different regions of the same linear complementary nucleic acid sequence, and the 3′ end of one oligonucleotide points towards the 5′ end of the other, the former may be called the “upstream” oligonucleotide and the latter the “downstream” oligonucleotide. Similarly, when two overlapping oligonucleotides are hybridized to the same linear complementary nucleic acid sequence, with the first oligonucleotide positioned such that its 5′ end is upstream of the 5′ end of the second oligonucleotide, and the 3′ end of the first oligonucleotide is upstream of the 3′ end of the second oligonucleotide, the first oligonucleotide may be called the “upstream” oligonucleotide and the second oligonucleotide may be called the “downstream” oligonucleotide.
[0035] The term “primer” refers to an oligonucleotide that is capable of acting as a point of initiation of synthesis when placed under conditions in which primer extension is initiated. An oligonucleotide “primer” may occur naturally, as in a purified restriction digest or may be produced synthetically.
[0036] A primer is selected to be “substantially” complementary to a strand of specific sequence of the template. A primer must be sufficiently complementary to hybridize with a template strand for primer elongation to occur. A primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5′ end of the primer, with the remainder of the primer sequence being substantially complementary to the strand. Non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the sequence of the template to hybridize and thereby form a template primer complex for synthesis of the extension product of the primer.
[0037] The term “label” as used herein refers to any atom or molecule that can be used to provide a detectable (preferably quantifiable) effect, and that can be attached to a nucleic acid or protein. Labels include but are not limited to dyes; radiolabels such as 32P; binding moieties such as biotin; haptens such as digoxgenin; luminogenic, phosphorescent or fluorogenic moieties; and fluorescent dyes alone or in combination with moieties that can suppress or shift emission spectra by fluorescence resonance energy transfer (FRET). Labels may provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, and the like. A label may be a charged moiety (positive or negative charge) or alternatively, may be charge neutral. Labels can include or consist of nucleic acid or protein sequence, so long as the sequence comprising the label is detectable.
[0038] The term “signal” as used herein refers to any detectable effect, such as would be caused or provided by a label or an assay reaction.
[0039] As used herein, the term “detector” refers to a system or component of a system, e.g., an instrument (e.g. a camera, fluorimeter, charge-coupled device, scintillation counter, etc.) or a reactive medium (X-ray or camera film, pH indicator, etc.), that can convey to a user or to another component of a system (e.g., a computer or controller) the presence of a signal or effect. A detector can be a photometric or spectrophotometric system, which can detect ultraviolet, visible or infrared light, including fluorescence or chemiluminescence; a radiation detection system; a spectroscopic system such as nuclear magnetic resonance spectroscopy, mass spectrometry or surface enhanced Raman spectrometry; a system such as gel or capillary electrophoresis or gel exclusion chromatography; or other detection systems known in the art, or combinations thereof.
[0040] The term “sequence variation” as used herein refers to differences in nucleic acid sequence between two nucleic acids. For example, a wild-type structural gene and a mutant form of this wild-type structural gene may vary in sequence by the presence of single base substitutions and/or deletions or insertions of one or more nucleotides. These two forms of the structural gene are said to vary in sequence from one another. A second mutant form of the structural gene may exist. This second mutant form is said to vary in sequence from both the wild-type gene and the first mutant form of the gene.
[0041] The term “nucleotide analog” as used herein refers to modified or non-naturally occurring nucleotides such as 7-deaza purines (i.e., 7-deaza-dATP and 7-deaza-dGTP). Nucleotide analogs include base analogs and comprise modified forms of deoxyribonucleotides as well as ribonucleotides.
[0042] The term “polymorphism” refers to the coexistence of more than one form of a gene or portion thereof. A portion of a gene of which there are at least two different forms, i.e., two different nucleotide sequences,, is referred to as a “polymorphic region of a gene”. A polymorphic region can be a single nucleotide, the identity of which differs in different alleles. A polymorphic region can also be several nucleotides long.
[0043] A “polymorphic gene” refers to a gene having at least one polymorphic region.
[0044] The term “polymorphic locus” is a locus present in a population that shows variation between members of the population (e.g., the most common allele has a frequency of less than 0.95). In contrast, a “monomorphic locus” is a genetic locus at little or no variations seen between members of the population (generally taken to be a locus at which the most common allele exceeds a frequency of 0.95 in the gene pool of the population).
[0045] A “non-human animal” of the invention can include mammals such as rodents, non-human primates, sheep, goats, horses, dogs, cows, chickens, amphibians, reptiles, etc. Preferred non-human animals are selected from the rodent family including rat and mouse, most preferably mouse, though transgenic amphibians, such as members of the Xenopus genus, and transgenic chickens can also provide important tools for understanding and identifying drugs that can affect processes, e.g., embryogenesis and tissue formation.
[0046] The term “operably linked” is intended to mean that the promoter is associated with the nucleic acid in such a manner as to facilitate transcription of the nucleic acid from the promoter.
[0047] The terms “protein”, “polypeptide” and “peptide” are used interchangeably herein when referring to a gene product.
[0048] The term “recombinant protein” refers to a polypeptide which is produced by recombinant DNA techniques, wherein generally, DNA encoding the polypeptide is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the heterologous protein.
[0049] A “regulatory element”, also termed herein “regulatory sequence” is intended to include elements which are capable of modulating transcription from a basic promoter and include elements such as enhancers and silencers. The term “enhancer”, also referred to herein as “enhancer element”, is intended to include regulatory elements capable of increasing, stimulating, or enhancing transcription from a basic promoter. The term “silencer”, also referred to herein as “silencer element” is intended to include regulatory elements capable of decreasing, inhibiting, or repressing transcription from a basic promoter. Regulatory elements are typically present in 5′ flanking regions of genes. However, regulatory elements have also been shown to be present in other regions of a gene, in particular in introns. Regulatory elements may also be present downstream of coding regions. Thus, it is possible that DMI genes have regulatory elements located in introns, exons, coding regions, and 3′ flanking sequences. Such regulatory elements are also intended to be encompassed by the present invention and polymorphisms in such elements can be identified by any of the assays that can be used to identify polymorphisms in regulatory elements in 5′ flanking regions of genes.
[0050] The term “regulatory element” further encompasses “tissue specific” regulatory elements, i.e., regulatory elements that affect expression of a DME gene preferentially in specific cells (e.g., cells of a specific tissue). Gene expression occurs preferentially in a specific cell if expression in this cell type is significantly higher than expression in other cell types. The term “regulatory element” also encompasses non-tissue specific regulatory elements, i.e., regulatory elements that are active in most cell types. Furthermore, a regulatory element can be a constitutive regulatory element, i.e., a regulatory element that constitutively regulates transcription, as opposed to a regulatory element that is inducible, i.e., a regulatory element which is active primarily in response to a stimulus. A stimulus can be, e.g., a molecule, such as a hormone, cytokine, heavy metal, phorbol ester, cyclic AMP (cAMP), or retinoic acid.
[0051] As used herein, the term “transfection” means the introduction of a nucleic acid, e.g., an expression vector, into a recipient cell by nucleic acid-mediated gene transfer. The term “transduction” is generally used herein when the transfection with a nucleic acid is by viral delivery of the nucleic acid. “Transformation”, as used herein, refers to a process in which a cell's genotype is changed as a result of the cellular uptake of exogenous DNA or RNA, and, for example, the transformed cell expresses a recombinant form of a polypeptide or, in the case of anti-sense expression from the transferred gene, the expression of a naturally-occurring form of the recombinant protein is disrupted.
[0052] As used herein, the term “transgene” refers to a nucleic acid sequence that has been introduced into a cell. Daughter cells deriving from a cell in which a transgene has been introduced are also said to contain the transgene (unless it has been deleted). A transgene can encode, e.g., a polypeptide, or an antisense transcript, partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout). Alternatively, a transgene can also be present in an episome. A transgene can include one or more transcriptional regulatory sequence and any other nucleic acid, (e.g. intron), that may be necessary for optimal expression of a selected nucleic acid.
[0053] A “transgenic animal” refers to any animal, preferably a non-human animal, e.g. a mammal, bird or an amphibian, in which one or more of the cells of the animal contain heterologous nucleic acid introduced by way of human intervention, such as by transgenic techniques well known in the art. The nucleic acid is introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant virus. The term genetic manipulation does not include classical cross-breeding, or in vitro fertilization, but rather is directed to the introduction of a recombinant DNA molecule. This molecule may be integrated within a chromosome, or it may be extrachromosomally replicating DNA. In the typical transgenic animals described herein, the transgene causes cells to express a recombinant form of one of a protein, e.g. either agonistic or antagonistic forms. However, transgenic animals in which the recombinant gene is silent are also contemplated. Moreover, “transgenic animal” also includes those recombinant animals in which gene disruption of one or more genes is caused by human intervention, including both recombination and antisense techniques.
[0054] The term “treating” as used herein is intended to encompass curing as well as ameliorating at least one symptom of the condition or disease.
[0055] The term “sample” in the present specification and claims is used in its broadest sense. On the one hand it is meant to include a biological (e.g., human) specimen. On the other hand, a sample may include a specimen of synthetic origin.
[0056] Biological samples may be animal, including human, fluid, solid (e.g., stool) or tissue, as well as liquid and solid food and feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste. Biological samples may be obtained from all of the various families of domestic animals, as well as feral or wild animals, including, but not limited to, such animals as ungulates, bear, fish, lagamorphs, rodents, etc.
[0057] The term “source of target nucleic acid” refers to any sample that contains or is suspected to contain nucleic acids (RNA or DNA). Particularly preferred sources of target nucleic acids are biological samples including, but not limited to blood, saliva, cerebral spinal fluid, pleural fluid, milk, lymph, sputum and semen.
[0058] The term “polymerization means” or “polymerization agent” refers to any agent capable of facilitating the addition of nucleoside triphosphates to an oligonucleotide. Preferred polymerization means comprise DNA and RNA polymerases.
[0059] The term “ligation means” or “ligation agent” refers to any agent capable of facilitating the ligation (i.e., the formation of a phosphodiester bond between a 3′-OH and a 5′ P located at the termini of two strands of nucleic acid). Preferred ligation means comprise DNA ligases and RNA ligases.
[0060] The term “reactant” is used herein in its broadest sense. The reactant can comprise, for example, an enzymatic reactant, a chemical reactant or light (e.g., ultraviolet light, particularly short wavelength ultraviolet light is known to break oligonucleotide chains). Any agent capable of reacting with an oligonucleotide to either shorten (i.e., cleave) or elongate the oligonucleotide is encompassed within the term “reactant.”
[0061] The term “nucleic acid sequence” as used herein refers to an oligonucleotide, nucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin that may be single or double stranded, and represent the sense or antisense strand. Similarly, “amino acid sequence” as used herein refers to peptide or protein sequence.
[0062] The term “peptide nucleic acid” (“PNA”) as used herein refers to a molecule comprising bases or base analogs such as would be found in natural nucleic acid, but attached to a peptide backbone rather than the sugar-phosphate backbone typical of nucleic acids. The attachment of the bases to the peptide is such as to allow the bases to base pair with complementary bases of nucleic acid in a manner similar to that of an oligonucleotide. These small molecules, also designated anti gene agents, stop transcript elongation by binding to their complementary strand of nucleic acid (Nielsen, et al. Anticancer Drug Des. 8:53 63 [1993]).
[0063] As used herein, the terms “purified” or “substantially purified” refer to molecules, either nucleic or amino acid sequences, that are removed from their natural environment, isolated or separated, and are at least 60% free, preferably 75% free, and most preferably 90% free from other components with which they are naturally associated. An “isolated polynucleotide” or “isolated oligonucleotide” is therefore a substantially purified polynucleotide.
[0064] As used herein, the term “kit” refers to any delivery system for delivering materials. In the context of reaction assays, such delivery systems include systems that allow for the storage, transport, or delivery of reaction reagents (e.g., oligonucleotides, enzymes, etc. in the appropriate containers) and/or supporting materials (e.g., buffers, written instructions for performing the assay etc.) from one location to another. For example, kits include one or more enclosures (e.g., boxes) containing the relevant reaction reagents and/or supporting materials. As used herein, the term “fragmented kit” refers to a delivery systems comprising two or more separate containers that each contain a subportion of the total kit components. The containers may be delivered to the intended recipient together or separately. For example, a first container may contain an enzyme for use in an assay, while a second container contains oligonucleotides. The term “fragmented kit” is intended to encompass kits containing Analyte specific reagents (ASR's) regulated under section 520(e) of the Federal Food, Drug, and Cosmetic Act, but are not limited thereto. Indeed, any delivery system comprising two or more separate containers that each contains a subportion of the total kit components are included in the term “fragmented kit.” In contrast, a “combined kit” refers to a delivery system containing all of the components of a reaction assay in a single container (e.g., in a single box housing each of the desired components). The term “kit” includes both fragmented and combined kits.
[0065] As used herein, the term “information” refers to any collection of facts or data. In reference to information stored or processed using a computer system(s), including but not limited to internets, the term refers to any data stored in any format (e.g., analog, digital, optical, etc.). As used herein, the term “information related to a subject” refers to facts or data pertaining to a subject (e.g., a human, plant, or animal). The term “genomic information” refers to information pertaining to a genome including, but not limited to, nucleic acid sequences, genes, allele frequencies, RNA expression levels, protein expression, phenotypes correlating to genotypes, etc. “Allele frequency information” refers to facts or data pertaining allele frequencies, including, but not limited to, allele identities, statistical correlations between the presence of an allele and a characteristic of a subject (e.g., a human subject), the presence or absence of an allele in a individual or population, the percentage likelihood of an allele being present in an individual having one or more particular characteristics, etc.
[0066] The term “cleavage structure” as used herein, refers to a structure that is formed by the interaction of at least one probe oligonucleotide and a target nucleic acid, forming a structure comprising a duplex, the resulting structure being cleavable by a cleavage agent, including but not limited to an enzyme. The cleavage structure is a substrate for specific cleavage by the cleavage means in contrast to a nucleic acid molecule that is a substrate for non-specific cleavage by agents such as phosphodiesterases that cleave nucleic acid molecules without regard to secondary structure (i.e., no formation of a duplexed structure is required).
DESCRIPTION OF THE DRAWINGS[0067] FIG. 1 shows sample embodiments of TAQMAN probes.
[0068] FIG. 2 represents one embodiment of the TAQMAN PCR method.
[0069] FIG. 3 shows examples of probes labeled with fluorescent dyes.
[0070] FIG. 4 shows a sample embodiment of an invasive cleavage structure, e.g., for an INVADER assay.
[0071] FIG. 5 shows one embodiment of a FRET probe, e.g., for an INVADER assay.
[0072] FIG. 6 shows one embodiment of an INVADER assay.
[0073] FIG. 7 shows a diagram of an INVADER assay probe in which the allele does not match the probe.
[0074] FIG. 8 shows one embodiment of allele identification using a ligation reaction.
[0075] FIG. 9 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily B member 2 (ABCB2) gene.
[0076] FIG. 10 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily B member 4 (ABCB4) gene.
[0077] FIG. 11 shows a drawing of the structure of and SNP position in the microsomal epoxide hydrogenase 1 (EPHX1) gene.
[0078] FIG. 12 shows a drawing of the structure of and SNP position in the cytoplasmic epoxide hydrogenase 2 (EPHX2) gene.
[0079] FIG. 13 shows a drawing of the structure of and SNP position in the guanidinoacetate-N-methyltransferase (GAMT) gene.
[0080] FIG. 14 shows a drawing of the structure of and SNP position in the nicotinamide-N-methyltransferase (NNMT) gene.
[0081] FIG. 15 shows a drawing of the structure of and SNP position in the phenylethanolamine-N-methyltransferase (PNMT) gene.
[0082] FIG. 16 shows a drawing of the structure of and SNP position in the phosphatidylethanolamine-N-methyltransferase (PEMT) gene.
[0083] FIG. 17 shows a drawing of the structure of and SNP position in the glutathione-S-methyltransferase 3 (GSTM3) gene.
[0084] FIG. 18 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 5 (ALDH5) gene.
[0085] FIG. 19 shows a drawing of the structure of and SNP position in the transglutaminase (TGM1) gene.
[0086] FIG. 20 shows a drawing of the structure of and SNP position in the gamma glutamyltransferase (GGT1) gene.
[0087] FIG. 21 shows a drawing of the structure of and SNP position in the NAD(P)H: quinone oxidetransferase (NQ01) gene.
[0088] FIG. 22 shows a drawing of the structure of and SNP position in the p53-induced gene 3 (PIG3) of a quinone oxide transferase homologue.
[0089] FIG. 23 shows a drawing of the structure of and SNP position in the NRH: quinone oxide transferase 2 (NQ02) gene.
[0090] FIG. 24 shows a drawing of the structure of and SNP position in the sulfotransferase 1A1 (SULT1A1/STP1) gene.
[0091] FIG. 25 shows a drawing of the structure of and SNP position in the sulfotransferase 1A2 (SULT1A2/STP2) gene.
[0092] FIG. 26 shows a drawing of the structure of and SNP position in the sulfotransferase-related protein 3 (SULTX3) gene.
[0093] FIG. 27 shows a drawing of the structure of and SNP position in the tyrosyl protein sulfotransferase (TPST1) gene.
[0094] FIG. 28 shows a drawing of the structure of and SNP position in the tyrosyl protein sulfotransferase (TPST2) gene.
[0095] FIG. 29 shows a drawing of the structure of and SNP position in the sulfotransferase 1A3 (SULT1A3/STM/HAST) gene.
[0096] FIG. 30 shows a drawing of the structure of and SNP position in the cerebroside transferase (CST) gene.
[0097] FIG. 31 shows a drawing of the structure of and SNP position in the sulfotransferase 1C1 (SULT1C1) gene.
[0098] FIG. 32 shows a drawing of the structure of and SNP position in the sulfotransferase 1 C2 (SULT1C2) gene.
[0099] FIG. 33 shows a drawing of the structure of and SNP position in the thyroid hormone sulfotransferase (ST1B2) gene.
[0100] FIG. 34 shows a drawing of the structure of and SNP position in the hydrocarbon sulfotransferase 2 (CHST2) gene.
[0101] FIG. 35 shows a drawing of the structure of and SNP position in the sulfotransferase 2A1 (SULT2A1) gene.
[0102] FIG. 36 shows a drawing of the structure of and SNP position in the sulfotransferase 2B1 (SULT2B1) gene.
[0103] FIG. 37 shows a drawing of the structure of and SNP position in the hydrocarbon sulfotransferase 4 (CHST4) gene.
[0104] FIG. 38 shows a drawing of the structure of and SNP position in the hydrocarbon sulfotransferase 5 (CHST5) gene.
[0105] FIG. 39 shows a drawing of the structure of and SNP position in the HNK-sulfotransferase (NHK-1ST) gene.
[0106] FIG. 40 shows a drawing of the structure of and SNP position in the estrogen sulfotransferase (STE) gene.
[0107] FIG. 41 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 1 (ADH1) gene.
[0108] FIG. 42 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 2 (ADH2) gene.
[0109] FIG. 43 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 3 (ADH3) gene.
[0110] FIG. 44 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 6 (ADH6) gene.
[0111] FIG. 45 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 7 (ADH7) gene.
[0112] FIG. 46 shows a drawing of the structure of and SNP position in the short-chained alcohol dehydrogenase family (HEP27) gene.
[0113] FIG. 47 shows a drawing of the structure of and SNP position in the L1 intracellular adhesion molecule (L1CAM) gene.
[0114] FIG. 48 shows a drawing of the structure of and SNP position in the arylalkylamine-N-acetyltransferase (AANAT) gene.
[0115] FIG. 49 shows a drawing of the structure of and SNP position in the N-actyltransferase homologue (ARD1) gene of Saccharomyces cerevisiae.
[0116] FIG. 50 shows a drawing of the structure of and SNP position in the N-actyltransferase 1 (NAT1) gene.
[0117] FIG. 51 shows a drawing of the structure of and SNP position in the N-actyltransferase 2 (NAT2) gene.
[0118] FIG. 52 shows a drawing of the structure of and SNP position in the granzyme A (GZMA) gene.
[0119] FIG. 53 shows a drawing of the structure of and SNP position in the granzyme B (GZMB) gene.
[0120] FIG. 54 shows a drawing of the structure of and SNP position in the esterase D-formylglutathione hydrolase (ESD) gene.
[0121] FIG. 55 shows a drawing of the structure of and SNP position in the dolichyl-diphosphooligosaccharide-protein glycosyltransferase (DDOST) gene.
[0122] FIG. 56 shows a drawing of the structure of and SNP position in the microsomal glutathione-S-transferase (MGST1) gene.
[0123] FIG. 57 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 5 (ADH5) gene.
[0124] FIG. 58 shows a drawing of the structure of and SNP position in the glutathione-S-transferase M1 (GSTM1) gene.
[0125] FIG. 59 shows a drawing of the structure of and SNP position in the glutathione-S-transferase M2 (GSTM2) gene.
[0126] FIG. 60 shows a drawing of the structure of and SNP position in the glutathione-S-transferase M4 (GSTM4) gene.
[0127] FIG. 61 shows a drawing of the structure of and SNP position in the glutathione-S-transferase Z1 (GSTZ1) gene.
[0128] FIG. 62 shows a drawing of the structure of and SNP position in the glutathione-S-transferase P (GSTZPi) gene.
[0129] FIG. 63 shows a drawing of the structure of and SNP position in the glutathione-S-transferase q1 (GSTT1) gene.
[0130] FIG. 64 shows a drawing of the structure of and SNP position in the microsomal glutathione-S-transferase 1L1 (MGST1L1) gene.
[0131] FIG. 65 shows a drawing of the structure of and SNP position in the microsomal glutathione-S-transferase 2 (MGST2) gene.
[0132] FIG. 66 shows a drawing of the structure of and SNP position in the microsomal glutathione-S-transferase 3 (MGST3) gene.
[0133] FIG. 67 shows a drawing of the structure of and SNP position in the glutathione-S-transferase A1 (GSTA1) gene.
[0134] FIG. 68 shows a drawing of the structure of and SNP position in the glutathione-S-transferase A4 (GSTA4) gene.
[0135] FIG. 69 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase 1a subcomplex 1 (NDUFA1) gene.
[0136] FIG. 70 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase 1a subcomplex 2 (NDUFA2) gene.
[0137] FIG. 71 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase 1a subcomplex 3 (NDUFA3) gene.
[0138] FIG. 72 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase 1a subcomplex 5 (NDUFA5) gene.
[0139] FIG. 73 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase 1a subcomplex 6 (NDUFA6) gene.
[0140] FIG. 74 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase 1a subcomplex 7 (NDUFA7) gene.
[0141] FIG. 75 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase 1a subcomplex 8 (NDUFA8) gene.
[0142] FIG. 76 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase 1a/b subcomplex 1 (NDUFAB1) gene.
[0143] FIG. 77 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase 1a subcomplex 9 (NDUFA9) gene.
[0144] FIG. 78 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase Fe—S protein 1 (NDUFS1) gene.
[0145] FIG. 79 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase Fe—S protein 3 (NDUFS3) gene.
[0146] FIG. 80 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase Fe—S protein 4 (NDUFS4) gene.
[0147] FIG. 81 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase Fe—S protein 5 (NDUFS5) gene.
[0148] FIG. 82 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase Fe—S protein 6 (NDUFS6) gene.
[0149] FIG. 83 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase Fe—S protein 8 (NDUFS8) gene.
[0150] FIG. 84 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase 1b subcomplex 3 (NDUFB3) gene.
[0151] FIG. 85 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase 1b subcomplex 5 (NDUFB5) gene.
[0152] FIG. 86 shows a drawing of the structure of and SNP position in the NADH-ubiquinone oxide reductase 1b subcomplex 7 (NDUFB7) gene.
[0153] FIG. 87 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily A member 1 (ABCA1) gene.
[0154] FIG. 88 shows a drawing of the structure of and SNP position in the catechol-0-methyltransferase (COMT) gene.
[0155] FIG. 89 shows a drawing of the structure of and SNP position in the vitamin-N-transferase (HNMT) gene.
[0156] FIG. 90 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily 1 (aromatic compound-induced) polypeptide 1 (CYP1A1) gene.
[0157] FIG. 91 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily 1 (aromatic compound-induced) polypeptide 2 (CYP1A2) gene.
[0158] FIG. 92 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily 1 (dioxin-induced) polypeptide 1 (CYP1B1) gene.
[0159] FIG. 93 shows a drawing of the structure of and SNP position in the arylacetamide deactylase (AADAC) gene.
[0160] FIG. 94 shows a drawing of the structure of and SNP position in the neuropathy target esterase (NTE) gene.
[0161] FIG. 95 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily C (CFTR/MRP) member 2 (MRP2) gene.
[0162] FIG. 96 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily B member 1 (ABCB1) gene.
[0163] FIG. 97 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily B member 3 (ABCB3) gene.
[0164] FIG. 98 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily B member 7 (ABCB7) gene.
[0165] FIG. 99 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily B member 8 (ABCB8) gene.
[0166] FIG. 100 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily B member 9 (ABCB9) gene.
[0167] FIG. 101 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily B member 10 (ABCB10) gene.
[0168] FIG. 102 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily B member 11 (ABCB11) gene.
[0169] FIG. 103 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily IVB polypeptide 1 (CYP4B1) gene.
[0170] FIG. 104 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily XXVIIA polypeptide 1 (CYP27A1) gene.
[0171] FIG. 105 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily IVF polypeptide 1 (CYP4F2) gene.
[0172] FIG. 106 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily 4F polypeptide 3 (CYP4F3) gene.
[0173] FIG. 107 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily 4F polypeptide 8 (CYP4F8) gene.
[0174] FIG. 108 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 1 (ALDH1) gene.
[0175] FIG. 109 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 2 (ALDH2) gene.
[0176] FIG. 110 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 7 (ALDH7) gene.
[0177] FIG. 111 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 8 (ALDH8) gene.
[0178] FIG. 112 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 9 (ALDH9) gene.
[0179] FIG. 113 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 10 (ALDH10) gene.
[0180] FIG. 114 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily C member 7 (ABCC7) gene.
[0181] FIG. 115 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily C member 8 (ABCC8) gene.
[0182] FIG. 116 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily C member 9 (ABCC9) gene.
[0183] FIG. 117 shows a drawing of the structure of and SNP position in the carboxylesterase 1 (CES1) gene.
[0184] FIG. 118 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily A member 4 (AB(CC4) gene.
[0185] FIG. 119 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily A member 7 (ABCC7) gene.
[0186] FIG. 120 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily G member 1 (ABCG1) gene.
[0187] FIG. 121 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily G member 2 (ABCG2) gene.
[0188] FIG. 122 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily G member 4 (ABCG4) gene.
[0189] FIG. 123 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily E member 1 (ABCE1) gene.
[0190] FIG. 124 shows a drawing of the structure of and SNP position in the carbohydrate sulfotransferase 1 (CHST1) gene.
[0191] FIG. 125 shows a drawing of the structure of and SNP position in the carbohydrate sulfotransferase 3 (CHST3) gene.
[0192] FIG. 126 shows a drawing of the structure of and SNP position in the NADH: ubiquinone dehydrogenase flavoprotein 1 (NDUFV1) gene.
[0193] FIG. 127 shows a drawing of the structure of and SNP position in the NADH: ubiquinone dehydrogenase flavoprotein 2 (NDUFV2) gene.
[0194] FIG. 128 shows a drawing of the structure of and SNP position in the NADH: ubiquinone dehydrogenase flavoprotein 3 (NDUFV3) gene.
[0195] FIG. 129 shows a drawing of the structure of and SNP position in the NADH: ubiquinone oxide reductase A10 (NDUFA10) gene.
[0196] FIG. 130 shows a drawing of the structure of and SNP position in the high-mobility group protein 17-like 1 (HMG17L1) gene.
[0197] FIG. 131 shows a drawing of the structure of and SNP position in the UDP glycoxyl transferase 2 family polypeptide A1 (UGT2A1) gene.
[0198] FIG. 132 shows a drawing of the structure of and SNP position in the human organic anion transporter polypeptide 1 (hOATP1) gene.
[0199] FIG. 133 shows a drawing of the structure of and SNP position in the human organic anion transporter polypeptide 2 (hOATP2) gene.
[0200] FIG. 134 shows a drawing of the structure of and SNP position in the human organic anion transporter polypeptide 8 (hOATP8) gene.
[0201] FIG. 135 shows a drawing of the structure of and SNP position in the human organic anion transporter 1 (hOAT1) gene.
[0202] FIG. 136 shows a drawing of the structure of and SNP position in the human organic anion transporter 2 (hOAT2) gene.
[0203] FIG. 137 shows a drawing of the structure of and SNP position in the human organic anion transporter 3 (hOAT3) gene.
[0204] FIG. 138 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 1 family member A2 (ALDH1A2) gene.
[0205] FIG. 139 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 1 family member A3 (ALDH1A3) gene.
[0206] FIG. 140 shows a drawing of the structure of and SNP position in the formyltetrahydroforate dehydrogenase (FTHFD/ALDH1L1) gene.
[0207] FIG. 141 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily IIIA (aromatic compound-induced) polypeptide 4 (CYP3A4) gene.
[0208] FIG. 142 shows graph of the results of typing performed on two different groups of subjects using the INVADER assay method.
[0209] FIG. 143 shows a summary of genetic information.
[0210] FIG. 144A shows a structure of ATP-binding cassette subfamily A member 1 (ABCA1) gene and the SNP location therein.
[0211] Accession No.: AF275948.1 and AL359846.11
[0212] FIG. 144B shows a structure of ATP-binding cassette subfamily A member 1 (ABCA1) gene and the SNP location therein. (continuation of FIG. 144A)
[0213] Accession No.: AF275948.1 and AL359846.11
[0214] FIG. 145 shows a structure of ATP-binding cassette subfamily A member 4 (ABCA4) gene and the SNP location therein.
[0215] Accession No.: NT—019258.1
[0216] FIG. 146 shows a structure of ATP-binding cassette subfamily A member 7 (ABCA7) gene and the SNP location therein.
[0217] Accession No.: NT—025194.1
[0218] FIG. 147 shows a structure of ATP-binding cassette subfamily A member 8 (ABCA8) gene and the SNP location therein.
[0219] Accession No.: AC005922.1 and AC015844.5
[0220] FIG. 148 shows a structure of ATP-binding cassette subfamily B member 1 (ABCB1) gene and the SNP location therein.
[0221] Accession No.: AC002457.1 and AC005068.1
[0222] FIG. 149 shows a structure of ATP-binding cassette subfamily B member 4 (ABCB4) gene and the SNP location therein.
[0223] Accession No.: AC079591.1, AC079303.3 and AC005045.2
[0224] FIG. 150 shows a structure of ATP-binding cassette subfamily B member 7 (ABCB7) gene and the SNP location therein.
[0225] Accession No.: AL360179.3 and AC002417.1
[0226] FIG. 151 shows a structure of ATP-binding cassette subfamily B member 8 (ABCB8) gene and the SNP location therein.
[0227] Accession No.: AC010973.4
[0228] FIG. 152 shows a structure of ATP-binding cassette subfamily B member 9 (ABCB9) gene and the SNP location therein.
[0229] Accession No.: AC026362.9 and AC073857.10
[0230] FIG. 153 shows a structure of ATP-binding cassette subfamily B member 10 (ABCB10) gene and the SNP location therein.
[0231] Accession No.: AL121990.9
[0232] FIG. 154 shows a structure of ATP-binding cassette subfamily B member 11 (ABCB11) gene and the SNP location therein.
[0233] Accession No.: AC008177.3 and AC069137.3
[0234] FIG. 155 shows a structure of ATP-binding cassette subfamily C member 1 (ABCC1) gene and the SNP location therein.
[0235] Accession No.: AC026452.5 and AC025778.4
[0236] FIG. 156 shows a structure of ATP-binding cassette subfamily C member 2 (ABCC2) gene and the SNP location therein.
[0237] Accession No.: AL392107.4
[0238] FIG. 157 shows a structure of ATP-binding cassette subfamily C member 3 (ABCC3) gene and the SNP location therein.
[0239] Accession No.: AC004590.1 and AC005921.3
[0240] FIG. 158A shows a structure of ATP-binding cassette subfamily C member 4 (ABCC4) gene and the SNP location therein.
[0241] Accession No.: AL356257.11, AL157818.12 and AL139381.12
[0242] FIG. 158B shows a structure of ATP-binding cassette subfamily C member 4 (ABCC4) gene and the SNP location therein. (continuation of FIG. 158A)
[0243] Accession No.: AL356257.11, AL15,7818.12, and AL139381.12
[0244] FIG. 159 shows a structure of ATP-binding cassette subfamily C member 5 (ABCC5) gene and the SNP location therein.
[0245] Accession No.: AC068644.5
[0246] FIG. 160 shows a structure of ATP-binding cassette subfamily C member 7 (ABCC7) gene and the SNP location therein.
[0247] Accession No.: AC000111.1 and AC000061.1
[0248] FIG. 161 shows a structure of ATP-binding cassette subfamily C member 8 (ABCC8) gene and the SNP location therein.
[0249] Accession No.: AC000406.1
[0250] FIG. 162 shows a structure of ATP-binding cassette subfamily C member 9 (ABCC9) gene and the SNP location therein.
[0251] Accession No.: AC084806.9 and AC008250.23
[0252] FIG. 163 shows a structure of ATP-binding cassette subfamily D member 1 (ABCD1) gene and the SNP location therein.
[0253] Accession No.: U52111.2
[0254] FIG. 164 shows a structure of ATP-binding cassette subfamily D member 3 (ABCD3) gene and the SNP location therein.
[0255] Accession No.: NT—019284.3
[0256] FIG. 165 shows a structure of ATP-binding cassette subfamily D member 4 (ABCD4) gene and the SNP location therein.
[0257] Accession No.: AC005519.3
[0258] FIG. 166 shows a structure of ATP-binding cassette subfamily G member 1 (ABCG1) gene and the SNP location therein.
[0259] Accession No.: AP001746.1
[0260] FIG. 167 shows a structure of ATP-binding cassette subfamily G member 2 (ABCG2) gene and the SNP location therein.
[0261] Accession No.: NT—022959.2
[0262] FIG. 168 shows a structure of ATP-binding cassette subfamily G member 4 (ABCG4) gene and the SNP location therein.
[0263] Accession No.: AP001315.3
[0264] FIG. 169 shows a structure of ATP-binding cassette subfamily G member 5 (ABCG5) gene and the SNP location therein.
[0265] Accession No.: AC084265.2 and AC011242.8
[0266] FIG. 170 shows a structure of ATP-binding cassette subfamily G member 8 (ABCG8) gene and the SNP location therein.
[0267] Accession No.: AC084265.2
[0268] FIG. 171 shows a structure of ATP-binding cassette subfamily E member 1 (ABCE1) gene and the SNP location therein.
[0269] Accession No.: NT—006296.2
[0270] FIG. 172 shows a structure of ATP -binding cassette subfamily F member 1 (ABCF1) gene and the SNP location therein.
[0271] Accession No.: NT—007592.3
[0272] FIG. 173 shows a structure of organic anion transporter 1 (OAT1) gene and the SNP location therein.
[0273] Accession No.: AP001858.3, AJ249369.1, and AP000438.4
[0274] FIG. 174 shows a structure of organic anion transporter 2 (OAT2) gene and the SNP location therein.
[0275] Accession No.: AC26532.3
[0276] FIG. 175 shows a structure of organic anion transporter 3 (OAT3) gene and the SNP location therein.
[0277] Accession No.: AP001858.3
[0278] FIG. 176 shows a structure of organic anion transporter polypeptide 1 (OATP1) gene and the SNP location therein.
[0279] Accession No.: AC022224.22
[0280] FIG. 177 shows a structure of organic anion transporter polypeptide 2 (OATP2) gene and the SNP location therein.
[0281] Accession No.: NT—024399.2
[0282] FIG. 178 shows a structure of organic anion transporter polypeptide 8 (OATP8) gene and the SNP location therein.
[0283] Accession No.: NT—024399.2
[0284] FIG. 179 shows a structure of transporter 1 ATP-binding cassette subfamily B (TAP1) gene and the SNP location therein.
[0285] Accession No.: X66401.1
[0286] FIG. 180 shows a structure of transporter 2 ATP-binding cassette subfamily B (TAP2) gene and the SNP location therein.
[0287] Accession No.: X6640 1.1
[0288] FIG. 181 shows a structure of SLC22A4 solute carrier family 22 (organic cation transporter) member 4 (OCTN1) gene and the SNP location therein.
[0289] Accession No.: AC008599.6
[0290] FIG. 182 shows a structure of SLC22A5 solute carrier family 22 (organic cation transporter) member 5 (OCTN2) gene and the SNP location therein.
[0291] Accession No.: AC023861.3
[0292] FIG. 183 shows a structure of SLC22A1 solute carrier family 22 (organic cation transporter) member 1 (OCT1) gene and the SNP location therein.
[0293] Accession No.: AL35625.5
[0294] FIG. 184 shows a structure of SLC22A2 solute carrier family 22 (organic cation transporter) member 2 (OCT2) gene and the SNP location therein.
[0295] Accession No.: AL162582.18
[0296] FIG. 185 shows a structure of SLC10A2 solute carrier family 10 (sodium/bile acid cotransporter family) member 2 (NTCP) gene and the SNP location therein.
[0297] Accession No.: AL157789.6
[0298] FIG. 186 shows a structure of SLC15A1 solute carrier family 15 (oligopeptide transporter) member 1 (PEPT1) gene and the SNP location therein.
[0299] Accession No.: AL353574.8 and AL391670.6
[0300] FIG. 187 shows a structure of microsomal epoxide hydrolase 1 (EPHX1) gene and the SNP location therein.
[0301] Accession No.: AC058782.8
[0302] FIG. 188 shows a structure of cytoplasmic epoxide hydrolase (EPHX2) gene and the SNP location therein.
[0303] Accession No.: AC010856.3
[0304] FIG. 189 shows a structure of catechol-O-methyl transferase (COMT) gene and the SNP location therein.
[0305] Accession No.: AC000080.2
[0306] FIG. 190 shows a structure of guanidinoacetate N-methyl transferase (GAMT) gene and the SNP location therein.
[0307] Accession No.: NT—000879.1
[0308] FIG. 191 shows a structure of phenyl ethanolamine N-methyl transferase (PNMT) gene and the SNP location therein.
[0309] Accession No.: AC040933.3
[0310] FIG. 192 shows a structure of histamine N-methyl transferase (HNMT) gene and the SNP location therein.
[0311] Accession No.: AC019304.3
[0312] FIG. 193 shows a structure of nicotinamide N-methyl transferase (NNMT) gene and the SNP location therein.
[0313] Accession No.: AC019290.3
[0314] FIG. 194 shows a structure of phosphatidylethanolamine N-methyl transferase (PEMT) gene and the SNP location therein.
[0315] Accession No.: AC020558.3
[0316] FIG. 195 shows a structure of aldehyde dehydrogenase 1 family member A1 (ALDH1A1) gene and the SNP location therein.
[0317] Accession No.: AC009284.2 and AL162416.3
[0318] FIG. 196 shows a structure of aldehyde dehydrogenase 1 family member A2 (ALDH1A2) gene and the SNP location therein.
[0319] Accession No.: AC025431.7 and AC012653.8
[0320] FIG. 197 shows a structure of aldehyde dehydrogenase 1 family member A3 (ALDH1A3) gene and the SNP location therein.
[0321] Accession No.: AC015712.7
[0322] FIG. 198 shows a structure of aldehyde dehydrogenase 1 family member B1 (ALDH1B1) gene and the SNP location therein.
[0323] Accession No.: AL135785.9
[0324] FIG. 199A shows a structure of formyl tetrahydrofolate dehydrogenase (ALDH1L1) gene and the SNP location therein.
[0325] Accession No.: AC079848.6
[0326] FIG. 199B shows a structure of fornyl tetrahydrofolate dehydrogenase (ALDH1L1) gene and the SNP location therein. (continuation of FIG. 199A)
[0327] Accession No.: AC079848.6
[0328] FIG. 200 shows a structure of aldehyde dehydrogenase 2 (ALDH2) gene and the SNP location therein.
[0329] Accession No.: AC002996.1 and AC003029.2
[0330] FIG. 201 shows a structure of aldehyde dehydrogenase 3 family member A1 (ALDH3A1) gene and the SNP location therein.
[0331] Accession No.: AC005722.1
[0332] FIG. 202 shows a structure of aldehyde dehydrogenase 3 family member A2 (ALDH3A2) gene and the SNP location therein.
[0333] Accession No.: AC005722.1
[0334] FIG. 203 shows a structure of aldehyde dehydrogenase 3 family member B1 (ALDH3B1) gene and the SNP location therein.
[0335] Accession No.: AC004923.2
[0336] FIG. 204 shows a structure of aldehyde dehydrogenase 3 family member B2 (ALDH3B2) gene and the SNP location therein.
[0337] Accession No.: AC021987.3
[0338] FIG. 205 shows a structure of aldehyde dehydrogenase 5 family member A1 (ALDH5A1) gene and the SNP location therein.
[0339] Accession No.: AL031230.1
[0340] FIG. 206 shows a structure of aldehyde dehydrogenase 6 family member A1 (ALDH6A1) gene and the SNP location therein.
[0341] Accession No.: AC005484.2
[0342] FIG. 207 shows a structure of aldehyde dehydrogenase 8 family member A1 (ALDH8A1) gene and the SNP location therein.
[0343] Accession No.: AL445190.9 and AL021939.1
[0344] FIG. 208 shows a structure of aldehyde dehydrogenase 9 family member A1 (ALDH9A1) gene and the SNP location therein.
[0345] Accession No.: AL451074.4
[0346] FIG. 209 shows a structure of alcohol dehydrogenase 1 (ADH1) gene and the SNP location therein.
[0347] Accession No.: AP002027.1
[0348] FIG. 210 shows a structure of alcohol dehydrogenase 2 (ADH2) gene and the SNP location therein.
[0349] Accession No.: AP002027.1
[0350] FIG. 211 shows a structure of alcohol dehydrogenase 3 (ADH3) gene and the SNP location therein.
[0351] Accession No.: AP002027.1
[0352] FIG. 212 shows a structure of alcohol dehydrogenase 4 (ADH4) gene and the SNP location therein.
[0353] Accession No.: AP002026.1
[0354] FIG. 213 shows a structure of alcohol dehydrogenase 5 (ADH5) gene and the SNP location therein.
[0355] Accession No.: AC019131.4
[0356] FIG. 214 shows a structure of alcohol dehydrogenase 6 (ADH6) gene and the SNP location therein.
[0357] Accession No.: AP002026.1
[0358] FIG. 215 shows a structure of alcohol dehydrogenase 7 (ADH7) gene and the SNP location therein.
[0359] Accession No.: AC027065.3
[0360] FIG. 216 shows a structure of short-chain alcohol dehydrogenase family gene (HEP27) and the SNP location therein.
[0361] Accession No.: AL135999.3
[0362] FIG. 217 shows a structure of UDP glycosyltransferase 1 family polypeptide A1 (UGT1A1) and the SNP location therein.
[0363] Accession No.: AC006985.2
[0364] FIG. 218 shows a structure of UDP glycosyltransferase 2 family polypeptide A1 (UGT2A1) and the SNP location therein.
[0365] Accession No.: AC011254.3
[0366] FIG. 219 shows a structure of UDP glycosyltransferase 2 family polypeptide B15 (UGT2B15) and the SNP location therein.
[0367] Accession No.: AC019173.4
[0368] FIG. 220 shows a structure of UDP glycosyltransferase 8 (UGT8) and the SNP location therein.
[0369] Accession No.: U31353.1
[0370] FIG. 221 shows a structure of glutathione S transferase A1 (GSTA1) gene and the SNP location therein.
[0371] Accession No.: AC021133.4
[0372] FIG. 222 shows a structure of glutathione S transferase A4 (GSTA4) gene and the SNP location therein.
[0373] Accession No.: AC025085.4
[0374] FIG. 223 shows a structure of glutathione S transferase M1 (GSTM1) gene and the SNP location therein.
[0375] Accession No.: AC000032.7
[0376] FIG. 224 shows a structure of glutathione S transferase M2 (GSTM2) gene and the SNP location therein.
[0377] Accession No.: AC000031.5
[0378] FIG. 225 shows a structure of glutathione S transferase Z1 (GSTZ1) gene and the SNP location therein.
[0379] Accession No.: AC007954.7
[0380] FIG. 226 shows a structure of glutathione S transferase Pi (GSTPi) gene and the SNP location therein.
[0381] Accession No.: X08058.1 and M24485.1
[0382] FIG. 227 shows a structure of glutathione S transferase T1 (GSTT1) gene and the SNP location therein.
[0383] Accession No.: AF240786.1 and AP000351.3
[0384] FIG. 228 shows a structure of microsomal glutathione S transferase 1 (MGST1) gene and the SNP location therein.
[0385] Accession No.: AC007528.5
[0386] FIG. 229 shows a structure of microsomal glutathione S transferase 1-like 1 (MGST1L1) gene and the SNP location therein.
[0387] Accession No.: AC007936.2
[0388] FIG. 230 shows a structure of microsomal glutathione S transferase T2 (MGST2) gene and the SNP location therein.
[0389] Accession No.: AC019049.4
[0390] FIG. 231 shows a structure of microsomal glutathione S transferase T3 (MGST3) gene and the SNP location therein.
[0391] Accession No.: AC064827.2
[0392] FIG. 232 shows a structure of sulfotransferase 1A1 (SULT1A1/STP1) gene and the SNP location therein.
[0393] Accession No.: U52852.2
[0394] FIG. 233 shows a structure of sulfotransferase 1A2 (SULT1A2/STP2) gene and the SNP location therein.
[0395] Accession No.: U33886.1, U34804.1 and AC020765.5
[0396] FIG. 234 shows a structure of sulfctransferase 1A3 (SULT1A3/STM/HAST) gene and the SNP location therein
[0397] Accession No.: L34160.1 and AC012645.4
[0398] FIG. 235 shows a structure of sulfotransferase 1C1 (SULT1C1) gene and the SNP location therein.
[0399] Accession No.: AC019100.4
[0400] FIG. 236 shows a structure of sulfotransferase 1C2 (SULT1C2) gene and the SNP location therein.
[0401] Accession No.: AF186263.1
[0402] FIG. 237 shows a structure of sulfotransferase 2A1 (SULT2A1) gene and the SNP location therein.
[0403] Accession No.: AC024582.4, AC008745.5, NT011190.1, and AC024582.4
[0404] FIG. 238 shows a structure of sulfotransferase 2B1 (SULT2B1) gene and the SNP location therein.
[0405] Accession No.: AC040922.2 and AC008403.6
[0406] FIG. 239 shows a structure of sulfotransferase-associated protein 3 (SULTX3) gene and the SNP location therein.
[0407] Accession No.: Z97055.1
[0408] FIG. 240 shows a structure of tyrosyl protein sulfotransferase 1 (TPST1) gene and the SNP location therein.
[0409] Accession No.: AC026281.5
[0410] FIG. 241 shows a structure of tyrosyl protein sulfotransferase 2 (TPST2) gene and the SNP location therein.
[0411] Accession No.: Z95115.1
[0412] FIG. 242 shows a structure of cerebroside sulfotransferase (CST) gene and the SNP location therein.
[0413] Accession No.: AC005006.2
[0414] FIG. 243 shows a structure of thyroid hormone sulfotransferase (ST1B2) gene and the SNP location therein.
[0415] Accession No.: AC027059.2
[0416] FIG. 244 shows a structure of carbohydorate sulfotransferase 1 (CHST1) gene and the SNP location therein.
[0417] Accession No.: NT—008982.1
[0418] FIG. 245 shows a structure of carbohydorate sulfotransferase 2 (CHST2) gene and the SNP location therein.
[0419] Accession No.: AC055737.10
[0420] FIG. 246 shows a structure of carbohydorate sulfotransferase 3 (CHST3) gene and the SNP location therein.
[0421] Accession No.: AC073370.3
[0422] FIG. 247 shows a structure of carbohydorate sulfotransferase 4 (CHST4) gene and the SNP location therein.
[0423] Accession No.: AC010547.5
[0424] FIG. 248 shows a structure of carbohydorate sulfotransferase 5 (CHST5) gene and the SNP location therein.
[0425] Accession No.: AC025287.3
[0426] FIG. 249 shows a structure of HNK-sulfotransferase (HNK-1ST) gene and the SNP location therein.
[0427] Accession No.: AC012493.4
[0428] FIG. 250 shows a structure of estrogen sulfotransferase (STE) gene and the SNP location therein.
[0429] Accession No.: AC074273.1
[0430] FIG. 251 shows a structure of NAD (P)H: quinone oxidoreductase 1 (NQO1) gene and the SNP location therein.
[0431] Accession No.: M81596.1
[0432] FIG. 252 shows a structure of NRH: quinone oxidoreductase 2 (NQO2) gene and the SNP location therein.
[0433] Accession No.: AB050248.1
[0434] FIG. 253 shows a structure of p53-inducible gene 3 (PIG3) in a quinone oxidoreductase homolog and the SNP location therein.
[0435] Accession No.: AC008073.3
[0436] FIG. 254 shows a structure of NADH-dehydrogenase(ubiquinone) 1&agr;-subcomplex 1 (NDUFA1) gene and the SNP location therein.
[0437] Accession No.: AC002477.1
[0438] FIG. 255 shows a structure of NADH-dehydrogenase(ubiquinone) 1&agr;-subcomplex 2 (NDUFA2) gene and the SNP location therein.
[0439] Accession No.: AB054976.1
[0440] FIG. 256 shows a structure of NADH-dehydrogenase(ubiquinone) 1&agr;-subcomplex 3 (NDUFA3) gene and the SNP location therein.
[0441] Accession No.: AC009968.6
[0442] FIG. 257 shows a structure of NADH-dehydrogenase(ubiquinone) 1&agr;-subcomplex 5 (NDUFA5) gene and the SNP location therein.
[0443] Accession No.: AC073323.5
[0444] FIG. 258 shows a structure of NADH-dehydrogenase(ubiquinone) 1&agr;-subcomplex 6 (NDUFA6) gene and the SNP location therein.
[0445] Accession No.: AL021878.1
[0446] FIG. 259 shows a structure of NADH-dehydrogenase(ubiquinone) 1&agr;-subcomplex 7 (NDUFA7) gene and the SNP location therein.
[0447] Accession No.: AC010323.6
[0448] FIG. 260 shows a structure of NADH-dehydrogenase(ubiquinone) 1&agr;-subcomplex 8 (NDUFA8) gene and the SNP location therein.
[0449] Accession No.: AL162423.10
[0450] FIG. 261 shows a structure of NADH-dehydrogenase(ubiquinone) 1&agr;-subcomplex 9 (NDUFA9) gene and the SNP location therein.
[0451] Accession No.: AC005832.1
[0452] FIG. 262 shows a structure of NADH-dehydrogenase(ubiquinone) 1&agr;-subcomplex 10 (NDUFA10) gene and the SNP location therein.
[0453] Accession No.: AC013469.8
[0454] FIG. 263 shows a structure of NADH-dehydrogenase(ubiquinone) 1&agr;/&bgr;-subcomplex 1 (NDUFAB1) gene and the SNP location therein.
[0455] Accession No.: AC008870.6
[0456] FIG. 264 shows a structure of NADH-dehydrogenase(ubiquinone) 1&bgr;-subcomplex 3 (NDUFB3) gene and the SNP location therein.
[0457] Accession No.: AC007272.3
[0458] FIG. 265 shows a structure of NADH-dehydrogenase(ubiquinone) 1&bgr;-subcomplex 5 (NDUFB5) gene and the SNP location therein.
[0459] Accession No.: AC068361.2
[0460] FIG. 266 shows a structure of NADH-dehydrogenase(ubiquinone) 1&bgr;-subcomplex 7 (NDUFB7) gene and the SNP location therein.
[0461] Accession No.: AC010527.4
[0462] FIG. 267 shows a structure of NADH-dehydrogenase(ubiquinone) Fe—S protein 1 (NDUFS1) gene and the SNP location therein.
[0463] Accession No.: AC007383.4
[0464] FIG. 268 shows a structure of NADH-dehydrogenase(ubiquinone) Fe—S protein 3 (NDUFS3) gene and the SNP location therein.
[0465] Accession No.: AC067943.4
[0466] FIG. 269 shows a structure of NADH-dehydrogenase(ubiquinone) Fe—S protein 4 (NDUFS4) gene and the SNP location therein.
[0467] Accession No.: AC024569.3
[0468] FIG. 270 shows a structure of NADH-dehydrogenase(ubiquinone) Fe—S protein 5 (NDUFS5) gene and the SNP location therein.
[0469] Accession No.: AL139015.5
[0470] FIG. 271 shows a structure of NADH-dehydrogenase(ubiquinone) Fe—S protein 6 (NDUFS6) gene and the SNP location therein.
[0471] Accession No.: AC026443.2
[0472] FIG. 272 shows a structure of NADH-dehydrogenase(ubiquinone) Fe—S protein 8 (NDUFS8) gene and the SNP location therein.
[0473] Accession No.: AC034259.2
[0474] FIG. 273 shows a structure of NADH-dehydrogenase(ubiquinone) flavoprotein 1 (NDUFV1) gene and the SNP location therein.
[0475] Accession No.: NT—009304.2
[0476] FIG. 274 shows a structure of NADH-dehydrogenase(ubiquinone) flavoprotein 2 (NDUFV2) gene and the SNP location therein.
[0477] Accession No.: NT—011024.2
[0478] FIG. 275 shows a structure of NADH-dehydrogenase(ubiquinone) flavoprotein 3 (NDUFV3) gene and the SNP location therein.
[0479] Accession No.: AP001748.1
[0480] FIG. 276 shows a structure of gamma-glutamyl transferase 1 (GGT1) gene and the SNP location therein.
[0481] Accession No.: D87002.1
[0482] FIG. 277 shows a structure of transglutaminase 1 (TGM1) gene and the SNP location therein.
[0483] Accession No.: M98447.1
[0484] FIG. 278 shows a structure of cytochrome P450 subfamily 1 (aromatic compound-inducible) polypeptide 1 (CYP1A1) gene and the SNP location therein.
[0485] Accession No.: X04300.1 and AC020705.4
[0486] FIG. 279 shows a structure of cytochrome P450 subfamily 1 (aromatic compound-inducible) polypeptide 2 (CYP1A2) gene and the SNP location therein.
[0487] Accession No.: AC020705.4
[0488] FIG. 280 shows a structure of cytochrome P450 subfamily 1 (dioxin-inducible) polypeptide 1 (CYP1B1) gene and the SNP location therein.
[0489] Accession No.: AC009229.4
[0490] FIG. 281 shows a structure of cytochrome P450 subfamily 3A (aromatic compound-inducible) polypeptide 4 (CYP3A4) gene and the SNP location therein.
[0491] Accession No.: AF280107.1
[0492] FIG. 282 shows a structure of cytochrome P450 subfamily 3A (aromatic compound-inducible) polypeptide 5 (CYP3A5) gene and the SNP location therein.
[0493] Accession No.: AC005020.5
[0494] FIG. 283 shows a structure of cytochrome P450 subfamily 3A polypeptide 7 (CYP3A7) gene and the SNP location therein.
[0495] Accession No.: AF280107.1
[0496] FIG. 284 shows a structure of cytochrome P450 polypeptide 43 (CYP3A43) gene and the SNP location therein.
[0497] Accession No.: AC011904.3
[0498] FIG. 285 shows a structure of cytochrome P450 subfamily IVB polypeptide 1 (CYP4B1) gene and the SNP location therein.
[0499] Accession No.: AL356793.10
[0500] FIG. 286 shows a structure of cytochrome P450 subfamily IVF polypeptide 2 (CYP4F2) gene and the SNP location therein.
[0501] Accession No.: AC005336.1
[0502] FIG. 287 shows a structure of cytochrome P450 subfamily IVF polypeptide 3 (CYP4F3) gene and the SNP location therein.
[0503] Accession No.: AD000685. 1
[0504] FIG. 288 shows a structure of cytochrome P450 subfamily IVF polypeptide 8 (CYP4F8) gene and the SNP location therein.
[0505] Accession No.: AC068845.3
[0506] FIG. 289 shows a structure of cytochrome P450 subfamily XXVIIA polypeptide 1 (CYP27A1) gene and the SNP location therein.
[0507] Accession No.: AC009974.7
[0508] FIG. 290 shows a structure of cytochrome P450 subfamily XXVIIB polypeptide 1 (CYP27B1) gene and the SNP location therein.
[0509] Accession No.: AC025165.27
[0510] FIG. 291 shows a structure of allylacetamide deacetylase (AADAC) gene and the SNP location therein.
[0511] Accession No.: AC068647.4
[0512] FIG. 292 shows a structure of carboxyl esterase 1 (CES1) gene and the SNP location therein
[0513] Accession No.: AC007602.4
[0514] FIG. 293 shows a structure of carboxyl esterase 2 (CES2) gene and the SNP location therein
[0515] Accession No.: AC027131.4
[0516] FIG. 294 shows a structure of granzyme A (GZMA) gene and the SNP location therein.
[0517] Accession No.: AC091977.1
[0518] FIG. 295 shows a structure of granzyme B (GZMB) gene and the SNP location therein.
[0519] Accession No.: AL136018.3
[0520] FIG. 296 shows a structure of esterase D/formylglutathione hydrolase (ESD) gene and the SNP location therein.
[0521] Accession No.: AL136958.9
[0522] FIG. 297A shows a structure of carboxyl ester lipase (bile salt-stimulated lipase) (CEL) gene and the SNP location therein.
[0523] Accession No.: AL138750.8, AL162417.20 and AF072711.1
[0524] FIG. 297B shows a structure of carboxyl ester lipase (bile salt-stimulated lipase) (CEL) gene and the SNP location therein. (continuation of FIG. 297A)
[0525] Accession No.: AL138750., AL162417.20 and AF072711.1
[0526] FIG. 298 shows a structure of interLeukin 17 (cytotoxic T lymphocyte-associated serine esterase 8) (IL17) gene and the SNP location therein.
[0527] Accession No.: AL355513.11
[0528] FIG. 299 shows a structure of ubiquitin carboxyl terminal esterase L3 (ubiquitin thiol esterase) (UCHL3) gene and the SNP location therein.
[0529] Accession No.: AL137244.28
[0530] FIG. 300 shows a structure of dolichyl-diphosphooligosaccharide-protein glycosyltransferase (DDOST) gene and the SNP location therein.
[0531] Accession No.: D89060
[0532] FIG. 301 shows a structure of neuropathy target esterase (NTE) gene and the SNP location therein.
[0533] Accession No.: AC021153
[0534] FIG. 302 shows a structure of L1 cell adhesion molecule (L1CAM) gene and the SNP location therein.
[0535] Accession No.: U52112
[0536] FIG. 303 shows a structure of arylalkylamine N-acetyltransferase (AANAT) gene and the SNP location therein.
[0537] Accession No.: U40391
[0538] FIG. 304 shows a structure of N-acetyltransferase homolog (ARD1) gene of Saccharomyces cerevisiae and the SNP location therein.
[0539] Accession No.: U52112
[0540] FIG. 305 shows a structure of N-acetyltransferase (NAT1) gene and the SNP location therein.
[0541] Accession No.: X17059
[0542] FIG. 306 shows a structure of N-acetyltransferase 2 (NAT2) gene and the SNP location therein.
[0543] Accession No.: D10870
[0544] FIG. 307 shows a structure of ATP-binding cassette subfamily B member 2 (ABCB2) gene and the SNP location therein.
[0545] Accession No.: X66401
[0546] FIG. 308 shows a structure of ATP-binding cassette subfamily B member 3 (ABCB3) gene and the SNP location therein.
[0547] Accession No.: X66401
[0548] FIG. 309 shows a structure of glutathione S transferase M3 (GSTM3) gene and the SNP location therein.
[0549] Accession No.: AF043105.1
[0550] FIG. 310 shows a structure of glutathione S transferase M4 (GSTM4) gene and the SNP location therein.
[0551] Accession No.: M96233.1
[0552] FIG. 311 shows a structure of aldehyde dehydrogenase 7 (ALDH7) gene and the SNP location therein.
[0553] Accession No.: AC004923
[0554] FIG. 312 shows a structure of high-mobility group protein 17-like 1 (HMG17L1) gene and the SNP location therein.
[0555] Accession No.: Z97055.1
[0556] FIG. 313 shows a printed representation of submissions from Laboratory for Genotyping, The SNP Research Center, The Institute of Physical and Chemical Research (RIKEN) on the IMS-JST JSNP database website
GENERAL DESCRIPTION OF THE INVENTION[0557] The present invention provides a method of analysis of drug metabolizing enzymes by analysis of SNPs associated with their encoding genes. In some embodiments, the method of the present invention can be used in the selection of drugs based on, e.g., particular characteristics of an individual patient or on characteristics of a target disease.
[0558] In some embodiments, the present invention provides a method for detecting a genetic polymorphism associated with a DME, wherein an oligonucleotide probe and/or oligonucleotide primer is created so as to include the genetic polymorphism site from genetic polymorphism data in a gene for encoding a drug metabolizing enzyme or so as to include the genetic polymorphism site in an amplified fragment when the gene encoding the drug metabolizing enzyme has been amplified, and wherein at least one genetic polymorphism in a gene for encoding the target drug metabolizing enzyme is detected using the oligonucleotide probe and/or oligonucleotide primer thus obtained.
[0559] The present invention further provides methods for evaluating a drug, wherein the effectiveness and safety of a drug metabolized by the drug metabolizing enzyme are evaluated based on the results obtained by the detection method.
[0560] In some embodiments, the present invention provides a method for screening a drug, wherein the drug to be used is selected based on the results obtained in the evaluation method. In other embodiments, the present invention provides a method for screening a drug, wherein the genetic polymorphism data associated with the gene encoding a DME in a control subject is compared to the genetic polymorphism data associated with the same gene in a test subject, and wherein a drug to be used is selected from the results of an analysis of the effectiveness and/or safety of the drugs metabolized by the drug metabolizing enzyme. 1 TABLE 1 SEQ ID GENE NO LOCATION SEQ. NO. ABCB2 1 5′flanking − 673 agctaagagtcaaagcaccc G/C ctttttccaccagcctcgcg 1 ABCB2 2 5′flanking − 646 ccaccagcctcgcgtgcctg T/G tcccttcacggacactctag 2 ABCB2 3 5′flanking − 563 ttgcaagcgctggctgctac A/C ggcgacctccctgcgctccc 3 ABCB2 4 5′flanking − 236 gctttgcgcgcggcgctaac G/T tgtgtagggcagatctgccc 4 ABCB2 5 Intron3 + 408 aaggaaactgaggccaagac C/T ctaaatgctgaaactgcaca 5 ABCB2 6 Exon4 + 153 ccctcaccatggtcaccctg A/G tcaccctgcctctgcttttc 6 ABCB2 7 Intron4 + 289 gtatttctttagcatccaag G/T ggcatagctgtgtctctttc 7 ABCB2 8 Intron4 + 291 atttctttagcatccaaggg C/G catagctgtgtctctttctc 8 ABCB2 9 Intron5 − 63 ttccttcaggttaatgactg C/T ggttctttgtgtcccctcca 9 ABCB2 10 Intron7 − 185 gtctctgcccttgtctttgc C/T gcttcttctatctctactcc 10 ABCB2 11 3′flanking + 71 agcgcacttttcagctgcgg G/A tgtctcctcttttatcatcc 11 ABCB2 12 3′flanking + 129 aactgcatcaccttttccct T/C aagctttttaattcctatga 12 ABCB2 13 3′flanking + 459 cattcagggaggcccaggtc G/A tgtgacgtcgacagttgctg 13 ABCB4 1 exon3 + 3 aacacccttattttatagat C/T caatgactgagtcaagaatt 14 ABCB4 2 intron3 + 45 cagcatctctacttatacca T/C gctctgctttaaggttctct 15 ABCB4 3 intron3 + 498 actcaaataggtggtaggag C/T agagacaattcaatacagac 16 ABCB4 4 intron3 + 515 gagcagagacaattcaatac A/G gacagaagtcttagatgaga 17 ABCB4 5 intron3 + 1030 tagttttgcaatgtagaatt G/C aaaaagtgatagatggtgtt 18 ABCB4 6 intron6 + 1437 gttaagcctgcttcaatcaa G/A ttagttatattcttgttcta 19 ABCB4 7 intron6 + 2449 ttgacttagcgacactgtta G/A catacttatctttcctgtgt 20 ABCB4 8 intron7 + 451 ccttgctgcacctgtgctgt A/C taagtttggcttattatagt 21 ABCB4 9 intron7 + 530 agtagagacaggctggcgat C/G acaccggacagagctaactg 22 ABCB4 10 intron7 − 152 aacagaatcatgaaattaag T/C tgttaatgatttgaaggcct 23 ABCB4 11 exon8 + 40 aggataaattgtttatgtcg C/T ctgggtaccatcatggccat 24 ABCB4 12 intron8 + 130 ctggttgactccagatatca T/C agaaggagttgtaaaattct 25 ABCB4 13 intron8 + 248 aatacacaggaagcttctaa A/G taaagtaaggaagtcactct 26 ABCB4 14 intron8 + 531 ctaaagagtgaatggattca A/G tacgtcccttggaactcacc 27 ABCB4 15 intron8 + 4240 ctgaggttccagcttatctc T/A tagagatgtttacttagtct 28 ABCB4 16 intron8 + 4343 tgttagaagaaaaaaaggtt C/T atattacaagagggtctgac 29 ABCB4 17 intron8 + 4677 cccaagatatcttcataact G/C tccatagtgcctagggtgcc 30 ABCB4 18 intron9 + 113 tttacccagattcacctatt A/G agacttcatctcaaaaaaaa 31 ABCB4 19 intron9 + 982 tgtcctatacagtttttgtt T/A taagtttagtaaattgatta 32 ABCB4 20 intron11 + 457 tccagcttgggtgacagagt A/G agacttcatctcaaaaaaaa 33 ABCB4 21 intron11 + 1337 tactcttggggagcctatca C/G cagggtgggtcagatatagc 34 ABCB4 22 exon12 + 3 tgtttcttttctgtccagat A/T ctctcggcatttagtgacaa 35 ABCB4 23 intron12 + 1288 cagaccacactaaccctcag T/C tggacctcaggatgtcagtg 36 ABCB4 24 intron13 + 206 tgtggataagaaaatagcat G/A tggttagaccatttgtgaaa 37 ABCB4 25 intron13 + 988 cagtcggtttggaagcttgc T/C accctttcttcacttcctca 38 ABCB4 26 intron13 + (1413-1414) tttatcttcacttatgtttt (T) ctcagttaagttatgctaat 39 ABCB4 26 intron13 + (1413-1414) tttatcttcacttatgtttt ctcagttaagttatgctaat 40 ABCB4 27 intron13 + 1931 cttgcaaatgttgctcttcc A/G caaaaaaaaaaggaaaggat 41 ABCB4 28 intron23 + 784 agtatctcctaaactcttgc T/C atgcaggaaaaattatttta 42 ABCB4 29 intron25 + 158 gaaatattttactgtattaa T/C gtctagaacttaaatataag 43 ABCB4 30 intron25 + 2920 ctgagtcttcctatacatct T/A ttccattcctcggatgctgt 44 ABCB4 31 intron29 + 411 cttctcttaccttgaattct A/C ggctctcgaactttgacttt 45 ABCB4 32 intron32 + 458 agaaaatgaaattgccctac T/C gagctaactctgaaagcaca 46 EPHX1 1 intron1 + 110 tgcaaaatgtgtcttactag C/T ttctagtgcataaaatattg 47 EPHX1 2 intron1 + 143 aaatattggtggagctcttc G/A ctgtgctgggccagtcacca 48 EPHX1 3 intron1 + 1097 aatccagagagggagataga T/G tggaagttcaagggtggaca 49 EPHX1 4 intron1 + 1717 ttccaagacagagcgagggg T/C gctgctggggcgtggtttgc 50 EPHX1 5 intron1 + 1772 aactcgatgctttctcctcc G/T tctgggtcctaactgcagtg 51 EPHX1 6 intron1 + 2054 gaaatgtaacaggcaacact A/G tggacacagaaagtagatta 52 EPHX1 7 intron2 + 1414 atttccaaaatctgtttggg G/T gtaactgaaacacttgggaa 53 EPHX1 8 exon3 + 174 taccctcacttcaagactaa G/A attgaaggtatgtttgcaaa 54 EPHX1 9 intron3 + 6583 ctgtcaataccatgaagggg G/C ggcgggggcactaagggtgg 55 EPHX1 10 intron4 + 34 agaaggttccataactgccc G/A tcctcgccaagggtgggccc 56 EPHX1 11 intron4 + 63 aagggtgggcccggtgttcc C/T accaggctctccttccggcg 57 EPHX1 12 intron5 + 154 gcagtgcctgaggcacgttg G/A cttggatcctcctgtctgta 58 EPHX1 13 intron5 + 276 tgctggaccaagctctggga T/C agccctgagcagaactcccc 59 EPHX1 14 exon6 + 130 gatgtggagctgctgtaccc C/T gtcaaggagaaggtattcta 60 EPHX1 15 intron8 + 206 ggtgcctggctcccgggcgg C/A cctcagtaccgctccccagt 61 EPHX1 16 intron8 + 353 tggccctcccagaaaagaga A/G ggccctcagtgaggggagag 62 EPHX1 17 3′flanking + 708 aggtgcagactcatgcactc A/G ggccctcagtgaggggagag 63 EPHX2 1 5′flanking − (523-522) aaagtcactggatatgcccc (C) tcccccgccccccaacacgg 64 EPHX2 1 5′flanking − (523-522) aaagtcactggatatgcccc tcccccgccccccaacacgg 65 EPHX2 2 5′flanking − 522 aaagtcactggatatgcccc T/C cccccgccccccaacacggt 66 EPHX2 3 5′flanking − 521 aagtcactggatatgcccct C/T ccccgccccccaacacggtc 67 EPHX2 4 5′flanking − 516 actggatatgcccctccccc G/C ccccccaacacggtcttatg 68 EPHX2 5 5′flanking − 515 ctggatatgcccctcccccg C/G cccccaacacggtcttatgt 69 EPHX2 6 Intron1 − 74 tggctgcttctcaatgaata T/C gaacagtgtctgtttccatg 70 EPHX2 7 Intron3 + 72 gagcattaggtcagaatcca T/C tgaagtgagctttgagatca 71 EPHX2 8 Intron4 + 473 gtgtgtctctagtttaatct A/G caaaaggtgattgaatggag 72 EPHX2 9 Intron5 + 276 caagagtgggatgttcaagg C/T catcctgacctcacttttga 73 EPHX2 10 Intron8 + 8 tctgctcctcccggtgggtg T/C gctgtcttgcagctgtctta 74 EPHX2 11 Intron9 + 1573 atgtcgtgaagactgatgaa C/T gatggacggctgcactgctc 75 EPHX2 12 Intron10 + 207 gaacaggatggagatgagct T/C gtttatttgtcttttaatga 76 EPHX2 13 Intron12 + 911 tgaagagacctcgacatgtc G/T catcccacatactacaggga 77 EPHX2 14 Intron12 + 2425 atcttctcagctgagcaaac C/T gaggctcagagggcttaacc 78 EPHX2 15 Intron12 + 2460 ttaaccccaactggcccaag G/A ccaggtacatgattgggtca 79 EPHX2 16 Intron12 − 281 aagtcctttcaagagattat T/C ataagtagtaccttctcatt 80 EPHX2 17 Intron12 − 268 agattattataagtagtacc T/G tctcattataggaatattga 81 EPHX2 18 Exon13 + 50 cctgagtcggactttcaaaa G/T cctcttcagagcaagcgatg 82 EPHX2 19 Intron13 + 1739 ttgtcgtaacagggttttca G/T atgagcatatttcctttgta 83 EPHX2 20 Exon14 + 33 atgcataaagtctgtgaagc G/A ggtaagagacatgcttggga 84 EPHX2 21 Intron14 + 314 ggattgagagcttacctcta T/C gggggtcacctcgtgtatgc 85 EPHX2 22 Intron14 + 878 attcccttattccttcacac C/T gtctgtcactcattcattca 86 EPHX2 23 Intron14 + 948 gcacaggctgggtatgaagc T/C ggggctgcatgctcagctac 87 EPHX2 24 Intron15 + 259 agagggttttcactactttt C/T agtcatggctcctcagagaa 88 EPHX2 25 Intron16 + 459 tcctcatttgtcaagcagaa G/C atgagtttccaatctctggg 89 EPHX2 26 Intron16 + 645 gtaagtgaacacactgctac G/A atgaaaatgaccaaactgca 90 EPHX2 27 Intron16 + 985 gtcattatcatcatatgacc G/A atgaaaatgaccaaactgca 91 EPHX2 28 3′flanking + 12 aggtggccttacacacatct T/C gcatggatggcagcattgtt 92 EPHX2 29 3′flanking + 374 tgttcacggagaatgcacgg C/T atggggatgaaccctttccc 93 EPHX2 30 3′flanking + 544 tagccacctgcctttctccc G/A gcttccctagcagagtttgc 94 GAMT 1 intron1 + 429 ctcggaaagctgagctcagg G/A agacagctgtccccggggtg 95 GAMT 2 3′flanking +626 cactgacctccttgccctga G/A agaaggccggctcctgtgct 96 NNMT 1 5′flanking − 228 ataattttcctgacgagctc A/T agtgctcccctctggtctaca 97 NNMT 2 intron1 + 44 ccccactaatgtgagtcata T/C agatggagtctcagggcacg 98 NNMT 3 intron1 + 149 ggataaaaaacgaatattggt A/G tagcgattccacagtttaca 99 NNMT 4 intron2 + 158 agataggcccatgtgtgtgc G/A tgttagtaaatttgtgtatg 100 NNMT 5 intron2 + 433 gctgtagccatccaagccta T/C agaacttggctgtgagtgtg 101 NNMT 6 intron2 − 3064 atcatctgactggtaagttc C/T agttctgtggtaactcaagt 102 NNMT 7 intron2 − 260 atttcatggagggaagtcca T/C ggtagaagcaggctgctagg 103 NNMT 8 3′flanking + 71 ggctcagtggttggggccca A/G tggttcatctaggacgggac 104 PNMT 1 5′flanking − 390 aagaggtgaatggctgcggg G/A ggctggagaagagagatggg 105 PEMT 1 exon2 − 4 agctcagcagacctcctggc C/T gtggtgggtagctcctttcc 106 PEMT 2 intron4 + 39 actgtccagacgggagtatc C/T cactgcttggtgagccccac 107 PEMT 3 intron4 + 1317 accgtccccagctggcccca G/A cctcctgacatgggcctctg 108 PEMT 4 intron4 + 1355 ctggagccaggctgcagccg A/C agtgcctggccatcctggcg 109 PEMT 5 intron4 + 5925 gtccaggcactgtggcccta C/T gtgggagtctccagtctcca 110 PEMT 6 intron4 + 6028 ggcagtggtccaaggaccag G/C atggactccctcttctcacc 111 PEMT 7 intron4 + 6078 atctgtaccctcgcggactc C/T acctggcttcgtgccatcac 112 PEMT 8 intron4 + 6089 cgcggactctacctggcttc A/G tgccatcacccccgccagat 113 PEMT 9 intron4 + 6379 tcaggtgtcccctccctcat G/A cctcctcaccctgccctctc 114 PEMT 10 intron4 + 7339 tgtaaggaatcctgccaaga C/T ggcagatgcacacggggtca 115 PEMT 11 intron4 + 7619 ctcctgcacatgtgctccag A/G gaggaaaggcatttgacagg 116 PEMT 12 intron4 + 8858 ggcatgtgtgtgtgtgtgta T/G gtgtgtgagtgtgtgcatgt 117 PEMT 13 intron4 + 9029 tttctggaccagaaagcgtc G/A tcctctgccagggcctcttg 118 PEMT 14 intron4 + 9056 gccagggcctcttgcacttg C/T gggaaagctgagctgagctg 119 PEMT 15 intron4 + 9512 ctgagctgggcagcagcatt A/G ctctgtgtgctgctggcact 120 PEMT 16 intron4 + 9523 agcagcattactctgtgtgc T/C gctggcactggcctggtggg 121 PEMT 17 intron4 + 9622 gacaaagtgtacaacaaggt G/A tctcgaactgggtcagctca 122 PEMT 18 intron4 + 10776 ccattcctgggtcttctttg G/A aggctgaatgaaattccatg 123 PEMT 19 intron4 + 10912 tctgccccactttgctcaga G/C gtgcaacaaggccttcagga 124 PEMT 20 intron4 + 11590 ggacactggcctgatgcaga G/C gtgtggtctctctcctgcag 125 PEMT 21 intron4 + 12090 ggccagggcacccctaccag G/C ctgagtcccacctgtccagc 126 PEMT 22 intron4 + 12263 tacccgccttcccagatgga G/A cgggctgctcatgggactta 127 PEMT 23 intron4 + 12448 tctggtcccctctcctgctt G/A tagtttcctgggctaaaatc 128 PEMT 24 intron4 + 12730 tgggaccagtgccgccacca C/T ggcccaaggacctggtgttc 129 PEMT 25 intron4 + 13240 gggctccaggcacacagcgg T/C cccagtacacctgtcgcttt 130 PEMT 26 intron4 + 13494 tccgtggaactcagagatgg T/C acctccctgcgaggtggggc 131 PEMT 27 intron4 + 13817 aactctcccctgctgctgag A/G cagatcttggagcctcggcc 132 PEMT 28 intron4 + 14773 ccgccctgtgcttcatgccc C/T ctatgcctctcactgcctgg 133 PEMT 29 intron4 + 14951 gtcctgaggcccctcccacc G/A gagcctggggtgccgtcaca 134 PEMT 30 intron4 + 16896 gctgtgactgtcttggagac T/C gggtcttggcgggcctggtg 135 PEMT 31 intron4 + 19439 ccaggagcctctgaggcagc G/A ggggcttctcaaccacacag 136 PEMT 32 intron4 + 19559 attttgtcagcatgtcacgt C/T cctttcataatgaagcaagg 137 PEMT 33 intron4 + 20051 acagcactgcgggagccacg A/G catctgcagacgcatttgat 138 PEMT 34 intron4 + 20816 tggactctctggcgtccatc C/T agccacttcagtgcgacgtg 139 PEMT 35 intron4 + 21196 ggctggctgggccctgggat C/G atcgtgacaggctttagtgg 140 PEMT 36 intron4 + 21528 acaggtgggagccgaggctc G/T ggaggtgggccgggctgagc 141 PEMT 37 intron4 + 21596 ccgcttccccgtgctctggc C/T gtagcagaaagtgtcccact 142 PEMT 38 intron4 + 22672 agcctcccactgccttgtgg C/T tgaggggagggggccgggtc 143 PEMT 39 intron4 + 22713 tctaacgctgtcttctttgt A/T ctgaaaaccaaacaccttct 144 PEMT 40 intron4 + 23010 tgccgggcagcggggaggga G/A ggcgagtggttcccccaagt 145 PEMT 41 intron4 + 23588 gtgcaggcgccctgcatccc C/T gcagccaagttctgggcgga 146 PEMT 42 intron4 + 23627 gacactgccctgagccagga C/T ggtgaggtgggacgccttcc 147 PEMT 43 intron4 + 23941 tgaggggttgggactctaca G/A aggagagtggactcacgggg 148 PEMT 44 intron4 + 24091 gacacctcttcactgtcagc G/T ctgagacacgcccctgccct 149 PEMT 45 intron4 + 25348 caggccagttggaatcctac G/A tagagtgaaagcatctcagc 150 PEMT 46 intron4 + 25603 taagcagttaacactgatgc G/A tgatgaaaattccaacagca 151 PEMT 47 intron4 + 31540 cctccaggtggcaggaacac T/C gtgaggagcatgcaacgtgc 152 PEMT 48 intron4 + 31637 gtgggctgggacgccaggac G/A gtgaggggcttcaaggtgtg 153 PEMT 49 intron4 + 31642 ctgggacgccaggacggtga G/A gggcttcaaggtgtgtttgt 154 PEMT 50 intron4 + 35593 ggaggagctgaaagagctgg G/A gctcgggatcaggtggttca 155 PEMT 51 intron4 + 35647 actttgaggcaccaccgcac C/A tgtccgtgcgtgagggagac 156 PEMT 52 intron4 + 35862 tcccagtggtggctctgtcc C/T cgtctcagccgagcactcag 157 PEMT 53 intron4 + 35882 ccgtctcagccgagcactca T/G cggccagggtggctggactc 158 PEMT 54 intron4 + 37141 ccacaggccggatgccttga T/G acttctcagctgcagggctg 159 PEMT 55 intron4 + 38862 tggagagaccacctcagaca C/G caaggacgggcatgccatgg 160 PEMT 56 intron4 + 38872 acctcagacagcaaggacgg G/T catgccatgggtcccggcag 161 PEMT 57 intron4 + 39140 atgtctcaaatctccctccc C/T gggaaatctaggcacaggtc 162 PEMT 58 intron4 + 39635 caggcccaggagcaggtggg G/T cctcctcacaggagcagggc 163 PEMT 59 intron4 + 39713 actctgagcatgctggctcc C/T tccttctttccagggcagca 164 PEMT 60 intron4 + 40436 cctggttgtgcttcggaccc G/A gaggcagacagaggaggcct 165 PEMT 61 intron4 + 47485 acaatgactgttggagccct C/T gagcaggctgtgtcacgtgg 166 PEMT 62 intron4 + 48131 actgggggatcctgaatccc G/A cctcctgatgccagtggagc 167 PEMT 63 intron4 + 48558 cacagtgtgaactgttaggc C/G acagccacatcttgccggag 168 PEMT 64 intron4 + 48702 gagatgggggcggttcggga G/A gcaaaagcaggaaggcagaa 169 PEMT 65 intron4 + 50302 gcatgtgcatgggcagaggc T/C gttcccatctgagtgggacc 170 PEMT 66 intron4 + 54102 ggccgcgtgctcctgcagcc A/T tgggctcctctggcagttct 171 PEMT 67 intron4 + 54220 cccagggacagatcttctcc G/A ccagacgtctctttctgcct 172 PEMT 68 intron4 + 54371 gcagataatgtgcagctggg G/A tgcatgtggttgttgctccc 173 PEMT 69 exon5 + 79 tggcctgctactctctaagc G/C tcaccatcctgctcctgaac 174 PEMT 70 intron5 − 6796 ggaggaagtcagcttcttac A/C gatggtggctcccagctttc 175 PEMT 71 intron5 − 6636 ttttctcctctcaccttttg T/G gttcagaggcagaggtgtgc 176 PEMT 72 intron5 − 6448 gttgggccaggctctgacag G/A accctcgggaccagctcctg 177 PEMT 73 intron5 − 5218 ggagccctggctgaagaagc C/G ttacgaccaaggcctggagg 178 PEMT 74 intron5 − 4824 ggacaggccgggggttgagc G/A gctgcatgaaggagggaggg 179 PEMT 75 intron5 − 4249 tcaccagagtgatttcctcg C/A ggcaggtgcctggggtagcc 180 PEMT 76 intron5 − 4230 gaggcaggtgcctggggtag C/T cactgggcggggtccatgag 181 PEMT 77 intron5 − 4182 ggagagtaaggggtgggggg G/A cacttaggacagggaagctg 182 PEMT 78 intron5 − 3369 ccaggtggggccgtgtgcct G/C tggcctggtgtgtggcccag 183 PEMT 79 intron5 − 2625 cagggaagctgggccctgaa C/T gagctgggcttttgggccac 184 PEMT 80 intron5 − 1200 attattgtgagcatgggaag A/T gcacatttggtcacacatgt 185 PEMT 81 intron6 + 606 gcctggctagacgcccacca A/G tgaccctgatgatggcagca 186 PEMT 82 intron6 + 1229 tttggtccaggaagggggac G/A gcagccaggagcgtctggat 187 PEMT 83 intron7 + 716 atggagatgtgctcccccgg C/G gggtcagaggacctgcggtc 188 PEMT 84 intron7 + 1537 ctctgggggacgcataagcc G/A cctccagaggacatcagcca 189 PEMT 85 intron7 + 1718 gggcttccaggtgtctgagc T/C ccccggcatgtaggacccca 190 PEMT 86 intron7 + 2695 ggctttgggggaccctggac C/T catttctagaaaacagcctt 191 PEMT 87 intron8 + 140 ccagggctcccaggtcagag C/T ggccatggtagcttacaatg 192 PEMT 88 3′flanking + 178 tacttaggaggcgtcagggg C/T tcacctggccatggccatgg 193 PEMT 89 3′flanking + 394 gatgacactgtcattcctaa A/G tgaatggccttgtgctgacc 194 GSTM3 1 5′flanking − 144 ccaacgccggcattagtcgc G/T cctgcgcacggccctgtgga 195 ALDH5 1 5′flanking − 2808 cgttgcactgtaggactctc C/T ccacgtcccctaatcccatc 196 ALDH5 2 5′flanking − 2575 gcagttcccgcggatagaga A/G ggtccggtccttcccgctgt 197 ALDH5 3 5′flanking − 2537 tgtgggtgaactgtaaaaaa C/T tgcctgtattcaggaggata 198 ALDH5 4 5′flanking − 940 cttcaactaatctgggaaca C/T tacactctgtttaattttca 199 ALDH5 5 5′flanking − 785 tgggaaagctgaaaagggat G/T ctgagacctgtggttggggg 200 ALDH5 6 exon1 + 183 ccgacggtcaaccctaccac T/C ggggaggtcattgggcacgt 201 ALDH5 7 exon1 + 257 cgtgaaagcagcccgggaag C/T cttccgcctgggtcccccat 202 ALDH5 8 exon1 + 320 gcggggccggctgctgaacc G/T cctggcagacctagtggagc 203 ALDH5 9 exon1 + 605 acttgccccggcactcgcca C/T aggcaacactgtggttatga 204 ALDH5 10 3′flanking + 1527 aaagtgcaactgtaagaccc G/A tagagaaaaactctggttcc 205 TGM1 1 Exon2 + 179 tgccgaaatgcggcagatga C/T gactggggacctgaaccctc 206 TGM1 2 Intron9 − 611 acttaccactctgtcctctc C/T tgccaggcctcttcctgtca 207 TGM1 3 Intron9 − 272 ccgcacatctgtaccctgcc C/G ccatcctccagcagagcagc 208 TGM1 4 Intron10 + 54 tcagtcatgggttctctggt C/T ccaacttcaccgctgactga 209 TGM1 5 Intron10 − 51 aggaggccgggagtcaggcc A/G ccctcagaccctctggctca 210 TGM1 6 Intron12 − 47 gggagtccctgggggaagcc T/G catgtagggaagcaggcctc 211 TGM1 7 Intron13 + 72 ggataaggacatcagaggtg G/A gcgctaagccagcagcaggc 212 TGM1 8 Intron14 + 1671 atctcttacccacaccccca C/G catggtggggaggttcctca 213 TGM1 9 Intron14 + 1691 ccatggtggggaggttcctc G/A tcctaagggatccgcagagc 214 TGM1 10 Intron14 − 1634 tccctgcctccctccttcag G/A gagctcagaaacaccttcaa 215 TGM1 11 Intron14 − 1459 ggaaacccctcagaaccagg T/C tccaagccaaatgctttgcc 216 TGM1 12 Intron14 − 801 cagaatacaaaagtgggatg G/C gaggcaaggagtcccgttag 217 TGM1 13 Exon15 + 233 ctcgaggtggagcttagccc T/C gtgccaggagcaatgggact 218 TGM1 14 Exon15 + 369 ggagtcagtcttcacttgca C/A tgggggaacagatgctaata 219 GGT1 1 intron1 + 85 ttatccagtaaggtggctcc G/A tcacctcttttcctggtggg 220 GGT1 2 exon3 + 68 gacggccaggtccggatggt G/T gtgggagctgctgggggcac 221 NQO1 1 1 intron 1 80 aggaggttgtaggggcttgg C/A ctgaattttgttccttgact 222 PIG3 1 5′flanking region − 47 gggaaggaggaaaggaaaga G/A ggggagggtggttctgctta 223 PIG3 2 intron 2 243 taacaccggacgcccagcag A/C agtcccagcttcttagaatc 224 PIG3 3 3′flanking region 282 agcaggccccagccctgccc G/A ctactcacctgggccccacc 225 NQO2 1 5′flanking region-434 tttctgttgcaccacggacc C/G tcattctgtaaccgggatac 226 NQO2 2 5′flanking region-406 gtaaccgggataccagccag A/G gatggggagcgggaggcgca 227 NQO2 3 5′untranslated region-102 tcctgcggctcctactgggg A/C gtgcgctggtcggaaggtga 228 NQO2 4 intron 1 1919 tcactcaaatagagctgagt T/C agtcactcagctcttggacc 229 NQO2 5 intron 1 2004 acaaactcacatgccaccag C/G catatgatgtaaacatgtaa 230 NQO2 6 intron 1 3391 aaagcagagggctgtgcagg C/T gcccctgcccctaggctagg 231 NQO2 7 intron 1 3456 caaaggcctcatcctcaggg C/A ggccaactcttctgttttag 232 NQO2 8 intron 1 3595 actgcccagctttaggttca T/C tcttgtaagtgttgctggtg 233 NQO2 9 intron 1 3596 ctgcccagctttaggttcat T/C cttgtaagtgttgctggtgt 234 NQO2 10 intron 1 3598 gcccagctttaggttcattc T/C tgtaagtgttgctggtgtca 235 NQO2 11 intron 1 3651 ccctgcgctttgaagggatg A/G atgtgacctctcccacattc 236 NQO2 12 intron 1 6036 tggtgtggcggttcactgat C/T ccccagccttctgctcgatc 237 NQO2 13 intron 2 14 atggcaggtaatgattcact A/G ttgtggagtaagactttttt 238 NQO2 14 intron 2 192 gccacgtggaagtgtataaa C/T tatctggaattatcttgttt 239 NQO2 15 intron 2 635 caccctgtttagcacctagc A/C ccatccctggcctctgccca 240 NQO2 16 intron 2 685 agtagcaccccctccccacc G/A gctgtgacaaaccaaaatgt 241 NQO2 17 exon 3 139 ctgatttgtatgccatgaac T/C ttgagccgagggccacagac 242 NQO2 18 intron 3 36 aatgctctatttataaaaac T/C atctttatgttttttacttt 243 NQO2 19 intron 3 728 aacgtgggcataaaccacca T/C ctagtgcaaaaaaagcggtg 244 NQO2 20 intron 4 1577 tgcctctgcacaccccttcc C/T gacaccagccctttctttac 245 NQO2 21 intron 4 1832 tcggccggccacgtggagcc C/T gctttcctcctcgcacccac 246 NQO2 22 intron 4 2583 tggtgttacgcacagctcct C/T gtcccctccctgcctgccca 247 NQO2 23 exon 5 330 ctgtactggttcagcgtgcc A/G gccatcctgaagggctggat 248 NQO2 24 exon 5 405 atcccaggattctacgattc C/T ggtttgctccaggtatgtgc 249 NQO2 25 intron 5 21 gtatgtgctcttggataagg A/T tcactatggatagttggagg 250 NQO2 26 intron 5 253 atggcaaacaagggagtggg T/C caggtgtcaggtgacggggg 251 NQO2 27 intron 6 2435 ccccccttaaatcatttaac T/C gaatggtatgtaacaggtgt 252 SULT1A1 1 5′flanking region − 1597 gcagagtaaagggactcact C/G aagaagaggaacgtgggggt 253 SULT1A1 2 5′flanking region − 1491 gaggggtatattcatgaaga G/T tccaggaaaaggtaaagatt 254 SULT1A1 3 5′flanking region − 1376 cggtttcatatgttactgat C/T atacaatgagatcctaggtg 255 SULT1A1 4 5′flanking region − 1375 ggtttcatatgttactgatc A/G tacaatgagatcctaggtga 256 SULT1A1 5 5′flanking region − 1370 catatgttactgatcataca A/G tgagatcctaggtgaaacct 257 SULT1A1 6 exon 1B − 65 aaccctgcattccccacaca G/A cacccacaatcagccactgc 258 SULT1A1 7 intron 1B 442 gagccaccctgcctaggcct G/A tgcttttgctgagtcatcag 259 SULT1A1 8 exon 1A − 197 gctgggggtcccagcaggaa A/G tggtgagacaaagggcgctg 260 SULT1A1 9 exon 1A − 159 ctggctggcagggagacagc A/C caggaaggtcctagagcttc 261 SULT1A1 10 exon 1A − 95 gagaccttcacacaccctga C/T gccactgactggctttgtga 262 SULT1A1 11 intron 1A 60 ctggttttcagccccagccc C/T gccactgactggctttgtga 263 SULT1A1 12 intron 1A 69 agccccagccccgccactga C/G tggctttgtgagtgcgggca 264 SULT1A1 13 intron 1A 174 tgtgatggtggtaagggaac G/A ggcctggctctggcccctga 265 SULT1A1 14 intron 6 11 catgaaggaggtgagaccac C/G tgggaagcttccctccatgt 266 SULT1A1 15 intron 6 17 ggaggtgagaccacctgtga A/T gcttccctccatgtgacacc 267 SULT1A1 16 intron 6 35 gaagcttccctccatgtgac A/T cctgggggccggcacctcac 268 SULT1A1 17 intron 6 71 ctcacagggacccaccaggg T/C cacccagccccctcccttgg 269 SULT1A1 18 intron 8 108 ttggcagcccccacagcagg C/A ccggattccccatcctgcct 270 SULT1A1 19 intron 6 111 gcagcccccacagcaggccc G/A gattccccatcctgccttct 271 SULT1A1 20 intron 6 270 ctccctgccaaagggtgtgc C/T acccagggccacagtcatgg 272 SULT1A1 21 intron 6 488 ttttacttttcctgaatcag C/T aatccgagcctccactgagg 273 SULT1A1 22 intron 6 509 aatccgagcctccactgagg A/G gccctctgctgctcagaacc 274 SULT1A1 23 exon 7 600 ccctctgctgctcagaaccc C/G aaaagggagattcaaaagat 275 SULT1A1 24 exon 7 645 gagtttgtggggcactccct G/A ccagaggagaccgtggactt 276 SULT1A1 25 exon 8 902 gctgtgagaggggctcctgg G/A gtcactgcagagggagtgtg 277 SULT1A2 1 5′flanking region − 547 tgttctttcttggttctatg G/C atccatgctctgctccaccc 278 SULT1A2 2 5′flanking region − 425 tgtgggttgcactgggccag G/A acccctggcaccttcaagac 279 SULT1A2 3 5′flanking region − 358 ctttccagggcctgcctatc C/T cagctttctccttcttgcct 280 SULT1A2 4 5′flanking region − 355 tccagggcctgcctatccca G/T ctttctccttcttgcctggg 281 SULT1A2 5 5′untranslated region − 28 actgcagggcgaggagggcac A/G aggccaggttcccaagagct 282 SULT1A2 6 intron 1A 85 ctgactggccttgtgagtgc G/A ggcaagtcactcagcctccc 283 SULT1A2 7 exon 2 24 gagctgatccaggacatctc T/C cgcccgccactggagtacgt 284 SULT1A2 8 intron 2 34 gccacccaccctctcccagg T/C ggcagtccccaccttggcca 285 SULT1A2 9 intron 5 77 cagcaaccctgtgtcggcac T/C ccctgcccgcttctccagtg 286 SULT1A2 10 intron 6 684 actggggtcccaggggtcga G/C gagctggctctatgggtttt 287 SULT1A2 11 3′untranslated region 895 gctctgagctgtgagagggg T/C tcctggagtcactgcagagg 288 SULT1A2 12 3′flanking region 98 cctccccgctccagctcctc A/T acttgccctgtttggagagg 289 SULT1A2 13 3′flanking region 817 ccactgactcggggcttgcc A/C aggctgccagggctggcaaa 290 SULT1A2 14 3′flanking region 1006 cctctcccctggaggctgct T/C tacccgctgtgggggcgcat 291 SULT1A2 15 3′flanking region 1464 tcccgtagcccaggcaagtt C/T ggtgaccagagagcagcccc 292 SULTX3 1 intron 1 332 cctgcttctccctttacctg G/T ctggctgtgtgaccttggac 293 SULTX3 2 intron 1 1167 taggaatggctaagcgtgtc G/A ttggcttctgtggccactca 294 SULTX3 3 intron 1 2872 cattctcactgatgcagacg G/A aagcttctgggcctgggcgt 295 SULTX3 4 intron 1 6242 cacccttggcttttaccagc A/G tggaaacattttacctgaat 296 SULTX3 5 intron 1 6601 gcgtgggcttctggagggag C/T gagaggagagtggagggccc 297 SULTX3 6 intron 1 6768 agcttgaaatgagccagact C/T tcctgggacctgttgacccc 298 SULTX3 7 intron 1 6905 agtactttgttttatcctcc C/T catcctcacaactttgccat 299 SULTX3 8 intron 1 7464 gccaggatcccttgagagac G/A acatgaacacagccaggagc 300 SULTX3 9 intron 1 7833 tgcttcgggctgggcttggc G/A ggggcagctgtgctccaggc 301 SULTX3 10 intron 1 8189 caaactggggcccttaatgc C/T gcacaccagagcctcctttc 302 SULTX3 11 intron 1 8316 ctctcacacaagggcggagc C/G tcttccccttgaggcagagc 303 SULTX3 12 intron 1 8617 agacagaggctggggccaag C/T cagggttgccggagcttcct 304 SULTX3 13 intron 1 8631 gccaagccagggttgccgga G/T cttcctggactggtcaggcc 305 SULTX3 14 intron 1 9493 ttttcctcttagagcttccc G/A tcgtgctctgtgtcgagggc 306 SULTX3 15 intron 1 10306 caggcggggagcctgaatgc C/T gcagtcgtgagggtggccag 307 SULTX3 16 intron 1 11987 tcataaaataatgatatcag T/C acactttttggaaatttgag 308 SULTX3 17 intron 1 13085 ctctgtgcccggtgttgaga C/A aggccatgccctagagtcct 309 SULTX3 18 intron 1 13108 gccatgccctagagtcctgg G/A gagttccaccccagaacagc 310 SULTX3 19 intron 2 700 gaaccatctgggagtcgttc C/T gtactgccgtgccgagggcc 311 SULTX3 20 intron 2 818 agccatagtagctagccagc G/A atcagcgctgggaggggagc 312 SULTX3 21 intron 2 1677 actccacttcccctgaaccc C/T accccttccttcctcctctg 313 SULTX3 22 intron 4 4954 gcgtgccgaaggcgggaggg C/T tgggatggctcaagacgtga 314 SULTX3 23 intron 5 3632 ccagctgactcccacaccag C/T ggtcagagaacattgtcttt 315 SULTX3 24 intron 5 3662 acattgtcttttaaggtttc C/T gaagtgctgcaataaagaaa 316 SULTX3 25 intron 6 1874 tctgatctcagagagctgac A/G atggaaagaattctaaacga 317 SULTX3 26 intron 6 2133 agaccggtgcctgcagttta T/G cccacagctcagccctccct 318 SULTX3 27 intron 6 2524 ggaagggccagggctgcctg T/C gatgcccagagcagtgcact 319 SULTX3 28 intron 6 2573 agatcatactcgctcctggg A/G tgtttattaaacacctgcca 320 SULTX3 29 3′flanking region 12 gttcccggcgttgcgtcgag C/G gtttctgcttgtgggggtag 321 SULTX3 30 3′flanking region 445 tccaaagcctgtcttcctga T/G ttcctgtggaaggagagtcc 322 TPST1 1 5+ flanking region − 298 acccgccaccatgcccagct A/C attttttttgtatttttttt 323 TPST1 2 intron 1 3520 agaaaagcagattaatgtaa C/G agtgacgcttagacaacaag 324 TPST1 3 intron 1 3610 ggcagaaagagaatatagca A/G ctattaaacacaaataaatt 325 TPST1 4 intron 1 20828 tattgctgtccacctggtca A/G tgtgtcctgctgataagtgc 326 TPST1 5 intron 1 − 6761 aatacaatacttattctgta T/C aattctagagggcccagaga 327 TPST1 6 intron 1 − 544 tagaacaagtgaatatttta G/T gttcttagtggtttatggtt 328 TPST1 7 intron 1 − 526 tacgttcttagtggtttatg G/T ttggcagttttcccccaaca 329 TPST1 8 intron 1 − 234 tcaagacatttaataatgca C/T atgtttcagctaaccctttt 330 TPST1 9 intron 1 − 48 ttatagtgggtttaagcatg A/G tttctaaaaaatttaaataa 331 TPST1 10 intron 2 − 18944 aaaacattagaactgggaag G/A ttaaaaaatctttagtcttt 332 TPST1 11 intron 2 − 18687 tatgtgcaccctaataacat A/G tttccttaaaactagtacta 333 TPST1 12 intron 2 − 18501 ttggaaggtaacttaatgta A/G gtgcctgaaaaacagggata 334 TPST1 13 intron 2 − 159 gaatggggatttccctcagt C/G ctgcccactggctgctcttg 335 TPST1 14 intron 2 − 19 acctgttgccttaaactcac G/A cctgctttgtttttccaggt 336 TPST1 15 intron 2 158 tgctggggaagaaagatcag C/G gtctgggacttgttgatttt 337 TPST1 16 intron 2 3779 agcagggcacgtcaccctcc G/T ggcacacccatgtgttcacc 338 TPST1 17 intron 2 292 ttgttattttcattatgaac C/T atgaaatatttcagctgaaa 339 TPST1 18 3′untranslated region 1518 gttgtctgtacatgttctaa T/G gttttgtagaacacgtgtgc 340 TPST1 19 3′flanking region 264 acggtgcttggcctgcatta C/T cattttgtagtgaagtttct 341 TPST2 1 intron 2 578 tcacctatcatcctcactgc G/A aggatgccaggatacctccc 342 TPST2 2 intron 2 789 cttaagccatcgtgcaggtc A/G ttgctgtcttctgctcactt 343 TPST2 3 intron 3 2009 cccaggctggagtgtagtgg T/C gtgatctcggctcactgcaa 344 TPST2 4 intron 3 2017 ggagtgtagtggtgtgatct C/T ggctcactgcaacctccgcc 345 TPST2 5 intron 3 2035 ctcggctcactgcaacctcc G/A cctcccgggttcaagcagtt 346 TPST2 6 intron 4 104 aatgttcagtctctcaattc C/T tggtcatctgatttgttcct 347 TPST2 7 intron 4 379 tacatacctaccctattggt C/T cctttcttgtcttataaggt 348 TPST2 8 intron 4 588 tactgcagcctgatacttct G/T ggcttaagccatcctctcac 349 TPST2 9 intron 4 626 caccccaggctcctgagtag C/T taggactgcaggtgcacgcc 350 TPST2 10 intron 4 718 cccaggctggtctagaactc C/G tggccgtacgggatgcccct 351 TPST2 11 intron 4 873 gttgatggccttatttatac G/A tttccattacagcttctagt 352 TPST2 12 intron 4 949 caaatatttgaaaatgggac C/G caggcctgaggaagagcttt 353 TPST2 13 intron 4 1033 taagctcagcatttctgagc G/A tgtgctgattttaggaaata 354 TPST2 14 intron 4 1051 gcgtgtgctgattttaggaa A/G taaacagttatcgtattgaa 355 TPST2 15 intron 4 1356 gattcaacgtacataccagc C/T gacattgacaggtgaatggc 356 TPST2 16 intron 4 1707 gtctccttaaaaggtggctc G/T ctgcccctggcttgccccag 357 TPST2 17 intron 5 215 aagaccagcctgaccaaaac G/A gtgaaaccccgtctctacta 358 TPST2 18 intron 5 341 tgggaggcagaggtcgcagt G/A agctgagatcacgccgttgc 359 TPST2 19 intron 6 31 ggacttcactgggggttccc G/A ctgcttctgggtggccccgg 360 TPST2 20 intron 6 273 gtttgtctgacactggggac A/G gggcaggaagcaccactatg 361 TPST2 21 intron 6 693 aaagggatttttttgaactt G/C gtaattcaaagatttaagat 362 TPST2 22 intron 6 1635 tcctgggtacagagttggcc T/G tgaacaaacatgagtccttc 363 TPST2 23 3′untranslated region 1147 cttccccactttcagatctc C/T gcaaatgacttcattgccaa 364 SULT1A3 1 exon 8 843 cgcttcgatgcggactatgc G/A gagaagatggcaggctgcag 365 CST 1 intron 1b 6302 agagctccccagagaggact A/G tgaggctgcatgatgcatga 366 CST 2 intron 2a 1004 gagtgagacccccatctcta C/T aaaattttttttaaaaagta 367 CST 3 intron 2a 1395 atgcctaagtttacagtagc T/C ggggcccctccatggctgcc 368 CST 4 intron 1d 473 ccagagcctgaggttggtgc T/A gtccctgtctggaccctgct 369 CST 5 intron 2b 726 ctatctctccagtgcctctc T/C gtccctgtctggaccctgct 370 CST 6 intron 2b 745 ctgtccctgtctggaccctg C/A tggggggccacagagcaggc 371 CST 7 intron 3 85 tcactagtttcctgctgctg G/A tgtactcctatgccgtgccc 372 CST 8 intron 3 308 tcgtctgaggtcaggagttc G/A agaccagcctggccaacatg 373 CST 9 intron 3 853 ttttgtcctataaaatggca G/A tttcatgtggcccaagctga 374 CST 10 exon 4 198 gaggcagtgatccgggccaa G/T ggctcggcgggggagtgcca 375 SULT1C1 1 intron 3 2280 gcaaatttttggtattttta G/T tacagtcagggttttaccat 376 SULT1C1 2 intron 3 3742 gcagatctcactttctggca G/A attccctgaatttgctcccc 377 SULT1C1 3 intron 3 4453 ttcatagggcttttccctca C/T ttgttttgtaattttgtata 378 SULT1C1 4 intron 3 5234 gaaaagagactagaggcagg A/G gagctttgcagttcttctaa 379 SULT1C1 5 intron 3 6175 tggctggcaggaaggtgagg G/C agtcctctcttctctggtcc 380 SULT1C1 6 intron 3 205 acatgaaggcaggatccaga T/C tgaatgtttggagggaacta 381 SULT1C1 7 intron 3 408 ggctcacgcctgtaatccca G/C cactttgggaggccgaggcg 382 SULT1C1 8 intron 3 429 cactttgggaggccgaggcg G/C gtggatcacaaagtcaggag 383 SULT1C2 1 5′flanking region − 110 tcctgttaactcacagagaa C/T ggaagggctggaacgggacc 384 SULT1C2 2 exon 1 15 acactaatggccttacacga C/G atggaggattttacatttga 385 SULT1C2 3 intron 1 297 gtagacttgtttatttattc A/C ttcccaatctaggcccttat 386 SULT1C2 4 intron 1 363 gagtgtgtgagctagaaagg T/G gatcctgagtctgatttggg 387 SULT1C2 5 intron 1 2300 gggctactatcagcagccac C/T acctcaggaaggatgacttc 388 SULT1C2 6 intron 2 455 aagacttggaagcaaataga T/G aaaaaaaaaatcgtagaaat 389 SULT1C2 7 intron 4 55 caaaatctccaaacacccta G/A aaggaaagaatcttttcttt 390 SULT1C2 8 intron 4 111 ctgccttctttaatggaaca T/C tctcacttctcttcaggaat 391 SULT1C2 9 intron 5 1857 ctttgtgtttactttgtttt T/C acttggtacaaaagtgttgt 392 SULT1C2 10 intron 5 2082 ctttgtgtttactttgtttt T/C gtcccacagccacagtgatg 393 SULT1C2 11 intron 5 933 agctactgaacctctcccac A/G taactgtatttcaggggcag 394 ST1B2 1 intron 1 80 acttgtccataaaatcatta C/T cattctaaataaagttaata 395 ST1B2 2 intron 2 − 352 aacatttaaatagtcattta T/C agcaatgcacaggtataata 396 ST1B2 3 intron 2 − 85 attcataatgctcaaaaaat G/A tcttgaaaaactggttggca 397 ST1B2 4 intron 4 460 gtacttgacattaaaaaata T/C ctgatgtttatatatccata 398 ST1B2 5 intron 4 470 ttaaaaaatatctgatgttt A/G tatatccataaatagctaat 399 ST1B2 6 intron 4 518 tttaagattgtcctcatatt C/G ttacttcctttggttactaa 400 ST1B2 7 intron 4 616 aatgtttatgaaaatagact T/C ttatctggttttagtggcct 401 ST1B2 8 intron 5 58 ctgcatcatgctgtaaaagg G/A ttgatatttgctttccaact 402 ST1B2 9 exon 6 612 taatagaatccaaaggagga A/C atcaagaagatcattagatt 403 ST1B2 10 intron 6 582 aatacattacttccatttaa G/A tagtctgtttattgtggctt 404 ST1B2 11 intron 6 3130 agatgtaaaaaattattcaa A/T ttttcaaaagcctgaaaatt 405 ST1B2 12 3′untranslated region 907 tttaaagtgtctaaatcaca C/A atctgaagaaatcagagatt 406 ST1B2 13 3′flanking region 50 tcagatcccagttttgttcc T/G ttgattctgagtttggaaat 407 ST1B2 14 3′flanking region 328 tttgacccaggacactgtgt T/G ccactgctgtctaccgagtt 408 ST1B2 15 3′flanking region 446 gtagttcagattttggaaat G/A ttttttctatatcataccta 409 CHST2 1 5′flanking region − 260 agccggacagtccgccgggc G/A gtgatccgggggccgctccc 410 CHST2 2 5′flanking region − 56 gcgctggggaccagccgccg C/T gcccgcctcggagtcgcggc 411 CHST2 3 5′flanking region 218 aggagtgaaacacatctttg T/A attctaaaggcagaaaccaa 412 CHST2 4 5′flanking region 383 gcagagaccaatgttttggt G/C ctgaggctggttcagaaaaa 413 CHST2 5 5′flanking region 952 tactgaaacattctgcagaa T/C gttatactatgagaagaaat 414 SULT2A1 1 intron 2 478 ggactgggctctgtacacac T/C tcgtcttactgtgtgtaaat 415 SULT2A1 2 intron 2 382 caaaaccctcttaatattct G/A tttctatctgtctcagaact 416 SULT2A1 3 intron 2 409 tctgtctcagaactgattgc A/G tgactctaggatcgctatat 417 SULT2A1 4 intron 2 249 agctggaaattacaggcaca C/T gccaccacacccagctaatt 418 SULT2A1 5 intron 2 395 aggcatgagccacggcgccc G/A gccaatttatcagctttaat 419 SULT2A1 6 3′flanking region 33 ttccttgttaaaagttacca G/C ggttggccaggcacggtggt 420 SULT2A1 7 3′flanking region 46 gttaccagggttggccaggc A/G cggtggttcatgcctgtaat 421 SULT2A1 8 3′flanking region 199 ttagccaggcgcattggctc A/G tgtctgtaatcccagcactt 422 SULT2B1 1 intron 2 4162 ttctcccctctcctcaccat C/T cgcacacaggtgatctacat 423 SULT2B1 2 intron 3 879 gagggcatccagctctgggg G/A ctggacctgggggtttgtgg 424 SULT2B1 3 intron 4 3882 ttccacgctccttccttggc C/T catgtccaagcagtaatggc 425 SULT2B1 4 intron 5 1780 cctgcagaagggggtccctt C/T ttgtgggggcattgagacag 426 SULT2B1 5 intron 5 1814 taatggctgcagcatggagc G/A ttgtgggggcattgagacag 427 SULT2B1 6 extron 6 789 ccctcttctccaggggtctg C/T ggcgactggaagaaccactt 428 CHST4 1 5′flanking region − 1092 atgaagccttgtgccatctc G/A ctgtgtcgtgccagcacctg 429 CHST4 2 5′flanking region − 941 ctgccagagagaaacaggaa G/A ggaggaagagccacacaatt 430 CHST4 3 intron 1 − 150 caggaaatgatttggagaag G/T actggtgccattgttggcac 431 CHST5 1 intron 1 − 144 ggcctcttaggtttcagcca A/C gacaggtgactcttagcacc 432 CHST5 2 intron 2 17 caacgtaagagcgcttctca T/A tgtccagctcctttgtttct 433 CHST5 3 intron 2 139 aatcccagcactttgggagg C/A ggagatgtgcggatggatca 434 CHST5 4 intron 3 1828 gactgtatgtctgctattca T/C ataggaacaaataattcatg 435 CHST5 5 intron 3 2037 aaatgaaaccaacaccaaca C/G tgcagagaagcaaacaaaag 436 CHST5 6 intron 3 2134 aagcagctaaattgtgttcc G/A tacaggtgcaattaggcagg 437 CHST5 7 intron 3 2528 atggtaaagttcgcctgggt G/A cagtatgtcagcatcctgct 438 CHST5 8 intron 3 2674 gcacttatcctagaaaggcc A/G tttctgaagactcagcagga 439 CHST5 9 intron 3 7039 ctggctcccgccggccaccc T/C gggaccgcagccacgtctga 440 CHST5 10 intron 3 7211 gtagccccaggacaccccca T/G cctcaacatcccattctggg 441 CHST5 11 intron 3 7294 ggagcttccagtggcttggt T/C acccccgactcttcgtccat 442 CHST5 12 intron 4 108 gcagggtcctgcactctgca G/A ggggcaatcacaggtgggag 443 CHST5 13 intron 4 402 ctggctcccgccggccaccc T/C gggaccgcagccacgtctga 444 CHST5 14 intron 4 547 gtagccccaggacaccccca T/G gaaggagcagaggtgagatc 445 CHST5 15 intron 4 1142 gccccaggtctcatagctcc C/G cattggcagtgctgggattt 446 CHST5 16 intron 4 1187 cactgggcagtaattggggc A/G tgggatgggcatgagggccc 447 HNK-1st 1 intron 1 139 gtgttttggcgacttgaaga C/T ctccctagttcgcgggagta 448 HNK-1st 2 intron 1 1020 acctgagcagaaaattctct T/C cttcgctgaaatgaaaattg 449 HNK-1st 3 intron 1 1091 aagaatttgtaaacatcaca G/A gcaacttgcagttatattcg 450 HNK-1st 4 intron 1 1971 ctataactatttcaaacata C/T gaaacaggcataattggatt 451 HNK-1st 5 intron 1 2096 atttagaatattcatttacc A/C agaaatccaaatataacctg 452 HNK-1st 6 5′untranslated region − 91 ctatccagtgacaagaggaa C/A caagaacctcagttcagggg 453 HNK-1st 7 intron 2 − 530 agtgggcggaggcgagaagc G/A tcagtgttcattcctttgct 454 HNK-1st 8 intron 2 − 466 gctacatcttgtcagccagt C/T agaattttaaacacagccag 455 HNK-1st 9 intron 2 − 92 acggaaatatttgtgctgat A/T cttactgactgaaatcacct 456 HNK-1st 10 intron 3 152 catggcctccgttccttcat G/A ttacagaggtgtgaggggag 457 HNK-1st 11 intron 3 312 cacagtggccttatgccttg C/T agcagggcgcctctcaggct 458 HNK-1st 12 intron 3 1948 tcctttgatgtatcaagttt T/C gtgctgaatgttttcagtgt 459 HNK-1st 13 intron 3 2140 ttacacctggagaggagcac C/T gcagcggtccttaatactgc 460 HNK-1st 14 intron 4 187 agaagcacattcctgaggaa C/T tgaaggtgggcacagccagg 461 HNK-1st 15 intron 4 581 cctgatcattccctagctgg G/A atgaggggtgcactctggaa 462 HNK-1st 16 intron 4 615 tctggaaggcctctcacttc G/C taacccccattctggatcta 463 HNK-1st 17 intron 5 7 gattgttctaaatggtgtgt G/A tgggtctactgaatgtccac 464 HNK-1st 18 intron 5 123 acctgaagggactggtggcc G/T tccagacaggcctgtttttg 465 HNK-1st 19 intron 5 721 ataattatgggctctgctta T/C gaaatttagcttcagacagg 466 HNK-1st 20 intron 5 867 tgctgcccacagagtcggtg G/A tcactcctggccactgtttg 467 HNK-1st 21 intron 6 444 ccaggagcattttcttccat T/C gaggagatccccgaaaacgt 468 HNK-1st 22 intron 6 94 ctgagttctgtacttggcag A/G ttgatcggaggaccacagag 469 HNK-1st 23 intron 6 247 catgaaggtgacatcatttt G/A ttaatagaaattagcaggca 470 HNK-1st 24 intron 7 696 aggaggaaccggacagagac C/G cgggggatccagtttgaaga 471 HNK-1st 25 intron 7 870 gagaccctggaggacgatgc C/T ccatacatcttaaaagaggc 472 HNK-1st 26 3′untranslated region 1110 tcaaatatctttattagacc T/C ggggctaaccaggtgaagat 473 HNK-1st 27 3′untranslated region 1178 ccacacccctcctttgagga C/T gcccggggtctcccacaggc 474 HNK-1st 28 3′untranslated region 1393 ggaagcatcacacagcgtta G/A gagccgtttccttcaggtgt 475 HNK-1st 29 3′untranslated region 1452 tgaggttctcctggctagtc A/G gggtggcttcacccatcact 476 HNK-1st 30 3′untranslated region 1540 gcaagggggctgctgaaatc G/C cagagacttttgcagcatca 477 HNK-1st 31 3′untranslated region 1696 gggtggtgtggtgtccaggg G/A tccatctttccagaatccat 478 HNK-1st 32 3′untranslated region 1829 aggggaggctttttctacct G/A agaaggggagtgtctttgag 479 HNK-1st 33 3′untranslated region 2211 tccagcagtgcggcttcctg G/T caacaaggtaggccctggtg 480 HNK-1st 34 3′untranslated region 2212 ccagcagtgcggcttcctgg C/T aacaaggtaggccctggtgc 481 HNK-1st 35 3′flanking region 1016 cacacgaaggtgtgcactca C/T ggcctgcagggcacccaggt 482 HNK-1st 36 3′flanking region 1152 gcatgctttgctcatctgga A/C tctccagaagcagggaacag 483 HNK-1st 37 3′flanking region 1291 gccgagaccctcagcaggat A/G gtgcagttacagggctgagc 484 STE 1 5′flanking region − 605 caggtttctaaaataataat C/T gaaaggtgagtgatgtttac 485 STE 2 5′flanking region − 536 taaaattttcaggtctgctt A/G agagttaaaggcaaagagtt 486 STE 3 5′flanking region − 231 ccttcttccccaacccctga C/T gaaaggtgagtgatgtttac 487 STE 4 5′untranslated region − 64 tgcagcttaagatctgcctt G/A gtatttgaagagatataaac 488 STE 5 intron 1 69 aaatatagaatgaaaattat G/A tattaccaagctcttaaaaa 489 STE 6 intron 1 311 caatgagaaaataaagcaag C/G agggtagaaggaggtagaat 490 STE 7 intron 1 655 tctaagaaagtagggactat G/A agaacccctatgtatctata 491 STE 8 intron 1 671 ctatgagaacccctatgtat C/T tatatccaccatagtattct 492 STE 9 intron 1 772 aaaaggcaggttggaagatg C/A aggaggggagtatgcagaaa 493 STE 10 intron 1 1716 taaccatcttgcttaacctt A/G tcatttttagccaagtcatt 494 STE 11 intron 1 1928 aaatgatacatattcaggaa A/G tcaaaaatctctgacttaga 495 STE 12 intron 1 1953 aaatctctgacttagatacc C/T ggcaataataatcaaatgta 496 STE 13 intron 1 2087 aattttgaaagaaattgaag T/G tctgtggtttttatttatca 497 STE 14 intron 1 2323 taggtatgtaggagggtccc G/C ttatatacatagttgttaat 498 STE 15 intron 2 165 tctattccatgaccacaatt T/G ttacctgtaacttgaatagt 499 STE 16 intron 2 1707 cctaggacccaacatgagac A/G taatataccatcagtaaaat 500 STE 17 intron 3 850 ggtgtccattccctcaagaa T/G ttatactttgtgttacacac 501 STE 18 intron 4 1653 agtaacaggctagtagataa T/C ataaataactgaggccaacg 502 STE 19 intron 4 1899 tacatgaacttagagaatca A/G gtagatcacacacaccaaca 503 STE 20 intron 4 1930 cacaccaacaataaaattac A/G cagaatgataaaagaatttg 504 STE 21 intron 5 666 ttctgatcatgtagtaacaa T/C tataaagaaaataataatgt 505 STE 22 intron 5 982 aggcaaagcagaaccttttg A/C ctcacacaacattatattat 506 STE 23 intron 7 369 agattttattcctctctctt T/C ttgagttgaagaaataagtt 507 STE 24 intron 7 447 cacctttcaagggtaagtgg C/A aaaaaatagaaattcaaata 508 STE 25 intron 7 672 aatcttgctctttgaaccat A/T ctgtcagtgagagtcaggga 509 STE 26 intron 7 856 tgttacagaggacttaaaac A/G gttgtcttgcttgcaaacgg 510 STE 27 3′flanking region 218 cagcctcccaagtagctagg A/G ctacagacatgtgcaaccat 511 ADH1 1 5′flanking region − 55 atcatgtgtggaactggaat C/T gggtgttattcaagcaaaaa 512 ADH1 2 intron 1 268 acatttgcggtaaagcgata A/G tttattccaagctaatcatg 513 ADH1 3 intron 3 442 aaatggaggctacatggcta C/A ggctgaatgagcatgacctt 514 ADH1 4 intron 6 56 tacaacttggaggatgcatt T/G aggctgcagaatatatgttt 515 ADH1 5 intron 8 74 gtctagcagaaaatgaaaag G/A tggaaggatgagaaaaatta 516 ADH2 1 intron 2 340 ctattttttaaagcgtgcat T/C cttacataagacttaaatat 517 ADH2 2 intron 3 91 aaggcaatgagagacgaaag T/G gcttgcacaaggtcaccgcg 518 ADH2 3 intron 3 205 atgtattgtacccttcaacc A/G ttatgtaccgagtatctact 519 ADH2 4 intron 7 108 acaattgacaaggcaagatt T/C tgaaaacaaatcaaaaataa 520 ADH3 1 5′flanking region − 254 tgagagaagagaagcaggaa C/G ttgagagaggaggaagagag 521 ADH3 2 intron 2 355 tatgcattcttctatattat A/G caagacaaaaattttaggat 522 ADH3 3 intron 3 32 acactcagggaacatgcctt G/A gttcaccatcacaagattag 523 ADH3 4 intron 4 6 ctgcttgaaaaatgagtaag C/T ttctgatgctttctttgcac 524 ADH3 5 exon 5 453 agcaccttctcccagtacac A/G gtggtggatgagaatgcagt 525 ADH3 6 exon 6 815 ttcgtttgaagtcatcggtc A/G gcttgacaccatggtatgat 526 ADH6 1 intron 3 249 tgaaactggacttgaaagta G/A aaatgagacaaaaatttatg 527 ADH6 2 intron 6 815 ttcgtttgaagtcatcggtc A/G gcttgacaccatggtatgat 528 ADH6 3 exon 7 885 gtctgtgtggttgttggggt G/A ttgcctgccagtgttcaact 529 ADH6 4 intron 7 1292 gttgagaaacactgcctagt C/A ccgtctgtggtcctagaatt 530 ADH6 5 intron 7 1616 ctatcacagaataatccgca T/C agaacactaagcagattacg 531 ADH7 1 5′flanking region − 528 tgtgcagacacagaaagttt T/C acttaactttctacccctaa 532 ADH7 2 intron 1 361 tcagtagcatgtgctgcact C/T gctgcagtagttcaatggga 533 ADH7 3 intron 3 183 aacctcaacctttagaaggc A/G aaccttacggtgtttataaa 534 ADH7 4 intron 4 76 tgaattgaattaattaatac G/A tgtatttgatgtatcaaaca 535 ADH7 5 intron 5 615 tggcatagcgtaaagagact T/A ggaaaaatggaataaagcca 536 ADH7 6 intron 8 532 aagtctaaccatatcaccaa T/G ttagtatgccattgtactat 537 ADH7 7 intron 8 651 gctgctatttatttcaagta G/A gccacaaaatttccttattt 538 ADH7 8 intron 8 760 catttttagatgaagaccaa T/G gttgtgaaagcaaataaata 539 ADH7 9 intron 8 1207 tctccacatttggtctagcc T/C acaggatcatcatattatga 540 ADH7 10 intron 8 1691 tccctcatctcattgcccac G/A ctcattgctttaattcagtc 541 ADH7 11 3′untranslated region 1354 atttacattttgtaaggcta T/C aattgtatcttttaagaaaa 542 ADH7 12 3′untranslated region 1498 gatatagtaaatgcatctcc T/C agagtaatattcacttaaca 543 ADH7 13 3′untranslated region 1584 aaacacttgttatgagttaa C/G ttggattacattttgaaatc 544 ADH7 14 3′untranslated region 1818 aatataaacatagagctaga A/G tcatattatcatacttatca 545 ADH7 15 3′flanking region 865 tacatcaaaagaaataaatc G/T aagaaggaataaacacattt 546 HEP27 1 5′flanking region − 191 tcagcactctgtgtctagct A/T aaggtttgtaaatgcaccaa 547 HEP27 2 5′untranslated region − 163 gaacccatcaattccgtaca C/A attttggtgactttgaagag 548 HEP27 3 intron 1 1941 aaatttaccctaaccagcct G/C actctctgccactttctgtt 549 HEP27 4 exon 3 289 ttgtgtgccacgtggggaag G/A ctgaggaccgggagcagctg 550 HEP27 5 intron 4 1070 tgtctcagttcacaggatca T/C gactctttttctcgaaactg 551 HEP27 6 3′flanking region 362 ggctttgtgtgtgctccatt A/G tctgaactgggcctgctggg 552 L1CAM 1 intron 1 + 767 tttgacttccttacatgggt G/A actgtgtgagtcactctgtt 553 L1CAM 2 intron 1 + 862 gcattgggtcatgtgtatgt G/C tgagtggggctgaatgtaag 554 L1CAM 3 intron 1 + 1332 cagggatgaaggagcagagc C/T gctgagaggccacacaggtg 555 L1CAM 4 intron 4 + 502 tttccctggggttttccctt T/C gcattccatcctccctgagc 556 L1CAM 5 intron 18 + 147 agcgacgttatgaaattccc G/A acacttcacatttctataat 557 L1CAM 6 intron 24 + 221 ctccttagccccccagaggg C/T cccaactttaagagcatact 558 AANAT 1 5′flanking − 542 aggggtgcaggatggggtgt G/T agctggagggcagggggtag 559 AANAT 2 5′flanking − 263 ccccccacataagaggtggg C/G ttgtccaagactccgaggga 560 AANAT 3 intron3 39 cgcccagctccagggaggcc T/A ctgaagacagaggtcagcca 561 AANAT 4 exon4 150 cagccggccgtgcgccgggc C/T gcgctcatgtgcgaggacgc 562 ARD1 1 intron1 + 317 ccgtcggtctgctcggcccc C/G ctccctcggggctgggcagg 563 ARD1 2 intron6 + 322 gctcctcagcatctgctcac G/A ccagggacccacacctctct 564 ARD1 3 intron6 + 1095 aaggctccatcctgagacaa A/C aagtccagtgtgacctgccc 565 ARD1 4 intron6 + 1179 aggaggaagacctgtatccc A/G gggacaccctcctccactcc 566 ARD1 5 intron7 + 159 cctccaggctgctaggcaga C/T ggcctcctctaaagcccagc 567 ARD1 6 intron7 + 295 tgaccagccctgccacccga G/T gagccttgggcagaaccctg 568 ARD1 7 intron7 + 416 actaccatggaggcccccac G/A acagagcgctgccccttgac 569 NAT1 1 3′UTR 215 aataataataataataataa A/T aaatgtattttaaagatggc 570 NAT2 1 exon2 867 cgtgcccaaacctggtgatg G/A atcccttactatttagaata 571 NAT2 2 3′flank 521 ccatccatactttgccacaa G/A agaaggaacatgagctttat 572 NAT2 3 3′flank 573 gatttgaaatcctgtggaca C/T ggggtgaattacttttaaaa 573 NAT2 4 3′flank 918 attttctgtttgtaaattcc A/G gtatcagggctatagtttaa 574 NAT2 5 3′flank 979 actattctccctcttcgact C/T gtgatgactataataatctt 575 NAT2 6 3′flank 1958 tacctattgaagtaagccta C/T gtcatatccacctatttgtt 576 NAT2 7 3′flank 2034 ccactgattcccagagctag T/G tcattaagaagacagtgcct 577 NAT2 8 3′flank 2201 cagattactggagggctact G/A tttgctcaccaatgcaaatg 578 NAT2 9 3′flank 2818 gggatatttgtctcctttct C/G cccagtgcatgttggaaacc 579 NAT2 10 3′flank 3237 atatatattccaattaaaaa A/A caaaataaatttccgaaact 580 NAT2 11 3′flank 3388 caacaaagagattttttaaa G/A ctttttaaaacaccagacag 581 NAT2 12 3′flank 3660 cagcactattcgcaatagca A/G agatgtggaatcaatctaaa 582 NAT2 13 3′flank 3973 agcagaaaaaataaataatg C/T gtactaggcttactacctgc 583 NAT2 14 3′flank 4029 caaaacaaccccccatgaca T/C gagtttatctatataacaaa 584 NAT2 15 3′flank 4118 ataagattaatatctgcata C/A aaatctttgtttacagcttg 585 NAT2 16 3′flank 4146 tgtttacagcttgttatata C/T tgaattatgtctgctccccc 586 NAT2 17 3′flank 4279 ttaatctgataggattggtg G/C ctttataagaaaaagaaaag 587 NAT2 18 3′flank 4323 ttgctctctccccagtgcag T/G taccaaggaaaggccatgtg 588 NAT2 19 3′flank 4446 tcaattggctttatctgcga T/C tctggaatcaggcaatactc 589 NAT2 20 3′flank 4462 gcgattctggaatcaggcaa T/C actccatttcataaaacaga 590 GZMA 1 5′flanking − 462 cctcagcttgcacttggcct A/G ctaattcttatataatccaa 591 GZMA 2 5′flanking − 172 agcctgcctgctggcagtga G/C ccatcatccaccattctcac 592 GZMA 3 intron1 1949 gacataaggttctctctatc A/T gcatgtatggtttgccttgt 593 GZMA 4 intron2 + 683 gactgcgtgaccaggtggaa C/T tagcctcagcatggaagggt 594 GZMA 5 intron2 + 1250 gttggtgtagtttatactag G/A ttatgaatgatagccttaat 595 GZMA 6 exon4 + 105 tgccaagttgcagggtgggg C/G aggactcacaatagtgcatc 596 GZMA 7 intron4 + 696 atagagccttacctgaagaa A/G ggtgtgcagtatgcatggtt 597 GZMA 8 intron4 + 1141 ctgttcagggaggatcccgg G/A ttccaacatggttctttatt 598 GZMB 1 5′flanking + 529 gcctccgtctcacaccaaca A/G gcagatttccccaccacggc 599 GZMB 2 intron3 + 141 gagggaagattgtgcagccc C/T atcactgtgtcggggcccag 600 GZMB 3 3′flanking + 448 ttttcagggcctgtccctcc G/A atgggggcaggcttctccca 601 ESD 1 5′flanking − 323 gtcttgggacagaggagttg G/A gggagttgaaattaggccct 602 ESD 2 intron 1 603 gtcatttctgatggggtcat C/T agggaaatgggattgagcgc 603 ESD 3 intron 1 717 tgtgtggtagaagcagcatt C/T taagcactacgtgaattaac 604 ESD 4 intron 1 1864 gctttcatgcaggattgatc G/C tagtgggatgtattaggaag 605 ESD 5 intron 1 2389 ttttgggaacacctgtctag G/A tgttaagagccagtggaata 606 ESD 6 intron 2 21 taaacttgttttattgttta G/A tgttaagagccagtggaata 607 ESD 7 intron 2 588 taaaattagtatctctctct G/A taagttcattatttaagata 608 ESD 8 intron 2 1498 tagaaaaatgtgtatcacac C/T gtaagtgttcagtaatgtta 609 ESD 9 intron 3 92 ctttatctagatattatagt C/A cctcattttacttttaaact 610 ESD 10 intron 3 422 gtaaagagattaaacacaca C/T gcacacatacatatacctat 611 ESD 11 intron 3 581 agaaaacctgagaaatgaca C/T aatttatttaaagccatagt 612 ESD 12 intron 3 2270 gccagtaattacatgtagcc G/A tttacatcaaattagctaat 613 ESD 13 intron 3 2951 taatgaaagtaaatgtttca A/G cttccctaacaaaagttgaa 614 ESD 14 intron 3 3001 aaatgtcagaaattttttgt G/A ccgtcagtcatcaacaagaa 615 ESD 15 intron 3 3096 aaggagcatacagaaaactt G/C ccatgatggggcctttgtgg 616 ESD 16 intron 4 2611 tctaatagtccccagtatta A/G tggtgcacatcttcatgtcc 617 ESD 17 intron 5 390 tcttttttcatctctgttaa C/T atcaaccatacagttaaaca 618 ESD 18 intron 7 107 ttagtattggaactaaactt t/C tctagtgttgagaactttgg 619 ESD 19 intron 8 1090 aaattctaactaattaaagg G/T ttcatcctttagtaactaga 620 ESD 20 intron 8 1651 tataaagttgtggttaatga A/G tatatatgaataagaatatt 621 ESD 21 intron 8 2047 agaaggaaaaaggccatttt G/C ttaagaatccctgagatatg 622 ESD 22 intron 9 − 3490 atagaaggagaggctatact A/G cctccttaagtctcaggacc 623 ESD 23 intron 9 − 2596 actaaggataaaaatatggc A/G tactcagtcacattggaact 624 ESD 24 intron 9 − 666 aggccttaatgacatatttc T/C cctcacataaagatacaaca 625 ESD 25 intron 9 − 660 taatgacatatttcccctca A/C ataaagatacaacatgcttt 626 ESD 26 intron 10 799 tatggtaactgaagaaaatg A/G cattaagttcctaaagttat 627 DDOST 1 intron2 628 attctgttaagaagttctta T/C attaagaaatattgtctcct 628 DDOST 2 intron2 3125 gagaatataggagcttctgc G/A tatgcctgaaagtcagtcag 629 DDOST 3 intron2 3920 attactcatttaatgaataa A/G tggattactgagcactgtct 630 DDOST 4 intron3 189 actgctgtccaggggtccat C/T tggggctgagcccagctgga 631 DDOST 5 intron6 185 ctgtcctcttgttcgggagg C/T gtggcagcttttcccttact 632 DDOST 6 exon8 37 aactatgaactagctgtggc C/T ctctcccgctgggtgttcaa 633 DDOST 7 intron9 37 tcctgcccaagaatgctgcc A/A aaaaacggccccaggcctca 634 MGST1 1 5′flanking − 5 tctggaccctgaacaggagg G/C gacatcgtgacaaagcaaat 635 MGST1 2 intron1A + 330 atcagcaggcgatggttact C/G tgggcgggtaaatcaggtga 636 MGST1 3 intron1C + 1428 gtaaagggaaagggcgttcc T/A caactgagaagtgaagattc 637 MGST1 4 repeat attatttgctctacctcagg G/A tttttcgggtcaagcgagat 638 MGST1 5 intron1C + 2914 ctcatcaggtgtgtgtcaga G/T ggcttggtgctggccagtct 639 MGST1 6 intron1C + 4274 attgtaatagattaacaaag G/T tgatgaaagtagtgtacata 640 MGST1 7 intron1C + 4276 tgtaatagattaacaaagtt T/G atgaaagtagtgtacataat 641 MGST1 8 intron1C + 4306 gtgtacataatgtacatagt A/G tagttgaacacatagcaagc 642 MGST1 9 intron1C + 4406 gatggctatatgaccaataa T/A gatacatataaatgtataga 643 MGST1 10 intron1C + 4464 agaaagattgcagctgatag A/G tgtcaggctaataaggacac 644 MGST1 11 intron1C + 4683 aatggcagaggactggaaat G/T tacattttaagctttaccct 645 MGST1 12 intron1C + 4767 gccttcctcttcagcacatt C/T ccaattatacttccaattcc 646 MGST1 13 repeat atttcaatttttttttttgg G/A gggggagacagagtctcact 647 MGST1 14 repeat aattacctcccaaaggcctc A/T tatcccagatactatcacat 648 MGST1 15 intron2 + 2379 ttctcaaatttcattataca C/G tattcttcaacccaaagttt 649 MGST1 16 intron2 + 2767 tttaactatagatgccttct T/G ctcctcttgtgtttgattta 650 MGST1 17 repeat tcactgcagcctcaacctct C/T gggctcaggtgatcctccaa 651 MGST1 18 repeat aaaaaaatttgtagatatgg T/G tactccctatgttgcccagg 652 MGST1 19 repeat ctccctatgttgcccaggct A/G atcttgaattcttgggctca 653 MGST1 20 intron3 + 1495 gtcagacaatggccttcagc G/A tcctctctttgcagaatatg 654 MGST1 21 intron3 + 2528 ttttggagacacttttcaga G/C agagcgtttccagcatcttc 655 MGST1 22 intron3 + 2567 tccctttccatttttaagtt A/&Dgr; gacttttttttttcacctct 656 MGST1 23 intron3 + 2731 atacacatatggaacaatta A/C ctaaaaacttaaggtaatat 657 MGST1 24 intron3 + 3288 gggtttatagtgttcccccc C/&Dgr; tcccccgccccaaaagaccc 658 MGST1 25 intron3 + 4288 ccattctatttgtcaactgc G/A taacacaggcgtagaagtgg 659 MGST1 26 intron3 + 4378 aaatgtctgtccttttggca T/C gttgtgaaggagaacactaa 660 MGST1 27 intron3 + 4429 attggaggtgacgatatctc T/C gtgatgctgggggagaaatc 661 MGST1 28 intron3 + 4817 attgctatagaagagagtaa C/T gtaaagcagaaatagttttc 662 MGST1 29 intron3 + 6077 tttgaaattagtgtctttaa T/C agttatctttttccacagag 663 MGST1 30 exon4 + 304(3′UTR) aagaattctgtacttccaat T/G tataatgaatactttcttag 664 MGST1 31 3′flanking + 1581 tctgtgtgcatgaacatgca C/T gcgtgcacgcgcacacacac 665 MGST1 32 3′flanking + 1729 tatgtggagcaatttgaaaa A/T agtatattctaagccattaa 666 MGST1 33 3′flanking + 3407 ggatcactgctaaagatccc G/A gagtcactccatgtcccagt 667 MGST1 34 intron1B + 36 ggagaaggggaccgcatgca G/A agggtggcaggcagggaggg 668 MGST1 35 3′flanking + 25 gggtaaacccattttgaata T/C tagcattgccaatatcctgt 669 MGST1 36 exon4 + 266(3′UTR) aaagaaaatcatacaactca G/A catccagttggctttttaag 670 SULT1A2 1 intron 4 1728 tcagcttcctcctttgccaa A/&Dgr; ccaagagatgagctggcctg 671 SULT1X3 1 intron 1 6415 tgacctctccctgttagtgt G/&Dgr; ggggcagctctttccagtgt 672 SULT1X3 2 intron 5 2457 gcccttaaagggaagttcat C/&Dgr; cttctctgccttccaggctc 673 PIG3 1 5′untranslated region − 93 tccgcgaggatacagcggcc (CCTGY) cagacaatatgttagccgtg 674 ADH2 4 intron 7 + 108 acaattgacaaggcaagatt T/C tgaaaacaaatcaaaaataa 675 ADH2 5 intron 3 + (1721-1723) actgcatagaaatttaagaa GAA/&Dgr; cttgttttattcctctccag 676 ADH2 6 3′untranslated + (2305-2306) gttaatgctttcccactctc AG/&Dgr; gggaaggatttgcattttga 677 ADH5 1 5′flanking − 115 taactgctgtaaagttacac G/A gggaagccctttcccgacaa 678 ADH5 2 5′flanking − 114 aactgctgtaaagttacacg G/A ggaagccctttcccgacaaa 679 ADH7 16 intron 8 + 727 ttcagatccctgtaagccag G/A tattatttttaccattttta 680 GSTM1 1 5′flanking − 694 tacgaagtggctaatttaca C/T agtacttagccagatgaccg 681 GSTM1 2 5′flanking − 661 gatgaccgaaggactcagta C/T ccgagggcccctaacagaaa 682 GSTM1 3 5′flanking − 658 gaccgaaggactcagtaccc G/A agggcccctaacagaaaaca 683 GSTM1 4 5′flanking − 656 ccgaaggactcagtacccga G/A ggcccctaacagaaaacaca 684 GSTM1 5 5′flanking − 537 tagaggggagactaagccct G/C ggagtagctttcggatcaga 685 GSTM1 6 5′flanking − 525 taagccctgggagtagcttt C/G ggatcagaggaagtcctgct 686 GSTM1 7 5′flanking − 465 aattaaattcccaggttggg G/A ccaccactttttagtctgac 687 GSTM1 8 5′flanking − 383 gcggagagaaggctgaggga C/T accgcgggcagggaggagaa 688 GSTM1 9 5′flanking − 382 cggagagaaggctgagggac A/T ccgcgggcagggaggagaag 689 GSTM1 10 5′flanking − 378 gagaaggctgagggacaccg C/T gggcagggaggagaagggag 690 GSTM1 11 5′flanking − 343 agggagaagagctttgctcc G/A ttaggatctggctggtgtct 691 GSTM1 12 intron 2 + 118 tgctggagctgcaggctgtc T/C cttccctgagccccggtgag 692 GSTM1 12 intron 2 + 233 agtgagtgcccggtctcctc T/C ctgctcttgcttatgggaag 693 GSTM1 12 intron 2 + 26 tgtgggtggctgcaatgtgt G/A gggggaaggtggcctcctcc 694 GSTM1 12 intron 2 + 140 actatcagcagttattctca C/T gactccaatgtcatgtcaac 695 GSTM1 12 intron 2 + 577 ctgccaccccattagaagga A/G ctttctactttccctgagct 696 GSTM1 12 intron 2 + 645 gctggtctggatccagaggc T/A gccaggtgcttgggcgctcc 697 GSTM1 12 exon 2 + 519 caccgtatatttgagcccaa G/C tgcttggacgccttcccaaa 698 GSTM1 12 exon 2 + 528 tttgagcccaagtgcttgga C/T gccttcccaaatctgaagga 699 GSTM1 12 intron 2 + 2421 cagcaccgtgtagaatcttc A/G taagtgttagctgttactgt 700 GSTM1 12 3′flanking + 42 atttgctcctggccatctac C/T cagactgtctgtctgtctgt 701 GSTM2 1 intron 1 + 7 ggaacatccgcggggtgagc C/G agggtccgctgggcggtggg 702 GSTM2 1 intron 1 + 45 gggacgggggtgcgtggggg C/T ggggaagtgtggagcagctg 703 GSTM2 1 intron 3 + 70 gactgcatctcctctcccca G/C cttagaggtgttaagatcag 704 GSTM2 1 intron 3 + 224 agcaggccctggtctcctct T/C tgcccttgcatatgggaagg 705 GSTM2 1 intron 5 + 100 ttgattccttctggtgagtt C/A ttggtcttgctgactctaag 706 GSTM2 1 intron 5 + 341 tcctcttggtgggttcatgg T/C ctggctggcttcaggagtga 707 GSTM2 1 intron 5 + 696 acctttagctagacacagag C/T gctgatttgtgcatttacaa 708 GSTM2 1 intron 5 + 723 ttgtgcatttacaatccttt A/G gctaggcagaaaagttctcc 709 GSTM2 1 3′untranslated + 1006 tcctcttggtgggttcatgg T/C ctggctggcttcaggagtga 710 GSTM2 1 3′flanking + 139 ttctgctgggcatagtaagg C/T gcttgagaattcttgctccc 711 GSTM3 2 5′flanking − 144 ccaacgccggcattagtcgc G/T cctgcgcacggccctgtgga 712 GSTM3 3 intron 7 + 165 agcctaacttctataccttg A/G aggcactgtctacaaaaaaa 713 GSTM3 4 intron 7 + 257 ctgttggactgggtggggtc T/G ttataagattggtgtatttt 714 GSTM3 5 exon 8 + 91 cccagtggggcaacaagcct A/G tatgctgagcaggaggcaga 715 GSTM4 1 intron 4 + 67 ttggctggattggggtgcta T/C gctcagcgtgagtctgtgtt 716 GSTM4 2 intron 7 + 77 gatgctttcccagtcctgga T/G ctgcataaagaataacttgc 717 GSTM4 3 intron 7 + 80 gctttcccagtcctggatct G/A cataaagaataacttgcatt 718 GSTZ1 1 5′flanking − 546 agcagggcccaccagccgac C/A gcctcgaagcgccgtgagcc 719 GSTZ1 2 5′flanking − 321 tgtctgaccagccgccccgc T/C aaggagtcacaagagggcag 720 GSTM2 3 intron 1 + 2890 aaaatactgcatcaaaacca G/A gccacgctctgttgggggga 721 GSTM2 4 intron 1 + 2896 ctgcatcaaaaccaggccac G/A ctcgttgggggggacaccaa 722 GSTM2 5 intron 2 + 255 tctcccaacactgctctcca A/G agccccttggcaaccatgtt 723 GSTM2 6 intron 2 + 1560 caccactgtttaaggccctg G/C gggggcagagttaaacacaa 724 GSTM2 7 intron 3 + 94 ccttgaaaggcatcgactac G/A agacggtgcccatcaatctc 725 GSTM2 8 intron 4 + 297 agaaggaggagtttgctggc C/T ctgtcccctctggtccaggg 726 GSTM2 9 intron 6 + 94 tatctgaaccagcctcccag G/A ctgctttgggcctgacagtt 727 GSTPi 1 intron 1 + 269 ctcccccgggctccagcaaa C/G ttttctttgttcgctgcagt 728 GSTPi 2 intron 1 + 134 ccccgggcctccttcctgtt C/T cccgcctctcccgccatgcc 729 GSTPi 3 intron 1 + 438 gtgtgtgcgcgtgcgtgtgc G/A tgtgtgtgcgtgtgtgtgtg 730 GSTPi 4 intron 1 + 162 cccgctggctgagtccctag C/T ccccctgccctgcagatctc 731 GSTTi 1 5′flanking − 103 taaagagtgtcccaggcgtc C/T gtgccgcccaatggggcaca 732 MGST1L1 1 5′flanking − 105 tgctgccgctgccgtggggc G/A ttctggagggtggagtgtgg 733 MGST1L1 2 intron 1 + 277 agtgtctgtgagagaagcag G/A ttctggagggtggagtgtgg 734 MGST1L1 3 intron 1 + 8030 ggggttatacagagcccctc C/G gcccccaccacacatatgca 735 MGST1L1 4 intron 1 + 8499 gtatggcaggagtggggtcc C/T ggcaagccatagaggtatgg 736 MGST1L1 5 3′untranslated + 468 cgccacctgtgaccagcagc T/G gatgcctccttggccaccag 737 MGST2 1 5′flanking − 46 ggtcagcattcaaagtcaag A/T agcgccatttatcttcccgt 738 MGST2 2 intron 1 + 176 ggtcacccatgccgcctgct A/C ccctccttcccaggggcaag 739 MGST2 3 intron 1 + 204 tcccaggggcaagcagagac T/C gagaacattccagagattag 740 MGST2 4 intron 1 + 373 ttacaagtgttccaaaggaa A/T cgtgcctgcttctaaacctg 741 MGST2 5 intron 2 − 3245 cctcgtgctttgcccacctc G/A gcctcccaaagtgctgggat 742 MGST2 6 intron 2 − 1998 aggccgaggtgggcggatca T/C gaggtcaggagatcgagacc 743 MGST2 7 intron 2 − 1640 tgtttattccttgcatagcc A/G taatataaagtatgaatttt 744 MGST2 8 intron 3 + 41 actgtgttctaatgatgact A/G tgatgcttaaacgattaagg 745 MGST2 9 intron 3 + 453 atcagagtgctatgttgcag A/G tatatgaactttggcttcat 746 MGST3 1 5′flanking − 520 acaaaaaggccctaacagcg A/C taaatccattcacttcggga 747 MGST3 2 5′flanking − 355 cgcctaaaaccgctacggtg G/A ctctgctggggacaaattat 748 MGST3 3 5′flanking − 234 ctgggggagtagatatatgt T/A tttgagaatgagaggagtaa 749 MGST3 4 intron 1 + 74 agcctttgcgcaggcactcc C/T atatttcagcctatgcgagc 750 MGST3 5 intron 1 + 682 agaaaatgccccttctttat G/C tggggtggcagcacggagcc 751 MGST3 6 intron 1 + 832 cgagtttacaagctacataa T/C agcgtcgggggcaagtaagt 752 MGST3 7 intron 1 + 1919 aataaaattcctgagtttct G/C tcactcgctcttacagtacc 753 MGST3 8 intron 1 + 1991 tgtaattaggcaacaggaaa A/G ttgtactatctttcaaatgc 754 MGST3 9 intron 1 + 4458 tcttccatcctcctaacata T/C agttagcttccactctccaa 755 MGST3 10 intron 1 + 4676 tgaatatgcaatgcaattgt C/G gggggatagttacttttcat 756 MGST3 11 intron 3 + 278 cagcatgacccatctaaacc G/C atgttgactctcccaggcct 757 MGST3 12 intron 4 + 423 cttgcctttttgttgtgggg T/G gtggggtggtcacagagaag 758 MGST3 13 intron 4 + 506 gtgcagagaagaaaacaaag T/C ggggaaggtggaaaggggat 759 MGST3 14 intron 4 − 162 tcacagatattttattttcc C/T gactgaaactaacttaattc 760 MGST3 15 intron 4 − 130 acttaattctacctaatttg C/G gtggggagtagttggccaaa 761 MGST3 16 intron 4 − 105 ggagtagttggccaaatcat C/G aaattgttaactttttgcta 762 MGST3 17 intron 4 − 65 aacatattgtgtaatcaacc C/T taggtgttaaaaaaggtttg 763 MGST3 18 intron 5 + 105 atcccagcactttgggaggc G/C aaggcaggcagattgcttga 764 MGST3 19 intron 5 + 197 aaaaaatacaaaaattagcc G/A gatgtggtggtgcacacctg 765 MGST3 20 intron 5 + 222 tggtggtgcacacctgtagt C/T ccagctacttgggaggctga 766 MGST3 21 intron 5 + 374 tcttatgctactatattttt T/C ttcttgggaatttgagaaaa 767 MGST3 22 3′untranslated + 517 atgacttacctttatttcca G/T ttacattttttttctaaata 768 MGST3 23 3′flanking + 166 agtctgattgtggtgatgta G/T gtatagtcatgccacagtga 769 GSTA1 1 5′flanking − 266 ttgcaaaaagagcaaaatct C/A ggtgaaatgtattgtgtaaa 770 GSTA1 2 intron 2 + 1220 gagacacaggctttcctaag A/C tatgacaacaccataactag 771 GSTA1 3 intron 4 + 1813 aaaggcacccactggaggtg A/C attattttgccatcacctga 772 GSTA1 4 intron 5 + 732 gaagagtgttgtcatgaagg T/C ggagtcactgcccaagggag 773 GSTA1 5 intron 6 + 333 ttatcccatatgtgcccaca A/G tgagccggtctgagcagagc 774 GSTA1 6 3′flanking + 412 ctttcttatgcatttgcaaa A/C caatgattctgtctgctgtg 775 GSTA4 1 intron 1 + 280 gcattggtggaaggtgggct C/T ggatcgtccccgggcctgga 776 GSTA4 2 intron 3 + 176 ggaaatcacttcttattcaa T/C agttccataaaagctggccg 777 GSTA4 3 intron 4 + 94 acaccacatttactttatgt C/G ttacatagttagtgagatca 778 GSTA4 4 intron 5 + 1062 cacacttgtgcacatgcaga C/T acccatgggcatccaagagt 779 GSTA4 5 intron 6 + 487 cagatgtgattttactccaa A/G ccattttagctctagaagag 780 GSTA4 6 intron 6 + 595 tgagctctgagagcaaatga G/A agatgttagcaccctaaaca 781 GSTA4 7 intron 6 + 630 taaacatcaccccaaaggat T/A cctaccattctccttctgag 782 GSTA4 8 intron 6 + 3943 tcttcgtagtatctaatacc T/C tttttgttagccttaaagtt 783 GSTA4 9 3′untranslated + 1099 taataacaaccgaatgtcta G/A taaatgactctcctctgagc 784 GSTA4 10 intron 5 + (370-371) gttgtcgaacagctgtctca (TA) gctgacatcctccctgataa 785 GSTA4 10 intron 5 + (370-371) gttgtcgaacagctgtctca gctgacatcctccctgataa 786 \ NDUFA1 1 5′flanking − 1437 agggctaaaaatcctgatta T/A acctaccttgaagcttttaa 787 NDUFA1 2 intron 2 + 3071 aataaaagtacatggcatat C/A tttgatgggaacagacttgt 788 NDUFA1 3 3′flanking + 1218 aactccatgtgtataaagca A/G caccacagatgacacttcca 789 NDUFA1 4 3′flanking + 1411 ggattgtgccatcccttgat C/T/G ggcaatgaccttttactttt 790 NDUFA1 5 3′flanking + 1411 ggattgtgccatcccttgat C/T/G ggcaatgaccttttactttt 791 NDUFA2 1 intron 2 + 1087 aacatacaaaaattagccgg A/G tatggtggcgggcacctgta 792 NDUFA2 2 intron 2 + 1089 catacaaaaattagccggat A/G tggtggcgggcacctgtaat 793 NDUFA2 3 intron 2 + 1356 ttccctgaaacaacccattg T/C ggccatccagaatcagccaa 794 NDUFA2 4 3′flanking + 467 cacagcctcatgggtcagcc C/T actccagagggtgcattccc 795 NDUFA2 5 3′flanking + 744 ggaagcaggggccctggcca C/T agccgctggcagtaagcagg 796 NDUFA2 6 3′flanking + (844-845) tatagtctacaaagaatgaa (ACAC) aaagatcataacaatagcta 797 NDUFA2 6 3′flanking + (844-845) tatagtctacaaagaatgaa aaagatcataacaatagcta 798 NDUFA3 1 intron 2 + 2656 tccctgctgccctcccctgc G/A cactttatcttccctttgcc 799 NDUFA3 2 exon 4 + 241 agggccccagcctggagtgg G/G tgaagaaactgtgagcacct 800 NDUFA3 3 3′flanking + 1019 tccttacctgcactggcacc A/G gctctggagccccagtccct 801 NDUFA5 1 intron 3 + 2155 agactctagcatggtacctg G/G aacataaggttccttagaaa 802 NDUFA5 2 intron 3 + 2493 ggcatattgctagttttctc G/T gtctcaatttcatcatctat 803 NDUFA5 3 intron 3 + 2712 acaaattttgaactgttcac C/T taacacaggctttttctgaa 804 NDUFA5 4 3′flanking + 1298 aggtatctaaaaggtattgc A/C atttggtcattggttctttc 805 NDUFA5 5 intron 3 + (30-31) aagtcagttttgttgtcttg (GATTTGTGGTATCCAG) tgtaa 806 catttaaccaaaaaa NDUFA5 5 intron 3 + (30-31) aagtcagttttgttgtcttg tgtaa 807 catttaaccaaaaaa NDUFA5 6 intron 3 + (427-428) attaagtagcagttaataaa AG/&Dgr; tctagactgctgattcatac 808 NDUFA5 7 intron 3 + (4733-4734) tataggaattttaaaatata TA/&Dgr; ggatattgaaacattcagtt 809 NDUFA6 1 5′flanking − 1148 tttataatttatatatgtta C/T gtgctttcttttgtatagct 810 NDUFA6 2 5′flanking − 363 actaccaaggagcgcggcgg G/A cagccggatagcaggacgct 811 NDUFA6 3 exon 1 + 26 ggggagcggcgtccgccaag C/T tacttctaccgccagcacct 812 NDUFA6 4 intron 1 + 1318 attcagcagtttgaaaacat A/G atgtttgcctggcagaatac 813 NDUFA6 5 intron 2 + 562 agttaaagaatctgaaaagt G/C tcagaaatgatttaccctga 814 NDUFA6 6 5′flanking − (861-862) ctgtaaaatggggatgctga (T) ggtacctacctgacctatga 815 NDUFA6 6 5′flanking − (861-862) ctgtaaaatggggatgctga ggtacctacctgacctatga 816 NDUFA7 1 5′flanking − 731 accaaccaaaggtctatcaa A/G ggggtgtcctctttgcaccc 817 NDUFA7 2 5′flanking − 434 aaagggaaccatcagaaccc C/T gtgatgaaatgagaatcggc 818 NDUFA7 3 5′flanking − 395 gctcccggattccggctggc A/G ggggttagggcagggtagag 819 NDUFA7 4 5′flanking − 100 agaggagtcacgtgcttcgg G/A gagagcctttataggacgtt 820 NDUFA7 5 intron 1 + 92 tcacctccctcctaagccgg G/A acccttcgctctccccgaat 821 NDUFA7 6 intron 1 + 133 ctccctgggaacccccagct A/C gtcaccccttcagcccggga 822 NDUFA7 7 intron 1 + 136 cctgggaacccccagctagt C/G accccttcagcccgggaccc 823 NDUFA7 8 intron 2 + 89 tcctttagacccctgaaacg G/C agggctgacatcctgccacc 824 NDUFA7 9 exon 3 + 196 gccgccgggaatctgtgccc C/G cttccatcatcatgtcgtcg 825 NDUFA7 10 intron 3 + 4203 gcctccacccctggggcgcc T/G cctccatcaccccaccctcc 826 NDUFA7 11 intron 3 + 4604 gggccttgtgtacgctggag A/G ccaaaagtgggaagggagga 827 NDUFA7 12 5′flanking − (1360-1353) agggtccagggtcccctgct (CAGAGGCT) aacactggccg 828 aagagaaag NDUFA7 12 5′flanking − (1360-1353) agggtccagggtcccctgct aacactggccgaagagaaag 829 NDUFA7 13 5′flanking − (1240-1239) tgatagagccctgatccacc CA/&Dgr; ctctctgaaacttctttgct 830 NDUFA7 14 intron 2 + (4142-4143) cattttgtgactgaggtgac AG/&Dgr; gggcccacagcggggccatg 831 NDUFA8 1 intron 1 − 75 tttgtgttctctattctgac C/T ctttatccagaagtgagcag 833 NDUFA8 2 intron 2 + 790 caaacctagacaaagtgtgc C/T attgctcaggcctgagatgg 834 NDUFA8 3 intron 2 + 900 ttcaggagataaaaagctct G/A attgctcaggcctgagatgg 835 NDUFA8 4 intron 2 + 3837 gaagttgtcttgtaagtgag A/G taagaatatgtactcacata 836 NDUFA8 5 intron 2 + 3942 tcattgttttgcaaagagat G/T cccctaacccagctttcttt 837 NDUFA8 6 intron 3 − 66 gaggagacaccaggaggcgc A/G ttgatggttacagattcctc 838 NDUFA8 7 3′untranslated + 520 tttatttctggaccaagtaa A/G gatgggtccgtggcccacac 839 NDUFA8 8 3′flanking + 367 gtcatacaaggggagcctcc A/G ggatagaagtgcagaaactt 840 NDUFA8 9 3′flanking + 777 attcttttttcactactagg C/T tgtttcctccacatctgact 841 NDUFA8 10 3′flanking + 1053 aaagaaaaagcactgtgtga T/A ctgccatggccgcttctgca 842 NDUFA8 11 3′flanking + 1190 gattctctaatgaaaaataa G/T acttttttttgcattttttt 843 NDUFA8 12 intron 2 + (449-453) ggtcattgtgcatgatacttaa (GTAAA) aaaaaactaagctgtgtaat 843 NDUFA8 12 intron 2 + (449-453) ggtcattgtgcatgatacttaa aaaaaactaagctgtgtaat 844 NDUFA8 13 intron 2 + (707-708) ctcattttggaaagactctc (A) accttgctgtaccaaaaatg 845 NDUFA8 13 intron 2 + (707-708) ctcattttggaaagactctc accttgctgtaccaaaaatg 846 NDUFAB1 1 intron 1 + 8451 cagcaccctgtagaggcctc G/A ggatgctgaagatgccatga 847 NDUFAB1 2 intron 1 + 8495 gacacaggcattctgcagac G/A ctagacaattttagtggcag 848 NDUFA9 1 5′flanking − 807 gatggctctttgtagaacaa T/G gcagattctcaaaggtgacc 849 NDUFA9 2 5′flanking − 769 accacagttaaagaaaaaat T/C acaagccattgcgctagaga 850 NDUFA9 3 5′flanking − 353 cacaccctattttggtttct C/G ttctccacttttcccctcgt 851 NDUFA9 4 5′flanking − 322 ttcccctcgttcttgtcccc C/T cttttctctctcctgggccc 852 NDUFA9 5 intron 1 + 447 attcatatgagcacaatgga A/G atgataatattacaatacca 853 NDUFA9 6 intron 1 + 1039 ggcttgatgttcagcctgag G/A caagaattaggagtgtttag 854 NDUFA9 7 intron 1 + 4010 aatgtatccaaaagagattc T/G cattcctgccatatgaagaa 855 NDUFA9 8 intron 3 + 49 gacaaatataaattactaag G/A tcatttttaggagtgatagg 856 NDUFA9 9 intron 3 + 107 aatttcttcccagaatggac C/T aaaggcatcctctgttccca 857 NDUFA9 10 intron 3 + 1183 atctctggtaatattcatac A/G gattatttgtaatcccttta 858 NDUFA9 11 intron 3 + 1395 attcctagttctttgtccct C/T aagtttgttggtcaccttgt 859 NDUFA9 12 intron 3 + 2363 agaaaatagtcatgaatggc C/T ccaactaacactagtcttta 860 NDUFA9 13 intron 3 + 2608 gtcatttgattacctgagta A/C agtgtactgttacctgtttg 861 NDUFA9 14 intron 4 + 561 attttataaattctttgatg A/C cttgggggtcttattcaact 862 NDUFA9 15 intron 4 + 860 attgtgtagagtaatgacag C/T agagctgtcaacttttttaa 863 NDUFA9 16 intron 4 + 879 gcagagctgtcaactttttt A/T aaaaaataattttagcttaa 864 NDUFA9 17 intron 4 + 893 ttttttaaaaaaataatttt A/G gcttaaaaaaattaaaaatt 865 NDUFA9 18 intron 4 + 1090 atcattgctgtttaaaagtt T/C aagtagtgtgaatttcagta 866 NDUFA9 19 intron 4 + 1188 aaccaatccttttatttttt A/T tcttccagaaactttgattt 867 NDUFA9 20 intron 5 + 161 gggtgtgtgtgatgttttga C/T gttttgattgattgccttct 868 NDUFA9 21 intron 5 + 373 ctttctcaccccttgcactg C/T agtggttttgtgccactctt 869 NDUFA9 22 intron 5 + 457 gccagggaagatgcctattc A/C cacagtgcttatgctccttt 870 NDUFA9 23 intron 5 + 3113 gatttttctccttcttcaat G/A taagcttcccttaaaataaa 871 NDUFA9 24 intron 5 + 3339 tctaaactcaaaacaggttt G/A tttggttattgtttaggctg 872 NDUFA9 25 intron 6 + 414 tatagttttgccttttccag G/C atattacatatatggttaga 873 NDUFA9 26 intron 6 + 518 ctttcatttcttttcatagc T/C tggtagctcatttctttata 874 NDUFA9 27 intron 6 + 974 ggattatgcgtacttggaaa A/G tacttggatagcggtgatta 875 NDUFA9 28 intron 7 + 368 acattaattttgatggagta T/G cacaatgcctccagaggctg 876 NDUFA9 29 intron 8 + 954 gcatgcaatcagttatatag T/C ctagataagaattacaattc 877 NDUFA9 30 intron 8 + 1253 tcctcttgaaattgtagata G/T gtatctacacatttctcatc 878 NDUFA9 31 intron 8 + 11608 gaaaagatagatgtataaat G/A accaaaaattcgtgaagaaa 879 NDUFA9 32 intron 8 + 11930 ctacaaatatattctaaatg C/T gtaatcatggataagtacaa 880 NDUFA9 33 intron 9 + 1998 tgtttttcaagcctttaaac G/A gctgtggaaccctgtgctca 881 NDUFA9 34 intron 9 + 2238 ccagctacttgggaggctga A/G gtgggaggatcacttgagcc 882 NDUFA9 35 intron 9 + 2885 acagcggtctgtcttcctgc A/G gttctcataggctagattac 883 NDUFA9 36 intron 10 + 801 tacactaaagtgtctcttac G/A tttatacttgagaaagtgtt 884 NDUFA9 37 intron 10 + 910 tgcagactttcaggtgggta G/C gatgagggattgctgctgct 885 NDUFA9 38 intron 10 + 1180 aaaactgagtcagaacgccc G/A tgctcagaaaaacagggcgt 886 NDUFA9 39 intron 10 + 554 gtgccagcacttaggaatta T/G gaccttctaatgaagttctt 887 NDUFA9 40 5′flanking − (1129-1128) taaacagtaggggcaagata (TC) gagtggaaacagccaagatt 888 NDUFA9 40 5′flanking − (1129-1128) taaacagtaggggcaagata gagtggaaacagccaagatt 889 NDUFA9 41 5′flanking − 341 tggtttctcttctccacttt T/&Dgr; cccctcgttcttgtcccccc 890 NDUFS1 1 5′flanking − 3 tcctagggggtcgtcgtggt C/G cagacagtttagcagaacag 891 NDUFS1 2 intron 1 − 445 gtgttagcaatggctcacgc T/C tctgtttgttgtccttgttt 892 NDUFS1 3 intron 1 + 470 tttgttgtccttgtttgttt G/T gtccattgaccacgttggac 893 NDUFS1 4 intron 1 + 502 acgttggacagcattttttt A/G ttcctttaactaacgggaaa 894 NDUFS1 5 intron 1 + 557 ttttgaaaagttagcccagg A/G ttgcattgcaaataacaaaa 895 NDUFS1 6 intron 1 + 5218 tatctcagaatatctcagga A/G catttagtagacagctatgc 896 NDUFS1 7 intron 3 + 1371 aagccctaaaatagatagtg T/G caatgggaatgaaaacaaga 897 NDUFS1 8 intron 5 + 414 ttttgaaacgaggtctcact A/G tgttgtccaggctgggcttg 898 NDUFS1 9 intron 10 + 812 gagtgcggtggcgcgatctc G/A atctcgggtcactgcagcct 899 NDUFS1 10 intron 11 + 233 ggaggccaaggcaggcagat C/T gcctaagtgcaggagtttga 900 NDUFS1 11 intron 11 + 283 ggccaaacatggcgaacccc G/A tctctactaaaaatacaaaa 901 NDUFS1 12 intron 11 + 585 ctgtatgtcttaattttaaa G/T taaatttgcattttatatat 902 NDUFS1 13 intron 12 + 1251 gcaccactgtttaatgctag A/G attcgaaagaggttggtaat 903 NDUFS1 14 intron 13 + 5159 attacttttagaaaacgtgt T/C ttagctgatactcaggcata 904 NDUFS1 15 intron 14 + 250 aaaaattgttatattagtta C/T acccttggttcaaaaatgca 905 NDUFS1 16 intron 14 + 550 gataaagtctcactatgttg C/T ccaggttgatctcaaactcc 906 NDUFS1 17 intron 14 + 2429 ctgaaaatacaaaaattagc C/T gggtgtggtggcatgtgcct 907 NDUFS1 18 intron 14 + 2530 ttacagtgagccgagatcac G/T ccactgcgctccagcctggg 908 NDUFS1 19 intron 14 + 2659 acacatttaattttttacat T/C gaaaatactgcagttatggt 909 NDUFS1 20 intron 16 + 150 agaaaacatgtattcagaaa C/T aggaattcaaggttacagtg 910 NDUFS1 21 intron 18 + 279 cactgtgtagcaatttatgg T/C gaattttccaaagtggcaaa 911 NDUFS1 22 3′flanking + 182 tctaggataattataattaa T/A aataatcatagtaacaatgg 912 NDUFS1 23 intron 11 + 3226 aaatgtattgtctgtgcttt T/&Dgr; aacattttgtaatagtaaat 913 NDUFS3 1 5′flanking − 194 tctgccacaaggagctagga C/T cacgctcacctcacgatttc 914 NDUFS3 2 intron 1 + 46 cggggtcaggcgcagcggcg T/C gcccagtgcagagagctcct 915 NDUFS3 3 intron 6 − 439 aaagctgtgtcaaatgtact G/A ctttagatctggactgtgaa 916 NDUFS3 4 intron 6 − 280 ggtgggtgagcagtcagttc G/A gagctcctgatgtgggagtg 917 NDUFS4 1 5′flanking − 439 aactgaatacagccctgtcc T/A gagggcttgcaaagtgaatc 918 NDUFS4 2 intron 1 + 1829 gaaaaaaaatcttaatgcca G/T ggaagacgttttttaaatac 919 NDUFS4 3 intron 1 + 2057 attaatgggaaaatctacat C/G taaaattcattttattgtaa 920 NDUFS4 4 intron 1 − 521 ttcattttaactaattttat T/G tctcccattttgtgaatggg 921 NDUFS4 5 intron 1 − 1259 ataaaattatgatattatta G/A tactaatatagccagccata 922 NDUFS4 6 intron 1 − 1174 aatatatataattataggaa T/C ctcagagtagcaaccatggt 923 NDUFS4 7 intron 1 + 10682 cacaatataggcacaaactt A/C ctaccaaagcactaacaagt 924 NDUFS4 8 intron 1 + 12299 tttactatatagatatatgg A/T atagactatagagtatctct 925 NDUFS4 9 intron 1 + 12550 accaaataaggtattatgca G/A gctcatctttttatataaga 926 NDUFS4 10 intron 1 + 18801 ggaaagacttgctttgccag T/C gtatccgaaacctctgttat 927 NDUFS4 11 intron 1 + 19888 tcgcacagctgagaagagca A/G ggggctggttttcagtaccc 928 NDUFS4 12 intron 1 + 20178 agaaaagatgagtataattc G/A tctaacttacccattcttaa 929 NDUFS4 13 intron 1 + 23016 ctactctgtgaaagtaaggt T/A atgttgaacaagtaaattaa 930 NDUFS4 14 intron 1 + 23124 actttctttggagatggagt T/A ccagcagttgggaatgtaat 931 NDUFS4 15 intron 1 + 766 tgtgatgatttttttttttt T/&Dgr; ggctgtattaaccttccatt 932 NDUFS4 16 intron 1 + 1261 tttctttctctttttttttt T/&Dgr; gagatacattctcactctga 933 NDUFS5 1 intron 1 + 388 ccaaacatagccagcacttc C/T ggctgtaactccgggctgtt 934 NDUFS5 2 intron 1 − 13082 agtgagccgagattgcacca G/A tgcattccagcctgggcaac 935 NDUFS5 3 intron 1 − 12905 gttttcaacaaaggactcca G/T agtagtagagaagtttctgt 936 NDUFS5 4 intron 1 − 12564 attttcatcacacctcaact T/G aaggtataacagccttaaga 937 NDUFS5 5 intron 1 − 12561 ttcatcacacctcaacttaa G/A gtataacagccttaagaatg 938 NDUFS5 6 intron 1 − 10561 aacaatgtggtatagtgggg C/G gggtggtgagcaggtgtcat 939 NDUFS5 7 intron 1 − 9065 cctgatgctcctggctccag G/A gtagaccttttccctttaga 940 NDUFS5 8 intron 1 − 8871 tcaccacgtgtctgtagata T/C aggaccgcagaccttcgctt 941 NDUFS5 9 intron 1 − 7312 aaatccttggcttctagaat G/T ggtcactgatggtatataat 942 NDUFS5 10 intron 1 − 6827 aacctctgcctccccgattc A/G cgccattctcctgcctcagc 943 NDUFS5 11 intron 1 − 6725 agtagagacggggtttcacc G/A tgttagccagcatggtctcg 944 NDUFS5 12 intron 1 − 6631 aggcgtgagccactgcgccc G/A gcctagaccttcttcttata 945 NDUFS5 13 intron 1 − 6531 cccaacagctcccaatgtaa A/G acagatctattaatattctg 946 NDUFS5 14 intron 1 − 6346 gcaacagatcttgacctata T/C cccatagggtacagctgagg 947 NDUFS5 15 intron 1 − 6327 atcccatagggtacagctga G/C gactttaatcagaaaaggag 948 NDUFS5 16 intron 1 − 6122 tagccttgcttttactctac T/C gttcctcccaaatcacaccc 949 NDUFS5 17 intron 1 − 2512 acaaactcttaatgcgaatt T/C tgcagatcaaagtgggctta 950 NDUFS5 18 intron 1 − 1945 tttaatctcctttaaatttc G/A caatttcacaacctagggta 951 NDUFS5 19 intron 2 + 75 tttttttttttttttgagac G/A aagtctcactcttgtcccct 952 NDUFS5 20 intron 2 + 148 ctgtagcctctgcctcccag G/A ttcaggcgattcgcgtacct 953 NDUFS5 21 3′flanking + 150 cagattcaagtggttctcct G/G cctcagcctcccaagtagct 954 NDUFS5 22 intron 1 − (10682-10681) attataaacactaaacaaac AT/&Dgr; gtgtggtctctttagagggg 955 NDUFS5 23 intron 1 − 10272 aggaacaagtgactaccctg A/&Dgr; aaaaagaagagatgaaacaa 956 NDUFS5 24 intron 1 − 2069 accagacagagttcccttta C/&Dgr; ttgttttcctgtggcaaaga 957 NDUFS6 1 intron 1 + 26 ggccgctgggtacaggatgc A/C ccttcctccagccgcacctc 958 NDUFS6 2 intron 2 + 1078 ggatcatggtggtggagagg G/A gcttgtgtctggtgggtttg 959 NDUFS6 3 intron 2 + 1260 cagttgtcgagtaagtggtg T/C atagggtaagtgctctttct 960 NDUFS6 4 intron 2 + 1413 caaaggagctcatggcattg C/T gaatgggacatttcttccgt 961 NDUFS6 5 intron 2 + 1568 tggagaaggggaggtttctc T/C tagtgtggatgcggtatggt 962 NDUFS6 6 intron 2 + 1692 gaccgtggtgacggaggttt C/T ctgggcatcgatgggtggtt 963 NDUFS6 7 intron 2 + 6488 tagcttaaataattattggc A/G ttcatgttcagaatgcctga 964 NDUFS6 8 intron 2 + 6563 tttaaacttttattttaaat G/A tccatgaatggggtcggtat 965 NDUFS6 9 intron 2 + 6740 aaagatttaaacctacatat C/T tttatgcccaatcatttgat 966 NDUFS6 10 intron 2 + 6832 gcgaggactcatttttacag A/T ggttggacacttcactgtgt 967 NDUFS6 11 intron 2 + 7054 ttcactgccggagcttggcc G/A tgtgaacccggagccgggct 968 NDUFS6 12 intron 2 + 7186 ggtcagggtcacccttgagc T/C gcgcacactaaatgacggga 969 NDUFS6 13 intron 2 + 7225 gagggcatcccgcgtcagtc G/A ccagtgtcgaggcgtcagca 970 NDUFS6 14 intron 2 + 7810 cttccactctggggcgggga C/T gctgtagaaggagcacaaag 971 NDUFS6 15 intron 2 + 11080 gtaactgttcagtgctttct C/T ctttggatttcatgtaaatc 972 NDUFS6 16 intron 2 + 11657 gggacagaacgatgtggtgg G/A gagaagagggcgtggcagag 973 NDUFS6 17 intron 3 + 208 cgaaaaccccctttcaactg T/C gaagtggtgggcggcatgtt 974 NDUFS6 18 intron 3 + 1031 ctagagtgggactgggcacc C/T ggcatgtcccctcctgggct 975 NDUFS6 19 3′flanking + 270 gcttcagagagccaaggtgg G/C tcttgaggtgcatagtgaag 976 NDUFS8 1 5′untranslated − 45 agtgtagcctccgcctcccg A/C ttgactggcctgcttggcaa 977 NDUFS8 2 intron 1 + 163 aggtgcagcggggagccggc T/C ctcagggcgcatgcgccgcc 978 NDUFS8 3 intron 3 + 123 tctctgagcctgtttccact T/C ttaaaatgattatggtgatg 979 NDUFS8 4 intron 6 − 505 aggcaaggcaggccgggcac G/A gtggctcacgcttgtaatcc 980 NDUFS8 5 3′flanking + 491 ggccctgagctggcctgcgt C/A cagccacatcctctttcctg 981 NDUFS8 6 3′flanking + 693 ttcacttcatttgcagtgag G/A aaaccagctccgagaggtga 982 NDUFS8 7 3′flanking + 1267 ttttcccagacgtaaccgcc G/A tcagagcgtggcatggagcc 983 NDUFS8 8 3′flanking + 1362 cgctgggttctttcccttac C/T gtggtctcccaggcacttac 984 NDUFS8 9 3′flanking + 1449 tgtcagaacaggcctatggc G/A cccaaccacaagtcccccaa 985 NDUFS8 10 3′flanking + 1572 cagccccacaggcctgtgct C/A gctgtgtggggcttagggat 986 NDUFS8 11 3′flanking + (783-784) cagagaccttgacccccccc (G) atctaccatcatttccaaaa 987 NDUFS8 11 3′flanking + (783-784) cagagaccttgacccccccc atctaccatcatttccaaaa 988 NDUFB3 1 5′flanking − 1439 ttaaaagttgacttttttct G/A ccgggcacggtggctcacgc 989 NDUFB3 2 5′flanking − 1436 aaagttgacttttttctgcc G/A ggcacggtggctcacgcctg 990 NDUFB5 1 5′flanking − 213 ggcggatgaaactctcctac A/C aagaagggccaaaccggccg 991 NDUFB5 2 intron 1 + 6288 ggggatgttgattacctagg T/C cagtaaagtaaagaaggcat 992 NDUFB5 3 intron 1 − 1581 cttctgggccactgtatcct A/G tttctttcccttgttaccct 993 NDUFB5 4 intron 1 − 1487 ccctcttagaccgtatatag T/G tctagcataggatctgcaca 994 NDUFB5 5 intron 2 + 556 ttgtctggaccatctgccac G/A gtagataaagctctgaatca 995 NDUFB5 6 intron 3 + 467 ggcgccatcgcactccagcc C/T gggcaacagagtgagactct 996 NDUFB5 7 intron 4 + 497 agtgagactctgtccccccc C/G caaaaaaaaactataatcct 997 NDUFB5 8 exon 5 + 397 atgatagtcctgaaaagata T/C atgaaagaacaatggccgtc 998 NDUFB5 9 intron 1 + (231-215) attagcatttctaaaacgtt GTT/&Dgr; attcaccatcccaattaatg 999 NDUFB7 1 intron 1 + 68 cctgaacacctggcacccca G/A ggctggcaccccagggctgg 1000 NDUFB7 2 intron 2 + 266 gggctctctaggggcctgtt T/C gatggggacagggcaggtgg 1001 ABCA1 1 5′flanking − 278 gggcccgggcgggggaaggg G/C acgcagaccgcggaccctaa 1002 ABCA1 2 5′flanking − 99 acataaacagaggccgggaa G/C ggggcggggaggagggagag 1003 ABCA1 3 intron 1 + 159 gcggtgttaaatggggagac G/T atgtcctagtacgagctctg 1004 ABCA1 4 intron 1 + 506 gaattggctatatgctcccc G/C ggactggagcggcacagtcc 1005 ABCA1 5 intron 1 + 5897 gtacaaaaccctttagcttt T.G gcaaacctcctttaagaccc 1006 ABCA1 6 intron 1 + 5929 ttaagacccgatttaaatgc C/T tccctcctcatgaagctctt 1007 ABCA1 7 intron 1 + 5962 aagctcttctggatccactc T/C ttcccatcactaagttgaaa 1008 ABCA1 8 intron 1 + 5985 cccatcactaagttgaaagt A/C agatccccttctctttactt 1009 ABCA1 9 intron 1 + 11416 ttacagtgccctttatagga G/A agaaagaagaaattgtgtct 1010 ABCA1 10 intron 1 + 11935 tctctgtggagcaaatagag G/A gctgtctgacacttggttcc 1011 ABCA1 11 intron 1 + 12281 gaatgtttgatttgtgaaaa T/A cttaataacagtagtttttt 1012 ABCA1 12 intron 1 + 12924 gtgctgacaatcttatactc T/C aggttgaacctccggggaag 1013 ABCA1 13 intron 1 + 13002 gagcctcaatcacagattct C/G tctagctcacatgaagttaa 1014 ABCA1 14 intron 1 + 17715 ggagcatgactttgtggaag C/T ctctcctcttccacccagag 1015 ABCA1 15 intron 1 + 17848 gagggctgactgtcaccctt T/C gataggagcccagcactaaa 1016 ABCA1 16 intron 1 + 21384 gtgggtgggaggaattggag G/C aggaagcttgcctaagtgtg 1017 ABCA1 17 intron 1 + 22145 gtagcttctaaatcaacgaa C/G tgattcctggagagcagctt 1018 ABCA1 18 intron 1 + 23063 ggaggcacctgtgaaaccaa G/A cggagtaggggggcggtgtg 1019 ABCA1 19 intron 1 + 23131 agtgtgcatatgtgctgacc G/A tgggagcttgtttgtcggtt 1020 ABCA1 20 intron 2 + 156 ggacacaggactgtgtggtc T/C ggatatggcatgtggcttat 1021 ABCA1 21 intron 2 + 384 gctgtgggtgaagtgagtta A/G tggccccactcttagagatc 1022 ABCA1 22 intron 2 + 1081 agtgcagccaaaattgcaaa G/A tcataccattcaaattaata 1023 ABCA1 23 intron 2 + 2801 aagaaaagtgatttatttca A/G gttgctgatgcttagattgt 1024 ABCA1 24 intron 2 + 2830 tgcttagattgttagagttg C/G aaagatctggcttgcatctt 1025 ABCA1 25 intron 2 + 2856 tctggcttgcatcttgtaca A/G ctgacagaactggggctcag 1026 ABCA1 26 intron 2 + 3187 tgatagctgttgcctgcagc A/G tacggacgttcattgcgcag 1027 ABCA1 27 intron 2 + 3190 tagctgttgcctgcagcata C/T ggacgttcattgcgcagttc 1028 ABCA1 28 intron 2 + 3194 tgttgcctgcagcatacgga C/T gttcattgcgcagttcctgt 1029 ABCA1 29 intron 2 + 3204 agcatacggacgttcattgc G/A cagttcctgtctcctgagat 1030 ABCA1 30 intron 2 + 3401 acataaagcctgtgtgctgc T/C gccaggaagactagaaacgc 1031 ABCA1 31 intron 2 + 13927 gtcaccacatacctggcact A/G tgctaaggctgggaatgcag 1032 ABCA1 32 intron 3 + 4163 ccagcccacttcatcttacc G/A tagttacctccttagagtat 1033 ABCA1 33 intron 3 + 4262 tgtcaaagaggaactaagga T/C gccagggactttctgcttag 1034 ABCA1 34 intron 3 + 4306 ccctctcatcacttctccaa C/T gctggtatcatgaaccccat 1035 ABCA1 35 intron 5 + 240 gacagaagaaaagtccccag G/A gaagaatactacagacttgg 1036 ABCA1 36 intron 5 + 490 gatgggcatttgaacttgtt G/A tctttaaaaagtgaaatctt 1037 ABCA1 37 intron 5 + 583 tatctggggagtgggcattt T/G ctgactgaggcattggctgc 1038 ABCA1 38 intron 5 + 1051 ggctacaaaactgtgctttc C/T ttgggcagtaaaagaggcaa 1039 ABCA1 39 intron 5 + 3051 tagagaacaagtctaattct G/A ttttccttgaaatagtcgaa 1040 ABCA1 40 intron 5 + 3127 aagtccatgattttttaggc A/G aaatggcctcctttcctctt 1041 ABCA1 41 intron 5 + 5924 ctttctttcacaaaattgcc C/T cccagagctttctggaaggg 1042 ABCA1 42 intron 5 + 6831 ccagtccctcagccttgcca T/C tgcttatgctggtctggaaa 1043 ABCA1 43 intron 5 + 12678 gctcaccgctctgctcaccc G/C accctctggccatctcctct 1044 ABCA1 44 intron 5 + 14214 cagcttggtcccagaggcct G/A gacctgggtcccagaggtcc 1045 ABCA1 45 intron 5 + 14257 gctggttccccggcttggtc C/T cagaggcctggatgtgtggc 1046 ABCA1 46 intron 5 + 18078 cctaccacaccatgcacgtg C/T acagccaagggttgttgact 1047 ABCA1 47 intron 5 + 18795 ctgggctcttcctggacctg G/A ccagctaaaaggaaatctcc 1048 ABCA1 48 intron 5 + 18948 gcattggtggtactaagaac G/A catattccctatcctatagg 1049 ABCA1 49 intron 5 + 19053 ctcccccaacattaaaagtg T/C aagggatgcttattcaaatg 1050 ABCA1 50 intron 5 + 19148 ggcccaagaaactgcatttt C/A gcatgctccctaaatgaagc 1051 ABCA1 51 intron 5 + 19229 atgctaacagtgtagagtca C/T atgtgatgggaagcatcagg 1052 ABCA1 52 intron 5 + 19405 cttgctcaatttattctgtc T/C atataactcaatattactga 1053 ABCA1 53 intron 5 + 19534 catgtgaccctcttagctcc G/A cggattaactcctgtcctca 1054 ABCA1 54 exon 6 + 474 gaaaccttctctgggttcct G/A tatcacaacctctctctccc 1055 ABCA1 55 intron 6 + 210 gcaacctggcgtcatgggcc A/G gctggttaaaataaaattga 1056 ABCA1 56 intron 6 + 334 acagttctgaggcaataacc G/A tggttaagggttattgatct 1057 ABCA1 57 intron 6 + 2288 cttctttcaaagcttgtggt C/T cactggaccacgtatgaagt 1058 ABCA1 58 intron 6 + 2322 atgaagtagaatagtttagg T/C ccagaaaggcaattaagtaa 1059 ABCA1 59 intron 6 + 2820 gtgctttgatacattctgag T/G ttcagtaaagagacctgatg 1060 ABCA1 60 exon 7 + 656 tgagctttgtggcctaccaa G/A ggagaaactggctgcagcag 1061 ABCA1 61 intron 7 + 416 catcataaagatgacattgt G/A ggctgtcacagttggaaggc 1062 ABCA1 62 intron 7 + 471 agaccacactatttagctta C/T ttagtaataacattgcaaag 1063 ABCA1 63 intron 7 + 504 ttgcaaagaaaaattccgac G/A aagttttttcagcctaggaa 1064 ABCA1 64 intron 7 + 679 gctctggtgaaattcctctc G/C ctaccccaaacatcatcatt 1065 ABCA1 65 intron 7 + 1740 acaaatgctcaccctttcag G/T tggaatgattgaaattttgg 1066 ABCA1 66 intron 7 + 2122 tgattaaggtggctactacc A/G ggtgctttctgcatatctcg 1067 ABCA1 67 intron 7 + 7753 taggaattccaagctgtgaa T/C tttttactgaagctctttgg 1068 ABCA1 68 intron 7 + 8973 atggaaatttgtttatattg A/T ctacagattgccaatattat 1069 ABCA1 69 intron 7 + 8976 gaaatttgtttatattgact A/G cagattgccaatattattag 1070 ABCA1 70 intron 7 + 11327 ctaacaatcttatttccatt G/C agtccttataaaagaagtgg 1071 ABCA1 71 intron 7 + 11738 ctgacgtttaagggagaccg C/T gtaggtccctttgaggactg 1072 ABCA1 72 intron 7 + 12295 agtctgtaaattattgttct T/A ttttttctttagcttatgct 1073 ABCA1 73 intron 8 + 387 tagcaaggccaatcatttta C/G caacacacatgcttgctaac 1074 ABCA1 74 intron 8 + 697 ggaactgtctggtgtccccc A/T gcataggaagctgagccagg 1075 ABCA1 75 intron 8 + 1312 attgctctgcagatcccctc G/A cagccctctgtcccttgttc 1076 ABCA1 76 intron 8 + 3036 ctttatgtgggaagaaattt T/G tttttttgattggggagtgg 1077 ABCA1 77 intron 8 + 3176 aaatggcctggttctctgtc C/A cctttctgtctgtatgcctc 1078 ABCA1 78 intron 8 + 3364 ggcagaaggcaaagcttagg A/T cctagagagtgctggaccac 1079 ABCA1 79 intron 8 + 3373 caaagcttaggacctagaga G/A tgctggaccacgccactcac 1080 ABCA1 80 intron 8 + 3581 cagggatttattaatgattt C/A ttgtgaaatgtttggaaata 1081 ABCA1 81 intron 8 + 3654 agtgccggaatacatttgca T/C gtaagacagaccgctgcctg 1082 ABCA1 82 intron 8 + 4715 ggcagaggggtctcagaatc C/T gcatttccaacaatgtctcc 1083 ABCA1 83 exon 9 + 936 cgtattgtctgcgggcatcc C/T gagggaggggggctgaagat 1084 ABCA1 84 intron 9 + 2309 cccctcaagagtcagtttaa A/G tgttggtcatgttagttgtc 1085 ABCA1 85 intron 9 + 2392 atgggagggcttgtgcttca T/C gaaaacatttttccagatca 1086 ABCA1 86 intron 10 + 228 tggggatggggaggactggc A/G cagggctgctgtgatggggt 1087 ABCA1 87 intron 10 + 319 ttctgcggtccctggctccc C/T acctgactccaggtgaacaa 1088 ABCA1 88 intron 11 + 377 gaaagaagtgtgggagcaaa A/C gcatgatgttacatgtagac 1089 ABCA1 89 intron 11 + 521 agtgctctagagacaattgg G/A ttcaaatgtggagcaggctg 1090 ABCA1 90 intron 11 + 2850 ctctatacaatcattatgct G/C ccattgaaataataaataca 1091 ABCA1 91 intron 11 + 2976 ctccaattcggtagaaccag A/G gcttcatcttctctgtcgaa 1092 ABCA1 92 intron 11 + 3056 gtttgcagctgctgtttttc G/T ggcagcacatctgtgcaggc 1093 ABCA1 93 intron 12 + 340 ggcattatttgtgaaactta T/C ctaaaatcgaattcgggtcc 1094 ABCA1 94 intron 12 + 381 aattaaatttttgaaatttt A/G tattaaaaattatattagta 1095 ABCA1 95 intron 14 + 1728 caggctcagaggccttggcc C/T atcaccctggctcacgtgtg 1096 ABCA1 96 exon 15 + 2040 atgggcctggacaacagcat C/A ctctggtttagctggttcat 1097 ABCA1 97 intron 15 + 1382 cttttagacagaaaagttac G/A tgggatattatctcccacag 1098 ABCA1 98 intron 15 + 1453 tatataaggagaaaccagtt G/A aaattacctattgaagaaac 1099 ABCA1 99 intron 15 + 1567 ttctgcgtagttttgggtaa G/A tcacttatcttctttaggat 1100 ABCA1 100 intron 15 + 1617 cagttgcctcatcagaaaga T/A gaacagcattacgcctctgc 1101 ABCA1 101 intron 16 + 95 agttgagaacagaagatgat T/A gtcttttccaatgggacatg 1102 ABCA1 102 intron 16 + 452 tggtgttttgcttgagtaat G/A ttttctgaactaagcacaac 1103 ABCA1 103 intron 16 + 657 ctgttgcctcagtctgggct T/C cataggcatcagcagcccca 1104 ABCA1 104 exon 17 + 2473 gcttcaatctcaccacttcg G/A tctccatgatgctgtttgac 1105 ABCA1 105 exon 18 + 2649 ggttccaaccagaagagaat A/G tcagaaagtaagtgctgttg 1106 ABCA1 106 intron 18 + 1730 tgaaagttcaagcgcagtgc C/G ctgtgtccttacactccact 1107 ABCA1 107 intron 19 + 428 aggaccttacagtgggtagt A/G tcaggaggggtcaggggctg 1108 ABCA1 108 intron 19 + 468 aaagcaccagcgttagcctc A/G gtggcttccagcacgattcc 1109 ABCA1 109 intron 20 + 876 ccctcctcatctaaagtgaa C/T acatggggctcatgtgcagg 1110 ABCA1 110 intron 22 + 118 catgggatactcttctgtta T/G cacagaagagataaagggca 1111 ABCA1 111 intron 22 + 560 aaagctttgccattctaggg G/A tcatagccatacagggtgaa 1112 ABCA1 112 intron 23 + 102 accccttttgccatgttgaa A/G ccaccatctccctgctctgt 1113 ABCA1 113 intron 23 + 287 gtcaaagaaaagagacttgt C/T gtttatggatggatagtcta 1114 ABCA1 114 intron 23 + 1063 acctttcaccctcaggaagc G/A aggctgttcacacggcacac 1115 ABCA1 115 intron 25 + 321 ctctttacttaagtacagtg T/G gaggaacagcggcatcagga 1116 ABCA1 116 intron 25 + 376 gttagaaattcagcaacttg G/C gcccagctcagacctactga 1117 ABCA1 117 intron 25 + 478 catacataggaaatgacaaa C/T gtttatggatggatagtcta 1118 ABCA1 118 intron 25 + 579 tcatttaattctcaaaaaaa G/T atgaaaaaatgaacactcag 1119 ABCA1 119 intron 27 + 153 aatggtaaaagccacttgtt C/T tttgcagcatcgtgcatgtg 1120 ABCA1 120 intron 28 + 1058 actatcatgggagataatga C/T tatggttgtccatgattgga 1121 ABCA1 121 intron 28 + 1317 caggacccagtgttctgagt C/T accctgaatgtgagcactat 1122 ABCA1 122 intron 30 + 372 tatatgatttttaggttttg T/C ttatcagcttcttcgctttt 1123 ABCA1 123 intron 30 + 506 ccttttaaaaagtaagcagt A/G gataaataaattcagtgaag 1124 ABCA1 124 intron 30 + 1033 ctggatttcatggtgccttt G/c attttccacatgaaggttgt 1125 ABCA1 125 exon 31 + 4281 tcttccctttgcagagacac G/A ccctgccaggcaggggagga 1126 ABCA1 126 intron 33 + 626 ggctccttgttactgatttc C/T gtcttttctctctgcctttt 1127 ABCA1 127 intron 33 + 719 taatagccctcatgctagaa G/A ggagccggagcctgtgtata 1128 ABCA1 128 intron 33 + 726 cctcatgctagaagggagcc G/A gagcctgtgtataaggccag 1129 ABCA1 129 intron 33 + 889 ctttcctcaatgtctcagct A/G tctaactgtgtgtgtaatca 1130 ABCA1 130 intron 33 + 1097 ctgtgcaccccactgtctgg G/C ttttaatgtcaggctgttct 1131 ABCA1 131 intron 35 + 4760 tatgacaggactggacacca G/A aaataatgtcaaggtaaacc 1132 ABCA1 132 intron 35 + 234 aacctatctaaacctcagtt T/C cctcatctgtgaaatggaga 1133 ABCA1 133 intron 37 + 411 aactctgtacattttatcag C/T agcttatccatccattgcaa 1134 ABCA1 134 intron 37 + 1224 caggcataggtgattcagag A/G tgaaaggtcaagtccctgaa 1135 ABCA1 135 intron 37 + 1720 aaattaaaattactctgact G/T ggaatccatcgttcagtaag 1136 ABCA1 136 intron 40 + 251 tgaaggtaaggaaaatagtg T/G tatttgcttggatccactgg 1137 ABCA1 137 intron 40 + 252 gaaggtaaggaaaatagtgt T/C atttgcttggatccactggc 1138 ABCA1 138 intron 40 + 319 agcactggaaaagtcaaacc A/G taactttgagaattaggtga 1139 ABCA1 139 intron 40 + 957 cttgttactcttttttcctt G/C tcatgggtgatagccatttg 1140 ABCA1 140 intron 41 + 146 tgatgtgggcatcccgcagc C/T ccctccctgcccatcctgga 1141 ABCA1 141 intron 42 + 238 cattggttttatatgcttac A/C tttatgtgttagttattaaa 1142 ABCA1 142 intron 42 + 321 aataaatggttgattttgag T/A ttgagtttcatagtccaaaa 1143 ABCA1 143 intron 42 + 322 ataaatggttgattttgagt T/C tgagtttcatagtccaaaaa 1144 ABCA1 144 intron 42 + 533 agatgaaaaattatgtagat G/A ataatgaatgatacggttct 1145 ABCA1 145 intron 42 + 546 tgtagatgataatgaatgat A/G cggttctaaaaagacaggtt 1146 ABCA1 146 intron 43 + 739 tacagccacacttaaaatgg T/A cccattatgaaatacatatt 1147 ABCA1 147 intron 44 + 18 taggtgagaaaagaagtggc T/C tgtattttgctgcaaagact 1148 ABCA1 148 intron 44 + 264 acaatataatttgcttgttt T/C ttaagagtataatttagtga 1149 ABCA1 149 intron 44 + 279 tgttttttaagagtataatt T/C agtgatttttggtaaattga 1150 ABCA1 150 intron 44 + 508 tttacattgctacataaaat C/T cccctatgtacatgtaccta 1151 ABCA1 151 intron 44 + 1477 gatctcctctcctgtctctt A/T catttttgcagtagcaatgt 1152 ABCA1 152 intron 44 + 1665 tggttgtaagaactgatttg G/A ttggtatagctgtgagggcc 1153 ABCA1 153 intron 44 + 1956 gtgttgctcacactcaaaat T/G tctgggccttctcatttggt 1154 ABCA1 154 intron 45 + 68 aatatataccttatggcttt T/C ccacacgcattgacttcagg 1155 ABCA1 155 intron 46 + 608 ttatactgacttcaatagag G/C tttcagacaaaaagttgttt 1156 ABCA1 156 intron 47 + 336 ttcacaattgtaaacaccac T/C acactgaacagcatcatccc 1157 ABCA1 157 intron 49 + 55 agggtgtggattcctgcccc G/C acactcccgcccataggtcc 1158 ABCA1 158 3′UTR(exon 50)+ 7949 aacaaaaatgtgggtgtctc C/T aggcacgggaaacttggttc 1159 ABCA1 159 3′UTR(exon 50)+ 8226 aggagcccactgtaacaata C/T tgggcagccttttttttttt 1160 ABCA1 160 3′UTR(exon 50)+ 8682 aacttcttccactttttcca G/A aatttgaatattaacgctaa 1161 ABCA1 161 3′UTR(exon 50)+ 8697 ttccagaatttgaatattaa C/T gctaaaggtgtaagacttca 1162 ABCA1 162 3′UTR(exon 50)+ 9097 aactattttgaagaaaacac A/G acattttaatacagattgaa 1163 ABCA1 163 5′flanking − (1033-1032) tgacttaaatatttagacat (AT) ggtgtgtaggcctgcattcc 1164 ABCA1 163 5′flanking − (1033-1032) tgacttaaatatttagacat ggtgtgtaggcctgcattcc 1165 ABCA1 164 intron 5 + 6368 ttctgatggggttgttgctg C/&Dgr; tgagaatcatgactgggtgg 1166 ABCA1 165 intron 5 + 9709 cattttctgtctgaaccccc T/&Dgr; cacccattcaggcagctgct 1167 ABCA1 166 intron 5 + 13816 tccctacttctccttttttt T/&Dgr; catttgcctcctccacccac 1168 ABCA1 167 intron 10 + (270-271) cttttcagggaggagccaaa (G) cgctcattgtctgtgcttct 1169 ABCA1 167 intron 10 + (270-271) cttttcagggaggagccaaa cgctcattgtctgtgcttct 1170 ABCA1 168 intron 20 + (611-612) tttagcccatcctctccccc (C) gccaccctccttattgaggc 1171 ABCA1 168 intron 20 + (611-612) tttagcccatcctctccccc gccaccctccttattgaggc 1172 ABCA1 169 intron 32 + (391-392) gagtgccttgggtactctct (T) gatgggggactccatgataa 1173 ABCA1 169 intron 32 + (391-392) gagtgccttgggtactctct gatgggggactccatgataa 1174 ABCA1 170 intron 37 + 847 gctgtatattgtgaatgtcc C/&Dgr; gttttcaaaagcaaaagccaa 1175 COMT 1 5′flanking − 1287 cgtatgatattccccattct G/A agtccagaatacctagaaat 1176 COMT 2 5′flanking − 1217 tgtgagtatgggaaggggaa G/A cttttctgtctgttgtcccc 1177 COMT 3 5′flanking − 503 caggggctccaggaggacga G/A tgtgtatcctcccattgctc 1178 COMT 4 5′flanking − 425 gagaagttgggaagtctggc C/T agtggggccggtgcctggtg 1179 COMT 5 5′flanking − 277 cccagccccagtttccccac C/T tgggaagggggctacttgtg 1180 COMT 6 intron1 + 12058 ctggcccatggaagggaggg G/A agggggccccgacggggcca 1181 COMT 7 intron1 + 12070 agggaggggagggggccccg A/G cggggccacagtaaaggagt 1182 COMT 8 intron1 + 18831 tgtgtatgttcttggtaaac C/T agcccttggtcttacacatc 1183 COMT 9 intron2 + 832 cctctcctttggccacccgt G/C actacccccaactccgggcc 1184 COMT 10 intron3 + 90 ggagaagctgttatcacccc A/G tttccagggggctgggaacc 1185 COMT 11 intron3 + 425 ccccaaggtgggcggttcgg T/G gattcagagagggcagctct 1186 COMT 12 intron3 + 871 ggctcctgctctttgggaga G/A gtggggggccgtgcctgggg 1187 COMT 13 intron3 + 876 ctgctctttgggagaggtgg G/T gggccgtgcctggggatcca 1188 COMT 14 intron4 + 75 tcagcctcagcctctccaaa G/C agccaggcattccagtagag 1189 COMT 15 intron5 + 310 accagacaccagggcagaaa C/T ggcacaggaccaaggagatg 1190 COMT 16 intron5 + 346 agatggggtggggaagggcc G/A ctctgggcccagcctgctct 1191 COMT 17 intron5 + 3023 aaggcagccgccctgctcaa G/A gcctaggccattgtcctcct 1192 HNMT 1 5′flanking − 211 cagaggcagatgacagtctt C/T cgttaaagatttcactgctg 1193 HNMT 2 intron1 + 5409 aatataactgatataattgg A/G acatttcatgttggcctagt 1194 HNMT 3 intron2 + 2561 cacttgtgcttggacaagaa A/G agaaggcctacaagaaaaag 1195 HNMT 4 intron2 + 2895 caatcagaaatgtaagaaaa A/C ctccaagaaaaatttaagtt 1196 HNMT 5 intron2 + 3977 accaaacttggaagtgtaaa G/A ttatgcatgtatgttcatgt 1197 HNMT 6 intron2 + 5296 ttaacatagtgagtttggag T/C cccaggattttattttcctt 1198 HNMT 7 intron2 + 13317 caaccctcatgaattcttag C/T tgggatgggtccctataaca 1199 HNMT 8 intron2 + 14682 gtagatgagcaaatgagttc A/&Dgr; ggagagatttaaatacccta 1200 HNMT 9 intron2 + 15406 gtctatgcattcatgcatcc G/A tctaaccagctgtctaccta 1201 HNMT 10 intron2 + 28943 atgtgacttaaacttcaggt A/G tatcaatatcccttgaatgt 1202 HNMT 11 intron4 + 49 cagaaagaagacttttcaga A/G tatatatataatgaatatct 1203 HNMT 12 intron4 + (1942-1943) tttgagaaaaatttaaggta (A) tcttctatggcccacttcca 1204 HNMT 12 intron4 + (1942-1943) tttgagaaaaatttaaggta tcttctatggcccacttcca 1205 HNMT 13 intron4 + 2405 ccctgtgaccaagcagataa C/A ctcatgctttatttagtcca 1206 HNMT 14 intron5 + (80 − 81) cctgtgtttgaaagaagctt (TT) atatattttgtcttcattat 1207 HNMT 14 intron5 + (80 − 81) cctgtgtttgaaagaagctt atatattttgtcttcattat 1208 HNMT 15 intron5 + 235 ctttcttttgggaaaatatg T/C ctttgtcttctatatatgaa 1209 HNMT 16 intron5 + (702-703) tacttacaggttgattttag (AT) acacagcagactctgtcttc 1210 HNMT 16 intron5 + (702-703) tacttacaggttgattttag acacagcagactctgtcttc 1211 HNMT 17 intron5 + 749 ttacaccagaccccatactt T/G aacaccatatgtcacaaaat 1212 HNMT 18 intron5 + 1101 gtaggcagcctattcttgat T/G atattcatcaatcatacaga 1213 HNMT 19 intron5 + 1137 acagaaaaagtattgtagac G/A gaaataacaattcattgaga 1214 HNMT 20 intron5 + 1348 aagggagcatgaatagtcca C/G aagtaactgagaactgatta 1215 HNMT 21 intron5 + 1673 caaaagaaagggagtaaaga C/G tcaacaatcagttagctttt 1216 HNMT 22 intron5 + 2022 attttatttggggctttcta C/T gtctctctctcctaagccta 1217 HNMT 23 intron5 + 2285 tgtcatacttaactcttaaa G/C atccagagtaaatgatggag 1218 HNMT 24 intron5 + 4159 taccagttgacccagcaacc C/T tcttatagagtagtttaaat 1219 HNMT 25 intron5 + 4501 aatgatccacaaaattacta C/G tcattgttttctttcaatga 1220 HNMT 26 intron5 + 5251 cacacacacacacacacaca C/G caaatggaagcagccagaca 1221 HNMT 27 intron5 + 5802 gaaaaagaaaatctggctta C/T atcatgttgaaaacaaaagt 1222 HNMT 28 intron5 + 6189 tccaattccaccttctccta G/C agcatatcctgcagttacct 1223 HNMT 29 intron5 + 6297 gtcttggttcatctcttgag T/A taaattagatctgggaactt 1224 HNMT 30 3′flanking + 458 tatgtcactctcaagaactc C/T tataagaccaagagtcatct 1225 HNMT 31 3′flanking + 993 ctgaaaatgaacactgaacc G/A ttaatcatactgatatgtac 1226 HNMT 32 3′flanking + 1793 gtggagcacagcattttagg G/A cttgatatttgcttattata 1227 GAMT 3 intron5 + 1411 ggtgacctggtgccatcccc G/A accaggagacgcaggtgccc 1228 PNMT 2 intron1 + 35 ctgaggcacgagggacaaga G/T gtcgtcggggagtgaaagca 1229 CYP1A1 1 intron 1 + 1590 ccactcttcaaaaggaggta C/T atgtgacagcagctggaaat 1230 CYP1A1 2 exon2 + 160 gaatccaccagggccatggg G/A ctggcctctgattgggcaca 1231 CYP1A2 1 5′flanking − 731 gcctgggctaggtgtagggg T/G cctgagttccgggctttgct 1232 CYP1A2 2 intron1 + 371 cttccctgtgttcacactaa C/T cttttccttctttgaaattg 1233 CYP1A2 3 intron3 + 44 atagccaggagaagccttga G/A acccaggttgtttgttcagt 1234 CYP1A2 4 intron5 + 81 tccctgctaggaactgttta T/C ataatgaaaggaggggacct 1235 CYP1A2 5 exon6 + 181 ctggccatcctgctacagca A/T ctggagttcagcgtgccgcc 1236 CYP1A2 6 exon6 + 295 cggctgcgcttctccatcaa C/T tgaagaagacaccaccattc 1237 CYP1B1 1 5′flanking − 3669 tgtatcctgtgaagcatcac G/A gttatccttctctgcacatg 1238 CYP1B1 2 5′flanking − 3149 tgacagcacttaccaaccta G/C ttcctctgatttttgagtca 1239 CYP1B1 3 5′flanking − 1222 gggggaagccacccccgccc G/A agcgcctccggcttccctta 1240 CYP1B1 4 5′flanking − 376 ttccgggaagcaagctcaag T/C cgcggagagggaagggaggt 1241 CYP1B1 5 5′flanking − 265 ctggggacaccgtgcggcct C/T gattggaggtggctgtgatg 1242 CYP1B1 6 intron1 + 129 tgcccgcagcgttgtcccca G/A attgcaggaaccgttacgcg 1243 CYP1B1 7 intron1 + 379 tgagtgtcacgccttctcct C/T tctgtccccagcatgggcac 1244 CYP1B1 8 exon3 + (799-800) agcttctgggagattttttt (T) gagtcaaagacttaaagggc 1245 CYP1B1 8 exon3 + (799-800) agcttctgggagattttttt gagtcaaagacttaaagggc 1246 CYP1B1 9 exon3 + 1284 agtatagtggggttccatga G/T ttatcatgaattttaaagta 1247 CYP1B1 10 3′flanking + 2226 tttctttttctttttttttt T/&Dgr; aaaatttattcctatttcct 1248 CYP1B1 11 3′flanking + (2226-2227) ttcttttctttttttttt (T) aaaatttattcctatttcct 1249 CYP1B1 11 3′flanking + (2226-2227) ttcttttctttttttttt aaaatttattcctatttcct 1250 CYP1B1 12 3′flanking + 2230 ttttcttttttttttttaaa A/&Dgr; tttattcctatttccttaca 1251 PEMT 90 intron1 + (297-298) attgtgtgagactcagaggt TGT/&Dgr; ccgtgttagtctttgggatt 1252 PEMT 91 intron1 + 817 tcatgaagcctgtaaggcac A/G tctctgccccaagcagcttc 1253 PEMT 92 intron1 + 830 aaggcacatctctgccccaa G/A cagcttctaatccagttctt 1254 PEMT 93 intron1 + 1035 gagttctctgaaggagctaa T/C accagttagtgttttgaaga 1255 PEMT 94 intron1 + 1573 agtgggcaggggagactaac C/T gggtgtgtgaggggtgggct 1256 PEMT 95 intron1 + 1759 gatttttcttaaagaaagaa A/G gaaagaaacatacaacatac 1257 PEMT 96 intron1 + 2768 gcatcttgctgtccacaggc C/A ggggcacctccaggattcag 1258 PEMT 97 intron1 + 2768 ggccggggcacctccaggat T/C cagaagatgactccagtagg 1259 PEMT 98 intron2 + 4598 ccgtgggttttttttttttt T/&Dgr; cttcatttctttggttgctg 1260 NAT2 21 exon2 + 288 atgttaggagggtattttta C/T atccctccagttaacaaata 1261 NAT2 22 5′flank − 2053 ctggattgcaacattttaat T/C ccaggtgtcaggtttccaac 1262 NAT2 23 5′flank − 1299 gaatcaccagtgcgggaggt A/G taacagtgaacccaagacac 1263 NAT2 24 5′flank − 1145 ctgtagaacacaaggatatt C/T ggaggcagtttgtacatgcc 1264 NAT2 25 5′flank − 1036 ccttcccacagagtcccgag T/A tcatgtggcagcatgccaga 1265 NAT2 26 5′flank − 94 aaagatttgctaagagattc G/A cagaggcaacctgaggccct 1266 NAT2 27 5′flank − 643 atgtttatattttatattaa T/C attaatgtaaataaaaattt 1267 AADA 1 5′UTR + 29 attaaagtacactattcagg C/T atatcatgtaggtttacttt 1268 AADA 2 intron1 + 138 gctgtggcctttgacaatgt G/A ttacttagaaatgttgtttg 1269 AADA 3 intron1 + 142 tggcctttgacaatgtgtta C/T ttagaaatgttgtttgtttt 1270 AADA 4 intron1 + 1033 ttccagcagagacaccaaca A/G gtaaaaacaccccagctaca 1271 AADA 5 intron1 + 1253 tttttttccctcatatttgc T/C gtctgtgctacaatatgtga 1272 AADA 6 intron1 + 1366 ctctggtcgccttttaatta A/G ttaattcattcatttactta 1273 AADA 7 intron1 + 1369 tggtagccttttaattaatt A/C attcattcatttacttacat 1274 AADA 8 intron1 + 2501 ggttacagaaagaatggtgg C/A ttggccaaaaaatgatatgg 1275 AADA 9 intron2 + 1971 aaatgagagttaagtaggag A/C attttcttttatttttgtgc 1276 AADA 10 intron2 + 1988 gagaattttcttttattttt A/G tgcaggagaaatataaacaa 1277 AADA 11 intron2 + 2341 aggtgccttttctattgtcc C/T atgcagacttaggtgatcct 1278 AADA 12 intron2 + 2546 gtctgacacagaaggatcaa T/A ggcaaaatgtgcaagacaaa 1279 AADA 13 intron2 + 2609 taggaggttcactgggaaac T/C tgaattccactgagtcatga 1280 AADA 14 intron2 + 2663 tataaatacagtgttaaatt T/C gtctctcgtattttaaggta 1281 AADA 15 intron4 + 605 tgtgtcagtaaaatattata T/C taagtaggtgaatgagatca 1282 AADA 16 intron4 + 621 tatattaagtaggtgaatga G/T atcatgtaattgtgagacta 1283 AADA 17 intron4 + 679 ttagagattcagacgaattc A/G tataatcttcgatggtgtat 1284 AADA 18 intron4 + 1680 gttaaaatgtggataaatac C/T acaatttgcaaaatatttgg 1285 AADA 19 intron4 + 1748 atttagaagttctatacatc T/C tttatagtatattacacact 1286 AADA 20 intron4 + 1771 tatagtatattacacacttc G/A aaaacacaaaattatttttt 1287 AADA 21 exon5 + 238 caagtcatctcttcaaattt A/G ttaattggagttccctgctc 1288 AADA 22 3′UTR + 121 ttagaaattggtctttctta A/G aatggtctagttaagttcca 1289 NTE 1 5′flanking − 535 cacgatctgtcctccgattc C/T tgttaactctagactttctg 1290 NTE 2 5′flanking − 15 gtaaatccccggcaaaaacc A/G gcagcgccttgcaagcccac 1291 NTE 3 5′flanking − 748 agcatggcgcggggaggagg G/T gtgggagggtcgggagggac 1292 NTE 4 5′flanking − 690 tgaataatttaaaggggccg T/C gcctgcggagccgggcggaa 1293 NTE 5 intron6 + 605 tcttgccatatacttagtgg A/G ggggtctacatcaggggttt 1294 NTE 6 intron6 + 748 agcctccagcctctcttctc C/T gggggttatctcaggcatct 1295 NTE 7 intron6 + 987 ggtgctggctctgggatccc C/T gtgcgtcatgtagtctacct 1296 NTE 8 intron6 + 1882 tggcctcaagcaatcctccc G/A cctcggcctcccaaagtgct 1297 NTE 9 intron6 + 2222 gaatgtttatgtagaacaga G/A agactgtatctgcggtcttc 1298 NTE 10 intron12 + 168 tatctggtaccgaggaagct C/G tggcctcgtccccaagggcc 1299 NTE 11 intron13 + 69 atccaggtccaccgcctgcc C/T gtcttgattgttttaatctg 1300 NTE 12 intron14 + 8 agcccccgctcgggtaaggc C/T tgggaccctgcccggtggtg 1301 NTE 13 intron16 − 113 gccaccgcgccctgcgcctt T/C atatttttcttaacccttcc 1302 NTE 14 intron21 + 34 agagccggccggcccagagc A/G tgctgggagatgtagtccgg 1303 NTE 15 intron21 + 128 gaagaaatcgtgcccctgag G/A gtttcaaaccctaagtagga 1304 NTE 16 intron21 + 151 ttcaaaccctaagtaggacc C/G aggtgcagagcattctgggg 1305 NTE 17 intron21 + 651 ccactgtactccagccggga C/T gacagagctagaacctgttt 1306 NTE 18 intron21 + 797 tggaaaatagtctgtggatt G/T ttgtttaggactctgggcac 1307 NTE 19 intron21 + 1752 acagctggtctaggctgtta G/C tggagaaactgggaagcaac 1308 NTE 20 intron21 + 1788 gaagcaacagctgggtcaaa A/&Dgr; gtagcttttcttttcttggc 1309 NTE 21 intron21 + 1907 cactgcaacctctgcctccc A/G ggttcaagtgattctcctgc 1310 NTE 22 intron21 + 2065 ctgcctcgttttatgttcag G/T tcccccattagacagaggaa 1311 NTE 23 intron21 + 2336 agtctgggagcacaggagca G/A gaatttcagataaggaggaa 1312 NTE 24 intron23 + 41 tggggagggtggtgggtggg G/C ctggagcctcaaattctttc 1313 NTE 25 intron23 + 71 caaattctttcagacctgag T/C tcaagttctcggcttccaac 1314 NTE 26 intron23 + 81 cagacctgagttcaagttct C/T ggcttccaaccacggagcct 1315 NTE 27 intron24 + 150 gtggggcggctggtgacctc A/C gccgtccgtattccgcagct 1316 NTE 28 intron29 + 37 gcctgcagcaaccgctgacg T/C cacgtggggttggggggatg 1317 NTE 29 intron29 + 370 cgtcccaggtcagcgagccc G/A tcgggccggctgggcctccg 1318 NTE 30 intron30 + 56 acctcccgcaccacacacac G/A cacacgcgtgggcacacaca 1319 NTE 31 intron30 + 358 aaaaatacaaaaaattaacc A/G ggctggtggggtgtgcctgt 1320 NTE 32 intron30 + 372 ttaaccaggctggtggggtg T/C gcctgtaatcccagctactc 1321 NTE 33 intron30 + 430 aaatcacttgaacctgggag G/T tggaggttgcagtgagctga 1322 NTE 34 intron30 + 655 gtgtgcacaccagctatata T/C gcaaatgctttctctcaggg 1323 NTE 35 intron30 + 659 gcacaccagctatatatgca A/C atgctttctctcaggggcag 1324 NTE 36 intron30 + 760 tgaaatagggcatttgccaa C/T gcatgccagtctgtcccgtt 1325 NTE 37 intron30 + 835 gcacacacgtagataggatg T/C ggcacctctgaccgagttaa 1326 NTE 38 intron31 + 40 tggtgcctgcataggtggtc T/C ggctaagctttgctacttaa 1327 NTE 39 intron31 + 41 ggtgcctgcataggtggtct G/A gctaagctttgctacttaaa 1328 NTE 40 intron31 + 1329 gtctgtcaagggcaggacag G/A ggatgtgtaggcgagtgtgc 1329 NTE 41 intron35 + 31 aatggcttcctgtcgttttc G/A gactggggacccaccttctg 1330 DDOST 8 intron2 + 1299 atcttctgatgactgggctt C/T ggtgcagtaactggtgtttg 1331 DDOST 9 intron2 + 1581 gatactgttggtgggagaaa T/C gacagagagtgtaaaacagt 1332 DDOST 10 intron2 + 2822 gtttctcaacaggtgcattc T/G tgacgtttcagactggataa 1333 DDOST 11 intron2 + 3392 cagaaggcgtggaggcctgc C/T gcgcctccctctgttgctgc 1334 DDOST 12 intron2 + 495 attgcttgaacccaggaggc G/A gaggttgcagtgagccaagg 1335 DDOST 13 intron5 + 226 ggaactgcttgggtcacagc C/T tcgttttgttcccagtatcc 1336 DDOST 14 intron8 + 303 aagagaaataggtcattagg A/T tgaatttgttaggcaagaga 1337 DDOST 15 3′flanking + 40 cacagcgtggagacggggca G/A ggaggggggttattaggatt 1338 MRP2 1 exon 1 + 77 catattaatagaagagtctt G/C gttccagacgcagtccagga 1339 MRP2 2 intron2 + 192 atcaaagtggctttgatttt T/G gcataagaatggtgactctt 1340 MRP2 3 intron 1 + 413 gataagttctagaactggca A/C ctaatgatatggactagaag 1341 MRP2 4 intron2 + 3639 gtcatatcccacccccaaat C/A gacccaataggtacaatgaa 1342 MRP2 5 intron2 + 3989 agttatgaaaccgatttttc C/T gggactggttgttctagtct 1343 MRP2 6 intron2 + 4078 aggtttccagatgtgttccc T/C aggcattcctggtggtagga 1344 MRP2 7 intron2 + 4171 cttattctttggtcagttgg C/T tttctaccacctcttagctt 1345 MRP2 8 intron 2 + 5373 gttaaggatatgtgaactca A/G aatttttatacacagtgcaa 1346 MRP2 9 intron2 + 4436 ggactagtggaagaattaga C/G ctttcctgaataaatagatc 1347 MRP2 10 intron 2 + 3930 aaaactggcaggagaatttc A/G ctggagctgcatgcaggact 1348 MRP2 11 intron 2 + 4257 gggtattggaaagttcttgc G/A gctgctggaggctgcggtgt 1349 MRP2 12 intron 3 + 772 ggtataaggcaagatttttt A/T aaaaaattaattgcttaatc 1350 MRP2 13 intron 7 + 1658 ggactcttaccagcttagtt G/T cctggttttctaatctaaaa 1351 MRP2 14 intron 10 + 40 tggccaggaaggagtacacc G/A ttggagaaacagtgaacctg 1352 MRP2 15 intron 11 + 1672 aactttttaagtcttaagac T/A ggaaggcctgtgtcctaggc 1353 MRP2 16 intron 12 + 148 ccctctcaccgccccatgcc A/G cttttcctcctttgtaccat 1354 MRP2 17 intron 2 + 1020 agtgctgcgattacaagcct G/C agccacctgcacagcctctg 1355 MRP2 18 intron 2 + 5227 taccataatttatgtgtcct A/G tatgacatgaatttcattgg 1356 MRP2 19 intron 2 + 5373 gttaaggatatgtgaactca A/G aatttttatacacagtgcaa 1357 MRP2 20 intron 2 + 5538 ttaatgaggttaagcacatg G/T tcatatgtttaaaagccttt 1358 MRP2 21 intron 13 + 180 catgagttttctgagcccca G/C tttatctaactataaaatga 1359 MRP2 22 intron 13 + 1497 gtgcagggtccccctgatgc T/C atagccagttcctctttaga 1360 MRP2 23 intron 15 + 169 atgagctgaaagcaaaggtt T/C tcagccccttcccctgataa 1361 MRP2 24 intron 15 + 949 ttccaggtgacacatttagt A/G cctaatttgggaaatgttaa 1362 MRP2 25 intron 15 + 984 tgttaatctagtccaatccc A/C ttagtaagaaaggaggggtc 1363 MRP2 26 intron 16 + 4059 catcctgatgcacagttatt C/T aaatttaagctccatttgtt 1364 MRP2 27 intron 19 + 10899 atgtatggagtatttatgga G/A taaagtattccatgctgtat 1365 MRP2 28 exon 22 + 51 caagcaataggattgttttc G/A atattcttcatcatccttgc 1366 MRP2 29 intron23 + 56 tatactgaggatctttctga C/T agggaggaattattatgtcc 1367 MRP2 30 intron 23 + 734 tgagccaactactgtactag G/A cactggggcactcaatgaat 1368 MRP2 31 intron 23 + 801 atgggccagacccaactcac T/G gattttttagtgtatctgag 1369 MRP2 32 intron 27 + 124 gggtccctaaagtttccttt C/G ctctaactcaaaggacctaa 1370 MRP2 33 exon 28 + 52 cagattggcccagcaaaggc A/C agatccagtttaacaactac 1371 MRP2 34 exon 28 + 84 aacaactaccaagtgcggta C/T cgacctgagctggatctggt 1372 MRP2 35 exon 28 + 129 agagggatcacttgtgacat C/T ggtagcatggagaaggtagg 1373 MRP2 36 intron 29 + 154 ttccctaggatggacacgtc A/G tttccagaactttgaaatgt 1374 MRP2 37 intron 30 + 91 gtgttaggtgatgcctggca T/C agaattttcatccaggtctg 1375 MRP2 38 intron 31 + 170 gccaaaattttacatcacgc A/G aatgaaaacgaacaaggtta 1376 MRP2 39 intron 26 + 154 ctggctccatcttttaccca T/C ggacgtattccttactcttc 1377 MRP2 40 3′-flanking + 739 gtgaatttttattataagct C/T gttctccttaaaactttatc 1378 MRP2 41 intron 3 + 1145 acatccttctcccctcagtc C/T tcggttagtggcagtattct 1379 MRP2 42 intron23 + 432 tggcagtagagcagggtgag G/A aggattattctgcagaggaa 1380 ABCB1 1 5′flanking − 196 gctttggagccatagtcatg T/C actcaaaatttattttatct 1381 ABCB1 2 5′flanking − 18 tactctttacctgtgaagag T/C agaacatgaagaaatctact 1382 ABCB1 3 intron1 + 71660 cttgctggaggaagggtgct A/C gaaaatataccaaatccaag 1383 ABCB1 4 intron1 + 80091 gaaataatattcaagttctg A/C aataatatcatgacctatag 1384 ABCB1 5 intron1 + 103126 gatgtgaatcagaattcatc T/C gtgtctcaagaaaaggtcat 1385 ABCB1 6 intron1 + 103148 tgtctcaagaaaaggtcatg C/T gataaattaagttctgctag 1386 ABCB1 7 intron1 + 108428 aattaatttatcatcatctg A/G tcaccatttcacacaactca 1387 ABCB1 8 intron1 + 112042 cataagttgaaatgtcccca A/G tgattcagctgatgcgcgtt 1388 ABCB1 9 intron2 + 491 gctctctggcttcgacgggg G/&Dgr; actagaggttagtctcacct 1389 ABCB1 10 intron4 + 36 attaactattcaaaatactt C/T ggaaatttgacatctcctta 1390 ABCB1 11 intron5 + 1596 ttagctctcttactgcttca T/C agtggaagaatcaaatactt 1391 ABCB1 12 intron8 + 1789 aaacactctgaatattaaac C/T gctcctggaaccacagctca 1392 ABCB1 13 intron14 + 24 agttgtccttgccctttgcc T/C ttctagaggtgcaaaaaata 1393 ABCB1 14 intron14 + 81 tgcaggaagttaggaaacta C/T tataaatcggaagaagggaa 1394 ABCB1 15 intron15 + 38 caaaccaacctgatttataa A/G cataagaacattctactact 1395 ABCB1 16 intron17 + 73 gtttggtgggctagggctcc A/G gtaggagtgggaacaagaga 1396 ABCB1 17 intron18 + 564 caacagtaaagttacaatct G/A aaaggaatgctctctgttta 1397 ABCB1 18 intron18 + 2062 tttccctgaggaatggttat C/T ctctgtgttccttgagtcca 1398 ABCB1 19 intron18 + 2293 ccacatcaggttttccccag A/G caccttgggacagtttgaaa 1399 ABCB1 20 intron20 + 557 aaaaccctaaccattgacac G/A tgtgaatgttttcctgggga 1400 ABCB1 21 intron21 + 24 cgtgcctcctttctactggt G/A tttgtcttaattggccattt 1401 ABCB1 22 intron21 + 2725 ctgacctgtttttggctgac A/G ggttttagttcctcccctca 1402 ABCB1 23 intron21 + 4725 tcttggtattaaaagatcca A/G agagataggaatatgtaatt 1403 ABCB1 24 intron22 + 8507 tgcacttaggaaaaaaacaa T/C atggaaatgtgtaaaatata 1404 ABCB1 25 intron22 + 8537 tgtaaaatatactttttttt T/A aaaaaaaaggacacatttat 1405 ABCB1 26 intron22 + 8565 aggacacatttattcagcat T/C atgatcagactattacattt 1406 ABCB1 27 intron22 + 8952 caccttggtttcatggtttg G/A caaagtactggcctgtacca 1407 ABCB1 28 intron22 + 9520 caccaacaaatatctttttc A/G cagttgggtgggcatctggt 1408 ABCB1 29 intron22 + 9836 agactctgacttagacatga C/T ggcaggggaaagagagactt 1409 ABCB1 30 intron24 + 377 taaaatacagatgtgttgta C/A taagttctgcaagcctttgg 1410 ABCB1 31 intron24 + 1493 ggggaggtgtccaggcacga A/&Dgr; catggagagctggacttgat 1411 ABCB1 32 intron24 + 1495 ggaggtgtccaggcacgaac A/T tggagagctggacttgatac 1412 ABCB1 33 intron25 + 342 tgcagccttgatcttctggg C/T tcaagcgatcctcctgcctc 1413 ABCB1 34 intron26 + 134 cttggataaagtctgagagc C/G taaatatggtctccaagtgg 1414 ABCB1 35 intron26 + 1272 gtccttcaattttgtggtga A/G cttaaaaacaggactctaaa 1415 ABCB1 36 intron26 + 1394 tattaagtggtgtgttaaag A/G ttgtgctataatgaattgta 1416 ABCB1 37 intron26 + (1987-1988) aagggctggaagagtgaaag (AAAG) gaggctatttgctcccagac 1417 ABCB1 37 intron26 + (1987-1988) aagggctggaagagtgaaag gaggctatttgctcccagac 1418 ABCB1 38 intron27 + 59 gcagcctctctggcctatag G/T ttgatttataaggggctggt 1419 ABCB1 39 intron27 + 80 ttgatttataaggggctggt T/C tcccagaagtgaagagaaat 1420 ABCB3 1 intron3+ 8 tctcctttggcaggtaggtg G/A tgggcagctgggtccatttg 1421 ABCB3 2 intron4+ 104 cttcacccgtatgccaggac C/T tggggatgcttttctcttgt 1422 ABCB3 3 intron10+ 219 gcagcagtggtgctccctcc A/G tgggcagccccgtcaggtcc 1423 ABCB3 4 intron11+ (317-319) atggtgcccaggtggatgtg GTG/&Dgr; tccatctcattcctgtcttt 1424 ABCB3 5 exon12 + 19 agctgcaggactggaattcc T/C gtggggatcgcacagtgctg 1425 ABCB3 6 exon12+ (356-357) aggtggggtggggtggggtg GG/TGGTGGGGTGGA ggct 1426 tctgtgtccaggaaa ABCB7 1 intron1 + 220 acggggcaggaggttctggg C/A agaggacacctggagcgctg 1427 ABCB7 2 intron1 + 480 agttaactcccttgctgaca G/A gcgtgcttcttgataggcca 1428 ABCB7 3 intron1 + (512-513) gataggccaaaaccgtaact AT/&Dgr; ctttccaaaacatagaccgc 1429 ABCB7 4 intron1 + 1690 agttctccaataaggcagat G/A aagttaagataaaatttgta 1430 ABCB7 5 intron1 + 5309 aattaatatcatttattgct G/A tattgttgtcagtgttatct 1431 ABCB7 6 intron1 − 11274 tgcttcttttcaagccagcc A/G gctttaaaaaaaagttagct 1432 ABCB7 7 intron1 − 11085 caggttttcagggctcatgt A/G gacctgaagaaaaatgagag 1433 ABCB7 8 intron1 − 10037 attctactttctcaacttct T/C ttattacattatctcatcat 1434 ABCB7 9 intron1 − 21 ccactctgaaacttccccct G/A ctttttttccttgtcagcag 1435 ABCB7 10 intron3 + (135-136) ttctctaatgaaaaaaaaaa (A) catattaattgaccatagtt 1436 ABCB7 10 intron3 + (135-136) ttctctaatgaaaaaaaaaa catattaattgaccatagtt 1437 ABCB7 11 intron3 + 333 aaaacaatttgtgtgtgtgc G/A tgtgcttcaaggttaatgtt 1438 ABCB7 12 intron12 + 524 taaccactctgccctcagta G/T gaaacacagtgccgaaccca 1439 ABCB7 13 intron13 + 1543 atcctgtgaggtggggaagc G/A tatggctagcataaatataa 1440 ABCB7 14 intron13 + 2400 tgttaccttactgcctcatt C/G tcattcttcccacctgctat 1441 ABCB7 15 intron15 + 2201 ctccttcctaaccttagcaa G/C agtctggagatttacttatc 1442 ABCB8 1 5′flanking − 2272 ggcttaggcctaagggctga T/C gttggggccagtacccctga 1443 ABCB8 2 5′flanking − 2070 agctatgaaaacaagaccct G/A tccttctagaggtagcaaaa 1444 ABCB8 3 intron1 + 25 aaacggaaaaacctactcag A/C gcgggccattgaccgcccgg 1445 ABCB8 4 exon2 + 308 tgctggtcctgggggtagcc G/A tcgtggtgaggctttcccca 1446 ABCB8 5 intron2 + 334 cccccacttaaaacatttgt C/G ccctctgtctccccattcca 1447 ABCB8 6 intron4 + 12 cctgctccggtactgccagc C/T gcagggtgcagagttggggt 1448 ABCB8 7 intron5 + 547 agttcatagcattctcgctc G/A gccccctcaggcctgctgct 1449 ABCB8 8 exon7 + 57 ggcaatgtgcggactgtgcg A/T gccttcgccatggagcaacg 1450 ABCB8 9 intron9 + 1231 tttccgcagctgcatggaca C/T cctcgcgtgccccgtttctg 1451 ABCB8 10 intron9 + 2164 cctcttggaggtccttctag C/T gctgcctatgtggagattct 1452 ABCB8 11 intron9 + 2645 ttcctgcctggtgcctcccc C/&Dgr; ggctgcctttagcaagtgct 1453 ABCB8 12 intron9 + 2646 tcctgcctggtgcctccccc G/A gctgcctttagcaagtgctg 1454 ABCB8 13 intron9 + 3229 cagggccgagcagggagtcc G/A tgggtcagctgggctccctt 1455 ABCB8 14 intron12 + (113-114) tcctccactgccaccagggg (GG) ccttctttcctgggacaatc 1456 ABCB8 14 intron13 + (113-114) tcctccactgccacaagggg ccttctttcctgggacaatc 1457 ABCB8 15 intron13 + 128 tgctctcgggagaccctggc C/T gtcttcacatgtcctcagct 1458 ABCB8 16 intron13 + 305 atccaggtctagagaagcct A/G tagtggaggtgctgagctgc 1459 ABCB8 17 intron14 + 135 acagttgtgtcagggaagac C/G agaaccacagccaaagggga 1460 ABCB8 18 intron14 + 159 accacagccaaaggggacag A/T gtcgttgtgtggggacaggg 1461 ABCB8 19 intron15 + 747 gttggagccttgggctctgt A/G agggggacagagggaatcat 1462 ABCB8 20 3′flanking + 333 cctatcccctggctcacccc G/A cagtgcattgatggagcagc 1463 ABCB8 21 3′flanking + 1168 ccctctttcaggggtgtgat G/A cagtgcattgatggagcagc 1464 ABCB8 22 3′flanking + (1719-1721) tagaccgcaggagccgcgcc GTC/&Dgr; ttcctaacctcgcctcggcc 1465 ABCB9 1 intron1 + 69 agggtgccaggccaggcacg G/C gttggggggcgtctgggcac 1466 ABCB9 2 intron1 + 8873 tgggcccagcacgtggggcc T/C ggaactacctcaaaggcttc 1467 ABCB9 3 intron1 + 8940 accagctcagcctgcccagc G/A tgcacacggcaccaagctgg 1468 ABCB9 4 intron1 + 11410 agatccaagggatccagagg T/C tggaatgtgaccctccgtgc 1469 ABCB9 5 intron1 + 12863 gggaagccagatgcccacaa G/A gctctgtgacttcacttcca 1470 ABCB9 6 intron1 + 19731 gccaagtgtcaagatcgagc G/A aggggagggcctgacgaggg 1471 ABCB9 7 intron1 + 29649 cagaatccagatgcccgtaa T/C gttgttaagaagcctgcaca 1472 ABCB9 8 intron1 + 31793 ggccaggcggggaggggtac C/T ggccagaccggtgggcaaaa 1473 ABCB9 9 intron1 + 37537 agagtcacagggttggggtg C/A ccccgggaaggtggcatcta 1474 ABCB9 10 intron1 + 38293 taccagccctgtgctttcag G/A gaccatgtgacctgtcaact 1475 ABCB9 11 intron1 + 44661 cccgaggtgcctggcttcac A/G gcaggattgccgtcctgcag 1476 ABCB9 12 intron1 + 49576 aaagtggccccgtggcttgt C/T ccctgaagccctaaagcacc 1477 ABCB9 13 intron1 + 64669 ccacagacaagccgggtagc C/A cacctcgcagctcaacacac 1478 ABCB9 14 exon2 + 448 cctggttttgggccctgttc G/A tgtggacgtacatttcactc 1479 ABCB9 15 intron7 + 3364 ggtaccaggagtcgggtatc A/G gtgggacaggaacgcgtgtc 1480 ABCB9 16 intron11 + 113 gggccccaggagctctccca G/T actatcagcctcctgggctg 1481 ABCB9 17 exon12 + 370 cccaggcctgcagcactgaa A/G gacgacctgccatgtcccat 1482 ABCB10 1 5′flanking − 424 tcgcgtctgcgcgctccgcc C/T ggtctgccggcgtgagaaag 1483 ABCB10 2 exon1 + 491 acaaggggcggttgcgcccc G/T cagcggccggactcccggag 1484 ABCB10 3 intron1 + 37 ccacttccctccgccgggcc T/G ctccttctccacacgcgggg 1485 ABCB10 4 intron1 + 217 actcgtttgcagattttaca C/T ttgttttcttgttgacacac 1486 ABCB10 5 intron1 + 405 gcgtttatactttttttttt T/&Dgr; aaccaaaaacacattatttg 1487 ABCB10 6 exon3 + 185 agggccggggcccaggcttc C/T gtaggcatcagtatgatggt 1488 ABCB10 7 intron6 + 1269 caaattcacaactgtgcctt C/G cacagaatgggttggaaaac 1489 ABCB10 8 intron9 + 632 ccccactccacttgggtgag G/A gcaggtggatggtgatgggt 1490 ABCB10 9 intron10 + 2373 tacctcagggcactcagaca G/C cctcaccaatcagaggctca 1491 ABCB10 10 intron11 + 108 tccttttcctgttttttgtt T/G tttttttttcttgggagtgg 1492 ABCB10 11 intron11 + 2379 cattggtttttagtgtattc T/A gtgttgtgcatccatcatca 1493 ABCB11 1 5′flanking − (2596-2595) tgtggtttagagctttctct (TT) gagacatttttgctaaggtt 1494 ABCB11 1 5′flanking − (2596-2595) tgtggtttagagctttctct gagacatttttgctaaggtt 1495 ABCB11 2 5′flanking − 1746 agctgaagtgaattaagcac G/A atcaactcagtactcacact 1496 ABCB11 3 5′flanking − (326-314) agggggacagtttaaaggta (T)9-12 gtcttgttatgtttttaagt 1497 ABCB11 4 5′flanking − 135 agagggtttcccaagcacac T/C ctgtgtttggggttattgct 1498 ABCB11 5 intron1 + 511 aaatatagatgcaaaaaaaa A/&Dgr; tgagctgtggatgcatgttt 1499 ABCB11 6 intron1 + 581 aatttcagtttttaggtcac C/T caagccagtgggagtcacat 1500 ABCB11 7 intron1 + (1938-1951) aaagacgttttaagggcttt (A)10-13 gaaagaaaagaaaactgtag 1501 ABCB11 8 intron1 + 4517 ggtttcccaacatctcatct G/A ataaaaaaaataatttgcca 1502 ABCB11 9 intron1 + 5651 aaagagaataggttagtgga T/C tagtattcctgtgcttaatg 1503 ABCB11 10 intron1 + (12200-12201) aagagatggtctctagcccc CT/&Dgr; gtttgatttggggcacttac 1504 ABCB11 11 intron1 + 13023 gtttggctactttgattaaa G/A aagaaagaagagataataat 1505 ABCB11 12 intron2 + 739 cctgcatctattctgaccta C/T actggggaaaacagtatgtg 1506 ABCB11 13 intron2 + (921-922) tattttgtagttcaaaaagt (CAGATCTTCTTCAGCT 1507 AATTTAGAAATGT) tgctgccatttgatattca ABCB11 13 intron2 + (921-922) tattttgtagttcaaaaagt tgctg 1508 tccatttgatattca ABCB11 14 intron3 + 644 agccacacgtttcttattgc G/A tgggagtttaaaaaaatggg 1509 ABCB11 15 intron3 + 2231 agtgaacctgagattgagct A/G tactgaaatctctagaagag 1510 ABCB11 16 intron3 + 2406 aaagggtggtctttaaatcc T/C tatgtttttctcatcaggtt 1511 ABCB11 17 exon4 + 10 tttctcatcaggttacaaga T/C gagaagaaaggtgatggcgt 1512 ABCB11 18 intron4 + 434 acaatttatagtatttctca A/G tgccccacacagtttatcta 1513 ABCB11 19 intron4 + 518 gtagatgagtagctaaaaac G/T aaagtcagctcctgaaataa 1514 ABCB11 20 exon5 + 120 ggcacaatgacagatgtttt T/C attgactacgacgttgagtt 1515 ABCB11 21 intron5 + 320 gggaggtgacccatgaattt T/C acttgagtatcatctccaag 1516 ABCB11 22 intron5 + 16076 agaagaggtaacagtaagcc T/G cctgatttacagcacacatc 1517 ABCB11 23 intron6 + 303 atttgcaggtgtgtttgtag G/C gggcagttgagtagcttgaa 1518 ABCB11 24 intron7 + 1141 aaaggattcagcaggcatga A/G gaaagaaaagctttgcaaga 1519 ABCB11 25 intron8 + 2463 ccattggctaatagcaatga A/C ctatgacatggtctaactta 1520 ABCB11 26 intron8 + 2677 tcaatgatgttacagtgaga A/C tctaatattgtattaaaccc 1521 ABCB11 27 intron8 + 2699 ctaatattgtattaaaccca T/A gccacatgttaaatgaatct 1522 ABCB11 28 intron9 + 24 gtgtccaagtttacggacta T/C gagctgaaggcctatgccaa 1523 ABCB11 29 intron10 + 108 caccttggtctgtggcctcc A/G gaggaagtacttgttcaaga 1524 ABCB11 30 intron10 + 2475 taatcattccaaaccacgga C/A tttatttcattaagaacatg 1525 ABCB11 31 intron10 + 2478 tcattccaaaccacggactt T/A atttcattaagaacatgata 1526 ABCB11 32 intron10 + 2711 tttacagattggaaaagcca C/T tgaagtcttgcaggtccaga 1527 ABCB11 33 intron10 + 3539 agtgactgtaattagtatca C/G ttgtgcacagagaaaaaatg 1528 ABCB11 34 intron10 + 3623 tgcagaaggttgttctttca T/C gaccttcctgagtttcagaa 1529 ABCB11 35 intron10 + 3661 gaattcattaataaaaataa A/T cacataatggagcgtgacat 1530 ABCB11 36 intron10 + 5100 gggccactctttggcttggc A/G atagactgtggccaatgaaa 1531 ABCB11 37 intron10 + 5292 gctatttggtaggaacatct G/A ggcatgatcaggtagccttc 1532 ABCB11 38 intron10 + 5912 gagtaatattcagtaaaaaa A/&Dgr; taaagtggtattttaaatca 1533 ABCB11 39 intron12 + 116 tgtttccagtaatagggaat G/A gaggtgtctttctctgaaag 1534 ABCB11 40 intron12 + 326 gataaatgacaaggcaatta G/C aacaatcaggaagcacaggt 1535 ABCB11 41 intron12 + 335 caaggcaattacaacaatca A/G gaagcacaggttcttcccaa 1536 ABCB11 42 intron12 + 2572 cctcatccttgccaatgttt C/T cttttactggtttttgatgg 1537 ABCB11 43 exon13 + 23 tctaaatgacctcaacatgg T/C cattaaaccaggggaaatga 1538 ABCB11 44 intron13 + 70 atggcagtatattgatcaaa C/T agaaaggtgtagcatacatt 1539 ABCB11 45 intron13 + (1578-1579) ttattggcctctattttttc (C) tgcccattggtcaagtatga 1540 ABCB11 45 intron13 + (1578-1579) ttattggcctctattttttc tgcccattggtcaagtatga 1541 ABCB11 46 intron14 + 32 catacattcctgggagaaac C/T aagaggtcatagaaggaaaa 1542 ABCB11 47 intron14 + 80 cacaattatacacatttctt C/T tcgtatgattcccaagtcat 1543 ABCB11 48 intron14 + 439 tattgtgtcaaaaacaattc A/G ttgtatatctccattctaag 1544 ABCB11 49 intron14 + (1262-1263) cagcctttgcattatatttt (T) gctgtgttgtctaacaggag 1545 ABCB11 49 intron14 + (1262-1263) cagcctttgcattatatttt gctgtgttgtctaacaggag 1546 ABCB11 50 intron14 + 1283 gctgtgttgtctaacaggag A/C aaagagacacggatttgctc 1547 ABCB11 51 intron14 + 1339 tgagatagatatttaggacc G/A tgaccaatttttattttggt 1548 ABCB11 52 intron14 + 1359 gtgaccaatttttattttgg T/C tgaaaaatcttatttgaagt 1549 ABCB11 53 intron14 + 1480 tattgattagacaataaccc G/A tctggggaagggatatttct 1550 ABCB11 54 intron15 + 370 ccttttctaatgtctgcaca G/A cctatttaagaatattccca 1551 ABCB11 55 intron16 + (550-559) aaagtttagtgtttctatca (T)9-12 gctacttctgatggacttct 1552 ABCB11 56 intron17 + 188 tttctctccccaattcatgg T/G tttttggttagcttctcatc 1553 ABCB11 57 intron17 + 194 tccccaattcatgggttttt T/G gttagcttctcatcttcttg 1554 ABCB11 58 intron17 + (197-198) caattcatgggttttgggtt (T) agcttctcatcttcttgggg 1555 ABCB11 58 intron17 + (197-198) caattcatgggtttttggtt agcttctcatcttcttgggg 1556 ABCB11 59 intron17 + (289-296) ttagaaaggggacttctttt (A)7g(A)4 tctgtgtttagtgttcctct 1557 ABCB11 59 intron17 + (289-296) ttagaaaggggacttctttt (A)12 tctgtgtttagtgttcctct 1558 ABCB11 59 intron17 + (289-296) ttagaaaggggacttctttt (A)10 tctgtgtttagtgttcctct 1559 ABCB11 60 intron17 + 1070 tcagacttgggttttcctat C/T tttcttcttgagaacaagtt 1560 ABCB11 61 intron17 + 1651 tgttaaaatatctcattgta T/C atgctgacggatttttcttg 1561 ABCB11 62 intron17 + 2226 ccttaagtctcctcctatca T/A gcaccttgttctcaccagct 1562 ABCB11 63 intron17 + 2979 ctctctcttcctttctcagc T/&Dgr; ctactatttcactgttggct 1563 ABCB11 64 intron17 + 3288 aatccccatatcctacctta T/G ccatctcatccatgaatctt 1564 ABCB11 65 intron17 + 3289 atccccatatcctaccttag C/T catctcatccatgaatcttg 1565 ABCB11 66 intron18 + 97 aatatgagttttctaggtat A/G tatctagcagtgtttcaagt 1566 ABCB11 67 intron18 + 98 atatgagttttctaggtata T/C atctagcagtgtttcaagtc 1567 ABCB11 68 intron18 + 892 ctctgaaagttagtgataca C/T cttatttgtgtttgaatcaa 1568 ABCB11 69 intron18 + 2681 atgtatgagatcaagtcagg A/G tcaaatattagacacccata 1569 ABCB11 70 intron18 + 3780 ggaccatcctgtggggcaat C/G gttccagaaaatgctggtat 1570 ABCB11 71 intron18 + 5741 ctcaccggtataaatacaac C/T gtagcaaaggttttcttttt 1571 ABCB11 72 intron18 + (5882-5883) tgcgtattccctcagttcag (C) tttttattcaagccacagca 1572 ABCB11 72 intron19 + (5882-5883) tgcgtattccctcagttcag tttttattcaagccacagca 1573 ABCB11 73 intron21 + 10022 tggctaagttaaaaaaaaaa A/&Dgr; gagattcaactataattgct 1574 ABCB11 74 intron22 + 322 caagattcaatactgccccc C/&Dgr; agggggtgggtgaacagggc 1575 ABCB11 75 intron22 + 257 ctgttcaatttcctctcgca T/C agtgattcattccacattcc 1576 ABCB11 76 intron22 + 552 taattaatatcttgtccttg G/C ggggtaaatgagggatggta 1577 ABCB11 77 intron22 + 569 ttggggggtaaatgagggat G/A gtagcataaacacttctcaa 1578 ABCB11 78 3′flanking + 243 aaacaccacagaatgacata G/A aactacaggcggcaggaatc 1579 CYP4B1 1 5′flanking − 333 gaaacattcacagtgcttgt A/T tgagaagacagtggttatta 1580 CYP4B1 2 5′flanking − 18 gagcagctgaaggcaggtca G/T atgaaggctaggtggctgga 1581 CYP4B1 3 intron1 + 341 tccaaaacctctggatagta C/T atagaagtaggcaatccatt 1582 CYP4B1 4 intron1 + 542 cctatgggtggctcaggagc C/T gtgacaccttcccaggttca 1583 CYP4B1 5 intron1 + 2856 gaggactttgcacatagtag G/A tgctcagctatattgttggc 1584 CYP4B1 6 intron1 + 6086 tttggaatctaaagactggg G/T cacgatgctagttgtgtgac 1585 CYP4B1 7 intron1 + 6598 ttttggggtgtggggagagg G/A cccatagtagggagacagct 1586 CYP4B1 8 intron1 + 6660 acctaagggtgtccatcctg A/G aggagagcagtcctaggggg 1587 CYP4B1 9 intron1 + 7242 ccctggtctcccttaactca T/C gctggactgttccctttggt 1588 CYP4B1 10 intron2 + 107 gcctgtgtactaagtctgcg C/G agctgaggttcccaccctac 1589 CYP4B1 11 intron3 + 361 atggtgtggtggtaggacca C/T ggctggtcaccagaggctgt 1590 CYP4B1 12 intron4 − 492 aaaggctttcacatctaaaa C/A gtgtctcctcattttctgtc 1591 CYP4B1 13 intron4 − 315 ggattacttacatatacacc A/G tgcgggggagctcaccacct 1592 CYP4B1 14 intron4 − 157 ctacccaccctatcctgata T/C tccagcaggatggagggcag 1593 CYP4B1 15 exon5 + 22 acaagtgggaagagaaagct C/T gggagggtaagtcctttgac 1594 CYP4B1 16 intron5 + 125 cccagggagccttagcttgc G/A gggagacaggacctgctcat 1595 CYP4B1 17 intron5 + (287-289) tgtctaagccaatccctcct CCT/&Dgr; accctctgcttagcagggac 1596 CYP4B1 18 intron6 + 54 gcctgggttcctcctcctgg C/T ccctctatgccccctcccat 1597 CYP4B1 19 intron7 + (99-100) agctcttaagcatttccccc (TC) tttcctcagcaaatataacc 1598 CYP4B1 19 intron7 + (99-100) agctcttaagcatttccccc tttcctcagcaaatataacc 1599 CYP4B1 20 exon8 + 114 tcctggtttctctactgcat G/A gccctgtaccctgagcacca 1600 CYP4B1 21 exon8 + 139 tgtaccctgagcaccagcat C/T gttgtagagaggaggtccgc 1601 CYP4B1 22 intron8 + 247 agaaagttgtcaacaagagg C/T tgatattttgtgtgctaact 1602 CYP4B1 23 intron8 + 366 tgtgggggtgaacagagctg A/G gacagctgggagagccagtt 1603 CYP4B1 24 intron8 + 650 cctttgcttgtggtcagaca C/A cctgcctttctctctgggct 1604 CYP4B1 25 intron8 + 844 tcatatgtgagaatcccccc C/A ccacggggtatccagacaca 1605 CYP4B1 26 intron8 + 1767 tcccattccaagaatgttct G/T gttgtgttgctggcagggat 1606 CYP4B1 27 exon9 + 53 tgtgcatcaaggagagcttc C/T gcctctacccacctgtgccc 1607 CYP4B1 28 intron9 + 652 agtcggatgtggtcatgaac G/T ctctgtcactggcagtggtc 1608 CYP4B1 29 intron9 + 774 cctggtcaccaacctctgtt C/T tgcccacaggaagcctgatc 1609 CYP4B1 30 intron10 + 33 tgggctgggagatcagacag G/T gtgggggactgggagggtca 1610 CYP4B1 31 exon12 + 224 ccagatggctcaggctgtga C/A ctccctgggcaccaccctcc 1611 CYP4B1 32 exon12 + 270 ctgggtgtggaggagttggg G/A ccccctgccttcaggaggct 1612 CYP4B1 33 3′flanking + 129 tctgtgtctcacagtcacgt G/A gtgctccaggcattcagggt 1613 CYP27A1 1 intron1 + 295 aggagggagctgtcttggga A/G gagagtggcagaggcaaatg 1614 CYP27A1 2 intron1 + 17503 cagtgcataaagcctctgat C/T ctccttagagaaggagggac 1615 CYP4F2 1 intron1 + (145-146) ccaagcccctggcaacctca CA/&Dgr; gtgattcaggctgggccttt 1616 CYP4F2 2 intron1 + 193 tttaatcagtctctctctct C/T tttcccattctaagtgctta 1617 CYP4F2 3 intron1 + 324 ccctgctctacctccggcac T/C gcccgtccctgcctctccac 1618 CYP4F2 4 intron1 + 367 tccctggaggtccctgggcc G/C ttctctgggcctcaggatct 1619 CYP4F2 5 intron1 + 402 ggatctcaccgtccatcccg T/C gcccgtccctgcctctccac 1620 CYP4F2 6 exon2 + 35 gcctgtcctggctgggcctc T/G ggccagtggcagcatcccct 1621 CYP4F2 7 exon2 + 166 cggtgtttcccacaaccccc A/G agacggaactggttttgggg 1622 CYP4F2 8 intron2 + 125 ggcagagaagcagaggaggc A/G tcttactcattcctctgctt 1623 CYP4F2 9 intron2 + 440 gggccgtctcccacttccac T/C acacccgaaggcacctttct 1624 CYP4F2 10 exon3 + 48 gttctgactcagctggtggc C/T acctacccccagggctttaa 1625 CYP4F2 11 intron3 + 701 agactccaccccagcttggg T/A ccctttccttgacccctgtg 1626 CYP4F2 12 intron3 + 742 cttcccatcgttggacgggc G/A aggctgagcagggggaatgg 1627 CYP4F2 13 intron3 + 1020 gctttagctttctccatgtc G/A cttttcctatcaaggtggcc 1628 CYP4F2 14 intron3 + 1039 cgcttttcctatcaaggtgg C/A cttttcctcatgatgtcaac 1629 CYP4F2 15 intron3 + 1040 gcttttcctatcaaggtggc C/G ttttcctcatgatgtcaacg 1630 CYP4F2 16 intron3 + 1920 ccacctgtctaacctctgtt G/C ctgtttgctcatgtctgggg 1631 CYP4F2 17 intron3 + 1945 ttgctcatgtctggggcgtg T/ ctctacaaatggctgttatat 1632 CYP4F2 18 intron3 + 2621 agcattctgtagaatgctga G/A ctgtgctcaggggttgcgga 1633 CYP4F2 19 intron3 + 2665 tgttggatcgtgtaggaggc A/G tgtcaaggcatgctggaacc 1634 CYP4F2 20 intron6 + 194 gggtttgaactggtgggtgt G/T gtcagagctctgtaggggac 1635 CYP4F2 21 intron7 + 67 tgtgaaatgtcagatgaaag G/A atttgaacttgattaagagg 1636 CYP4F2 22 intron7 + 2811 ttccaagggaaattgccatt T/G aattctcctgtaactcaggt 1637 CYP4F2 23 intron7 + (3096-3097) ggggtgggggttgggggggg (G) ttactgccttctctccagga 1638 CYP4F2 23 intron7 + (3096-3097) ggggtgggggttgggggggg ttactgccttctctccagga 1639 CYP4F2 24 intron8 + 145 ggtgctgtctaccttcgggt G/A ctgaagcagcccagagaccc 1640 CYP4F2 25 exon9 + 44 ctctcctgggtcctgtacca C/T cttgcaaagcacccagaata 1641 CYP4F2 26 exon11 + 48 gaacccatcacaacctagct G/A tgtggccggaccctgaggtg 1642 CYP4F2 27 intron12 + 108 tggtccaagttccagctctc C/T ttccctcacctcctctggag 1643 CYP4F2 28 intron12 + 285 gcatggggatccaggcacgg A/T tacccccttctctattcctc 1644 CYP4F2 29 exon13 + 238 aagtgaagcctagaattacc C/A taagaccctgttccacagtc 1645 CYP4F2 30 exon13 + 342 tgtgcgtgaatgttcatggc G/A gccctattcacagtagccaa 1646 CYP4F2 31 exon13 + 563 tagtgtactgtccttttata T/C gaaatttccagaacaggcca 1647 CYP4F2 32 exon13 + 707 aaatgttccggacctagata G/C tgacgaaggtagcacgacac 1648 CYP4F3 1 intron2 + 258 cattaatgcacctctgcggg G/T ctcttgggcagggggttggg 1649 CYP4F3 2 intron2 + 916 ttagggacatgtcctgagtc C/T acactgctccccacaaacct 1650 CYP4F3 3 intron2 + 3417 atccaggtctcacacagtgt C/T acttcctctcttggctttag 1651 CYP4F3 4 intron2 + 4090 gagagcatgaattgggtcct G/A tgtctttctctccagattca 1652 CYP4F3 5 intron3 + 89 tgtgctgcctccagcgggtc G/A cgtgcccatgtgcagacagg 1653 CYP4F3 6 intron3 + 243 tcaagtctgctgtacggcta C/T gtcttgtcacctgtatattt 1654 CYP4F3 7 intron3 + 502 aggtctgggacccagggtcc G/C taagtgaactgtctgagaca 1655 CYP4F3 8 intron3 + 755 ttttgtggccatgtcaggac A/T tgtgaacacatgtcagtgtc 1656 CYP4F3 9 intron3 + 855 gggacagacagggtgtccta G/A gtccttgtgaaggcattctg 1657 CYP4F3 10 intron3 + 970 cctgacatagctcctacgtg C/T catgttaggcagtgtcattg 1658 CYP4F3 11 intron6 + 122 gaggagttgttatacctgat C/T gttgaaggactggtatgaat 1659 CYP4F3 12 exon7 + 159 ggtgcacgacttcacagatg C/A cgtcatccaggagcggcgcc 1660 CYP4F3 13 intron7 + 2107 caggttgccagtgatttttt T/&Dgr; ctcagaaagtttcatcaag 1661 CYP4F3 14 intron7 + 2255 gaccaagaagggtctaggag T/A gcaagatgggcttgggtttc 1662 CYP4F3 15 intron8 + 132 cctcaatgcaaggttgctgt A/C caccctcgggtgctgaagca 1663 CYP4F3 16 exon9 + 59 taccaccttgcaaagcaccc G/A gaataccaggagcgctgtcg 1664 CYP4F3 17 intron9 + 13 attgaatggtgagtgcaggt G/A ctggtgccctgttcctgagc 1665 CYP4F3 18 intron9 + 36 ggtgccctgttcctgagcct G/C tctcattggctctgttcccc 1666 CYP4F3 19 intron9 + 167 acccatcctgactgtctggg C/G aaaggttataggcccttagg 1667 CYP4F3 20 intron9 + 369 tccctaattcctacccttcc G/A tccagtccagggatttataa 1668 CYP4F3 21 intron9 + 458 tcattcatccatccagtcct T/C gttcagcaaatactctcata 1669 CYP4F3 22 intron10 + 46 ctcctgggtaggaagagggg A/C ccctcaggcagggagcattg 1670 CYP4F3 23 intron10 + 63 gggcccctcaggcagggagc C/A ttgtcctgactgcccccttc 1671 CYP4F3 24 intron11 + 14 ccctgaggtgcgggcccccc C/G tctctgtttttgtccattcc 1672 CYP4F3 25 intron11 + 84 gatcaggagaatccaacatc G/A cctccctccaagacacacac 1673 CYP4F3 26 intron11 + 113 caagacacacaccactgtct T/C tccaaggctggcggactggg 1674 CYP4F3 27 intron11 + 164 cggcaacccttcttggtctc T/G cctccaggtctatgacccct 1675 CYP4F3 28 intron11 + 165 ggcaacccttcttggtctcg T/C ctccaggtctatgacccctt 1676 CYP4F3 29 intron12 + 156 gaaaaggcccacagagtagg G/A ttgggttggtcctagaagga 1677 CYP4F3 30 intron12 + 253 gagctcggctaggctcgcag G/T atatgcaagcccacatgggg 1678 CYP4F3 31 intron12 + 346 tgggtgtcccaggccaggtt G/A ttgggttggtcctagaagga 1679 CYP4F8 1 5′flanking − 61 accatgtttacccatcattg G/T tcctggagctccccagcccc 1680 CYP4F8 2 exon1 + 67 gtggcagcatccccgtggct G/T ctcctgctggtggtcggggc 1681 CYP4F8 3 intron1 + 707 tacgcagcaggtattcacca T/G tatttccacattatccactg 1682 CYP4F8 4 intron1 + 857 acaccccctaccctcacatc G/A tgacacagctgggccagaag 1683 CYP4F8 5 intron1 + 907 tgccatctccaccctccccc G/A tgcaggggcatcttctttat 1684 CYP4F8 6 intron1 + 668 tgtggcacttccaccatatg T/C tcattgccctcttgctccag 1685 CYP4F8 7 intron2 + 818 gccacagagaccatggctca G/A gccccaaaatgctgagtgac 1686 CYP4F8 8 intron2 + 1079 tatgcttgggtgttgcagaa C/T atgttggaccatgtaggagc 1687 CYP4F8 9 intron2 + 1194 ccggtcccctttatgccccc C/A accctcctttcttcttctgc 1688 CYP4F8 10 intron5 + 45 aacatgggatggagtggggg G/T gtgggtgtggggagagcaaa 1689 CYP4F8 11 exon8 + (19-20) ggccatgacaccacggccag (GCCAG) tggcctctcctgggtcttgt 1690 CYP4F8 11 exon8 + (19-20) ggccatgacaccacggccag tggcctctcctgggtcttgt 1691 CYP4F8 12 intron8 + 222 tttatttccccactaacttg C/G tatgcaagcttagtaaaatc 1692 CYP4F8 13 intron8 + 334 cttggagaattaacggcaaa A/T accgcaatgacttttggacc 1693 CYP4F8 14 intron8 + 1999 ttctaagtacatttattctc T/C tgcttttagctatgatctag 1694 CYP4F8 15 intron8 + 4184 caggagggccgtgtatgctc C/T ctggataattgttgggttgt 1695 CYP4F8 16 exon9 + 119 acgtggtgctcccagacagc C/T gagtcatccccaaaggtgcc 1696 CYP4F8 17 intron11 + 282 gggttgggggttccgggcct G/C gttcctggcgcagtggggcc 1697 CYP4F8 18 intron11 + 340 tgcagtcagaccttccacct C/T ggcccccaggaactgcatcg 1698 CYP4F8 19 3′flanking + 35 atcacctacctttgcaccaa T/C taccttttcagatttccggt 1699 CYP4F8 20 3′fanking +3083 ctgtgttggcccctgtgcct G/C agtcccgcggatggccagta 1700 CYP4F8 21 3′flanking + 90 ggcccctgtgcctcagtccc A/G cggatggccagtagggggcg 1701 ALDH1 1 intron1 + 564 cattatttcttcagccaagt T/C tgttgccattggagcagatg 1702 ALDH1 2 intron1 + 710 gttctgagagtaactctgaa C/T tttgcctgtttcacactgct 1703 ALDH1 3 intron1 − 3868 ccctttttatatccagaata C/G agcctaaacttctttctctg 1704 ALDH1 4 intron2 + 2933 taagtatgctatactatatt T/C gatagatatactatactata 1705 ALDH1 5 intron2 − 1646 caatgtgattaactgaatgc C/T gcaaatatgcactgtatatg 1706 ALDH1 6 exon3 + 54 caggcttttcagattggatc C/T ccgtggcgtactatggatgc 1707 ALDH1 7 intron3 + 157 taggccccttaacattgaac T/G attctcaaatagtaatctgc 1708 ALDH1 8 intron3 + 339 tgagtctcctagaatgatat G/A ttaggtttattcaagcattt 1709 ALDH1 9 intron3 + 655 agcagttagatgagtcagag C/A ataatatagttgggggaggg 1710 ALDH1 10 intron3 + 735 gaagccaatttaacataaac C/A aataccaagatcaggtttca 1711 ALDH1 11 intron3 + 863 gcaagtatggttaatcaaag G/A accatttattactcaaatct 1712 ALDH1 12 intron3 + 1757 agatgacaagatttcttcta T/A ttcaaaaattccctagcaca 1713 ALDH1 13 intron5 + 90 ttctctaaaacagatggatg C/A ttatgtatttgttaaatgtg 1714 ALDH1 14 intron6 + 213 caggaagccaaacacaaagg T/C ttggtgtcaaacagtcaact 1715 ALDH1 15 intron6 + 1323 ttttgaattaaattcttata C/T tgtaacttttaaacttttta 1716 ALDH1 16 intron7 + 638 gcaaaagacagtggtggaag C/A atactgtaccatgcaaaaaa 1717 ALDH1 17 intron9 + (1462-1463) aatggcattctatgtttttt (T) gttgtgattatttatctatc 1718 ALDH1 17 intron9 + (1462-1463) aatggcattctatgtttttt gttgtgattatttatctatc 1719 ALDH1 18 intron9 + 1757 tgatctagaatttagtttct A/G taaatgaatagaatccagtg 1720 ALDH1 19 intron12 − 1383 aatcccacttattactctcc T/G gagagcttcaagtgcctata 1721 ALDH1 20 3′flanking + 40 ttttaagtacaagttttggt T/C acagtgatttcttcttgtca 1722 ALDH2 1 intron3 + 1766 aaattggtggctcatcctgc C/&Dgr; tggccgcccttcctcctcctc 1723 ALDH2 2 intron8 + 52 gaaggtagccctggccacct G/C tgttgtggctccagccgatc 1724 ALDH2 3 intron8 + 69 cctgtgttgtggctccagcc G/A atcctgtcgcccccccagtg 1725 ALDH2 4 intron9 + 5197 gctttcttatgaccttggtc C/A atttcccagttgtcttgttg 1726 ALDH2 5 intron11 + 114 gagctgggctcagtttctcc T/C gggtcagggtgtgatgtcga 1727 ALDH2 6 3′flanking + 411 ggatatgatttctgcccctc T/C tctgctgtgggtaaacagct 1728 ALDH2 7 3′flanking + (432-433) tctgctgtgggtaaacagct TC/&Dgr; tgtttcatgcatttactttt 1729 ALDH2 8 3′flanking + 488 ccaataagaatgtgcttgaa G/T gtttcatgcatttaatttgt 1730 ALDH7 1 5′flanking − 1455 ctgcctgtccacacccacag C/T agcttgcacatcatccccac 1731 ALDH7 2 intron1 + 464 catgaatgactctgggaaag A/G atcattcttagcaatggact 1732 ALDH7 3 intron1 + 2269 aaatggaatccaaacagcaa G/C agacctcccctcaccggtca 1733 ALDH7 4 intron2 + 1349 actgagcttctgccaccggc C/T gcctgccggccttcatgaga 1734 ALDH7 5 intron2 + 1820 tccgtgtggaaggcaccttc C/G cccagcctcagtggctagga 1735 ALDH7 6 intron2 + 2046 aacctcaggcgctgcctcag C/G cagggagccagcctggcccc 1736 ALDH7 7 intron2 + 2939 aagcacgcactgaacatgga G/A tgagtgagtgaacgaatgaa 1737 ALDH7 8 intron3 + 7 tgcccaagaacctggtgagc C/T ggccgggctgaggcgggcag 1738 ALDH7 9 intron4 + 36 gccccttccggtcacccttc T/C ccgctcgaggcctcagggcc 1739 ALDH7 10 intron6 + (116-117) attctcctctctctctctct CT/&Dgr; ggaccaggctgggagcagtc 1740 ALDH7 11 intron6 + 263 cagaccctcatacgtgaccc T/C gctgccccccaggctcttag 1741 ALDH7 12 intron6 + 1298 gtagacagagctggactcca T/G ccttgggtgataagggatcc 1742 ALDH7 13 intron6 + 1411 gccagggtcacaagcagagg C/T gggaggagccaaggggtttg 1743 ALDH7 14 exon7 + 185 acctgcgtggcccccgacta C/T gtcctatgcagccctgagat 1744 ALDH7 15 exon7 + 339 tgcgggcattgctgggctgc G/A gcgtgtggccattgggggcc 1745 ALDH7 16 intron7 + 249 ccagggctccagggctcagc G/A tgctaagatgaactcccatc 1746 ALDH7 17 intron7 + 277 atgaactcccatcccaccac C/T ggctatcctgaaaggctgta 1747 ALDH7 18 intron7 + 498 gaccaaggtcgggggattct C/T tgtgtcccacaggccctgag 1748 ALDH7 19 intron8 + 14 cagccaggtgggggtgcggc C/T gggctgggcagggtcaggag 1749 ALDH7 20 intron8 + 49 caggagcccgcagtgggcag C/T acaagtggtggcagcagggg 1750 ALDH7 21 intron8 + 111 tcaggactttgggatggtgg A/T cctcttggctctgtctctgc 1751 ALDH7 22 intron8 + 3219 atcctgatggggctcaaggc A/G gcctcacgcacatcctgttc 1752 ALDH7 23 exon9 + 33 gtgctgacccagaccagcag G/T gggggcttctgtgggaacga 1753 ALDH7 24 intron9 + 948 tcccaggcccccgagctgac C/A cttcttggtggccgtggccc 1754 ALDH7 25 intron9 + 1067 aggctccccaagcctgggtc C/T ctcttgcccccacccactct 1755 ALDH7 26 exon10 + 137 ccgcaatcgccgcgccgcct G/A aggatgctgctggtggccat 1756 ALDH7 27 exon10 + 397 cgctcccaaccatgagagcc G/A aggatgctgctggtggccat 1757 ALDH7 28 exon10 + 1198 ctcttccccatgctgctcat C/T ctcctgggccccatccactc 1758 ALDH7 29 exon10 + 1475 caggggtggacctgagtttc G/A tctcctgtctctctggctga 1759 ALDH7 30 3′flanking + 15 cctggcaatacttacatctc A/G gtgatttgctttctgtgcat 1760 ALDH7 31 3′flanking + 60 caacaggactctggaccaag G/C ccctggcgttgggtaacaat 1761 ALDH8 1 intron1 + 98 agggaaggggatgtgtgccc G/A tggccgtgggtcaggggggc 1762 ALDH8 2 intron1 + 157 atggctgcaggggccatggg T/C acggggcttgctcaggagag 1763 ALDH8 3 intron1 + 354 tctgtggacagacaaggatt C/G ggtcgggggcaccagggctg 1764 ALDH8 4 intron1 + 851 tatgacaggtccatcaggcc T/G caccttcctgtgtgtcttat 1765 ALDH8 5 intron1 + 894 ctcagcatctgcccccacag T/G gcttttgcacacgttggttc 1766 ALDH8 6 intron1 − 463 aaagaaccctccgagtccct C/G gtttagtcccagaagggagg 1767 ALDH8 7 exon2 + 61 gccttcaactgagggcgcac G/A cggccggccgagttccgggc 1768 ALDH8 8 intron2 + 8 ggacctgcataaggtgggcc A/G tggagagtgggccccggcag 1769 ALDH8 9 intron2 + 23 gggccgtggagagtgggccc G/C ggcaggggctggagcagcgt 1770 ALDH8 10 intron2 + (180-181) ttcactcctgaacactcaca (A) gccaccctgtgatgcaggct 1771 ALDH8 10 intron2 + (180-181) ttcactcctgaacactcaca gccaccctgtgatgcaggct 1772 ALDH8 11 exon8 + 72 gactacgctctcaagaacct T/G caggcctggatgaaggatga 1773 ALDH8 12 intron8 + 375 ctgcagcatcctaacctcac C/T gtcgcgactcaaggctgccg 1774 ALDH8 13 intron8 + 463 aatcacccccatggcacccc G/A accgtcactgagagggtgct 1775 ALDH8 14 exon9 + 33 atgctggagcggaccagcag C/A ggcagctttggaggcaatga 1776 ALDH8 15 exon10 + 428 aggtgtcctcactcacccca C/T cctccccaattccagccctt 1777 ALDH9 1 exon1 + 121 actgtgtggggtatggcggg G/A tggtggggagaatgtggtgt 1778 ALDH9 2 intron1 + 67 cgcggatttcccggccagcc C/G ccgtttcctgtgttctgcag 1779 ALDH9 3 intron1 + 103 tgcagcgttgacttgagcac A/G agacagtgacagtggagagt 1780 ALDH9 4 intron1 + 1818 gaatttttgagaaaaaaaaa A/&Dgr; tgttcctttagggttgcctt 1781 ALDH9 5 intron2 + 5891 tcaggaacaggaagtaaaga G/A gtttccatttctaaatttct 1782 ALDH9 6 intron2 + 6398 atcaaaaacacttgtctgat T/G atcgtgctctgaacctgcct 1783 ALDH9 7 intron2 + 9677 atgacgctgagtttggtgct A/G ttcttttgtttttcttgcct 1784 ALDH9 8 intron2 + 9991 gggagaagtgagggacctac C/T cttggcttctaatctttcat 1785 ALDH9 9 intron2 + 10198 ttgtcagagacatctttgat A/G atccttacgtactatatcag 1786 ALDH9 10 intron2 + 10258 ttagtagataactttttttt T/&Dgr; gtaaggatggagaataatag 1787 ALDH9 11 intron2 + 11382 catattcaattcttttatgt T/C ctttagaccaaagaaaggca 1788 ALDH9 12 intron2 + 11455 taaacctttaagctcatcat C/T ggaccatctattgaatttct 1789 ALDH9 13 intron2 + 12044 atttaaagtgaaagctattt C/T tagttttaaaaattgagcag 1790 ALDH9 14 intron3 + 334 ctatttagcaaacttttttt T/&Dgr; gacagtgtataaagttttca 1791 ALDH9 15 intron3 + 368 gttttcaacaattgatattg G/&Dgr; aaggttggtagggcctagga 1792 ALDH9 16 intron4 + 191 ccctcaaggagcttatagtt T/A aggttgtacacaatcatgtc 1793 ALDH9 17 intron4 + 557 tagaaaaaattgtaatgtta A/G aaagcattactgttaggaca 1794 ALDH9 18 intron5 + 830 agttcaagatgattttgtag G/C ttcagggcctagttgactta 1795 ALDH9 19 intron5 + 838 atgattttgtaggttcaggg C/T ctagttgacttagcatgcaa 1796 ALDH9 20 intron6 + 120 agaaaagttgcacaaatagt A/C caaagaattcccatgtacct 1797 ALDH9 21 intron6 + 2569 attaaaatctgctttaaata T/C ttttttgggggagaggacac 1798 ALDH9 22 intron7 + 1414 ccgatcttcaaaaaattagc T/C gggggtggtggtgcacactg 1799 ALDH9 23 intron8 + 664 aaagttcacatttttttttt T/&Dgr; ataacttcatggtcaagagc 1800 ALDH9 24 intron8 + 2170 taatgcacacattttttttt T/&Dgr; cttcatagggacatccaacg 1801 ALDH9 25 exon11 + 587 aaaacaaaaaacaaaaaaaa A/&Dgr; ccttgttcctttataggttc 1802 ALDH10 1 intron1 + 39 gggtgtggggaaactggccc C/T cgccgcgcacttgtggactg 1803 ALDH10 2 intron3 + 2491 tgccgcgaagaaattggcac T/A gctgagttctacatgcagtt 1804 ALDH10 3 intron3 + 2595 ttctgtacatcaacttgtga T/A ggattgaggccagttctggt 1805 ALDH10 4 intron3 + 2775 taccgctttgcccctgacca G/A gggtaaattcttcaataact 1806 ALDH10 5 intron3 + 3424 aggcacttctgcacacaccc G/A cgtctcatgcattttccctg 1807 ALDH10 6 intron3 + 3676 atgttgaagagattgctgat G/A ttagacgttcggatttattt 1808 ALDH10 7 intron4 + 481 tagaaaataagaggtttcag G/T ttctctctgctaaatccggt 1809 ALDH10 8 intron4 + 769 atcctgctttatacctgaac G/A tcttgcaggcagagccaaaa 1810 ALDH10 9 intron4 + 796 aggcagagccaaaagccaca A/G ccaggagagtctgtaccgaa 1811 ALDH10 10 intron5 + 254 attagttgtggcatatactt T/G ttttaaaaaagttaaataat 1812 ALDH10 11 intron6 + 137 aatcctgctttctggtatac T/C gtacctgtagcttttgttat 1813 ALDH10 12 intron6 + 923 aggctaatgaatggtaagag G/A aaggggctatcctgattagc 1814 ALDH10 13 intron7 + 331 tgcttttctgatgttaatcc A/&Dgr; cagggcattgctgaataaca 1815 ALDH10 14 intron8 + 643 tttagaacatgacctgcctg C/T ctctcccacatgtgagatga 1816 ALDH10 15 intron8 + 666 ctcccacatgtgagatgact G/A actcagctttttatttctcc 1817 ALDH10 16 intron9 + 2129 tgttttcatttttaaaaaaa G/T gtttgactttggaattcatg 1818 ALDH10 17 exon10 + (1894-1895) ttggcttgtctactaataca CA/&Dgr; tctgcttcaaaatgaacata 1819 ALDH10 18 3′flanking + 31 gtatttgtcaactttttttt T/&Dgr; ctcattttaaaattcttagc 1820 ALDH10 19 3′flanking + 106 gtgtgttgggggtggtggtt G/A gtagctatagtaaataggtt 1821 ALDH10 20 3′flanking + 1630 aaaagcacgtgggaaacaca A/G ttaatcatgtcttaccgtat 1822 ABCC7 1 5′flanking − 834 gctaaaacactccaaagcct T/G ccttaaaaatgcgcactggg 1823 ABCC7 2 5′flanking − 729 cctccttgcagatttttttt T/&Dgr; ctctttcagtacgtgtccta 1824 ABCC7 3 exon1 + 125 tagcagggaccccagcgccc G/C agagaccatgcagaggtcgc 1825 ABCC7 4 intron1 + 5200 ctatgtgagacgttaagaag G/A tagaggtggccaagaaggaa 1826 ABCC7 5 intron1 + 7538 agttctctttcttagcatgg C/A ctacagaggtgcaactacct 1827 ABCC7 6 intron1 + 13519 gaaacttaaatcttgagtca T/C acaattgtgtctacatactg 1828 ABCC7 7 intron1 + 14110 attacacagtattttttttt T/&Dgr; ctctttcagtacgtgtccta 1829 ABCC7 8 intron1 + 14293 gccaggcagattcctgactc C/&Dgr; tataacccagagcttatcag 1830 ABCC7 9 intron1 + 14316 taacccagagcttatcagag C/G atttatgtccccaaagagaa 1831 ABCC7 10 intron1 + 14433 cagaataacaatgatggctc G/A gaaaaatatgggtatttctg 1832 ABCC7 11 intron1 + 14824 acgttttgacagttgcacaa G/C tttctttctttaagctttaa 1833 ABCC7 12 intron1 + 23401 aatatttttgaaaatcacta C/G ggtatcctgcatagtgattt 1834 ABCC7 13 intron3 + 879 gaaaaatttcagttcataca C/A ccccatgaaaaatacattta 1835 ABCC7 14 intron3 + 922 acttatcttaacaaagatga G/C tacacttaggcccagaatgt 1836 ABCC7 15 intron3 + 933 caaagatgagtacacttagg C/T ccagaatgttctctaatgct 1837 ABCC7 16 intron3 + 13704 tttttccaaataaaaaaaaa A/&Dgr; tcaggtgatatctgtaaatg 1838 ABCC7 17 intron3 + 13758 tattaaagaacatgatgctt A/G aaacagattagggaaaacta 1839 ABCC7 18 intron4 + 240 ctctgttgtagttttttttt T/&Dgr; ctcctaatcatgttatcatt 1840 ABCC7 19 intron4 + 376 ttatgttcagcaagaagagt A/G taatatatgattgttaatga 1841 ABCC7 20 intron4 + 586 tgtccagacaagagaccaaa T/C tgccgaggcatcatttaggt 1842 ABCC7 21 intron4 + 1089 tttcaatctgaacattttac G/A taagtgaagactttgttaga 1843 ABCC7 22 intron4 + 1615 aaagttaggtggtattgtat C/T tgtcttcctttctcaatgtt 1844 ABCC7 23 intron4 + 1946 aatacaaacaaacttgagct T/C tgcctatacttttcaagaat 1845 ABCC7 24 intron6 + 783 tatctaagttttggagtcaa A/G tagcactttgtttgaatccc 1846 ABCC7 25 intron6 + (1128-1131) gattgattgattgattgatt GATT/&Dgr; tacagagatcagagagctgg 1847 ABCC7 26 intron7 + (731-732) gtagcaatgagaccattttt (T) cttcagttgagctccatgtt 1848 ABCC7 26 intron7 + (731-732) gtagcaatgagaccattttt cttcagttgagctccatgtt 1849 ABCC7 27 intron7 + 1434 gaatgtttggttgtaacctg T/C ataatctggcatgaaattgt 1850 ABCC7 28 intron1 + 752 catgctctcttctcagtccc A/G ttccttcattatatcaccta 1851 ABCC7 29 intron8 + 1109 tatggccaagacttcagtat G/A cgtggacttaattcttcctt 1852 ABCC7 30 intron8 + 1312 atgaagacattcattttttt T/&Dgr; ctccgtccaatgttggatta 1853 ABCC7 31 intron9 + (6521-6522) gtgtgtgtgtgtgtgtgtgt (GT) ttttttaacagggatttggg 1854 ABCC7 31 intron9 + (6521-6522) gtgtgtgtgtgtgtgtgtgt ttttttaacagggatttggg 1855 ABCC7 32 intron10 + 2119 gaacactttatagttttttt T/G ggacaaaagatctagctaaa 1856 ABCC7 33 intron11 + 3867 tttttcttcaagaaattaga A/&Dgr; gaggggagaaattggtttaa 1857 ABCC7 34 intron11 + 11844 tgaatcaaaatcatctaaaa A/&Dgr; gctttcagaaaccagacttt 1858 ABCC7 35 intron11 + 12144 atattaaacagagttacata T/C acttacaacttcatacatat 1859 ABCC7 36 intron11 + 20975 gtgtggatagtaaatgccag G/A gtaaatcacatagcatctaa 1860 ABCC7 37 intron11 + 27057 atggaagagaagttttagta G/A aggggaggaaggaggaggtg 1861 ABCC7 38 intron11 + 27131 gagagagacttttttttttt T/&Dgr; aaggcgagagtttactacct 1862 ABCC7 39 intron13 + 152 gtattaactcaaatctgatc T/A gccctactgggccaggattc 1863 ABCC7 40 intron13 + 287 tttgcagtatcattgccttg T/C gatatatattactttaatta 1864 ABCC7 41 intron15 + (85-86) atacatatatatgcacacac AT/&Dgr; aaatatgtatatatacacat 1865 ABCC7 42 intron15 + 106 taaatatgtatatatacaca T/A gtatacatgtataagtatgc 1866 ABCC7 43 intron15 + 3341 ggaagtataaatttgtaaat A/C actgagacccaaacttacaa 1867 ABCC7 44 intron15 + 5556 tgctattgactaatagtaat A/T attttagggcagctttatga 1868 ABCC7 45 intron15 + 5919 tggtagttctatgtggaaac C/A gtgaggaaataattttatat 1869 ABCC7 46 intron17 + 2479 caaaaaggtatggaagtcag A/C ggagaaggagacccctatgt 1870 ABCC7 47 intron18 + 81 acgtatgcaaaaaaaaaaaa A/&Dgr; gaaataactcactgacacac 1871 ABCC7 48 intron19 + 751 cattaataaaataacaaatc A/G tatctattcaaagaatggca 1872 ABCC7 49 intron19 + 820 tgacatttgtgatatgatta T/C tctaatttagtctttttcag 1873 ABCC7 50 intron21 + 1532 ttacctttaacttttttttt T/&Dgr; agtttgatcagctctcttta 1874 ABCC7 51 intron21 + 1607 atgcttttggagttgggtct C/T ataaatgtatagaaatgttt 1875 ABCC7 52 intron21 + 11260 atgtggaacaatcatgacta T/C atgccttttactttctctat 1876 ABCC7 53 intron22 + (130-131) agaatcaatattaaacacac AT/&Dgr; gtttattatatggagtcat 1877 ABCC7 54 intron23 + 1828 ctgtcctaaagtttaaaaag A/&Dgr; aaaaaaaaaaggaagaaggaa 1878 ABCC7 55 intron24 + (7100-7112) cctttacaaactcttagaca (T)12-14 agtttaacatgttacaaaac 1879 ABCC7 56 intron25 + 237 actcttcccccttgtcaaca C/T atgatgaagcttttaaatac 1880 ABCC7 57 intron27 + 115 gggtgaagctctttccccac C/T ggaactcaagcaagtgcaag 1881 ABCC7 58 intron27 + 334 ggatgaattaagtttttttt T/&Dgr; aaaaacgccccatttggtaa 1882 ABCC8 1 5′flanking − 1099 aaaggggctgaaggggtctt T/C cttttgtgttcccctgactg 1883 ABCC8 2 5′flanking − (424-422) caccccaccaccaccaccac CAC/&Dgr; aaggtaacgttctgccccac 1884 ABCC8 3 intron1 + 1212 agcctgggcaacatagtgag A/G ccccccccgccctttctaca 1885 ABCC8 4 intron2 + 1003 aggaggactgtgaatcccag C/A ctgcatgtttgggtcggatt 1886 ABCC8 5 intron2 + 1253 catctcactaaggaagaatc C/T agtaaccagcaaggatgaga 1887 ABCC8 6 intron2 + 1382 cccagactgcactcctgcag T/C gctgcctggctcctgtagtt 1888 ABCC8 7 intron2 + 2371 tttcagagctgtctggaaat T/A tagggggcaggtgggagggg 1889 ABCC8 8 intron3 + 1957 ccctacccctagcccagggg C/T ccccacatgagtatgaatgg 1890 ABCC8 9 intron3 + (2088-2089) agagaacccttcattaacca (CCA) gggcgtggctgaccagtgtc 1891 ABCC8 9 intron3 + (2088-2089) agagaacccttcattaacca gggcgtggctgaccagtgtc 1892 ABCC8 10 intron3 + 2204 taaagcacaagttatcaccc G/A tggatggatttgtccttttc 1893 ABCC8 11 intron3 + 2286 ttatctccccttgaaaggac A/G ctccacagagccagaaattc 1894 ABCC8 12 intron3 + 2312 cagagccagaaattctagaa C/G agggaaaagtggaggggagg 1895 ABCC8 13 intron3 + 2358 ctgtgaactgcagggacaga A/G ggaaatgggtattgggagaa 1896 ABCC8 14 intron3 + 2359 tgacctgcagggacagaagg A/C aatgggtattgggagaatgg 1897 ABCC8 15 intron3 + 2370 gacagaaggaaatgggtatt G/A ggagaatggccagccctcca 1898 ABCC8 16 intron3 + 2382 tgggtattgggagaatggcc A/G gccctccaaggggctgatgt 1899 ABCC8 17 intron3 + 4910 ggggacagccttcagctgtg G/A aattcctccagtcctagaga 1900 ABCC8 18 intron3 + 4969 cattattccagtcctgaggc A/G tgagagcagaaggccgatgc 1901 ABCC8 19 intron3 + 5003 ccgatgcttctgccctccat C/G ctaatgtcctcctgcaggga 1902 ABCC8 20 intron3 + 5019 ccatcctaatgtcctcctgc A/C gggacccaaggtggatggca 1903 ABCC8 21 intron4 + 14 ggtgagggtaagcaggccac C/T tgggccagggtggggtggga 1904 ABCC8 22 intron4 + 187 agacactgcatctggcccac G/A tgtgctctaccccagggtcc 1905 ABCC8 23 intron4 + 204 cacgtgtgctctaccccagg G/C tcccagagggagaggggggt 1906 ABCC8 24 intron4 + 254 gttcgctgaggttggcggat G/A actttccgtagaaagggaag 1907 ABCC8 25 intron4 + 357 tgtattcatatcgtcacgct G/C gtaaatgaatgagtaagtgt 1908 ABCC8 26 intron5 + 92 ggcattaggtcaaaatcctg G/A tgggacaaaaggggaaactg 1909 ABCC8 27 intron6 + 4205 tctgtagaaagtacatgggg G/A catgaagatcattggcttga 1910 ABCC8 28 intron6 + 5519 gattcccagggaatgttaaa A/C aggaccgggtcttcctaaac 1911 ABCC8 29 intron6 + 5575 tctgacccagtaccagccag G/C gggcaagtttccatcccccc 1912 ABCC8 30 intron6 + 5587 gttgccatctgagatcttgc C/T ggaagtacacaagagaccct 1913 ABCC8 31 intron6 + 6747 ttccactggccttttctgct C/T agtaattgctacattacagg 1914 ABCC8 32 intron9 + 191 gaggaagctgcctcccggtg A/G ggacaggaagcgggcatggc 1915 ABCC8 33 intron10 + 1963 cccaggagtccaacctccct T/G tgtccagctagaccatggtg 1916 ABCC8 34 intron10 + 2724 cctgggacatgttttcttat A/G taaaacagcatcaaagatgt 1917 ABCC8 35 intron10 + 2938 gcccgcccaggactcctcac G/C tgtcaaagtcacctagggag 1918 ABCC8 36 intron10 + 3094 tccgaggatgtgtttttttt T/&Dgr; ccctccgttagtcagcagtg 1919 ABCC8 37 intron10 + 3368 tcctgctcatatgcggcacc A/G tcagacttctgggcaggcaa 1920 ABCC8 38 intron10 + 8897 ggtattgattaaaagcctca C/T gggcagagaaattcgccatc 1921 ABCC8 39 intron11 + 308 tgtgtattgtagaagtgatg G/A gaaatccagaacagaaagct 1922 ABCC8 40 intron11 + 1171 gccctctcatttcccttcca G/A tgctgagcgtttccagtgtg 1923 ABCC8 41 exon12 + 7 gcctctgtccacagactttc G/A tgggccacgtcagcttcttc 1924 ABCC8 42 intron12 + 356 accaagaatgaggccatccc G/T tccccacgtggctgccccat 1925 ABCC8 43 intron12 + 934 tgggttcaaagatggaatgg G/T gcataactcagcaaaattat 1926 ABCC8 44 intron12 + 1370 gggagggaggctggacaggg C/G atgaaggcagagcctggtgg 1927 ABCC8 45 intron15 + 412 ggaggtgggacccaggatgg C/T gtttcttgggaccacaagga 1928 ABCC8 46 intron15 + 688 actcccccggccccactcac A/G tctgccaccttccctccctg 1929 ABCC8 47 intron16 + 4464 actcattccaagtattgatc G/A agaagagaggtaggtactgg 1930 ABCC8 48 intron16 + 4574 ttgaagatcttaagttgttt T/C tggttcactcatttcgcaaa 1931 ABCC8 49 intron16 + 5011 agctaaaagcaaaacagcct C/T tgacctggcaagcattccca 1932 ABCC8 50 intron16 + 7608 tgtcctacttttcttttgac C/G cttataacttcctgacttcg 1933 ABCC8 51 intron16 + 7730 ccagctcctagtgggctgga G/A ggaaggacatgcggttgggg 1934 ABCC8 52 intron16 + 8369 ttgcaaactgagttagggcc T/C ggagagcttactgtgtgctg 1935 ABCC8 53 intron16 + 9708 tgcacttgccgcctacttat T/G ccagacccaatgattgggtc 1936 ABCC8 54 intron17 + 651 tatagattaatgaggctctg A/G gtccctcaaaaccttccctc 1937 ABCC8 55 intron17 + 692 cccttacctctccaaaaaac A/G cttgagataccctagaggtg 1938 ABCC8 56 intron17 + 1541 ctcaggatcttcctggagga C/T atggttcactcccatgagag 1939 ABCC8 57 intron18 + 580 actaagcagatttctaccaa C/T tgcacctccccatccccttg 1940 ABCC8 58 intron18 + 658 gaacaagcccctgagaatgc C/T ttccgcaccccctactcccg 1941 ABCC8 59 intron18 + 660 acaagcccctgagaatgcct T/C ccgcaccccctactcccgcc 1942 ABCC8 60 intron19 + 93 gcccttccatcgatcaccca T/C acccagccatctcactcccc 1943 ABCC8 61 intron19 + 123 tctcactccccaggtgctta T/C ctgcactccagcctctccat 1944 ABCC8 62 intron19 + 219 cataggggagagggcaggaa C/T ggagggaagggagagagccc 1945 ABCC8 63 intron19 + 845 tagtatttaacctgcccaaa C/T gctgtgtgaagtgctgacct 1946 ABCC8 64 intron20 + 338 tcccctccacaagcttagac A/G aacaggattctcctgtgact 1947 ABCC8 65 exon21 + 10 tttggtgacagggcatcaac C/T tgtctggtggtcaacgccag 1948 ABCC8 66 intron21 + 192 caaggatagcacaaatgacc C/&Dgr; attgcagacttcagatggag 1949 ABCC8 67 intron23 + 17 gaaggtgggtatatccaggg A/G tggccaagcagccacccctg 1950 ABCC8 68 intron23 + 67 gttctgctagaacctgaact G/T ataaaggtcttcctgtcctt 1951 ABCC8 69 intron26 + 268 gtgagcgtctgcacatccaa G/C taaagattgttttctcctcc 1952 ABCC8 70 intron26 + 308 cgataagtgggtgtaatttg C/T ccatccccacccatgagtcc 1953 ABCC8 71 intron26 + 348 cagctccctgccctcccctc A/G ctctctctccctcagccagc 1954 ABCC8 72 intron26 + 807 gacagctgctgagtcaggcc G/A agccggcagctgagaaaggc 1955 ABCC8 73 intron26 + 834 cagctgagaaaggcggcagt G/C gtcagatgggcttgagaaac 1956 ABCC8 74 intron26 + (118-121) cctccaaaaaataaaaacaa AAAA/&Dgr; cagaaatgaaggaaatagaa 1957 ABCC8 75 intron28 + 1348 tggggtaagcggaagacggg G/A ttgaacgctttgagtttggt 1958 ABCC8 76 intron29 + 1253 ctcttagggatcttgtctaa G/T taaagaagagcagagcaaag 1959 ABCC8 77 intron29 + 1589 cagatcccagcttcctgtaa A/G cagcctcagatcaggccaaa 1960 ABCC8 78 intron29 + 2322 gcgcctcacactcctataac G/A cgcacatgccctgatgcaca 1961 ABCC8 79 intron29 + 2348 atgccctgatgcacacacat T/C ttcaacacgcacttactcta 1962 ABCC8 80 intron29 + 2418 agacacgtcaccctcccaca C/T gtctccaccctgggggtgtg 1963 ABCC8 81 intron29 + 2494 tcagtcccctcagacacatg C/A cctctctccacgcagagaca 1964 ABCC8 82 intron29 + 2735 gcggccaaggagagtgatga C/T ggcagcccaggttgatcaga 1965 ABCC8 83 intron30 + 386 gctcctggggctccagcctt C/T gcagcccttgtgtgtgtctg 1966 ABCC8 84 intron33 + 93 ggcttcgcagtcacctcgtg G/T ccctccagggccgaggcctc 1967 ABCC8 85 intron33 + 358 agggacctgggggcagacag C/T gaggccacccttgtattgag 1968 ABCC8 86 intron38 + 54 cccagggacaggactggcct G/C ttgtggccgtcatcagtgca 1969 ABCC8 87 intron38 + 466 aggacattctggccacatgc C/&Dgr; tcatcctcctcctccaagcc 1970 ABCC8 88 intron38 + 529 tggcccccaccgcgggtggt A/G ttcccaccatcctgacccgc 1971 ABCC9 1 intron3 + 38 tgttgtttctccttaaagag C/A tatttgtttttccccccaaa 1972 ABCC9 2 intron3 + 305 gctggccttctggcttgcag T/A agttgtattttaagaatcag 1973 ABCC9 3 intron3 + 320 tgcagaagttgtattttaag A/G atcagagctcttgtgaggag 1974 ABCC9 4 intron3 + 631 ttctgtggaaatcagaggct G/C tctaaaatattcctaatttt 1975 ABCC9 5 intron3 + 8644 tggacgactcaacatttttc A/G agttattactccttcaactc 1976 ABCC9 6 intron4 + 757 aggatatcatgaaacactga A/C tcttagtaaaaactatcttt 1977 ABCC9 7 intron4 + 1022 tactgtggaatttttcttgc A/C acagagatatgtatttttca 1978 ABCC9 8 intron5 − 1217 cagtggtagatgtgttttct A/G ttgccatcatctacaaatat 1979 ABCC9 9 intron6 + (106-107) tatgagttgttcaaataggc (T)7-9 cagagaattgaatgctttct 1980 ABCC9 10 intron6 + 1347 tcagtcgtattcctactaaa A/&Dgr; caaaattttgtaagttatgt 1981 ABCC9 11 intron6 + 1618 ctttttatttgctgcttacc G/A ttttactaaggttggatata 1982 ABCC9 12 intron6 + 1835 cttttaataaatgcaaactg C/T acacctggtctataaaaaga 1983 ABCC9 13 intron7 + 407 cctatagaatttttcttttc T/G tttttctcaaaaaaattaaa 1984 ABCC9 14 intron7 + 423 tttctttttctcaaaaaaaa C/T taaatgtttgttatttattt 1985 ABCC9 15 intron3 + 743 ttctgtagatgaagcttaag A/T gctagatcttatttgaaaaa 1986 ABCC9 16 intron8 + 850 tttttaacttattgtttgcc T/G tttcattttttaatagaaaa 1987 ABCC9 17 intron9 + 585 cgaatttgctgcttttagag A/T aatctttgcaaataataaaa 1988 ABCC9 18 intron9 + 1394 atttttcttcttgtaagtat G/C agtgatagagctgactgcag 1989 ABCC9 19 intron12 + 1167 atttgtaagacttttaaaat G/A agataattgtgctggtgtct 1990 ABCC9 20 intron12 + 1195 tgtgctggtgtctatatctt A/G ctgagaaaactagaatttat 1991 ABCC9 21 intron12 + 2123 ataagtgctctcccagtgtt G/A attggacttagagcattttc 1992 ABCC9 22 intron12 + (2853-2856) caaaacagaataatgaaaag TAAC/&Dgr; tattatctaaaataataaaa 1993 ABCC9 23 intron13 + (3043-3044) aacatactctcctcctctct (CTCTTT) aagtcaaaatatattagtat 1994 ABCC9 23 intron13 + (3043-3044) aacatactctcctcctctct (CT) aagtcaaaatatattagtat 1995 ABCC9 23 intron13 + (3043-3044) aacatactctcctcctctct aagtcaaaatatattagtat 1996 ABCC9 24 intron14 + 85 ttctgtgaaagtgtcccaaa T/A tgtgcctttaaattgttttt 1996 ABCC9 25 intron14 + 275 agtgtcacagtgtatttttc T/C ggtattcctatgtttatcaa 1997 ABCC9 26 intron14 + 453 ctcattcaaaacttggctat T/C tggactctccccaggcattg 1998 ABCC9 27 intron14 + 3709 atcccctagtgatgtacact G/A agcttgcctccatctttcct 1999 ABCC9 28 intron14 + 3813 ctgatttatatattagctga C/T tttccaagttcagacatcta 2000 ABCC9 29 intron14 + 4000 ttcttttacttcaatgtagc A/&Dgr; ccaaatcagaaggtgacatt 2001 ABCC9 30 intron16 + 1466 atcccactggatttaattac A/C ttgtgtagcttgtacaacca 2002 ABCC9 31 intron16 + 5357 attttggaagagaaattata T/G aaccttccacaactgaattt 2003 ABCC9 32 intron17 + 1368 aatcctggtgtttttttttt T/&Dgr; ctttttcatttttcagtagg 2004 ABCC9 33 intron20 + 98 aagtaactcaaggaaagatg G/A tttaacttgtgaaatcgtaa 2005 ABCC9 34 intron22 + 28 ctcatagttcagaagagttc A/C gagcccaattcagaagagtt 2006 ABCC9 35 intron22 + 194 tgaacctataaaattctaat G/&Dgr; ccatctttggatgaggtgca 2007 ABCC9 36 intron22 + 1370 ccagggacaaaagaagatga C/T gtaaacttaaggattgggac 2008 ABCC9 37 intron22 + 1487 agcaagccaggaagaaagtc C/G attaagttgtatttagaaat 2009 ABCC9 38 intron23 + (455-462) atagccatgaaggataagaa AATTAGAA/&Dgr; tgccatttgt 2011 tatgtttcag ABCC9 39 intron24 + (460-465) aactctttctcttcatctgc TTTAAAA/TTTTAA gcaagccttg 2012 aaggagagtg ABCC9 40 intron24 + 595 gcatgcaaaataatgaagaa A/G acaatcttgtctgacattga 2013 ABCC9 41 intron28 − 926 aaatatttcagaatttgggg G/A tgtagagcatttgccgtcat 2014 ABCC9 42 intron29 + 2692 cttgtaagtctttttttttt T/&Dgr; aaagtaatgaaaattctaa 2015 ABCC9 43 intron29 + 5464 agacaacactgcttttttgt G/A tgttcacaattcaacgacag 2016 ABCC9 44 intron29 − 1830 aactggctgaaaggaaaaaa A/T tcatattgctgtaaatattt 2017 ABCC9 45 intron31 + 102 tgcttttgctttccacttca G/A tatccagaaaactctctcat 2018 ABCC9 46 intron33 + 877 aacatggaactatagtaaat A/G tagtttttttggggttcaga 2019 ABCC9 47 intron36 + 1281 aatttacacttttttttttt T/&Dgr; gcaggagaatattttgcaaa 2020 ABCC9 48 3′flanking + 197 aatggagctcatgcatgtgt T/G ttcaaatatatacatgcaaa 2021 CES1 1 5′flanking − 983 tatttccttagccagcggta T/C cacagtgtgtttagtgaatt 2022 CES1 2 5′flanking − 814 tcacattgccttgacatcac A/C cctactgctcctccacccta 2023 CES1 3 5′flanking − 248 agtcctgcaagggtgacacc G/&Dgr; ttatgccacaagcagttggg 2024 CES1 4 intron1 + 22 tgagtccttctgaagtcaaa T/&Dgr; atgcggggcactttttgaaa 2025 CES1 5 intron1 + 30 tctgaagtcaaatatgcggg G/T cactttttgaaatccttgtt 2026 CES1 6 intron1 + 1662 aagggaatccctgagctgag C/A atgaccagcccagtggtttc 2027 CES1 7 intron1 + 1726 cctccctgaagtcctcagca A/C tcttagctggttcctcgccc 2028 CES1 8 intron1 + 2716 tgcttccaaggaagttcatc T/G cagtattatttgtaattagc 2029 CES1 9 intron1 + (2747-2749) tgtaattagcaacaacaaca AAA/&Dgr; gaaaagaagctaaatattga 2030 CES1 10 intron1 + 3288 ttatttgtccattaaagaaa A/&Dgr; ctcaagcgcttagcctggca 2031 CES1 11 intron1 + 3691 gagaatatgggacacccctt T/G ttcatcctctcatccagcat 2032 CES1 12 intron1 + 3819 tccttcttgcatttattttt A/G gctggatgtttttatgcctc 2033 CES1 13 intron1 + 3880 aaccagctcaatgggttagg G/A aggacattgatcgtcatccc 2034 CES1 14 intron2 + 74 gagtcaaggcagtcccctga T/C gggctgatcctttgctctgg 2035 CES1 15 intron2 + 552 atggaaggtgtgtccattca C/A cctggccaagctgggaagaa 2036 CES1 16 intron2 + 885 cagtattttagatggtaaag T/C attatgatgtaatatattgt 2037 CES1 17 intron2 + 2001 ttggcatgtcagggctgcaa G/A actcatgtagaaatcactcc 2038 CES1 18 intron3 + 2119 cgctgagtgcatgaatagtc T/C aggcttgagggtgatgggag 2039 CES1 19 intron4 + 127 taaggcatccaagccccttc G/A taattggacactacctaccc 2040 CES1 20 intron4 + 347 tctgtcatgacacttagcag T/G cagcccagcaggtgaaggtt 2041 CES1 21 intron4 + (1984-1985) tgtggtcctgaaggtcctgc (C) tgacatctctgctccccacc 2042 CES1 22 intron4 + (1984-1985) tgtggtcctgaaggtcctgc tgacatctctgctccccacc 2043 CES1 22 intron5 + 766 gaggtgggcagagggtcagc T/C cactactggattcctcagtc 2044 CES1 23 intron5 + 825 ggagtagatctagcctggaa T/G agcgagtgagtcactgaccc 2045 CES1 24 intron5 + 828 gtagatctagcctggaatag C/T gagtgagtcactgaccccac 2046 CES1 25 intron5 + 868 ctcctgagcatgaactctcc T/A cccctccactctgctgtcag 2047 CES1 26 intron7 + 68 acttcttcatttcagctgtc C/G tcttgcccagggacagtttc 2048 CES1 27 intron7 + 681 cctccaaaatcaacaatcca A/G ttatcgcctgtctgctagtt 2049 CES1 28 intron7 + 885 aggaactatccaaagagaaa T/C acattcatatacttcgcagg 2050 CES1 29 intron7 + 2151 gtcgtgtaaactgaaaatct C/G aggagttgatggcttcaggc 2051 CES1 30 intron7 + 2470 atatagatatacgaattcac G/A gagtgatgcgggaagaacct 2052 CES1 31 intron8 + 128 cgtgtttgtttctgaggccc A/C gagaggggtagtgactcacc 2053 CES1 32 intron8 + 2618 cctgatggcaacacatgagt T/C gggctctctctaatctgtga 2054 CES1 33 intron8 + 2665 aaaaattattcatcaaaggt G/A aaacctaaaattaagacatg 2055 CES1 34 intron8 + 3785 ccatggcgcatggccatgcc G/A gtctatggtactggtctcac 2056 CES1 35 intron8 + 3791 cgcatggccatgccggtcta T/C ggtactggtctcaccctcag 2057 CES1 36 intron10 + 222 gtgggctggagaagctgcat C/T gctcacccggggctggtggt 2058 CES1 37 intron10 + 230 gagaagctgcatcgctcacc A/C ggggctggtggtcacttttt 2059 CES1 38 intron11 + 1177 ctagcaggtgccctgacaca C/G ctttgcacaggaaggggcag 2060 CES1 39 intron11 + 1311 gccctatgctctgcgtctga A/G ctatatatagagttcccatc 2061 CES1 40 intron11 + 2025 ttctcatttgggatgctaag A/G ttaaaaattagcataacact 2062 CES1 41 intron11 + 2029 catttgggatgctaagatta A/C aaattagcataacacttcca 2063 CES1 42 intron11 + 2317 cattcacaaaagctctttct T/C ctatggttggctctgagttt 2064 CES1 43 intron11 + 3887 caaatatttggctctaattc C/T gcttccacctcagacagcta 2065 CES1 44 intron12 + 2311 gcgcctctgggcatctcact G/A tgcatgcttaggcgccttgc 2066 CES1 45 intron12 + 2331 gtgcatgcttaggcgccttg C/G ggctctgttgtttttcagaa 2067 CES1 46 3′flanking + 71 aacggtgatgaaagaggcga T/C gtgagaaggaaggtggcttt 2068 CES1 47 3′flanking + 362 ttgcatggcacttactgacc G/A ttgcacaggcctgcaacacc 2069 CES1 48 3′flanking + 581 atttctggattctgttagta C/T gtagaaagctctaaagcatg 2070 CES1 49 3′flanking + 1348 aaatctgctgctgggagaga G/C agcaaagcatgcagatcaac 2071 ABCB4 33 intron22 + 767 acagtgggctgatgcataga A/&Dgr; cctgtagcaatccaccagca 2072 AADA 23 intron2 + 46 tgtcactgaggtagttcgca A/G acattttactaagtcttcag 2073 AADA 24 3′flanking + 208 aatgctaaaaaaaaaaaaaa A/&Dgr; tcactgtggtactttgggga 2074 ABCA4 1 5′flanking − 1005 tgccatcataagcagaaact A/C tctctctcttcttggaagct 2075 ABCA4 2 5′flanking − 819 gtctagagtctttcaaagag A/T acacattctgagatttgagg 2076 ABCA4 3 5′flanking − 680 agcaccaccccattgcaggg C/A tggaatgacagtaatgggcc 2077 ABCA4 4 intron1 + 208 tgcccttcccaggaagatgt G/A tttctctgtcctcagccaca 2078 ABCA4 5 intron1 + 234 ctgtcctcagccacatgaaa A/G tcttttgcctaccgtgcctg 2079 ABCA4 6 intron1 + 510 agctcacgatcaagtcacag T/C ttaactggacacattatttt 2080 ABCA4 7 intron1 + 1527 gcttaacaaccagcataaaa G/A agagcagcatgggacacgct 2081 ABCA4 8 intron1 + 2077 caggactgtagctgctggcc T/C aaaatgagcccattcctgtg 2082 ABCA4 9 intron1 + 2174 ccctctcaatctggcctttc G/C ctggcatgggtgggcgactc 2083 ABCA4 10 intron1 + 2246 gctcccagggagatggagcc A/G ctcgggctgagggccttggc 2084 ABCA4 11 intron1 + 2364 ttctgtctggcacgcctccc G/A atggctccccacctgctacc 2085 ABCA4 12 intron1 + 4243 ctccctggggtatgcctgta C/G gcagttaagcgtcaaggaca 2086 ABCA4 13 intron1 + 4287 atgccgctctggggagggga A/C gctgagcatgattttggaag 2087 ABCA4 14 intron1 + 4309 ctgagcatgattttggaagc C/T ggcagaagaggctattgtga 2088 ABCA4 15 intron1 + 4416 tgcagcaaccgcccccgccc C/T ccgccaaaaacaaacacact 2089 ABCA4 16 intron1 + 4996 tttacccctggaacaggcag G/A ccaagctggctggtcccctc 2090 ABCA4 17 intron1 + 5007 aacaggcaggccaagctggc T/C ggtcccctccctgatacaca 2091 ABCA4 18 intron1 + 5080 gtgtgtggctggtttcttag C/G aagcaccatggttccaagtt 2092 ABCA4 19 intron1 + 5152 gggagatgaacgtaagtgga G/A ggcaggcctacaaggttgca 2093 ABCA4 20 intron1 + 7110 ccactggatctgcttttgga A/G tcaagagtccttaagctcca 2094 ABCA4 21 intron1 + 7290 gatttttgttggctttgcaa T/A ggatcacagtcatttattca 2095 ABCA4 22 intron1 + 7483 tctgagcctctttccttaac T/C gcagagtgagtggctacaga 2096 ABCA4 23 intron1 + 7497 cttaactgcagagtgagtgg C/T tacagagaaatctttactac 2097 ABCA4 24 intron2 + 1067 tcaagcagcagcagcaactg C/A gtggagtcttcttgaactaa 2098 ABCA4 25 intron2 + 1106 aacactcctatgcccctctc G/A gcacaaaatgacgtgtcccc 2099 ABCA4 26 intron2 + 1119 ccctctcggcacaaaatgac G/A tgtccccccttgcttcccct 2100 ABCA4 27 intron2 + 1243 cacccagcacagggactggc A/T cacatgagatgctcctgctt 2101 ABCA4 28 intron3 + 26 tgttgagatccctaccatgc A/G ggggaggaagttgcacaccc 2102 ABCA4 29 intron3 + 101 agcatggagcactgagtgtt C/T ttgtggctttgctgagcccc 2103 ABCA4 30 intron3 + 330 tgcttgggtggagtgaatca T/C tgtaggagaaaaactcagtt 2104 ABCA4 31 intron3 + 470 tgaagtcaggtttacaaagt C/G aagtttacttcttgggagaa 2105 ABCA4 32 intron3 + 634 tgaaaaccaatgacccctct T/C ccaagaaaaatggccacata 2106 ABCA4 33 intron3 + 1016 ccttgggggagctcagtatg A/G ttcttccaggagaagcctgc 2107 ABCA4 34 intron3 + 1554 gaaagttgggtttcatgttt T/C gcactcacattatgagtgaa 2108 ABCA4 35 intron3 + 1686 ctagacattctcacagagcc A/G agggcagcaaggcggggctc 2109 ABCA4 36 intron3 + 1823 ttcacctctctccatggacc A/G gtctcccctgctcctcaatg 2110 ABCA4 37 intron3 + 1938 caaattcctgggaacaaatc G/A ggttgacccagctttattct 2111 ABCA4 38 intron3 + 1951 acaaatcgggttgacccagc T/G ttattctccctgtcccatca 2112 ABCA4 39 intron3 + 2063 ggctgtcagagcctacctgc G/T tgaatgggtggaagggcagg 2113 ABCA4 40 intron3 + 2079 ctgcgtgaatgggtggaagg G/A caggtctcagagaattgggt 2114 ABCA4 41 intron3 + 2186 agacacacagagcatgggac C/T gagaggcgagcagaccctgc 2115 ABCA4 42 intron3 + 2214 gagcagaccctgccaaaact G/A ggagactgaatagatcgctc 2116 ABCA4 43 intron4 + 2717 cgtgcttctgcacagccacc T/C gggaaggtatgccgatggtt 2117 ABCA4 44 intron4 + 2802 attctcagcagggaggatta A/G tggtaaaagcccaggaatgg 2118 ABCA4 45 intron4 + 3182 cccccagagccacagcagcc C/G tgtctcctgggtggtcttgt 2119 ABCA4 46 intron4 + 3515 agtataataaaagcaggagc C/T atagcccccaactctcaaga 2120 ABCA4 47 intron4 + 3907 aggggagtgacagtgggcac C/A actctcagggaacccattac 2121 ABCA4 48 intron4 + 3923 gcaccactctcagggaaccc A/G ttactgtgagagaagccact 2122 ABCA4 49 intron4 + 3952 agagaagccactgtgccact G/C tgtggtcgaacttcaagacc 2123 ABCA4 50 intron4 + 4125 ggctgtccagcacacagggg C/A aggcctcttggccactgggg 2124 ABCA4 51 intron4 + 4637 aatcacttgccccaaggtca C/T cttaactgttaggtgttctt 2125 ABCA4 52 intron4 + 5319 acctctaggggctcccagag A/G ccccaagaacagaaccttcc 2126 ABCA4 53 intron6 + 2266 cacccttgcagacctcagac G/A ggtcctgggggcttgctttc 2127 ABCA4 54 intron6 + 2857 ccagaggagaaagctctgcc G/A tagtcggcctcagttaacca 2128 ABCA4 55 intron6 + 2861 aggagaaagctctgccgtag T/C cggcctcagttaaccacgga 2129 ABCA4 56 intron6 + 3078 gcaggcattaaaatgggact T/G tgcctttattgctcctgggc 2130 ABCA4 57 intron6 + 3375 ttaaatgccaaatgagttct C/G attaacaaagaaagagggaa 2131 ABCA4 58 intron6 + 3412 ggaaaatctcagtaaaccac C/T gtgacggcatctacccactt 2132 ABCA4 59 intron6 + 4635 ctttcgggtggatattgcta C/T gtcaagtgtctgggaaagcc 2133 ABCA4 60 intron6 + 5576 ccactaatatgcattcttta G/C taagcggtctcaatatacac 2134 ABCA4 61 intron6 + 5825 aaaaagcattttgctcttat A/G aaagcacagcctcttttgag 2135 ABCA4 62 intron6 + 5916 cccagacaacccaagcagag A/G cctcttagggccggaatcat 2136 ABCA4 63 intron6 + 6993 agcacaggatcaaggcctaa A/G ggccccttagactgacctca 2137 ABCA4 64 intron6 + 7242 ttgccattttgatctgtgac T/C tttttttccagaaatagttt 2138 ABCA4 65 intron6 + 7454 atggagggctccctcgggac T/C aggcagtattcagagatgta 2139 ABCA4 66 intron6 − 264 aaacagcaattagaatcact T/C tgaaatagtgatagtattta 2140 ABCA4 67 intron6 − 86 aggagggggggagttttcaa A/G catataggagatcagactgt 2141 ABCA4 68 intron6 − 32 tatacctacaaacatatata T/C atttaaaaaattgttttact 2142 ABCA4 69 intron7 + 828 gatgtgggaaagttagagaa G/C agcccattgtactaatgctc 2143 ABCA4 70 intron7 + 1019 aggcttcttgactgtctaga T/C agcaagtctaatcatttgtg 2144 ABCA4 71 intron8 + 374 gtaaacacggctgtgggatg C/T ttttacaaacacaatatcgt 2145 ABCA4 72 intron8 + 874 tgatgagcttgttattggtg G/A ggtacagcctattaatttag 2146 ABCA4 73 intron9 + 605 tcgtgtctctgtcttgatct C/T tgtctggttttaggccaact 2147 ABCA4 74 intron10 + 1268 aacttttgaagaactggaac G/A cgttaggaagttggtcaaag 2148 ABCA4 75 intron10 + 1269 acttttgaagaactggaacg C/T gttaggaagttggtcaaagc 2149 ABCA4 76 intron11 + 5236 ggcctggcacagatgaaata C/T tattcagagttcacagtgta 2150 ABCA4 77 intron11 + 5270 cagtgtattttcatttcata A/G tatatttgattttcaggtct 2151 ABCA4 78 intron11 + 5687 atcatgtaatgtactttaga C/G tcagatatataaatatttgt 2152 ABCA4 79 intron11 + 7136 gacttcccaacttaccttag T/C ggagctgtagtcacatagaa 2153 ABCA4 80 intron11 + 7180 acgctcataaatgcttctct G/A ggctgtaaaggttgaatttt 2154 ABCA4 81 intron11 + 7701 gttagacgcaggcattacct C/T gtggctttgccccagtgtga 2155 ABCA4 82 intron11 + 8073 gggatgtttgcccacatcca T/C tggcatttctcaaaaggaac 2156 ABCA4 83 intron11 + 8586 cagctgcctgcgctggagag G/A gctcaaacctcttccgccag 2157 ABCA4 84 intron11 + 8893 agcaaagatgccctttgact C/T cttttcccactagtggtgct 2158 ABCA4 85 intron11 + 9257 gaatgaggtcacttgctgca T/A ggcaggtggcttccccatga 2159 ABCA4 86 intron11 + 11234 cccaaataattttgtttttc G/A ttttaggaattaaatttcag 2160 ABCA4 87 intron11 + 11641 aagaaacaaacatttattga C/G aacttttggtgtgtgacctg 2161 ABCA4 88 intron11 + 11808 tggtatttcttaaagaaata C/T caattccatttccttttaac 2162 ABCA4 89 intron11 + 11923 aagatcattattaatatctc A/G tcagcgtggtgtcacttaag 2163 ABCA4 90 intron11 + 12055 tgagaacattacatgggacc T/C gcccccagggcatggaggct 2164 ABCA4 91 intron11 + 305 tcaccctgtggtcgggaggt G/A tgagtgagctatccaagccc 2165 ABCA4 92 intron11 + 1461 ttgggtttcagtgtcagcat G/A tagctgtctactcagatccc 2166 ABCA4 93 intron12 + 1237 aagggcaccaaagttctaag A/G gatgaggggaggagctgagc 2167 ABCA4 94 intron13 + 1269 ggagctgagccccttgtcct T/C atctaggtttcccttgttct 2168 ABCA4 95 intron14 + 1309 ttcccatccctcagtctgct T/C cttttcccagtaccaacatg 2169 ABCA4 96 intron14 + 2979 tcacctgtgtgggtagcaaa C/T ctcagaaaatcaagtataga 2170 ABCA4 97 intron14 + 23 gagtcctttaaaacacaaat C/G ttaatgtttgaaatcaactc 2171 ABCA4 98 intron14 + 204 tgctgggccctgtgtgatca T/G gaatggctgatcatggatga 2172 ABCA4 99 intron17 + 715 gggactcccctagagctgaa G/A tactctcccatctgtttgtt 2173 ABCA4 100 intron17 + 1282 ggaagatgaagaacctaagc C/T gcttccagaaattcatgagg 2174 ABCA4 101 intron17 + 1531 gtctaccccttaggaccatt G/A taagagtacattgaggtaat 2175 ABCA4 102 intron18 + 1802 actgctcacccaggaggcaa C/A gcctcgagtcatgcaccgaa 2176 ABCA4 103 intron18 + 195 acagattattccattgtatg C/A atgaactatgtaagccatcc 2177 ABCA4 104 intron19 + 755 ctggctgccgctggggtttc C/T tatgtccatccacggggagg 2178 ABCA4 105 intron20 − 497 ctgagttaggtctagatggg G/A acactttggatgaatgagga 2179 ABCA4 106 intron23 + 702 tatcaaatacaactcagacg T/G cagtctcctggcccctttga 2180 ABCA4 107 intron26 + 156 cctgctttccaaacccttat C/T ttgattcttggtaacatgaa 2181 ABCA4 108 intron26 + 385 tttaaagaacagtgagtcac G/A tgacttgctctttgaaatgc 2182 ABCA4 109 intron27 + 299 gacatgccatcagaccactg C/T gagtgttcaggcagcctacc 2183 ABCA4 110 intron27 + 168 ctccttccacacttgtgtgc A/G gggacattcactacctccta 2184 ABCA4 111 intron28 + 497 gctgtcaataaggaccaaaa C/T agactaatttcaaattcctc 2185 ABCA4 112 intron29 + 587 agctgctaggaataaaaggg G/A agacaaaacgatccacaagc 2186 ABCA4 113 intron29 + 577 aataaaaagggagacaaaac G/A atccacaagctagagatggt 2187 ABCA4 114 intron29 + 2494 aatcacagctcatctgctgc A/G tcctagggatcccaaaagaa 2188 ABCA4 115 intron29 + 2169 aatgtaacagccaaagtcct A/G gaaaaaggcaagccagttcc 2189 ABCA4 116 intron30 − 535 ctaactgtgaattatcatct T/G tgatcactgccctttgagat 2190 ABCA4 117 intron30 − 957 gagttctcagcagcaaatct C/A cagtatgaaattttggattt 2191 ABCA4 118 intron31 + 445 tccagaggtttagaacctca C/T caagtgggactctaggagcc 2192 ABCA4 119 intron31 + 48 aggatttttgacttgcttaa C/T taccatgaatgagaaactct 2193 ABCA4 120 intron32 + 129 tgtttagtcaggcacatatg A/C acatccgactttcaaataag 2194 ABCA4 121 intron33 + 209 tctccccaacatttatgtgg C/A aagtaagtttacatttggtt 2195 ABCA4 122 intron35 + 3209 ttgaggcctccacaccccac G/A gcaggttgccccctgaggaa 2196 ABCA4 123 intron35 + 3542 cttggcagggaggtagggca T/C ggggtggggtaggaggacta 2197 ABCA4 124 intron36 + 304 ctggggcagccattccccca A/G cccctcacccagctctgact 2198 ABCA4 125 intron36 + 525 taaatttgaatgagtaatta A/G tccatctcggcctcagtttc 2199 ABCA4 126 intron37 + 766 tgttgcaggctggagaaccc T/G cctatgaattgtacagggct 2200 ABCA4 127 intron37 + 856 aaaaccccatgaagtggtca A/G ggcaggcatcattatctcca 2201 ABCA4 128 intron37 + 62 tagtagagtatgtgttggtc G/A agcagagccaggggcaagca 2202 ABCA4 129 intron37 + 761 tccttgggcaagttaatctt G/A atgaagagactgggtgttct 2203 ABCA4 130 intron38 + 1315 cagagtcagactctggaaag G/T cggggggataagaacacagc 2204 ABCA4 131 intron38 + 1316 agagtcagactctggaaagg C/A ggggggataagaacacagcc 2205 ABCA4 132 intron38 + 1525 ccaacatttgctaagcaccc G/A ccttcaaaaacctggtattt 2206 ABCA4 133 intron38 + 1561 gtattttcatgtaaattatc C/A gatacacagctgctatggaa 2207 ABCA4 134 intron38 + 1562 tattttcatgtaaattatcc G/A atacacagctgctatggaaa 2208 ABCA4 135 intron38 + 1674 ccagctgaacaccacgtgcc G/A ggtgtgtgctgatataaaca 2209 ABCA4 136 intron38 + 2867 tgcctggctagacaaagggg A/C agctcccgcccactagaaac 2210 ABCA4 137 intron38 + 2874 ctagacaaaggggaagctcc C/T gcccactagaaacttgcagg 2211 ABCA4 138 intron38 + 123 gaggggaccttgttgggctg G/A aggtgtcctgccagctggag 2212 ABCA4 139 intron40 + 1904 gacactgtacagccagccca A/C tcctgaccccttttcttcat 2213 ABCA4 140 exon41 + 5814 ggaaataaaactgacatctt A/G aggctacatgaactaaccaa 2214 ABCA4 141 intron41 + 122 atttggttcccagttttatg T/G agggtcatcatccctgtgtt 2215 ABCA4 142 intron41 + 287 tctgcagagcatgggtcagc C/T tcgagatgtctcagtactca 2216 ABCA4 143 intron41 + 411 cctcttcccctccttgctct C/A accctgtctcagttctcagt 2217 ABCA4 144 intron41 + 443 gttctcagtccggtttcttc G/A tatcttgcagatttatccag 2218 ABCA4 145 exon42 + 5844 cgtatcttgcagatttatcc A/G ggcacctccagcccagcagt 2219 ABCA4 146 intro43 + 328 tttgtagcctattcctataa A/G aatgcaccattgcttcccat 2220 ABCA4 147 intron43 + 345 taaaaatgcaccattgcttc C/G cattacctccctccacacat 2221 ABCA4 148 intron43 + 370 acctccctccacacattttt A/G caaaacgtttcagggagttt 2222 ABCA4 149 intron43 + 376 ctccacacatttttacaaaa C/T gtttcagggagtttactgag 2223 ABCA4 150 intron43 + 670 ttaaacagactggtccccta T/C gggcaggacagagaggatga 2224 ABCA4 151 intron43 + 701 gagaggatgagctctcactc A/G tctgcctctttcctggctgc 2225 ABCA4 152 intron43 + 822 gttaggtgctgctgacatct G/A tccagcatctgcttgactgg 2226 ABCA4 153 intron43 + 915 ggcaggacgagtcctgagca C/T gcttcactggctcagacagg 2227 ABCA4 154 intron43 + 1242 actgagctggacgctagaaa G/T aaactataggcttaagacac 2228 ABCA4 155 intron43 + 1671 tagagaagtttacttccatc G/A ggacacatgcatcttttcta 2229 ABCA4 156 intron43 + 2036 ttgaaggatactcagtaatt G/A ctttttttcttgcagtattt 2230 ABCA4 157 intron45 + 176 gtgtttggttcacacagctc C/T ggagaaaaacaagtcacggc 2231 ABCA4 158 intron45 + 193 ctccggagaaaaacaagtca C/T ggcacagccttgacttggga 2232 ABCA4 159 intron47 + 238 cccaagtctctggatggggc A/G tctgatcaggatgcatgcag 2233 ABCA4 160 intron47 + 269 atgcatgcagagcctggctg G/A gatgagggagggctgctacc 2234 ABCA4 161 intron47 + 326 accacttatctcaacagatc C/G gggacctgtggcctatttac 2235 ABCA4 162 intron47 + 715 aagtcactaagctggttggt G/A ggaggaacagcacataaccc 2236 ABCA4 163 intron47 + 734 tgggaggaacagcacataac C/T caccttatctatgctgaggt 2237 ABCA4 164 intron47 + 931 ggacactgcatagatatcta T/C agaaatagcagcatgtcagg 2238 ABCA4 165 intron47 + 1260 acactctctggtggaccatc A/C ctcatccaagagagggtaac 2239 ABCA4 166 intron48 + 1663 tctcgctcttctcttacctc T/C aggtgtttgtaaattttgct 2240 ABCA4 167 intron49 + 127 agagagccccacccacacca C/T ggtccctaccaagtccccac 2241 ABCA4 168 intron49 − 1545 gcagttaattccaaactttt C/A tcccttattggatgagatca 2242 ABCA4 169 5′flanking − (1441-1400) gtaaatctcagttgaatcag (TCA)14-15 atttttcagtctggttcctg 2243 ABCA4 170 intron1 + (4712-4720) gaggggcggggactataggc (A)8-10 cagcctaattcaaggatgag 2244 ABCA4 171 intron2 + 7295-7304) ttgttggctttgcaatggat CACAGTCAT/&Dgr; ttattcactc 2245 attcattcac ABCA4 172 intron3 + (951-952) cctgtccatcagactcttct TT/&Dgr; acctctccccgaggagccca 2246 ABCA4 173 intron4 + (2642-2653) cctgggtgacagagcgagat (A)10-12 tagcatgagatattattact 2247 ABCA4 174 intron6 + 5202 cacaaagcatctgacacccc C/&Dgr; agactaggagaaggtctgtc 2248 ABCA4 175 intron6 + (3029-3044) cactaaaaacaaaaatttac (A)16-18 cttttatggatttacaaaga 2249 ABCA4 176 intron6 + (5138-5139) ttcatgacagatcagatgtt (G) cttttatggatttacaaaga 2250 ABCA4 176 intron6 + (5138-5139) ttcatgacagctcagatgtt cttttatggatttacaaaga 2251 ABCA4 177 intron6 + 5985 tttccttcttcaaacccccc C/&Dgr; agactaggagaaggtctgtc 2252 ABCA4 178 intron6 + 6094 gggacggacagaaaaagacc T/&Dgr; agtttctgttgagccaaaga 2253 ABCA4 179 intron6 − 161 tattttttcaattaaataaa A/&Dgr; gagttttttgtttctaaaag 2254 ABCA4 180 intron7 + (809-810) gggccgagtatgcacactga (TG) tgtgggaaagttagagaaga 2255 ABCA4 180 intron7 + (809-810) gggccgagtatgcacactga tgtgggaaagttagagaaga 2256 ABCA4 181 intron8 + (472-484) atcttccccacctttcacta (T)10-13 ggtcttctatggggtaaagg 2257 ABCA4 182 intron9 + (48-71) gtaccctggacctcccagaa (GT)11-13 gagagagatgtgccttcctg 2258 ABCA4 183 intron9 + 554 ataggggcagaaaagacaca A/&Dgr; ccaaaagttctctctcactt 2259 ABCA4 184 intron10 + 11 catgatcagagtaagggggg G/&Dgr; ttggaggatggggaggggcg 2260 ABCA4 185 intron11 + 4242 ggagaggaaatgatgttagt G/&Dgr; cctcctgtaaataggcccag 2261 ABCA4 186 intron11 + (13743-13753) tgctcttttgtgggtaatgg (T)9-11 cctcttccaggagaagaaaa 2262 ABCA4 187 intron13 + (636-637) cggggtggagggttgggagg (G) ctcatttgtcattatagatg 2263 ABCA4 187 intron13 + (636-637) cggggtggagggttgggagg ctcatttgtcattatagatg 2264 ABCA4 188 intron18 + (569-570) tgctgccctcatcttctctc TT/&Dgr; aaactagttctgtatttctc 2265 ABCA4 189 intron20 − (304-297) tataacctgacttttttttc (A)7-9 ggattgcttttttaaacata 2266 ABCA4 190 intron22 + (1236-1246) gctgaattagttcccttggg (T)9-11 agttaactcctgatttttgc 2267 ABCA4 191 intron26 + (4626-4635) gataatcaatgctgtaaggg (A)9-10 tggcattagagatccagacc 2268 ABCA4 192 intron33 + (115-116) taaaaccgtcttgtttgttt GT/&Dgr; ttacatggtttttagggccc 2269 ABCA4 193 intron36 + 1078 taagcagctatcacttaaca (T) cagccattccccaacccctc 2270 ABCA4 194 intron37 + (290-291) ccttgaccaaagcctggggg (T) cagccattccccaacccctc 2271 ABCA4 194 intron37 + (290-291) ccttgaccaaagcctggggg cagccattccccaacccctc 2272 ABCA4 195 intron38 + 986 ataaaaagaggggggaaaaa A/&Dgr; gaagacagtcgctgcagggc 2273 ABCA4 196 intron38 + (1206-1210) gtggaccaactgagactgact CT/&Dgr; ttccagatcttgttagggtt 2274 ABCA4 197 intron38 + 1322 actctggaaaaggcgggggg G/&Dgr; ataagaaaacagccccagca 2275 ABCA4 198 intron38 + 3107 gggccccatctgctgaagag A/&Dgr; ggggggtggggtttgccccc 2276 ABCA4 199 intron40 + 182 ttttctccaataatacaagt A/&Dgr; gaggatcgggttaaaatagg 2277 ABCA4 200 intron43 + 330 tttaattggcacagccatgc A/&Dgr; tgcaccattgcttccgatta 2278 ABCA4 201 intron43 + 1354 tttaattggcacagccatgc C/&Dgr; tttggtggcttttgtcattg 2279 ABCA4 202 intron47 + (1305-1306) gatcatgctgaaggagaaag AAAG/&Dgr; caccaatggcccaagcccta 2280 ABCA7 1 5′flanking − 1588 agaatgttggccccctccgg C/T tcctgcatggtctgcagaag 2281 ABCA7 2 5′flanking − 1584 aatgttgggcccctccccgt C/T ctgcatcctctgcagaagcc 2282 ABCA7 3 5′flanking − 1180 ggccagtgagtgacgggcag G/A tcgccaaaatagcagcgtga 2283 ABCA7 4 5′flanking − 480 agagctggggtcgtgcctcc A/G gctgggcaactgcctgtctc 2284 ABCA7 5 5′untranslated − 9 gtgtgtcacgtcccctgccg A/G gtctcaccatggccttctgg 2285 ABCA7 6 intron5 + 81 ccccgggccaaggacatccc G/A ttccaggcatccagtctgtc 2286 ABCA7 7 exon6 + 583 cagcttgttggaggccgctg A/G ggacctggcccaggaggtac 2287 ABCA7 8 intron6 + 183 gccggagggtcacggaaact A/G tttgaagaagtaggagttag 2288 ABCA7 9 intron8 + 164 tgtggaggatcagaggcaca C/T gcaggagcaaggcagagggg 2289 ABCA7 10 exon8 + 955 accggaccttagaggagcta A/G ccctgctgagggatgtccgg 2290 ABCA7 11 intron9 + 421 tttttttttttttttttttt T/A taagagatggagtctgactc 2291 ABCA7 12 intron9 + 453 gttgcccaggctggactgca G/A tggcgagatcttggctcact 2292 ABCA7 13 intron9 + 467 cccaggctggactgcagtgg C/T gagatcttggctcactgcaa 2293 ABCA7 14 intron9 + 488 gagatcttggctgactgaaa C/T ctccgcctcgtggattcaag 2294 ABCA7 15 exon10 + 1184 cgcacacgctgatgtgggaa A/G actggtgggcacgctgggcc 2295 ABCA7 16 intron10 + 70 gagtgacggaggtgagggac T/C gtccacctgcggggtctgtt 2296 ABCA7 17 exon11 + 1306 cctgggccccggccacgtgc G/A catcaaaatcagcatggaaa 2297 ABCA7 18 intron12 + 118 cccttcctgctgagcgccgg T/G ttacaaaaatccacgtgacc 2298 ABCA7 19 exon13 + 1824 accttcctgctgagcgacgc A/C ctgctggttatggtgctcaa 2299 ABCA7 20 intron13 + 56 ggtgcgctggagggtgacag A/G gaggggcggcaccacgtcgg 2300 ABCA7 21 intron13 + 78 ggggcggccccacgtgggtg C/A gcgccaccaggccaatccag 2301 ABCA7 22 exon14 + 1851 cgttgcctctcacagctggg A/G gacatactcccatacagcca 2302 ABCA7 23 exon16 + 2153 cgagggcgcgcagtggaaca A/C agtgggcacccggactacgg 2303 ABCA7 24 intron16 + 34 ggcggggctccgggccgggt C/G gcaaatgctttgcgggaggc 2304 ABCA7 25 intron16 + 8 ctggacccaaagggtgaggc A/C ctacgaggcttaatagctgg 2305 ABCA7 26 intron16 + 161 tcccgcagcttttataggcc C/T aggcccagcaggtaacggat 2306 ABCA7 27 exon17 + 2386 caccccatctctgcagtgct G/A gtagaagaggcacgggccgg 2307 ABCA7 28 exon17 + 3427 accggcctgagtcctggcgt C/A tccgttcgcagcctggagaa 2308 ABCA7 29 intron20 + 168 cgagacagtaagagttgggg A/G tagacagaggttcccctgga 2309 ABCA7 30 exon21 + 3027 ctgctgggagaccgtgtggc C/T gtgatggcaggtggccgatt 2310 ABCA7 31 intron22 + 1386 gggtggggcgtgagccgggg C/T tacctgaagcaaccctttgt 2311 ABCA7 32 exon23 + 3417 gggatctccgacaacagcct G/G gaggaggtgtgaggcgtggg 2312 ABCA7 33 intron23 + 147 ggagctctggtgactaagat G/A taactcgggaaggcctgggg 2313 ABCA7 34 intron26 + 3628 gctggcctagacgtaaccat A/G cggctaaagatgccgcaaca 2314 ABCA7 35 exon29 + 4046 cccagcctgccagtgtagcc G/A gcccggtgccaggcgcctgc 2315 ABCA7 36 intron30 + 81 ccccctgggagctataccgg C/A ccccccggctctcagctcac 2316 ABCA7 37 exon31 + 4238 ctgcctgcatggccccacag A/C tacggaggcttctcgctggg 2317 ABCA7 38 intron32 + 1 caaggagcagctgtctgagg G/C tgcactgtgagtccctccac 2318 ABCA7 39 intron33 + 54 ccactgcttgacactgcaat G/A tatggcaccttgtaggcagg 2319 ABCA7 40 intron34 + 245 cagtactttgggaggccgag G/A caggaggactgattgtggcc 2320 ABCA7 41 exon36 + 3057 ggtgagcggatcttgaaaaa A/G ggtcttccttatgttccgag 2321 ABCA7 42 intron38 + 66 ggcccactcacctttgtgca A/G gaactgcaatctcccaggta 2322 ABCA7 43 intron40 + 154 ctctaactccacacacaaaa C/G caggctctgagacaaacctg 2323 ABCA7 44 intron40 + 277 ctgagcccccggagccacca T/C aaccagcgtggcccgggaac 2234 ABCA7 45 intron41 + 3392 gtggcccgggaacccagtgc T/C gagcacctgagcatgggata 2325 ABCA7 46 intron41 + 286 ctccttgactctgagttctg T/C ggccgtgcacacttgctcat 2326 ABCA7 47 intron41 + 396 tggcagttcccagtttgcag C/T cgtttcactgcctcttcaat 2327 ABCA7 48 intron41 + 391 cacactatggccctgcccca C/T accatcccagctccacccaa 2328 ABCA7 49 intron41 + 394 actatggccctgccgcagac C/T catcccagctggacacacaa 2329 ABCA7 50 intron41 + 398 tggccctgccccacacccat C/G acagctcgacccacaccatg 2330 ABCA7 51 intron41 + 1001 ccctgccccacacccatagc A/G gctccacccacaccatgggg 2331 ABCA7 52 intron41 + 1051 actcatgctggctccaccca C/T accatggccccgccccatac 2332 ABCA7 53 intron41 + 1131 tgccctgccccatgcccatt A/G tgcccctgctccacactcaa 2333 ABCA7 54 exon44 + 5985 gaagcgctctgctcgcgcct G/A gccatcatggtgaatgggcg 2334 ABCA7 55 intron44 + 201 ggcgcaggaccaggaggcgt G/C agccgggggctctgggtgga 2335 ABCA7 56 intron44 + 233 ctgggtggatttagaagaca C/T aatcaggtgtgcgttggagt 2336 ABCA7 57 intron44 + 313 agttaggggagggcctggtt A/G gtgggcggggccataggaaa 2337 ABCA7 58 intron44 + 337 ggcggggccataggaaagtg G/T cggagctgcgcgaggcacat 2338 ABCA7 59 exon45 + 6133 tggcggccgagttccctggg G/T cggagctgcgcgaggcacat 2339 ABCA7 60 exon45 + 6159 ctgcgcgaggcacatggagg C/T cgcctgcgcttccagctgcc 2340 ABCA7 61 intron45 + 27 acggcgccggggtcgggctg G/C gggaggcaggctgggggcca 2341 ABCA7 62 3′untranslated + 6580 aaggctggagagaagccgtg G/C tggtgaaaccgtgtgcatgt 2342 ABCA7 63 3′flanking + 108 caagctgagtgtgcacatac G/A ggccaagtggcgattcatag 2343 ABCA7 64 3′flanking + 376 cttacaggagcccggtgtcc C/T ggagcacaggccagggccgg 2344 ABCA7 65 3′flanking + 687 cagcagggagacttggggag G/A ggggagagagttcacactgc 2345 ABCA7 66 3′flanking + 688 agcagggagacttggggagg G/A gggagagagttcacactgcg 2346 ABCA7 67 3′flanking + 1169 cctcgacctgacccacttca C/T ggggctgcagggcgggtgat 2347 ABCA7 68 intron9 + (398-422) tgtgaactaccacgtcctgc (T)22-26 aagagatggagtctcactct 2348 ABCA7 69 intro121 + (175-184) ggggactctgagggtctggt (G)8-10 actctgagggtctgggggcc 2349 ABCA7 70 intron30 + (81-87) ccccctgggagctctcccgg (C)6-7 ggccctcagctccccttccc 2350 ABCA7 71 intron34 + (349-361) agaaagagaaagagagaaag (A)12-14 cagaaatgtgctttgggtga 2351 ABCG1 1 5′flanking − 1772 cctgggcttcagcaggggcc T/C cacacctgcaatgggtgcct 2352 ABCG1 2 5′flanking − 1754 cctcacacctgcaatgggtg C/T ctggggagagggtgcagatg 2353 ABCG1 3 5′flanking − 1450 tccaaagcccagatttggtg T/C ttttggggctcttttggaat 2354 ABCG1 4 intron1 + 4 ctggtggaggaagaaaggta G/A ggagggcggctgctttgtgt 2355 ABCG1 5 intron1 + 576 agctcaggaggtgtctggaa C/T gccacacagtgcaggagttt 2356 ABCG1 6 intron1 + 1426 aattctccttctaaacttaa A/G gaaatattttatagaaaaat 2357 ABCG1 7 intron1 + 2342 agagcctgcaatgggccgcc G/A agggacctgcccatgactca 2358 ABCG1 8 intron1 + 2399 gaggggttgacagacaggat A/G tgtctgctgtgttccagctg 2359 ABCG1 9 intron1 + 2406 tgacagacaggatatgtctg C/G tgtgttccagctgctggttt 2360 ABCG1 10 intron1 + 2911 ccctctctgtgcccactgtt G/C tcccaacaccagcctgttct 2361 ABCG1 11 intron1 + 4363 tataatagattcctagcaga A/G aacataattgtgagaggaac 2362 ABCG1 12 intron1 + 4752 gctttcagagcccattcaca C/T aagggtctcattttattagg 2363 ABCG1 13 intron1 + 5026 ccaggtctgtgggatttcag G/A ccaaaaaggagcgtagcaag 2364 ABCG1 14 intron1 + 5532 gggttaaatattccgggcag C/T gccaagtcagattatctgta 2365 ABCG1 15 intron1 + 5681 gctaaagtgcatggaaggca T/C catgaataaatcctttcagg 2366 ABCG1 16 intron1 + 6290 tcacagcagattcatgagag T/A tgaatgtttagccgccatgt 2367 ABCG1 17 intron1 + 6386 agatgctcccctccagccag C/T acattttctccctgtgagca 2368 ABCG1 18 intron1 + 6758 acctgcatggtgggtgcccc C/G ctgccttcctctactgcctt 2369 ABCG1 19 intron1 + 7029 tgggtcagattaaatatatc C/T tgaaggactaaaccgtaaaa 2370 ABCG1 20 intron1 + 7176 ttgctcacattgtgaaaaaa C/G gcaaaaagatgggttttcag 2371 ABCG1 21 intron1 + 8243 gcctgagagcgctggcagta G/A gaagggtcgccagtgtggac 2372 ABCG1 22 intron1 + 11224 tctggtttagagaggaaaat G/A ggcagcatcattttgtcacc 2373 ABCG1 23 intron1 + 11371 gggctctcttggagcccttt T/G tctctcccagccctgcgtct 2374 ABCG1 24 intron1 + 12420 gagttgtcctccaagagaat C/T tttgtatggttccttttctg 2375 ABCG1 25 intron1 + 12484 gagttgtcctccaagagaat G/T tttgtatggttccttttctg 2376 ABCG1 26 intron1 + 12955 ctggggttggtgggagccac A/G gtctcacacctattggcagg 2377 ABCG1 27 intron1 + 12985 ctcttggcaggtcgtgaaca T/C tgttcttggatttgcaaata 2378 ABCG1 28 intron1 + 20041 acatggccggcttcccttct T/C cctcggaatggcctggaatt 2379 ABCG1 29 intron1 + 20046 gccggcttcccttcttcctc G/A gaatggcctggaattcgatc 2380 ABCG1 30 intron1 + 21058 acaagacttagaatttgacc G/A tgattttaaaactattctaa 2381 ABCG1 31 intron1 + 26189 ttcttggatgtggccatgca C/T gggggcaagggtttgatgag 2382 ABCG1 32 intron1 + 27453 atcatgtggtttgggggaaa G/C ctgggaccccacttggtaca 2383 ABCG1 33 intron1 + 28098 caggaaggagacagctgctg G/C tgctgcttagagttaggcgc 2384 ABCG1 34 intron1 + 29670 ccttcagttgtaataggcag A/G aggagcgcacgaggaggctg 2385 ABCG1 35 intron1 + 29810 attgtttctcctggttttgt T/C tgtgttgactttccctttaa 2386 ABCG1 36 intron1 + 36220 cagatcccttggttgctggg C/T aggtagtaggagaggttttt 2387 ABCG1 37 intron1 + 36341 aaacagggcttgagtcctcc G/A taagggacaggagaccttcc 2388 ABCG1 38 intron1 + 36370 aggagaccttcccacatcct G/A gcaagaattcttcttttttc 2389 ABCG1 39 intron1 + 36662 cagactaaatgcacaattct G/A gattgagctgactgtattga 2390 ABCG1 40 intron1 + 36914 tgtaaaagatggagaagaac A/G cagtagtcgcttgctgtgag 2391 ABCG1 41 intron1 + 37029 tgtgactcatggcctctgcc A/G ggggactgggctggccctgc 2392 2392 ABCG1 42 intron4 + 1196 tgaaaagaaaatggatgagt G/A gaaaccaaaagagagaaaat 2393 ABCG1 43 intron4 + 1200 aagaaaatggatgagtggaa A/C ccaaaagagagaaaatgtgg 2394 ABCG1 44 intron4 + 2041 aagcagaggcttttccaccc G/A gagactcaagaagctgctcc 2395 ABCG1 45 intron4 + 2490 gtggtgaagtagagctgagc A/T cacgggggagccctccatcc 2396 ABCG1 46 intron4 + 2552 atggccttgggccactgcct G/A ctgtgccccgagccgagctt 2397 ABCG1 47 intron4 + 2822 cagcaggctccgtgctgaag T/C cacagcaagccaggcccttg 2398 ABCG1 48 intron4 + 2850 agccaggcccttggcctgcc G/A gagctggaagacccagaaca 2399 ABCG1 49 intron4 + 2919 gcctcccaggagtagctaca C/T gggacccgaaggcagatggc 2400 ABCG1 50 intron4 + 3506 ggcagcctgggctgccgaga T/C cacagcaagccaggcccttg 2401 ABCG1 51 intron4 + 3538 cgcccgccgggaagccccag G/A ggggctggagctacaagtgg 2402 ABCG1 52 intron4 + 3554 ccaggggggctggagctaca A/G gtggccttgcaggttttttg 2403 ABCG1 53 intron4 + 3721 ccagctcatgggcaggggtg C/T ggagggaaaggcacccacag 2404 ABCG1 54 intron4 + 3852 caccagagccactcagtcgg C/T caagagcgtcgcccagtggt 2405 ABCG1 55 intron4 + 3921 gaagaccagcagtcgatgcc A/G gctgggaagagggctctgcc 2406 ABCG1 56 intron4 + 3979 acccaccagccttttccaga C/T agccttccagaagctgtttc 2407 ABCG1 57 intron4 + 4291 gagccgctggagtagggtcc G/A cttgctatggctcccagggg 2408 ABCG1 58 intron4 + 4922 gaaaccaccagaaattgtgc A/G tcctctcatgtgtccattca 2409 ABCG1 59 intron4 + 4968 tattgactggacaccttctc C/T gtatggggcactgggctagg 2410 ABCG1 60 intron7 + 672 atcagtaacgggtcactaac G/A gatgctgctgagtggggcag 2411 ABCG1 61 intron7 + 840 atttcatttcctcaatgtcg T/C ctgaccagagagcgggaggt 2412 ABCG1 62 intron7 + 891 tggcccactgttgagggtgt G/A ggtgaccagaggggcctgga 2413 ABCG1 63 intron7 + 997 tgtgtcctggtttgtggctt C/G atctaggaggtgtggtggcc 2414 ABCG1 64 intron9 + 1616 ctggaggagaagacaggata A/C agtctaagacgtgctgtcac 2415 ABCG1 65 intron9 + 1630 aggataaagtctaagacgtg C/T tgtcacagagttcagggtcc 2416 ABCG1 66 intron9 + 1674 gcttccaaaggccgcatccg G/T gttgttctctgagccgagga 2417 ABCG1 67 intron9 + 1689 gcttccaaaggccgcatccg C/T gaggacggctttgcgaacgc 2418 ABCG1 68 intron10 + 446 tggctgacagtgaacacagc G/A gctgcttctccagaacttta 2419 ABCG1 69 intron10 + 581 atgcagagtttcagaagagg C/G agactcaggaagagtaaggc 2420 ABCG1 70 intron13 + 243 acccggagagccatggcagg A/C ccaagtgttctggacgttgc 2421 ABCG1 71 3′untranslated + 2370 gcctctcagctgatggctgc A/G cagtcagatgtctggtggca 2422 ABCG1 72 3′flanking + 1124 ctcagaactacatcgagtga G/A gtcagtgttgaaaacgccca 2423 ABCG1 73 3′flanking + 1252 atggggcccacagccctgcc T/C cagaagcagctttggtctcg 2424 ABCG1 74 3′flanking + 1433 gggggaagagcttgggaacc A/G tgagggctgttaggctgcaa 2425 ABCG1 75 3′flanking + 1513 tgaagggtgaactggagtag G/C tgaggattctgcagttgacg 2426 ABCG1 76 intron1 + (19909-19944) ccgatgaggaggggatgggg (CACCAGGCAGCAGACTCTGA 2427 TGAGGAGGGGAGGGGG)caccaggcagcagactctga ABCG1 77 intron1 + (19909-19944) ccgatgaggagggggatgggg ca 2428 ccaggcaagcagactctga ABCG1 78 intron1 + (25136-25137) catgaacttgcctgaccata (G) ccctgtgaggagctagggct 2429 ABCG1 79 intron1 + (25136-25137) catgaacttgcctgaccata ccctgtgaggagctagggct 2430 ABCG2 1 intron1 + 152 tcatttgaaagtgggtatgc G/A gtttaaaactgacagttcaa 2431 ABCG2 2 intron1 + 614 agctagtcataaataaatac G/A ccagagtagtaaggaagaga 2432 ABCG2 3 intron1 + 10002 cctcatgaatggtatacatg T/A cccaacatatctctttcgat 2433 ABCG2 4 intron1 + 10123 acagtggtccctttgggtgc G/A tatacccaaatccctgcata 2434 ABCG2 5 intron1 + 10768 ataggaataattgagaacag G/A gtctgaagaactctgcagga 2435 ABCG2 6 intron1 + 10791 ctgaagaactctgcaggaaa T/C gaaaatagttccctgctttt 2436 ABCG2 7 intron1 + 10792 tgaagaactctgcaggaaat G/A aaaatagttccctgatttta 2437 ABCG2 8 intron1 + 14183 tcacttaaggctttgcaggg T/G gtctaggacacagaaagaga 2438 ABCG2 9 intron1 + 14934 aaagtgtctttaaaatttcc A/G tcttgagtcagtgagctatt 2439 ABCG2 10 intron1 + 14955 tcttgagtcagtgagctatt G/T aaattcaagcaataagttat 2440 ABCG2 11 intron1 + 17251 ctgtttgggaacagcaactc A/C atcataggcagagagaaagt 2441 ABCG2 12 intron1 + 17347 atttcaaacctgtttcacaa G/A ttgttaagctcatcttaagg 2442 ABCG2 13 intron1 + 17626 gaaggtgcataacaacttcc T/G acataaagtctggagctata 2443 ABCG2 14 intron1 + 18271 aaatgaagctgctcattgcc A/G cacatttaaaaatggacttg 2444 ABCG2 15 intron1 + 18369 ctattgcttttctgtctgca G/T aaagataaaaactctccaga 2445 ABCG2 16 exon2 + 34 atgtcgaagtttttatccca G/A tgtcacaaggaaacaccaat 2446 ABCG2 17 intron2 + 36 tgtaaaaagacagcttttta A/G tttacctacagtgaacctca 2447 ABCG2 18 intron2 + 4230 caaccctaaattggagggcc C/T gggcgtggtgattgagaaag 2448 ABCG2 19 intron2 + 4518 gttgacagacttttatagtg A/C gggacactgacctgcatgca 2449 ABCG2 20 intron2 + 6278 atgtatgtaccacgtcttca T/C attcttaaaggatgacccta 2450 ABCG2 21 intron3 + 10 ggcaaatcttcgtgagtata A/G gagagtataagtaagcgttt 2451 ABCG2 22 intron5 + 421 tgccggtgagagaaaactta C/A agttctcagcagctcttcgg 2452 ABCG2 23 intron6 + 3158 actattctagttgattctag A/G ttgtcaatacaacacactga 2453 ABCG2 24 intron6 + 3203 tcctattctgttttaataaa A/G gcattgaatttaggtttgct 2454 ABCG2 25 intron6 + 3287 gtcaggctgaactagagcaa A/G caatctaaaggcaagaatag 2455 ABCG2 26 intron1 + 179 ttcatttttgtagcaccagc T/C tgttatttaggtatctttct 2456 ABCG2 27 intron8 + 5677 gcacttggactttgctttgc T/C acatacttgcattgctctgc 2457 ABCG2 28 intron8 + 5974 tatactaataaatggtgtgt A/T taagtttttatctctaattg 2458 ABCG2 29 intron10 + 1908 gacgcttatgtgcagcctat G/T ttgatgtctggaaaggctga 2459 ABCG2 30 intron10 + 2094 ccctgagggctgaggtatct G/A gattatttccagacttgcta 2460 ABCG2 31 intron11 + 20 tgtgagtaggtctttgttct A/G ggaacggggctgtccagcag 2461 ABCG2 32 intron11 + 1447 tgttcttcaaggaaagcccc C/T gtcaaagaaggaaaagaagc 2462 ABCG2 33 intron12 + 49 atgtctttagtcttgcctat G/T ggtgaagtcagttgcacctt 2463 ABCG2 34 intron12 + 1566 tatgcagttacatggacaga C/T acaacattggagaccgaggg 2464 ABCG2 35 intron13 + 40 gctctgataaggaattgttt C/T tttccttcatttcttcctgc 2465 ABCG2 36 intron13 + 1823 ttactcaagcaggcctgact C/T ttagtatttgctttttgtag 2466 ABCG2 37 intron14 + 497 ctaatgaaaacaaacaagaa T/C gaaagattgtcactgtaaat 2467 ABCG2 38 intron14 + 815 taactctttggaaacttctt A/G aaatttaaaactgtttacct 2468 ABCG2 39 intron15 + 110 ccaggggcactgaatttttc C/T gagcctacgttttctcatcc 2469 ABCG2 40 intron15 + 566 gccgcatagtcatgtgttgt T/A gtttttaaattaacttggaa 2470 ABCG2 41 intron15 + 639 aacaagaaacacttgaataa G/A ttgagaaaaaaccccgtttt 2471 ABCG2 42 intron15 + 1197 tgagtagctgggattacagg C/T gcccaccaccacacctggct 2472 ABCG2 43 intron16 + 520 catcaattcaggtcaagaaa T/C agaagattgtagcacacaaa 2473 ABCG2 44 5′flanking − (996-995) gttgggatggctacactcac TCAC/&Dgr; aaagcctgatggcccgtttc 2474 ABCG2 45 intron13 + 405 ctgctagtttattttttttt T/&Dgr; aacatttttaatttatgttt 2475 ABCG2 46 intron13 + (692-702) tcaatatgtttctgcttatc (T)9-11 aatggttacttaatcctaat 2476 ABCG2 47 intron15 + (645-650) aaacacttgaataagttgag (A)7-8 ccccgttttcacataatgtt 2477 ABCG4 1 intron1 + 84 ggcctgggtgtcccatgttc G/A gaaagtcctgcaccagtggg 2478 ABCG4 2 intron2 + 77 gaacacagaaggtattctga A/G agggcattgacccccatcct 2479 ABCG4 3 intron6 + 679 tggtgtccctcatgaagtcc C/T tggcacaggggggccgtacc 2480 ABCG4 4 intron7 + 95 ggcctcctaggggtagagat C/T tcaccgtcgcctgccttccc 2481 ABCG4 5 intron8 + 158 cttgcccttgggaagtgagt G/A tgaatctaaactgagctctc 2482 ABCG4 6 intron9 + 106 ccccagaggcattgcaacca A/G tgggtgctaggaagaaccta 2483 ABCG4 7 intron9 + 1089 aggtacacaacttaatggta C/G aagattctctgtagacctgg 2484 ABCG4 8 intron11 + 1113 acgtgagacgagataagtga T/C ggtcatatggccagggagga 2485 ABCG4 9 intron11 + 1120 acgagataagtgatggtcat A/G tggccagggaggaaggggac 2486 ABCG4 10 intron11 + 1173 gggggacagcttgaacaaga A/G tgtggaggcaggatggacac 2487 ABCG4 11 3′untranslated + 2758 gagtgacaggcacatacatg A/C gaacaggccatctcagccct 2488 ABCE1 1 5′flanking − 158 aactcagattctcggcacct C/T cagcagctggcttcgccaac 2489 ABCE1 2 intron9 + 237 ctgaaattatatgcaaattc C/T gtagctttataggaagcaga 2490 ABCE1 3 intron9 + 4203 ttgtgtaggaagctgataca T/G taatttgacatatgagatgt 2491 ABCE1 4 intron10 + 1811 ccaagaaacttcagctttct C/T ttcacttaaatataggaaac 2492 ABCE1 5 intron17 + 2301 atatccagaaacagatggta T/C gtgcagaacaggttgtacag 2493 ABCE1 6 3′untranslated + 2758 tggatgattagactgactct G/C agaatattgataagccattt 2494 ABCE1 7 intron1 + (5349-5363) tttgtctgggttggttgggg (T)13-16 gagactgggtctgactctca 2495 ABCE1 8 intron1 + (5845-5845) tacatttgtcaaaatttata (T)9-10 gcagataatcatttcatctc 2496 ABCE1 9 intron5 + (836-851) taaattcacatgattctgta (T)14-16 aggatcctcctgactggcag 2497 ABCE1 10 intron8 + (1153-1169) tctttcaaacttatatttgc (T)13-17 catagtttcatgtttgatga 2498 ABCE1 11 intron9 + (1023-1024) ttgctctgtttcaaatctct (T) attcatgggccagcagctcg 2499 ABCE1 11 intron9 + (1023-1024) ttgctctgtttcaaatctct attcatgggccagcagctcg 2500 ABCE1 12 intron9 + (2338-2348) agtgtagatggacctcgggg (A)6-9 ctagttaaggaaaagtaata 2501 ABCE1 13 intron9 + (3213-3221) ttccaattttccattgttac (T)8-9 cttgccagattactcctgaa 2502 ABCE1 14 intron10 + (284-299) tcctctgcattttggcttct GCAGTATTACTGTAGT/&Dgr; atttg 2503 tcattttcaaattaa ABCE1 15 intron10 + (840-853) ttttttggtttctttctttc (T)13-14 aatcttggaggaatcttttt 2504 ABCE1 16 intron16 + (1163-1172) gattagaaatccaggttaaa (T)9-10 gttttgcacaaaaatattac 2505 ABCE1 17 intron16 + (1372-1382) taaaatttaatcaaaattga (T)10-11 ctcttagtcctcaaaccctt 2506 CHST1 1 intron1 + 2475 taaatggagaaaataacacc G/A acctgatagcattgttgtga 2507 CHST1 2 intron1 + 2612 aaactccccaagcatgctca C/A ctagatccttaccctaggtc 2508 CHST1 3 intron1 + 3900 gccctgcccccactcccaga C/G ttgcggccctccagcccctt 2509 CHST1 4 intron1 + 6520 cctcccccagaggagctggg C/T acactggggccttgtgttgt 2510 CHST1 5 intron1 + 7534 attgtgtgttggcatactgc T/C cacatggaaggatgctctag 2511 CHST1 6 intron1 + 7911 ttttccttaggaagaaaaac G/A ccttgctgttttatgcattt 2512 CHST1 7 intron1 + 7963 aaaacattcatgggggatta G/C tgctggctacgtcagagtca 2513 CHST1 8 intron1 + 8173 gcgctgccacagatcaggcc G/A aggtgggggacagaaatgcc 2514 CHST1 9 intron1 + 9701 cccagaattctgaatacagc A/G gcgatgacgggactacgagg 2515 CHST1 10 intron1 + 12132 aacagatccacaggaccaga C/A agcaaaggggaggaacatgc 2516 CHST1 11 intron1 + 12465 atgcagggaaggggcttggc G/A caaaactgtcaactgagata 2517 CHST1 12 intron1 + 12561 atgctccctggtccactttc G/A ctttgagtttcaggtagctg 2518 CHST1 13 intron3 + 529 ccatggtctgcaggggtcct T/G catgctcaggggattggggt 2519 CHST1 14 intron3 + 617 agaggacagaggaaagagga C/A cacctggagaactgggcgcc 2520 CHST1 15 intron3 + 796 aagaggcttccgcagctgtc C/T gcaggttaaatcctggggtg 2521 CHST1 16 intron3 + 818 caggttaaatcctggggtgc A/G aggaatgtttgttcagctcc 2522 CHST1 17 3′flanking + 762 ataactggtacaggtttact G/C gtgtctacactggcagagaa 2523 CHST1 18 intron1 + 7874 gttttccccttgccttgcct T/&Dgr; cattttcatcacctcatttt 2524 CHST1 19 3′flanking + (335-349) cacactgccacacctggcta (T)12-15 ggattttagtagagacgggg 2525 CHST3 1 5′untranslated − 294 tccagcgtgccgaccggccc C/G gcagcgcctccatccctccg 2526 CHST3 2 intron1 + 96 gcgtccaggcgcgcgcgcca G/A actttggagggagaaggggg 2527 CHST3 3 intron1 + 4467 agagaagaatggggcagagc C/G ggagcagccaggggaggtga 2528 CHST3 4 intron1 + 4853 ggatgagcactgcccagctg A/G tccctgcccaccttccacag 2529 CHST3 5 intron1 + 4965 tccactgcagaggggacaca G/C tgaccaggacggaagttggg 2530 CHST3 6 intron1 + 5046 gggctgtccatctttgtacc C/T ctggttccatcccagtgcct 2531 CHST3 7 intron1 + 5300 ccttttcttctctaaggcct A/G aagagatgacagaatgctgc 2532 CHST3 8 intron1 + 5354 agcgcgtggactccacagcg G/A ggtgtggggtggcccctggc 2533 CHST3 9 intron1 + 5428 gacacgcttcagccctctgt C/G tctattgccccaaatctggc 2534 CHST3 10 intron1 + 5621 ctgtggcttccctgggccct A/G ggaaatttatcactgaggtt 2535 CHST3 11 intron1 + 6555 gagtggggcactgctggaag G/C ttctggttcctgctttgttc 2536 CHST3 12 intron1 + 6990 aaacacactgggccaccccc G/A tccccgcactgtgactacac 2537 CHST3 13 intron1 + 7133 ctgagggcctgtcctgcagg T/G ttgatgtgtctgaagaggcc 2538 CHST3 14 intron1 + 7161 gtctgaagaggccccgagaa T/C agaaatctagaacctgccag 2539 CHST3 15 intron1 + 7199 cagtcacgaagcagtgtcac C/T caccagaggatgaagaactg 2540 CHST3 16 intron1 + 7316 cttgcatctggtgtaggtgc C/T tgggggtagcgtgcccagga 2541 CHST3 17 intron1 + 7967 gacaggaaccccaccccgag T/G gatgtctggccctgtgacct 2542 CHST3 18 intron1 + 11412 gcttgcacttctgattcatt C/T tgcagtcactggctctttgt 2543 CHST3 19 intron1 + 11591 ccctggaagggcctcactgc G/A gtgactcattacccagcatg 2544 CHST3 20 intron1 + 12541 acccacacagcatgaatggg G/C ccagccccagcctgcccgct 2545 CHST3 21 intron1 + 12672 gtagccacagctggggctgt G/C gggtcagggcatggcaaggg 2546 CHST3 22 intron1 + 14809 ggatgtgtagggtttgggct C/T ggccttaagggatgggtgga 2547 CHST3 23 intron1 + 16161 gatgctggtcaggcattgtc G/A ttgggatctttaacaccacc 2548 CHST3 24 intron1 + 16385 tatttagcatgtgggtttca A/C ctttctgttttttcaaaggg 2549 CHST3 25 intron1 + 33638 gacttgggccacgtccttgg G/C catgaatcttggtctatgtc 2550 CHST3 26 intron1 + 33878 agcaagaaagtgtgctcccc C/T acagccccactcaggcataa 2551 CHST3 27 intron1 + 34690 agcacacatggagctttccc G/A cagtgggtttcagcgctccc 2552 CHST3 28 intron1 + 35145 agggaagccgaagcctcact T/C gctggggcttgcctggcctc 2553 CHST3 29 intron1 + 35340 tgtgaagttttgcccacagt T/C ggtggccatggttcgcaccg 2554 CHST3 30 intron1 + 35436 gccactcatgtatggagcaa T/C tgcctttttttcttcctctt 2555 CHST3 31 intron1 + 36150 ccatagaagaggctgggcct G/T aggaagccagggaagcagga 2556 CHST3 32 intron1 + 36194 ggtgtggggaggccagcagg G/A gtgtgggcctcagcggggag 2557 CHST3 33 intron1 + 36581 ctctggtgtttgctgtcaat A/G tgcagagtgctggacaaaac 2558 CHST3 34 intron1 + 37602 ctggaacagcaacttaaaaa A/T agaaatagtccctggaaggg 2559 CHST3 35 intron1 + 37725 gggtagccagggcagctccc C/T gacccgcacctgcctttt 2560 CHST3 36 intron1 + 37734 gcagctccccgacccgca C/G ctgccttttcacccctctcc 2561 CHST3 37 intron1 + 38208 gccattctagatgcgagtcc C/T gactttggggtgcttgca 2562 CHST3 38 intron1 + 38219 cgagtcccgactttgggg T/C gcttgcattctgggaaggga 2563 CHST3 39 intron2 + 255 ctacagctgtgaaaggttag A/G caagatacttaacatttctg 2564 CHST3 40 3′untranslated + 2202 acacctcagaggagcctgtg G/A ttaacatttgtaggattatt 2565 CHST3 41 3′untranslated + 2569 aggcctcatctggggtaggg C/G caagaggaaagtacagagtg 2566 CHST3 42 3′untranslated + 2717 ctggaattcctccttagggc C/T ctgggaagagtattgcttaa 2567 CHST3 43 3′untranslated + 2753 cttaacgcaggatgtgctgg G/A tgttttgtttcgggctttta 2568 CHST3 44 3′untranslated + 2800 gcttggtgtctttcttgttt C/T atggctgtgtttttgctttt 2569 CHST3 45 3′untranslated + 3283 ccgagggctgcccagctctg C/T ttctggtttcctggacaatt 2570 CHST3 46 3′untranslated + 3327 ctgtcagatacggcccattg T/C aaacccagagggctgcattt 2571 CHST3 47 3′untranslated + 3787 gttccccatgtggaggtcgg A/G ggggctgggactggggaggg 2572 CHST3 48 3′untranslated + 3860 ggccctgctaatgtggacag T/C agactttatccctccttctt 2573 CHST3 49 3′untranslated + 4915 ccagatgtgcatagaagcca G/A tctctgtcacatacaccgca 2574 CHST3 50 3′untranslated + 4993 taaagcaaatttaggctttt G/A tccttctgcaatacatgcac 2575 CHST3 51 3′untranslated + 5223 ggaaggagcttcagcaggag G/A tccttcccagaaggttgatt 2576 CHST3 52 3′untranslated + 5370 tcatacctgtaatcccagca G/T ttggggaggccaaggtggga 2577 CHST3 53 3′untranslated + 5545 ccattcccaaagtcagaaag T/C gaagccagatctcaagggct 2578 CHST3 54 3′untranslated + 5859 caaaagcacaaagcagaatt G/C gcaacttcacttgtctca 2579 CHST3 55 3′untranslated + 5870 cagaattggcaacttcac T/A tgtctcaagagctccaagat 2580 CHST3 56 3′untranslated + 5971 ttccaaggctacagacatgg C/T gccatcctcacaggcctagc 2581 CHST3 57 3′untranslated + 6208 atttcatgtctgcatggtac G/A agacaccccttcacggca 2582 CHST3 58 3′untranslated + 6223 tacgagacaccccttcac G/A gcatacactgccatggtatg 2583 CHST3 59 3′flanking + 281 agacaggagtgttgggccag C/T ggtcagggggcctggggatg 2584 CHST3 60 3′flanking + 997 acctcttaaagtatttgagc C/T ggtgcctgtcatcccaacct 2585 CHST3 61 intron1 + 22595 cgggagcaggaaaaaaaaaa A/&Dgr; gaataagaagaaaagaggct 2586 CHST3 62 intron1 + (35423-35424) gctcatgctcacagccactc AT/&Dgr; gtatggagcaattgcctttt 2587 NDUFV1 1 intron3 + 670 ctgggtggagtggggtggca T/C ggagttgaagacccagtcct 2588 NDUFV1 2 intron6 + 160 tgtgccggccccagccctga C/G catgcatccctttggggacc 2589 NDUFV1 3 intron9 + 27 accacccttctgcgtagcac G/A gagggtgggtggcatcaagg 2590 NDUFV1 4 3′flanking + 1111 tgtaggctgaggtcagcccc A/G atccagtccaaagcccaccc 2591 NDUFV1 5 3′flanking + 1658 gaatgcggaagtgctctgtg G/A gcacccaccatgctccgggc 2592 NDUFV1 6 3′flanking + 1713 gatctggggcggagggtaca C/T ggggctggcgctgggtgaag 2593 NDUFV1 7 intron4 + 214 tggtgtaaattttttttttt T/&Dgr; gcttcaaaaatatagtattt 2594 NDUFV1 8 3′flanking + (772-774) tgaactcggggttcagggtc TTC/&Dgr; ctgtgaacactggttttgaa 2595 NDUFV2 1 intron1 + 526 ggaaatgctggctaaataaa C/T ggtatcaaactaactctgaa 2596 NDUFV2 2 intron1 + 6689 tcgttggatggtagtattgt T/G tgaacaacagaagaaattca 2597 NDUFV2 3 intron1 + 14767 ccaaatgcatgccagcagag C/T gtggcaggaaggtacacaag 2598 NDUFV2 4 exon2 + 86 aaggaatttgcataagacag T/C tatgcaaaatggagctggag 2599 NDUFV2 5 intron2 − 29 cagaagatcttactctctaa T/G gaagctggataacacttttt 2600 NDUFV2 6 intron2 − 168 tttactttggtaatcatact T/C atcaaatgtgtgtttagaca 2601 NDUFV2 7 intron4 + 677 aaaccacatactatttgatt C/A tgatgagaatcacataacca 2602 NDUFV2 8 intron4 + 2295 tatgattcaactttcaaaag A/T gtattgtgatatgaaataga 2603 NDUFV2 9 intron5 + 102 caacttctgccatcttattg G/A atctgtacttacctagtaat 2604 NDUFV2 10 intron7 + 5466 tggtaagaggctttaagata A/C caaatgctcagctttcagga 2605 NDUFV2 11 intron1 + (13562-13563) tactcttaaaattaatcctt (CTT) ttattataagtatacagtct 2606 NDUFV2 11 intron1 + (13562-13563) tactcttaaaattaatcctt ttattataagtatacagtct 2607 NDUFV3 1 5′flanking − 606 aattacgactaacgttgggg A/G cgaactctttgctaaataaa 2608 NDUFV3 2 5′flanking − 222 cgccgcgcccccgccacagc G/A cccaggcgcccgcagggcac 2609 NDUFV3 3 5′flanking − 111 tggccccaagggaggcactt A/G gccctactggggatgcgcgc 2610 NDUFV3 4 intron1 + 137 ttgggccgctgaccccgctc C/T gagttacagtatcagcaaaa 2611 NDUFV3 5 intron2 + 152 tatacaagacacaagatcta T/C aacagattttagaccaaaca 2612 NDUFV3 6 intron2 + 6304 ttcacagatgaaggggttcc G/A aaatttttgtcaagaaagac 2613 NDUFV3 7 intron2 + 6433 tcgccttcgtcttcatcctc T/G tccagctcctctgattctga 2614 NDUFV3 8 intron2 + 6563 cctttgaaaacagagccccc C/T gagttacagtatcagcaaaa 2615 NDUFV3 9 intron2 + 9619 actatcttctgtgcgcatgc G/A cagagcccaccttgcagagc 2616 NDUFV3 10 intron2 + 9858 aggatgccagctctttaaat G/A agacatcgtttttgcttaac 2617 NDUFV3 11 intron2 + 11673 cttggtaggtaagcgcctgt A/G tgtgagccaagtcattcata 2618 NDUFA10 1 5′flanking − 1734 tgcaccttgaactgtttact T/C tcctgtaaccatttaccctt 2619 NDUFA10 2 5′flanking − 1492 aaaacatccatgcaaacagg T/C tgtgagaagttacgtctgcg 2620 NDUFA10 3 intron3 + 370 aagactgtgcatgtgccatg G/A agacagagatgtggatgcca 2621 NDUFA10 4 intron3 + 2485 ttgttattttcttttctctg G/A aatgcagtgatcagttgaca 2622 NDUFA10 5 intron4 + 236 ctgtgaaagcagattggagc C/T ctggacctcaaacacacgca 2623 NDUFA10 6 intron4 + 1742 tgtcggcatctgctgagtgt C/T tgctgaagtctgaggactgg 2624 NDUFA10 7 intron4 + 2090 ggctgggggaaagcagatca T/C gttggctaaaggacaggtgg 2625 NDUFA10 8 intron4 + 3054 cagctgattatactactgaa A/C cgggataaatgcagcttgat 2626 NDUFA10 9 intron4 + 3066 ctactgaaacgggataaatg C/T agcttgatgattttcagctg 2627 NDUFA10 10 intron4 + 3377 gtcacagtttaaatgctgct G/A ttttactctgtgtaagtagc 2628 NDUFA10 11 intron5 + 46 aagcatctctattttgaatg T/C agatcagcactaaaagccct 2629 NDUFA10 12 intron8 + 1465 gcaacgcccagttcctggta C/T aggcctcatatccagcgtgc 2630 NDUFA10 13 intron8 + 1809 cctggaggcacaaggatggc C/A ggggcactcaacttccctct 2631 NDUFA10 14 intron8 + 11226 gttgtgtgactgtgtggggc A/G tctcacctctcgggctgcag 2632 NDUFA10 15 intron8 + 11319 atcttgccttccctcctgcc G/A tctgttcaggcttgaatcct 2633 NDUFA10 16 intron8 + 11386 ccataatcctagcttgaacc C/T tcctttttccctgctgaccc 2634 NDUFA10 17 intron8 + 12301 acataattattgtaaacatg C/T cgcttaccagtgacattcat 2635 NDUFA10 18 intron8 + 13361 ccaggccactgattgctttc G/A cattttctagcattttctta 2636 NDUFA10 19 intron9 + 183 tttctgtgtggaaagctgat G/A aagtcctcagatgacagccc 2637 NDUFA10 20 intron9 + 8669 aataataatgaccatttctg G/T aaattcatagaattcctttt 2638 NDUFA10 21 intron9 + 8028 gaggacattccacagaacgt G/A tgactattagagcagaaggt 2639 NDUFA10 22 intron9 + 10742 ctggaggagaggggtggagc C/G agttcagccagcactggggt 2640 NDUFA10 23 intron9 + 10985 agaaagggttacacaggagc A/G cacttctcagggagtggtgt 2641 NDUFA10 24 intron9 + 10989 agggttacacaggagcacac T/C tctcagggagtggtgtgacg 2642 NDUFA10 25 intron9 + 12601 ctgtgaatcctctcacctgc G/A tgaagggcctggctgcctct 2643 NDUFA10 26 intron9 + 13908 cacattgttatgtaaccaag C/T ctggaattgcagtgtgaaga 2644 NDUFA10 27 intron9 + 13911 attgttatgtaaccaagcct G/T gaattgcagtgtgaagaact 2645 NDUFA10 28 intron9 + 14064 tcttgactattagaaaccct A/G tcagataaattttaaaacag 2646 NDUFA10 29 intron9 + 14184 tggctttggttgggaacagc G/A agagatacagaaccgacggt 2647 NDUFA10 30 intron9 + 16487 cttgaagctgatcgttccct C/A cttgaagctgatcgttccct 2648 NDUFA10 31 intron9 + 16779 gccagacgtgactgctttag G/A ttcctcatgacattcagacc 2649 NDUFA10 32 intron9 + 17663 ttccaaatcaccccagaact T/G tgcagtattttgaagctcct 2650 NDUFA10 33 5′flanking − (1668-1659) gtaaaattgttttaactaga (C)9-11 ttcctaaaccaaggtataaa 2651 NDUFA10 34 5′flanking − (1355-1334) ctgtatccattggaaggcac (A)15-21 tgcaaaggaaacaaggcaaa 2652 NDUFA10 35 intron1 + (46 − 61) tggcggggtggcagggtggc GGGGTGGCGGGGTGGG/&Dgr; gag 2653 AAGCTGATCGT/&Dgr; gtccaagatagttgctagga NDUFA10 36 intron4 + 2486 ctcactggaacttttttttt T/&Dgr; aatttaatttttaaaatttt 2654 NDUFA10 37 intron7 + (1600-1601) cacttccattctgactgtta (A) cggtgtgattcttcctgcca 2655 NDUFA10 37 intron7 + (1600-1601) cacttccattctgactgtta ctgtagacattttaaaccta 2656 NDUFA10 38 intron9 + 1054 gcgcgtgctgtttctccctt A/&Dgr; tctgtccttgtacacgtgtg 2657 NDUFA10 39 intron9 + (8161-8172) tttctcgctttctgggagac (T)10-12 aatgttgaaaatatgtgttt 2658 NDUFA10 40 intron9 + (8646-8647) aattcccccattgcttctct (TT) ctgtagacattttaaaccta 2659 NDUFA10 40 intron9 + (8646-8647) aattccccattgcttctct ctgtagacattttaaaccta 2660 NDUFA10 41 intron9 + (16503-16523) ccctccttgaagctgatcgt TCCCTCCTTG 2661 AAGCTGATCGT/&Dgr; gtccaagatagttgctagga NDUFA10 42 intron9 + (17905-17936) caaatatatgtatacatgta (CA)12-18 tccttcatgaaaactctttc 2662 MGST1 37 5′flanking − 1376 ttaataaatgtttattcaat T/G aaaccaactgctaatattct 2663 MGST1 38 intron1A + 147 cctggagattttaactttct G/A cgaagtttttaaaaaacaact 2664 MGST1 39 intron1B + 36 ggagaaggggaccgcatgca A/G agggtggcaggcagggaggg 2665 MGST1 40 intron1C + 456 ccccttgggacggttctcac C/T tgtgccccacttccccagtc 2666 MGST1 41 intron1C + 719 gcccgcaagcattgctgtat A/G gcacccaggcctccagtgag 2667 MGST1 42 intron1C + 985 cgagtaaaatttttctaccg C/G tttgttttagagtggtgtct 2668 MGST1 43 intron2 + 3083 aaaaaatttgtagatatggg T/G actccctatgttgcccaggc 2669 MGST1 44 intron2 + 3106 tccctatgttgcccaggctg A/G tcttgaattcttgggctcaa 2670 MGST1 45 intron3 + 1703 ttctcttctaagaagaagtc T/C gtgcagatacttagcacaaa 2671 MGST1 46 intron3 + 2557 tccagcatcttccctttcca T/C ttttaagttagacttttttt 2672 MGST1 47 intron3 + 3032 agagacatttagaatatatt C/A cctttaaaggtagagaataa 2673 MGST1 48 intron3 + 3045 atatattccctttaaaggta G/C agaataacccttcactgaga 2674 MGST1 49 intron3 + 3289 ggtttatagtgttccccccc T/A ccccgcccccaaaagaccca 2675 MGST1 50 intron3 + 3885 gaagctgccgctccaggaag G/C agtctgtcgttggagaagag 2676 MGST1 51 intron3 + 3976 ggaaagctggggaactgttt G/T cctggaacagagtctcaaaa 2677 MGST1 52 intron3 + 4298 tgtcaactgcgtaacacagg C/T gtagaagtggacattgtttt 2678 MGST1 53 intron3 + 4519 tttaatagaaaatggtattc C/T tgtcttttctttcccatctc 2679 MGST1 54 3′untranslated + 603 gggtaaacccattttgaata T/C tagcattgccaatatcctgt 2680 MGST1 55 3′flanking + 147 tatttgctttccttctctct C/T tgttttctttttctctgaaa 2681 MGST1 56 3′flanking + 237 cagcacgtttttcctatgaa C/T aagacattctccaaataact 2682 MGST1 57 3′flanking + 1318 tggctctgtgtgcatgaaca T/C gcacgcgtgcacgcgcacac 2683 MGST1 58 3′flanking + 1331 atgaacatgcacgcgtgcac G/A cgcacacacacacacacaca 2684 MGST1 59 intron1C + (904-923) tgcgattatctttggtaatt (A)18-20 ggcaaatcagtccaaatttg 2685 MGST1 60 intron1C + (3433-3434) ccccttcaatactagaacaa (AA) gcagacacattaaatgttac 2686 MGST1 61 intron1C + (3433-3434) ccccttcaatactagaacaa gcagacacattaaatgttac 2687 MGST1 62 intron1C + 5146 actatttcaatttttttttt T/&Dgr; ggagggggagacagagtctc 2688 MGST1 63 intron2 + (552-563) cccagcattataagaatgac (T)9-13 aagtgcagatgtggggaggg 2689 MGST1 64 exon3 + (172-173) tagcatttggcaaaggagaa AA/&Dgr; tgccaagaagtatcttcgaa 2690 agaaaactggatgtctgaaa TTGACA/GTCCAATAT cactg MGST1 65 intron3 + (152-158) TGGCTCACAT) agtcatcctctttgtgagac 2691 MGST1 66 intron3 + (2198-2200) ggattttagattcctcccta CTA/&Dgr; ttctttccgaccttccaccc 2692 MGST1 67 intron3 + (2571-2580) tttccatttttaagttagac (T)9-10 cacctctctcgttacttcag 2693 tcctcttcatgtctctatgt (GAGATGTTG MGST1 68 intron3 + (4682-4683) TGGCTCACAT) agtcatcctctttgtgagac 2694 MGST1 69 intron3 + (4682-4683) tcctcttcatgtctctatgt tgctctggagttgggcaact 2695 MGST1 70 3′flank+ (1359-1360) acacacacacacacacacac CC/&Dgr; tgctctggagttgggcaact 2696 MGST1 71 3′flank+ (1889-1891) ttagaatagtttctaactat ACT/&Dgr; tttactcccaagagaagctt 2697 HMG17L1 1 3′untranslated + 864 ctttctgatttttgatagtc G/C gttgaagaagggagtttgaa 2698 UGT2A1 1 5′flanking − 1602 ataacatcttctgcagagaa A/C cttcaatggaaatacactca 2699 UGT2A1 2 5′flanking − 1480 tacagattatctttggtgat G/C ggagagcttagaagagacat 2700 UGT2A1 3 5′flanking − 1406 atttcagaagatttattaac A/T tgaaaaggatcactctgctt 2701 UGT2A1 4 5′flanking − 1388 acatgaaaaggatcactctg C/T ttattcacagacatatgcat 2702 UGT2A1 5 5′flanking − 935 aaattattcaatctctttgg G/A cagtggtttctttttctttg 2703 UGT2A1 6 5′flanking − 287 cctgaatgtagagttgagat G/A tacagaagctttatccaatt 2704 UGT2A1 7 5′flanking − 128 gagaagtaagacacattacc C/T ataaatctgtaaatctccta 2705 UGT2A1 8 intron1 + 535 cattgatcagggtgatttat C/T catgctaagcttatttaatt 2706 UGT2A1 9 intron1 + 642 tatattgatcatgttgatac A/C tttatacacatatttgtcta 2707 UGT2A1 10 intron1 + 1221 ttttaatctaataagcaatt C/G aggaccatctaaagggaaat 2708 UGT2A1 11 intron1 + 1448 aggtgcttacaggcaacatc C/T acatagcagtctgtggctgg 2709 UGT2A1 12 intron1 + 2000 gacacattagcttcttttct A/G cagatctctgttctaaaaca 2710 UGT2A1 13 intron1 + 3118 cttaaaattctttaatgaaa T/G cattgcaacaaatttatatc 2711 UGT2A1 14 intron1 + 3191 ataaatagaacaactcccta A/T gtttacttctctgcagtgga 2712 UGT2A1 15 intron1 + 3770 atcaccagataatttactat C/T cattaaggagtaggtcatca 2713 UGT2A1 16 intron1 + 4584 tgattggttagaatctttga A/C aaatcttctagtatcattcc 2714 UGT2A1 17 intron1 + 4854 tactctgtgcattgttaata G/A cctatcacttgtggtctgcc 2715 UGT2A1 18 intron1 − 19146 ctgtttaaattctcattcaa C/T ggccacatggttaaaataaa 2716 UGT2A1 19 intron1 − 18346 atggcaatatttttagaaat G/A ttaactcccaataatgaata 2717 UGT2A1 20 intron1 − 18218 tatatcattattttaactta T/G agatagcactagccctaatt 2718 UGT2A1 21 intron1 − 17937 ctcctaataatttggactca C/T catacttattcagcactatc 2719 UGT2A1 22 intron1 − 12585 ttccacacagggacaagtca A/G cagaggaaatttttcttgct 2720 UGT2A1 23 intron1 − 11430 aacaaaggtttattttctta C/G agttctgatggctagacgtc 2721 UGT2A1 24 intron1 − 10761 tttaaaatatgcatgtattt T/G ccacttttaaaaactatatc 2722 UGT2A1 25 intron1 − 381 aaatcctccctccttccttc C/T tttccccaggcccactctac 2723 UGT2A1 26 intron1 − 329 ttccctttctccttttctcc A/G tctctctctcttcctctctc 2724 UGT2A1 27 intron1 + 41 ttttctcctcagcaaacata T/A aagctaatttcctccatcca 2725 UGT2A1 28 intron2 + 263 caccttgatactggacttgg T/C gggacagaaaaccagatcat 2726 UGT2A1 29 intron2 + 454 agaaagcccattgaaataag G/C cagggtttttaggttttaat 2727 UGT2A1 30 intron2 + 554 aaaaacttttttgagttgac A/T atggtgagtttagtttctga 2728 UGT2A1 31 intron2 + 1113 ctgcaggcaagctctagtga A/T tgtttattataggaaataat 2729 UGT2A1 32 intron2 + 1304 gacaaatcagccatgtttta C/T aatagcagacattatgccat 2730 UGT2A1 33 intron2 + 1305 acaaatcagccatgttttac A/G atagcagacattatgccatt 2731 UGT2A1 34 intron2 + 1367 atcgatataggctttgggaa A/C tatgaataccaaccatgggt 2732 UGT2A1 35 intron2 + 2074 aaattttttcttagacctat G/T aatcaaaggaggcatacagt 2733 UGT2A1 36 intron2 + 2164 attttattagatataactgg A/C atgctaacaattttaaaagc 2734 UGT2A1 37 intron2 + 2298 taacaatttcagttagcatg A/C gaagagttgtcccttattta 2735 UGT2A1 38 intron2 + 2346 tttctgtaatggttttgctt T/C catgcttggacttgtaatca 2736 UGT2A1 39 exon3 + 922 gtgttgtggtgttttctctg G/A gatcaatggtcaaaaacctt 2737 UGT2A1 40 intron3 − 217 aagcttagaagtgataaata T/C caaaacaataatactatact 2738 UGT2A1 41 exon5 − 194 aaacaataatactatactgg G/A tagactattagtacaagact 2739 UGT2A1 42 intron5 + 1171 acggagtccctatggtggga G/A ttcccatgtttgctgatcag 2740 UGT2A1 43 intron5 + 1546 tttttaaaattcagaaactc A/G gttatggtgtattcttacaa 2741 UGT2A1 44 intron5 + 1547 ttttaaaattcagaaactca G/A ttatggtgtattcttacaaa 2742 UGT2A1 45 intron5 + 2013 atcatattcattaccctccc G/T ctattattgtattttgaatc 2743 UGT2A1 46 intron5 + 2318 aatttagtgctttttcttaa C/T ggaagtaacctgcttaaaaa 2744 UGT2A1 47 intron5 + 2505 taattgacttttattaatac G/A tacatgttgtataagtcata 2745 UGT2A1 48 intron5 + 2639 tagactattacaaagttgtt A/G gttgctgacaattttgttca 2746 UGT2A1 49 intron5 + 4009 gaatccaggctggaactttt C/A ttccagacacaaaccaaaat 2747 UGT2A1 50 intron5 + 4311 atacagacactgtccttttc G/A tcacaaacatacagatgtgt 2748 UGT2A1 51 intron5 + 4545 agctcacacagtatcaaaat T/C atttttggaaaaattatgct 2749 UGT2A1 52 intron5 + 4616 acttttttatgtctacattt G/C atcatactgtgttaagcata 2750 UGT2A1 53 intron5 + 4717 tgcaagaattatattttctc C/A acgtaactatggccttaaac 2751 UGT2A1 54 exon6 + 1524 gctatatttttggtcataca A/G tgttgtttgttttcctgtca 2752 UGT2A1 55 3′untranslated + 1683 aaggagtttaacaaaaacac G/A tctcccatcctgtttccaaa 2753 UGT2A1 56 3′flanking + 685 aatctagaaaataattatca T/C ttttataaaatttttagtca 2754 UGT2A1 57 intron1 − (18967-18965) ctcccaattagattgattag TAT/&Dgr; gagttcctggggttactggt 2755 UGT2A1 58 intron1 − (18862-18803) ttgtgtgtatgtgtatgttt (AC)14-17 tattttaatgaattaatatc 2756 UGT2A1 59 intron1 − (17463-17447) gcttagtatattatatatat (A)16-27 gtaaagaaaatggcagagaa 2757 UGT2A1 60 intron1 − 10860 attcaatgcaactttttttt T/&Dgr; gtaatggcagaattagaaca 2758 UGT2A1 61 intron2 + (528-538) ctgttaggaaacaattggtt (A)16-27 gtaaagaaaatggcagagaa 2759 UGT2A1 62 intron2 + (1514-1533) ttgtgtgtatgtgtatgttt (GT)9-11 tattttaatgaattaatatc 2760 UGT2A1 63 intron5 + (916-917) gcttagtatattatatatat AA/&Dgr; gtctatatatatagcttagt 2761 UGT2A1 64 intron5 + 1163 caatatttatgtcatttttt T/&Dgr; ctcacatttactctgtttcc 2762 UGT2A1 65 intron5 + (3819-3838) agacagacagacacacaaac (AC)8-12 tcaacacatgtaaactactc 2763 UGT2A1 66 intron5 + 4785 tatcttcaatgaaaataaaa A/&Dgr; caaaaattgtctaatttctg 2764 CATP1 1 5′flanking − 916 acagcgtagatgttcaataa G/A tatttgttgtatctgtgaga 2765 CATP1 2 5′flanking − 843 tagtgcagcgactatgcctt G/A atgtgtgtgtgtttgggatt 2766 CATP1 3 5′flanking − 526 aaatgtgtgcctgtatgtta T/C acatctgtacatatatttcc 2767 CATP1 4 5′flanking − 172 acaaacacaactcaaagtat G/A tgtgttattaaaagtagcta 2768 CATP1 5 intron1 + 206 ttgattcaggcaagttagtc C/G taaatggctttgagagactt 2769 CATP1 6 intron1 + 454 caacataacaataatttcct G/A taagaaaaatggccattttg 2770 CATP1 7 intron1 + 999 gtttagcaaggttagatatt A/G atgtggatgttaagacaaaa 2771 CATP1 8 intron1 + 1223 ttgctagaagctagtaggac C/T agctttataaatacagagat 2772 CATP1 9 intron1 + 1326 aactagttaggcaacccatg T/C gttttaggggaaaagcaatg 2773 CATP1 10 intron1 + 1336 gcaacccatgtgttttaggg G/A aaaagcaatgaggtcatgat 2774 CATP1 11 intron1 + 1498 atagtttgctcttaagaata C/T actctgagaaggtttatagt 2775 CATP1 12 intron1 + 5041 ttatgctcccgaggagttag C/T tctctaaatgcataaggaga 2776 CATP1 13 intron1 + 9532 aaaaagttatatagaaatat A/G agtgtcactcctttctagtt 2777 CATP1 14 intron2 + 198 ttacctcatattaacaccta A/C atattgccacatatcctacc 2778 CATP1 15 intron2 + 961 aaaaagttatatagaaatat A/G agtgtcactcctttctagtt 2779 CATP1 16 intron2 + 1110 gtctactagtgttcaactcc T/C ttagatcttagcctgtatca 2780 CATP1 17 intron2 + 1419 aaagcctaagaaggatgcag T/C gcaatagcctatgtgagaag 2781 CATP1 18 intron2 + 3339 tatggtttgcaaaaaactta T/C tcgtatatttgtttttttca 2782 CATP1 19 intron3 + 66 caggaaatgaagttgcactt T/C cctctctaggagcaatgctt 2783 CATP1 20 intron3 + 205 tcagttttgtcaatttacac A/G atggggatttgggacctttt 2784 CATP1 21 intron3 + 6377 aatgaatagactttgagtta C/T tggatttttagtggataaat 2785 CATP1 22 intron3 + 7238 tgaatgtcacattttttaaa G/A tttgtgttccttatctcata 2786 CATP1 23 intron4 + 1016 ttttattctggattcatgtt T/C gtggaaattgcagtagtcca 2787 CATP1 24 intron5 + 110 tccacaatgatgagtagagt A/G tcttggcacagttggccttc 2788 CATP1 25 intron6 + 496 agtgtctgaattataagcca A/G ttttatagttggttgggacc 2789 CATP1 26 intron7 + 1934 aaagtgaaaggaaattaaaa G/C tgagaacttgagcctgaatg 2790 CATP1 27 intron7 + 2140 tagaatgtaccaaatgaatc A/G gcatctctgaggatgggacc 2791 CATP1 28 intron7 + 2365 tgaaatcttctttatcaact C/T gattttcctccagactttac 2792 CATP1 29 intron8 + 88 gcaaactcctaagttgaagt G/C ttttaggatattttttgact 2793 CATP1 30 intron9 + 534 tcatattttgtattttaaag G/A ttatctgggttttactgaaa 2794 CATP1 31 intron9 + 1286 tattcttctgagataaatca T/C tgaaggagtggctatgtggt 2795 CATP1 32 intron11 + 215 ttcactcctattcctcgcta C/T ttttcttccttatttcttag 2796 CATP1 33 intron11 + 663 ttcttcttcttttggagctc T/A aaagtagagttcagttaatc 2797 CATP1 34 intron11 + 999 atcatcactgcatgagagtt A/G gaattatctaactttgtgat 2798 CATP1 35 intron11 + 16727 tttcttttatttacaaactt A/G tttacttttcaggtgtatga 2799 CATP1 36 intron12 + 48 ctatcagaacaatattatta T/G tattattttttattacactt 2800 CATP1 37 intron12 + 686 tatgttttgataaactttgc C/A gtacaaataaagacaattga 2801 CATP1 38 intron12 + 708 tacaaataaagaaaattgaa A/G tatttccaaataaatcaagt 2802 CATP1 39 intron13 + 418 tctctggtctccaaaatcat A/G tattttctccctctttacat 2803 CATP1 40 intron13 + 436 atatattttctccctcttta C/A attttgctgaaacaatcttc 2804 CATP1 41 3′untranslated + 2130 gtctttaagaacctaaaaaa C/A ctcttaactcaaaataataa 2805 CATP1 42 3′flanking + 57 agtgactaaagtttttctta C/A aaacaagtgtctgaatcaaa 2806 CATP1 43 3′flanking + 572 aatacactatggttatttat G/A tgtactataaatggagtgag 2807 CATP1 44 3′flanking + 788 atttcctaaatgatcagatg C/T atcatatgaaaaaagaaagc 2808 CATP1 45 3′flanking + 1356 aggtgactgacataaatggg G/A gcagaggacataatgaggtt 2809 CATP1 46 5′untranslated + (189-188) attttctaatctgtattaaa (A) gcgttccaggtatttttgta 2810 CATP1 47 5′untranslated + (189-188) attttctaatctgtattaaa gcgttccaggtatttttgta 2811 CATP1 48 intron4 + (725-726) tgatctttaatagcggggaa AA/&Dgr; caggcaagtacgctatagtt 2812 CATP1 49 intron4 + (1082-1083) attgagtcaggaaaccaaaa CA/&Dgr; gtttcaaaaatttgaaaaat 2813 CATP1 50 intron4 + 2301 aatgtcatgtcttttttttt T/&Dgr; aatgcagagtgtacaaagga 2814 CATP1 51 intron9 + (241-246) attgtatgtgcatgtgggtg TGTGTG/&Dgr; catgattgtctttgtgatat 2815 CATP2 1 5′flanking − 2574 ggataaggcaacccctatgt A/G tcactgctgcaggagaggga 2816 CATP2 2 5′flanking − 2366 aacataggaatgtgcagagc C/T ctgtggggattagagaagag 2817 CATP2 3 5′flanking − 2244 tgatgatgccagagctttga T/G cattggtgggtatagaaaca 2818 CATP2 4 5′flanking − 1723 tctttcagacttcaaaggcc A/G tgatatttcatcagagctgt 2819 CATP2 5 5′flanking − 1180 tgcttatttaacaggcataa T/G ctttggtctcctgagccaga 2820 CATP2 6 5′flanking − 811 tatgtgcatatgtgtataca G/A gtaaaagtgtgtatatatgt 2821 CATP2 7 intron1 + 7188 aatcatttgaaatttaagaa A/G aaaatatgttcagagaaaaa 2822 CATP2 8 intron1 + 7331 gtgaaatgaggaacaaagtg T/C ccacctttttttcctgaata 2823 CATP2 9 intron1 + 7391 agagagatgtgaaatagtat T/G tttctggggaagtaggggaa 2824 CATP2 10 intron1 + 7886 ttgttagtagaaagaaaatc G/A aagcctaaaactaaaggaag 2825 CATP2 11 intron1 + 7958 ttgctattatataatttttt T/A aaaaaaagatttcctaatat 2826 CATP2 12 intron1 + 7959 tgctattatataattttttt A/T aaaaaagatttcctaatatt 2827 CATP2 13 intron1 + 8036 ggaaaaaatggggtgaaatt A/T atcaaagggcagcttattaa 2828 CATP2 14 intron1 + 9164 acattatattctatataaaa G/T agtcagttgaagtaaaaagt 2829 CATP2 15 intron1 + 10123 tctgtctttcctacttttgt T/G tccagcattgacctagcaga 2830 CATP2 16 intron2 + 193 tgattaagtatttctttggc G/A aaatttttgatgcttaatag 2831 CATP2 17 intron2 + 1020 ttgagtaacatttaggccaa G/A tggcagtcataaggaaaaag 2832 CATP2 18 intron2 + 14865 agaggaattaatcataagag G/A tggcagtcataaggaaaaag 2833 CATP2 19 intron2 + 14931 gttagttaataacagaaaaa A/T tatcagaaattttaaaaaat 2834 CATP2 20 intron2 + 15417 ttctaaaataagtaagctaa A/T tattctatattatactacta 2835 CATP2 21 intron2 + 20823 ttgtataagagatacaaaac A/C aattcctactaggggaaata 2836 CATP2 22 intron2 + 20852 ctaggggaaataaagcttca G/C taaggaggtggcattaagct 2837 CATP2 23 intron2 + 20930 atggagagaagcagcagtgt A/G ccacagataaatgaagtgag 2838 CATP2 24 intron2 + 21360 ttcaaaagctgtatttctca T/C tagtgctttttgtgaataaa 2839 CATP2 25 intron2 + 21467 tatatacacaatacctgtcc A/G gaagatgtggtataagccaa 2840 CATP2 26 intron2 + 21621 tatcaatacttatgaagaga A/G ctaactattctaactaggga 2841 CATP2 27 intron2 + 22760 ttccccacctcctgttggtt C/G tcctcttaaacttctccttg 2842 CATP2 28 intron2 + 23199 cctatctgcacataacatta C/T aaacttatggcaattataaa 2843 CATP2 29 intron2 + 23218 acaaacttatggcaattata A/G aactcaatacatattatact 2844 CATP2 30 intron2 + 23330 gcccttgttcctgttcctct G/A tacctgcctcaactacatag 2845 CATP2 31 intron2 + 23673 ctggagacggtagctcaaac T/C gaggatgaaaatagacattt 2846 CATP2 32 intron3 + 89 ggttatcaactggggtaaat T/G tatctctcacaggcaatttg 2847 CATP2 33 intron3 + 224 tgctaaatattctataatgc A/G caaagaatgatgtaactgaa 2848 CATP2 34 intron4 + 97 ccctttaaataggcagttac C/A ttttgagaagatacccacta 2849 CATP2 35 intron4 + 568 ttcatgatccaaattgtggc A/G acgtatttccaggcaacaag 2850 CATP2 36 intron4 + 599 aggcaacaagatagaagaag A/G aaagaataagaagcaacaaa 2851 CATP2 37 intron4 + 753 aaaatagacattattccaag T/A taccaagttcccggttaaaa 2852 CATP2 38 intron4 + 781 ttcccggttaaaaatcccaa G/C tataattactgtggaaggaa 2853 CATP2 39 intron4 + 1196 aaggaccacaatctagatca G/T cattgctctaaatatgccat 2854 CATP2 40 intron4 + 1229 tatgccataatatgtgacaa T/C tttgcacctggtatttctac 2855 CATP2 41 intron4 + 1623 catctagttgaaatggatta G/C attttatttttactacattt 2856 CATP2 42 exon5 + 388 attctaaagaaactaatatc A/G attcatcagaaaattcaaca 2857 CATP2 43 exon5 + 452 taatcaaattttatcactca A/G tagagcatcacctgagatag 2858 CATP2 44 intron5 + 165 ttaatatacacagttcgccc A/T ttaacaacacaggtttaaac 2859 CATP2 45 intron5 + 189 acaacacaggtttaaactac G/A cgttttcacttctatgcaaa 2860 CATP2 46 intron5 + 191 aacacaggtttaaactacgc G/A ttttcacttctatgcaaatt 2861 CATP2 47 intron5 + 507 atataactttgctttcattg C/T aaaaggcaaactgttatatc 2862 CATP2 48 intron5 + 520 ttcattgcaaaaggcaaact A/G ttatatcatttaaagacttt 2863 CATP2 49 intron5 + 856 agtcatgataaacctaatag A/G ataaaacaacaaaaaagaaa 2864 CATP2 50 intron5 + 1157 acagataatttttacttgtt T/C gtgcttttctgtatgatatg 2865 CATP2 51 intron5 + 1226 ccttgattgtaataatctcc A/C catgccaagagtggggccag 2866 CATP2 52 intron5 + 1228 ttgattgtaataatctccac A/C tgccaagagtggggccaggt 2867 CATP2 53 intron5 + 1304 actgttctcgtggtaatgaa G/T aagtctcacaagatctgatg 2868 CATP2 54 intron5 + 1348 ttataaatgagagttcccct G/A caaaagctctcttgcctgcc 2869 CATP2 55 intron5 + 1407 ttgctcttccttcatcttcc G/A ccatgattgtgaggcccccc 2870 CATP2 56 exon6 + 521 gtcatacatgtggatatatg T/C gttcatgggtaatatgcttc 2871 CATP2 57 exon6 + 571 gggagactcccatagtacca T/C tggggctttcttacattgat 2872 CATP2 58 exon6 + 597 ctttcttacattgatgattt C/T gctaaagaaggacattcttc 2873 CATP2 59 intron7 + 33 agaacaaggtaccatgataa C/T gtctttctaagcacacatgc 2874 CATP2 60 intron7 + 267 caaaataaccaaatgtaaaa T/A gtctccctcccaaactgact 2875 CATP2 61 intron7 + 1260 gtaatctcacatttctctgc A/G tttacacttggtaaaacttt 2876 CATP2 62 intron7 + 1386 agtctcaaattaatagccaa G/A agcatgcctttattgtaacc 2877 CATP2 63 intron7 + 1472 ctttaccacatgacagaatg G/A catgttcttagcaaataata 2878 CATP2 64 intron7 + 1697 tttacatgttcaattttaga C/A atatgccttagagtagctac 2879 CATP2 65 intron7 + 2273 ttctcacgtcctatctagcg C/T gattatgacccttagttact 2880 CATP2 66 intron8 + 207 gtggaagagaattaggtttg T/C actttttagcagggagaaac 2881 CATP2 67 intron8 + 546 tcgggagaagtttctcccta T/C gtaattagagtaatatttat 2882 CATP2 68 intron8 + 565 atgtaattagagtaatattt A/C ttttggtaattatctatcta 2883 CATP2 69 intron8 + 668 taagtaatgtaaattaggat G/T catcagcatttgacagtgcc 2884 CATP2 70 intron8 + 739 tggagaaccattgagagtca A/G taaacaaagagaatgacttg 2885 CATP2 71 intron8 + 2193 tgatcacagatccaaatgac A/G taatttctaccatgaacaga 2886 CATP2 72 intron9 + 112 attttagtaatacaggataa G/C tataattttcttgtattctt 2887 CATP2 73 intron9 + 266 ttagaggtagtatctgtata A/G ttggatcttataatttagtg 2888 CATP2 74 intron9 + 305 tgctaagatctgagacaaac C/G cttttgtaattataatcatt 2889 CATP2 75 intron9 + 888 aggttctgtatgttttttaa T/C aaatgacaaagatatattaa 2890 CATP2 76 intron11 + 10224 tacacttgttccataaaaaa T/C tcctctatattattcctagt 2891 CATP2 77 intron11 + 10359 attaatagattcaccgtgag G/C ttcccttaaactttagccta 2892 CATP2 78 intron11 + 10916 cttatatagaaagaaatcca C/G aaaactattttaccttttat 2893 CATP2 79 intron11 + 10997 aatatattagtttgaacaag T/C gagacttcactaaatataat 2894 CATP2 80 intron11 + 11018 gagacttcactaaatataat G/A caatgtatttgcagcactgt 2895 CATP2 81 intron12 + 442 aacattccaaaacttttaat C/T gactcacagcatgactttta 2896 CATP2 82 intron12 + 445 attccaaaacttttaatcga C/T tcacagcatgacttttataa 2897 CATP2 83 intron12 + 447 tccaaaacttttaatcgact G/A acagcatgacttttataata 2898 CATP2 84 intron12 + 907 aatgaaaagaagctggcaga T/C tgaaacatactgaatgagag 2899 CATP2 85 intron13 + 65 tatatatatatatatatata C/T acacacacatacatatatta 2900 CATP2 86 intron13 + 870 aattctgagtatcctatttc G/A atgtatccaatctgtggcac 2901 CATP2 87 intron13 + 1935 taaaaaaaaaaaaagtctgc T/C tttacagcaattgagccaag 2902 CATP2 88 intron13 + 2261 aacgaatcctccaaattttt G/C aacttttatttaatcaaaat 2903 CATP2 89 intron14 + 248 tcaaggataataaccaactt G/A tcaaaaatcagagataatag 2904 CATP2 90 intron14 + 2463 atttgtttactaatatggaa C/G cttcttcaagacatattttt 2905 CATP2 91 intron14 + 2857 tcatcatgtatttccaggac A/T cctggcaagatgctcctcag 2906 CATP2 92 intron14 + 11458 atctccagaggtcctgctgt C/T tcccaaagtcccactgaccc 2907 CATP2 93 3′untranslated + 2243 ataataaaacaaactgtagg T/C agaaaaaatgagagtactca 2908 CATP2 94 3′untranslated + 2404 tcttaataaaacaaatgagt A/G tcatacaggtagaggttaaa 2909 CATP2 95 3′untranslated + 2515 cagagtttgaactataatac T/G aaggcctgaagtctagcttg 2910 CATP2 96 3′untranslated + 2539 gcctgaagtctagcttggat A/G tatgctacaataatatctgt 2911 CATP2 97 intron1 + 457 taattggcaaacataaaaaa (A) caggtgtctcaaagtcacat 2912 CATP2 98 intron1 + 457 taattggcaaacataaaaaa caggtgtctcaaagtcacat 2913 CATP2 99 intron1 + (7537-7538) gatcagcattacaaccaaga (G) atggagaatgacattcagga 2914 CATP2 100 intron1 + (7537-7538) gatcagcattacaaccaaga atggagaatgacattcagga 2915 CATP2 101 intron1 + (10032-10035) tgtgtgattctatattactt ACTT/&Dgr; gtttcaaatttctctccaca 2916 CATP2 102 intron1 + (10058-10061) ttcaaatttctctccacaaa TTTA/&Dgr; tttttctattaaattgtaat 2917 CATP2 103 intron2 + (413-423) acttatttaaaaattctttt (A)11-13 caaaaaacaggattttaaaaa 2918 CATP2 104 intron3 + (1595-1603) ttgccaagtaattcaagtgc (T)8-10 gtatttaaaacaacttttca 2919 CATP2 105 intron4 + (10-23) ttcatgggatagtaagtgtt (A)12-14 cctctgtgccactatcagta 2920 CATP2 106 intron5 + (1567-1572) gtgaatataaattacttgta CTTGTA/&Dgr; aattaaaaaaaaataagtag 2921 CATP2 107 intron5 + (1577-1585) attacttgtacttgtaaatt (A)9-10 taagtagaataattaagagt 2922 CATP2 108 intron8 + (1939-1941) ttctctaactccttctactc CTT/&Dgr; atttcaagcagatgcaactg 2923 CATP2 109 intron10 + (3077-3078) aaattctttatctacttttt (CTT) ttccctctttctctgctttc 2924 CATP2 110 intron10 + (3077-3078) aaattctttatctacttttt ttccctctttctctgctttc 2925 CATP2 111 intron11 + 11011 aacaagtgagacttcactaa A/&Dgr; tataatgcaatgtatttgca 2926 CATP2 112 intron12 + (1160-1169) agcatgacatggtagagatg (A)9-11 gcatttttaacatttgttaa 2927 CATP2 113 intron12 + (1310-1312) tccatcttaatataaaatgt TGT/&Dgr; ctactcaaaaggagaagtct 2928 CATP2 114 intron13 + (9-34) tacgagcactaggtatgatg (A)24-27 tatatatatatatatatata 2929 CATP2 115 intron13 + (35-64) aaaaaaaaaaaaaaaaaaaa (TA)10-21 cacacacacatacatatatt 2930 CATP2 116 intron13 + (1379-1387) aaaattattcaccacaatac (A)8-10 caaagtaaagttatgaacac 2931 CATP2 117 intron13 + (1916-1928) aattctcttaaaataatgtt (A)11-13 gtctgcttttacagcaattg 2932 CATP2 118 intron14 + (588-596) caattatactttacctcttt (A)8-10 ctaatttcaaattcatatat 2933 CATP8 1 5′flanking − 1413 aataggggcttaataactct G/C aaacttatgatttctcatat 2934 CATP8 2 5′flanking − 1345 gaatttatcctacagatatg A/G ccacacagaaaatgacatat 2935 CATP8 3 intron1 + 38962 atgaaattagtttaaaaata G/A caaccttaactatactcctc 2936 CATP8 4 intron2 + 253 acagacttaccaacaaagaa T/G tatccttcccaaaatgtcta 2937 CATP8 5 intron2 + 329 actcatggtttgcaaattaa C/G tttttaggaaactttatctc 2938 CATP8 6 intron2 + 2568 ccattctggtgctttctttc G/A tgaaactattttccatcagt 2939 CATP8 7 intron2 + 2679 ctcttattgctcttcttcca T/G gttttaatctaaataattta 2940 CATP8 8 intron2 + 2753 caggaaactttcacaaagcc C/A ctaattaatttaagctccct 2941 CATP8 9 intron2 + 3132 tggtttaatgtaggagagtt T/C gttttaatctaaataattta 2942 CATP8 10 intron2 + 3193 aatgtcttgggcatatttgc A/G ttcatttggggcattcagtt 2943 CATP8 11 intron2 + 3207 atttgcattcatttggggca T/C tcagttctactagatacaaa 2944 CATP8 12 exon3 + 334 gaactggaagtattttgaca T/G ctttaccacatttcttcatg 2945 CATP8 13 intron3 + 76 agaattttatttttatactt G/A taagtgggcagttacctttt 2946 CATP8 14 intron4 + 2443 tcaatttcatgttgctctta C/T agttataggtattctaaaga 2947 CATP8 15 intron4 + 67 taatcacgtctataaagttt C/G tgatattctttaacaaaatt 2948 CATP8 16 intron4 + 91 tattctttaacaaaattgat T/A attttgtaacgacaaaagaa 2949 CATP8 17 intron4 + 197 ggtttgaactgcacctgttc G/A cttatatgcagcttttgtcc 2950 CATP8 18 intron4 + 813 tttaacagaataaaaaaaaa T/A attttgtaacgacaaaagaa 2951 CATP8 19 intron4 + 974 atatgcaccttaaaaataac C/G tggatttttaaatatgtaat 2952 CATP8 20 intron4 + 1003 taaatatgtaatgtacataa G/T gaatattatgcatattttgt 2953 CATP8 21 intron6 + 155 cattaataatcagaataaaa A/G agaaatttagctcctattta 2954 CATP8 22 intron6 + 750 atccaactggggtttagatt T/G cctctttctgcctctcctcc 2955 CATP8 23 intron6 + 780 gcctctcctccatctgcacc C/T tctcttttcctcagcaaaca 2956 CATP8 24 intron6 + 1248 ctatgccctgtaatctcaca C/T ttccctttatttaaaattgg 2957 CATP8 25 intron6 + 1500 tcgtgtctgtgttagcatat A/G ataactcatcagggtttgtg 2958 CATP8 26 intron6 + 2008 ataacataaatgagtaaaga A/G tatcaagggcaggaaattag 2959 CATP8 27 intron6 + 2087 actactctccccatacacac T/C aaaactcatgtgctccccag 2960 CATP8 28 intron6 + 12305 tcatctatggaggactgcaa T/C cattatcattatttcccaga 2961 CATP8 29 intron7 + 363 taacaaatgataccagccat C/G atactattctctggtaatag 2962 CATP8 30 intron7 + 411 cctttattttttgagaacct G/A gtggatgatattaagacgta 2963 CATP8 31 intron7 + 428 cctggtggatgatattaaga C/A gtatatagatcactgtaata 2964 CATP8 32 intron7 + 634 aaaattatatatatacatat A/G taatcttacctaagtattca 2965 CATP8 33 intron7 + 1791 tgtttttttaagggtagtga T/C gtgaatagtaaagcgaattt 2966 CATP8 34 intron7 + 2000 agttgagcaaattgctctca G/A gtagcataatgtcacttgaa 2967 CATP8 35 intron7 + 2043 gtttattgatccatttttta A/G tggatcaacattgtagtgag 2968 CATP8 36 intron7 + 2171 atttattttgagcaaaggtc G/A cgactctcttagaaagcctc 2969 CATP8 37 intron7 + 2173 ttattttgagcaaaggtcgc G/A actctcttagaaagcctcac 2970 CATP8 38 intron7 + 2179 tgagcaaaggtcgcgactct C/T ttagaaagcctcacaaatca 2971 CATP8 39 intron7 + 2219 atttgtaactttaagtctta T/G ataacttatatttacaaaat 2972 CATP8 40 intron7 + 2261 cagatattaatatatatttt A/T ttattgaaatatgttatttt 2973 CATP8 41 intron8 + 150 acaaaatttctccatcttgt T/C atatcatcgttgttctgcat 2974 CATP8 42 intron8 + 154 aatttctccatcttgtaata A/T catcgttgttctgcatttga 2975 CATP8 43 intron8 + 1303 ttttttttgagatggagtct T/C atatcatcgttgttctgcat 2976 CATP8 44 intron8 + 1372 aagctccgcctcccaggttc T/G ccacccttctcttaaagaaa 2977 CATP8 45 exon9 + 1272 tccttcttgtttcaacttct A/G tatttccctctaatctgcga 2978 CATP8 46 intron10 + 63 tcacagatttgatttaataa A/T tacttatcaaatcttcctat 2979 CATP8 47 intron10 + 911 cttgcccaatatcctaccaa G/T gtattattaaacggcatgga 2980 CATP8 48 intron10 + 972 tcctagtttccttgaagata G/A gctacaactttagtaaactt 2981 CATP8 49 intron10 + 1101 tccctggtcctgtgttgtcc A/T gtagtgaagacctgaaagag 2982 CATP8 50 intron10 + 1103 cctggtcctgtgttgtccag T/C agtgaagacctgaaagagag 2983 CATP8 51 intron10 + 2027 cccattttcatgagtggcta A/G gttttgtcccgtttcaaact 2984 CATP8 52 intron10 + 2028 ccattttcatgagtggctaa G/A ttttgtcccgtttcaaacta 2985 CATP8 53 intron10 + 2148 gtattttggaaagaaaatgt A/G ggtggaagagaaatatttta 2986 CATP8 54 intron10 + 2214 atatacagaatttcatacac T/C aatttcttaaattcctaaat 2987 CATP8 55 intron10 + 2316 taaatattttagtttgagac T/G tctttaaatataatggaatg 2988 CATP8 56 intron10 + 2372 tgtatttggcaaatgtattt G/T ttaatatttcaaaaactatt 2989 CATP8 57 exon11 + 1557 cagaacagaaattactcagc A/G cacttgggtgaatgcccaag 2990 CATP8 58 intron11 + 147 tttcttagaattattttgat A/C tttcaataacatcattaata 2991 CATP8 59 intron11 + 10339 aaaaaactgcattttagtgg G/C ttagctagaaaagatttgtc 2992 CATP8 60 intron11 + 10358 ggttagctagaaaagatttg T/G ctcatatacacaataaatta 2993 CATP8 61 intron11 + 10538 caacagaggatcaatgtaaa T/G gaaatctcttaaattaaaca 2994 CATP8 62 intron12 + 55 ataaatattaatgttaaata C/T taaagactgaatgcaattaa 2995 CATP8 63 intron12 + 1802 taaaatgaatcggtaaaaca T/G tcatgtataaatcactgtca 2996 CATP8 64 intron12 + 2612 ataggcatataatactcttt C/A ttccctctgtatatagggag 2997 CATP8 65 exon13 + 1833 aacagctgtggagcacaagg G/A gcttgtaggatatataattc 2998 CATP8 66 5′flanking − (1590-1587) atatacataacatataccta TATC/&Dgr; tatgttatgtgtctgcttat 2999 CATP8 67 5′untranslated − (11-28) agcatcagcaacaattaaaa ATATTCACT 3000 TGGTATCTG/&Dgr; tagtttaataatggaccaac CATP8 68 5′untranslated − (4-7) tattcacttggtatctgtag TTTA/&Dgr; ataatggaccaacatcaaca 3001 CATP8 69 intron4 + (213-214) cctgttcgcttatatgcagc (T) ttttgtccaaccaaacagaa 3002 CATP8 70 intron4 + (213-214) cctgttcgcttatatgcagc ttttgtccaaccaaacagaa 3003 CATP8 71 intron4 + 505 tataactttctctttataaa G/&Dgr; atgcaaaatgttatagcatt 3004 CATP8 72 intron4 + 616 aaaaataaatgaagtggagg A/&Dgr; aaaaaaatgatttcaagttt 3005 CATP8 73 intron4 + (804-812) acatccatgtttaacagaat (A)9-11 tattttgtaacgacaaaaga 3006 CATP8 74 intron4 + 855 gagattgtttaaccaaatta G/&Dgr; gaaactattattccaacacac 3007 CATP8 75 intron7 + (619-628) ttttatatatgaattaaaat (AT)4-5 catatataatcttacctaag 3008 CATP8 76 intron7 + (1773-1779) attttctatattatgaactg (T)7-8 aagggtagtgatgtgaatag 3009 CATP8 78 intron8 + (1270-1290) tagtgtgccacccttctctc (T)19-23 gagatggagtctcgctctgt 3010 CATP8 79 intron10 + 665 ttctttcttaactcaaaggc T/&Dgr; tttttttttccatgtgacac 3011 CATP8 80 intron11 + (247-250) aaaaatcttaaggcacacac TGAT/&Dgr; tgacagttgccttgattgta 3012 CATP8 81 intron12 + (1622-1630) aaataaattgttggcatcta (T)8-10 atttttctaagggtcgctgt 3013 CATP8 82 3′untranslated + (2464-2465) gagaaaagcctgatgccttt A/&Dgr; aaaaaaaatgaaacactttg 3014 CAT1 1 5′untranslated − 127 gcagctcggactcagctccc G/A gagcaacccagctgcggagg 3015 CAT1 2 5′untranslated − 20 gaaggcctcagcccccagcc A/G ctgggctgggcctggcccaa 3016 CAT1 3 intron3 + 150 caatagaacaaccttttctc G/A ggctcatgccgccctgaccc 3017 CAT1 4 intron4 + 211 ttctctggcttcccccactc A/C gttctccagcctgcctgctc 3018 CAT1 5 intron5 + 33 gagacttcccatgataacct C/T ccagggcttcacccccaaac 3019 CAT1 6 intron6 + 168 gaaccagatgcccccagcct C/T gactcagtcccagtctccac 3020 CAT1 7 intron1 + (58-71) ggaagatgggggcctttgtt (A)13-15 gtacatggagaaattaactg 3021 CAT1 8 intron3 + (1306-1319) aataggttgaggaggagcag (A)12-15 tcaagagtgtggagggggca 3022 CAT2 1 intron4 + 842 ttgacctccaaaagtgtttg G/A attacaggcatgggccattg 3023 CAT2 2 intron5 + 33 gtgtgtgtgagcatgcatat C/A tgtgtgtggtggggagtggg 3024 CAT2 3 intron5 + 183 ccacatccatcattcgagac A/C aactcgtctcagctgccatg 3025 CAT2 4 intron5 + 184 cacatccatcattcgagaca A/C actcgtctcagctgccatga 3026 CAT2 5 exon7 + 1269 actagactgctagtgtcctc C/T ggtgagcccagtcccatagg 3027 CAT2 6 3′untranslated + 1792 ataaatgtgtacatgagtgt A/G tgaacacaaatacataaggt 3028 CAT2 7 3′flanking + 1386 tgtagcagcccacatcgcca G/A tgttcacacctgagagagag 3029 CAT3 1 5′flanking − 580 ctgtgtcagagacacagaca C/G ggaggtcctggctgccccag 3030 CAT3 2 5′flanking − 463 ttcctgagaggcaaatcccc T/C tcccctactcgggaggtgcc 3031 CAT3 3 5′untranslated − 16 cctgcccacagctctggctc G/A tcttgccccagtgccatgac 3032 CAT3 4 exon2 + 153 cctgcccacagctctggctc G/A tcttgccccagtgccatgac 3033 CAT3 5 intron2 + 177 gcaccaagacccttggcttc T/C tcccactcagagtccaagca 3034 CAT3 6 intron2 + 6201 gctcatcctctctggtcctt T/G tgccccagcacaggttcctc 3035 CAT3 7 intron3 + 79 tctgctccacccgtgcaccc G/C caaagaggcaaagagctggg 3036 CAT3 8 exon5 + 723 tggcgttggctgcagttaac T/A gtgtccattcccttcttcgt 3037 CAT3 9 intron5 + 524 tcgaagtacaaaggaaagtt T/C aaagagaagcctgagcctgg 3038 CAT3 10 intron7 + 386 gaccaatgggtttcagactc G/A aagacaaaaattatgtttat 3039 CAT3 11 intron7 + 754 gcccacgtcagacatgacca G/A aagacaaaaattatgtttat 3040 CAT3 12 intron9 + 81 attgtcctgtcctctaccca G/A tcaatcacagcactttctcc 3041 CAT3 13 5′flanking − (661-680) tacatttggtccccaggggg (G) agcggctgatcaggagagaa 3042 CAT3 14 5′flanking − (661-680) tacatttggtccccaggggg agcggctgatcaggagagaa 3043 CAT3 15 intron11 + (211-212) tctgacttggactgggcaaa AA/&Dgr; gtatggtggtatctggacag 3044 ALDH1A2 1 5′flanking − 714 aagggatcatcattctgaga C/G cgaggagagggggactcgaa 3045 ALDH1A2 2 intron1 + 314 cagggatcctcattctgaga G/&Dgr; aaggcgtcgaacccgcttag 3046 ALDH1A2 3 intron1 + (864-875) ttttgaactgaagaacttac (T)11-12 ataacgaacgtgacgtctt 3047 ALDH1A2 4 intron1 + 1370 gcatgagacagaagtttttt A/G ttttatgagggtctctaacc 3048 ALDH1A2 5 intron1 + 1667 aatacgtgtttcagaattta A/&Dgr; tttggtaagctcttccagttc 3049 ALDH1A2 6 intron1 + 1934 tcagctctttagtgagactt C/G tgaattttctaagacagcca 3050 ALDH1A2 7 intron1 + (1971-1980) agcacagtgcacaagcagtc (T)6-11 aaaacgtgaagagcagaagct 3051 ALDH1A2 8 intron1 + 2285 tactgcaacgcagggggtta T/C tgttttttgtcttgctaaac 3052 ALDH1A2 9 intron1 + 2287 agcacagtgcacaagcagtc C/T tacttaaaataaatgaccac 3053 ALDH1A2 10 intron1 + 2641 aggactgtgctttttcaaac T/&Dgr; agatggtgctagtcaaaggag 3054 ALDH1A2 11 intron1 + 3035 gacttttataattttgcata A/G ctgatattataggaatacac 3055 ALDH1A2 12 intron1 + 3319 aaagagttatgttttttttt T/&Dgr; atgcatctgatatttatatgg 3056 ALDH1A2 13 intron1 + 3474 tgtctttttattttattcat T/C taaacttctgttttataacg 3057 ALDH1A2 14 intron1 + 4126 ccttccaacccatttactta G/C attgtcgttttggtcactaa 3058 ALDH1A2 15 intron1 + 4227 cataaattgtcagtcaaact A/G catgttaatagaccacttca 3059 ALDH1A2 16 intron1 + 4254 cggacttcaggttttttttt T/&Dgr; aaatacttttttcataactat 3060 ALDH1A2 17 intron1 + 4357 tccttccactagatgggcct A/G tggtaccatgtggaattata 3061 ALDH1A2 18 intron1 + 5323 taatccaggttgcaaataga T/C gtatctggtattttaagtag 3062 ALDH1A2 19 intron1 + 8206 ttttgacaaacctcctagca T/G ttctttaatttctctgttga 3063 ALDH1A2 20 intron1 + 9565 agataaactgatgaataatt C/T actctgtgctgctgatagct 3064 ALDH1A2 21 intron1 + (6831-9639) taaaaacggaatgctgaaaga (AAGA) ccttttttgaattaactact 3065 ALDH1A2 21 intron1 + (6831-9639) taaaaacggaatgctgaaaga ccttttttgaattaactact 3066 ALDH1A2 22 intron1 + 12731 atgaaatagaaagggtgagg T/A gtaccttggagagaagtgat 3067 ALDH1A2 23 intron1 + 13642 cagtgtcataaagatacacc G/A gagatcaaaatgtttcatat 3068 ALDH1A2 24 intron1 + (14173-14176) tctaaaaaataaataaata AAAA/&Dgr; gagaaagttaagtttaagat 3069 ALDH1A2 25 intron1 + 14538 actcatttattggttcaaag gcgaaagttaagtttaagat 3070 ALDH1A2 26 intron1 + 14685 ttggatcaaagccttcttaa A/G ccttaggatatgtattgagg 3071 ALDH1A2 27 intron1 + 14711 gttgagacattaacttacta A/G tttaaatgaagatgctagtt 3072 ALDH1A2 28 intron1 + (15227-15337) gaagagcacagtagaaagcc (T)6-11 aaggctagcactactattga 3073 ALDH1A2 29 intron1 + 17236 atcagtaccatgtgttggga A/G tacaacaattaacttaaagt 3074 ALDH1A2 30 intron1 + 18277 taatacaactcatttgaagg A/G tttagtcttaaaaaaacgaa 3075 ALDH1A2 31 intron1 + 18734 ctttgagaccctactggatc T/A taagtgatgtgagatgtggg 3076 ALDH1A2 32 intron1 + 19021 ttaatcacctaaatgtttaa C/T gaataagttgattttttcta 3077 ALDH1A2 33 intron1 + 21634 aatcaggatatgggggtttc G/A ttctttattctgccaaaaat 3078 ALDH1A2 34 intron1 + 21730 catttaaagtagtgatttta A/G taggagttggctgttacagt 3079 ALDH1A2 35 intron1 + 21566 taggataggtttcaaatgtg C/T tgttgtaggactcttttcca 3080 ALDH1A2 36 intron1 + 26782 aaaagaagaagaaaaaaaaa A/&Dgr; atggtatgagacttggtagg 3081 ALDH1A2 37 intron1 + 27885 ggatgatcctacccaaggga T/C tggcactttccagacagtat 3082 ALDH1A2 38 intron1 + 28204 gcactcaatgttttaactgt C/G cttctaattgtgtggttaaa 3083 ALDH1A2 39 intron1 + 28521 tctttgttacaattcctaag T/C aggggtatcagataatcctc 3084 ALDH1A2 40 intron1 + 43476 gaataggaggatacggtcaa G/T taacagagataaaaacctgc 3085 ALDH1A2 41 intron1 + 49334 gaatctggattctctcatgt G/T agaaatttcactatactgct 3086 ALDH1A2 42 intron1 + 50361 gagtgactggttcataagtc C/T gtaacaattggtagttaact 3087 ALDH1A2 43 intron1 + 51181 gtaaaaggaatccttaagaa C/T aactgtcaatctgtgagcca 3088 ALDH1A2 44 intron3 + 654 ttaacctctcttgagtaaaa G/A gaatacttgagaactcactg 3089 ALDH1A2 45 intron3 + 664 gtaaaaggaatcattaggaa C/T cagaggcgatggtaaggaat 3090 ALDH1A2 46 intron3 + 712 aatagactactgctccgttt G/T aaatgtcattctgtgagcca 3091 ALDH1A2 47 intron3 + 1273 tattcatactatgaaaaagg T/A gtttcatggggaagaaattc 3092 ALDH1A2 48 intron3 + 1743 atacacctaactgagattcc C/T gttttaaacaatctcaagct 3093 ALDH1A2 49 intron3 + 2591 tgcagatatataatcattgt A/G gttttactaggaactaggac 3094 ALDH1A2 50 intron3 + 2819 ctaggaaatagacaaaaatg G/A cagtactagaaatcttttta 3095 ALDH1A2 51 intron3 + 220 aattgtgctagattaggtgc T/C ggggtacgtatgaagggaca 3096 ALDH1A2 52 intron3 + 280 cggcttactcctcctgaaca T/C ataagatatactgtttggaa 3097 ALDH1A2 53 intron3 + 461 cataatggctggttttcagt G/T tctttttatatttcctatgg 3098 ALDH1A2 54 intron4 + 506 tctacatttctcgaacggcc G/A tgaattacttactaatctgg 3099 ALDH1A2 55 intron4 + 1952 ttggtccctactccacctgt C/G atttcattattaaaacaaca 3100 ALDH1A2 56 intron4 + 2078 ctgtgtggcgtggcggtcgg C/T ctcagttttcttttacttcc 3101 ALDH1A2 57 intron4 + 2589 ttgcgtcagaaacctctctc C/G ggtggtgtctcaaacagatg 3102 ALDH1A2 58 intron4 + (2840-2851) tttgtatgtgcatagttggc (T)11-13 cacagtgaagtctggagtat 3103 ALDH1A2 59 intron4 + 7231 aataggatacaaatacacaa A/T gatagtgattcagatcctaa 3104 ALDH1A2 60 intron4 + 7958 taaaatcgtttttattgtta C/T taggtatataaaatttgcta 3105 ALDH1A2 61 intron4 + 8090 tctgattttatcactgttta C/T agattgcttagtcatactca 3106 ALDH1A2 62 intron4 + 12823 tgttagcctgtagctaaatg C/T ttttcaaatatgtgaacggt 3107 ALDH1A2 63 intron4 + 12939 atgaggtccgacttttaaga T/C ttttgtctacattttcttcc 3108 ALDH1A2 64 intron4 + 14935 tattgatggagttcttttta T/G aaatggacttttaccttctt 3109 ALDH1A2 65 intron4 + 15321 gcatttgggtgtctgagaga C/T atatccagaaatatgctatg 3110 ALDH1A2 66 intron4 + 15412 tttcaagtttatttctgttt T/G aaatggacttttaccttctt 3111 ALDH1A2 67 intron5 + 1888 aatccaaacatctgtacttt G/T tagtggacaagatttatgtc 3112 ALDH1A2 68 intron7 + 9166 gaaaagctactttattcaaa G/A ataaaagtattttaagaaaa 3113 ALDH1A2 69 intron7 + 9914 aagctggagaaaatactagg C/T tttcctcaacagtgatttcc 3114 ALDH1A2 70 intron7 + 18942 tttggaggggaactaatccc G/A tgacttctaggttatctctt 3115 ALDH1A2 71 intron7 + 19820 ttcacccctcattttaggtt A/G ggggaggtggcttgctacag 3116 ALDH1A2 72 intron7 + 19826 cctcattttaggttagggga G/A gtggcttgctacagttttag 3117 ALDH1A2 73 intron7 + 19913 cgtgaatcattcagtatttt A/G tttaaaaataccagtttgaa 3118 ALDH1A2 74 intron7 + (20110-20111) catgatttattctctaacta (ACTA) tgctaagtcaaagattctgc 3119 ALDH1A2 74 intron7 + (20110-20111) catgatttattctctaacta tgctaagtcaaagattctgc 3120 ALDH1A2 75 intron7 + 21857 acaatgaaaattaagaaagg A/T gaagagggaagaagcagaga 3121 ALDH1A2 76 intron7 + 21929 tacaagacacaggcatcttt A/G actagtttactgggatctct 3122 ALDH1A2 77 intron7 + 23308 ggctttgacttcggaaacct G/T tgggttataacaaagtactg 3123 ALDH1A2 78 intron7 + 23554 gacattggtgaaaaccaggg C/T tgtttaggagtgtcctgtcc 3124 ALDH1A2 79 intron7 + (23701-23703) catctgagatttgccttgtg GTG/&Dgr; tttaccgagttagtgggtgc 3125 ALDH1A2 80 intron7 + 26479 gatacatgaacaatttgttt T/C atcctcatgatatctttcaa 3126 ALDH1A2 81 intron7 + 26561 taaaggccacaatgcagtga T/C tgaaatctccagttacattt 3127 ALDH1A2 82 intron7 + 26662 tttccttagtccttccatca C/T gaaactaaagctgtcttcca 3128 ALDH1A2 83 intron8 + 76 tttatatctccacttttgat G/A ggacactagcaaaagatatt 3129 ALDH1A2 84 intron8 + (700-711) accatctcattcagtgattc (T)11-12 ccctccacttgttgccaggc 3130 ALDH1A2 85 intron8 + 724 ttttttttccctccacttgt T/C gccaggcagagctgctttcc 3131 ALDH1A2 86 intron8 + 800 cagattgcttgaatttcagc C/A ccagcttggaatttgcagag 3132 ALDH1A2 87 intron8 + 1251 gatttctgtgaaaattgaga G/A gatctggcaacctggggctc 3133 ALDH1A2 88 intron8 + 1627 ggcccctccccaggcaaagc G/A gtgagaacatggctgtttcc 3134 ALDH1A2 89 intron9 + 141 tggagcgggccaagaggcgc G/A tagtggggagtccctttgac 3135 ALDH1A2 90 intron9 + 778 aaccagtctggacagatccc T/C tgtagcttgtgaaagtgtag 3136 ALDH1A2 91 intron9 + 801 tagcttgtgaaagtgtagga A/G gtgaagggctggctcacttc 3137 ALDH1A2 92 intron9 + 868 tctgaaggcctcgtgtactt T/C agtggggtggggagggccac 3138 ALDH1A2 93 intron9 + 1338 aatttttgcctctttttact A/G tcaatacaacttgctaagtt 3139 ALDH1A2 94 intron10 + (227-229) ctatgtgcttatgattatta TTA/&Dgr; gccaacagaacaatcagaat 3140 ALDH1A2 95 intron10 + 316 ctaaatgtgggtcactggga T/C gttaaccaggagagagaatc 3141 ALDH1A2 96 intron10 + 368 ctttacatctgtgcaagaga G/A ggacaaggagcaaatcagcc 3142 ALDH1A2 97 intron10 + 660 gtaaacttgcattgaaatgt G/A gaaagcaggtaaaggaatga 3143 ALDH1A2 98 intron11 + 104 tggggaataccaaaagcaac C/T aaagttcaccagaaaagggg 3144 ALDH1A2 99 intron11 + 229 aaacttctaaaagaaatacc A/G tgccagtcagattatgtgct 3145 ALDH1A2 100 intron12 + 117 catacattcaccaaacattt C/T gtggagcacatgctactata 3146 ALDH1A2 101 intron12 + 691 gatagggaagatcactgtga A/G ctggaaaaatctgggaaacc 3147 ALDH1A2 102 intron12 + 1934 catcttgtctagattgcatg T/C ttgtttgtttgtttgtctct 3148 ALDH1A2 103 intron12 + 1973 ctacttacccccaaaacatg T/A tttctctttcttaaatgacc 3149 ALDH1A2 104 intron12 + 2722 ccagagtgactccagtatac C/A tcactgcccaggacccacag 3150 ALDH1A2 105 intron12 + 3855 cacttgaaagcaaccataat T/C gtgaggtttctgatgctgta 3151 ALDH1A2 106 intron12 + 4185 ttgctttaagcgaaatgaac T/C atacggacaggagaacagcc 3152 ALDH1A2 107 intron12 + 4991 acaggaacacttagacatgc A/G acccactcccaccctccgtc 3153 ALDH1A2 108 intron12 + (5018-5019) cccaccctccgtcttggggg (G) aggaaagcacactactgtcc 3154 ALDH1A2 108 intron12 + (5018-5019) cccaccctccgtcttggggg aggaaagcacactactgtcc 3155 ALDH1A2 109 intron12 + (5051-5052) actgtcccaaagaactaata (A) ctgaaccagtgctgccttgt 3156 ALDH1A2 109 intron12 + (5051-5052) actgtcccaaagaactaata ctgaaccagtgctgccttgt 3157 ALDH1A2 110 intron12 + (5300-5302) ttaaagttttaaaaaaactt CCT/&Dgr; taaaaactactcatgagatg 3158 ALDH1A2 111 intron12 + 5405 catcccaggacttgctgttc G/C caggtgataaactgcacctc 3159 ALDH1A2 112 intron12 + 5435 aactgcacctccccaggact C/A ccgctgcactcacatgcagc 3160 ALDH1A2 113 3′flanking + 449 tttgggccgggaacaatttt T/C caaggttgtaaagccaaatt 3161 ALDH1A2 114 3′flanking + 597 acctgggatattcctgaccc A/C atctggttttcttttaccca 3162 ALDH1A2 115 3′flanking + 669 atagagactggaagtcatca T/C gtgcagttcaccgcttctga 3163 ALDH1A2 116 3′flanking + 1122 cgtgctccactgagctcctc T/G gtcacaccccattcttgccc 3164 ALDH1A2 117 3′flanking + 2214 tgcagctgtaaaaagaaatc T/C gtaaatggtgaccgtactac 3165 ALDH1A3 1 5′flanking − 1425 cagtgttagccagccgatat C/T ggtcaaggctgccccgctcg 3166 ALDH1A3 2 5′flanking − 1379 ccattatcccctttccccgg C/T ctcagctgtgcactccaggc 3167 ALDH1A3 3 5′flanking − 1270 aacttacccctctatccagc T/A ctatccagaaggacaccagg 3168 ALDH1A3 4 5′flanking − (1214-1213) acggaggcctcaaaacagga (GGA) aaataaggagacccctcccc 3169 ALDH1A3 4 5′flanking − (1214-1213) acggaggcctcaaaacagga aaataaggagacccctcccc 3170 ALDH1A3 5 5′flanking − 1103 gcacagcttttgtcaggagt C/T cgtgcctccggtctttgttc 3171 ALDH1A3 6 intron1 + 986 gccttaactttccccacctt T/G ggcttctcttgatttttgct 3172 ALDH1A3 7 intron1 + 1462 gtacaggatttcaaaatact G/A caacctttgccagttaaagg 3173 ALDH1A3 8 intron1 + 1661 cctgttgtcttggtgggtgc G/A caacctttgccagttaaagg 3174 ALDH1A3 9 intron1 + 2360 agaggatagaagtcccttct A/G atttagagggcctctttctt 3175 ALDH1A3 10 intron1 + 2516 tgaaaacatattctttttga G/A tttagctgagtggcctgttg 3176 ALDH1A3 11 intron1 + 2624 cctgagacaccttacagctc C/T gtcctgcttccatgtcattc 3177 ALDH1A3 12 intron1 + 3255 tttcatctttctacaaatgg G/C cccctcttcctggctgcact 3178 ALDH1A3 13 intron1 + (3643-3656) gcttcagaggtttttgtggg (T)12-14 aacattctatcaacttttaa 3179 ALDH1A3 14 intron1 + 4265 ccaaaagccctctcttttaa T/C atgacattaataagacaatt 3180 ALDH1A3 15 intron1 + 5187 caagatggataagacgtcac C/T taaggtccttagcatgttga 3181 ALDH1A3 16 intron2 + 43 ctctaagtaattcaattatg G/T atgaccaaaggataaggaaa 3182 ALDH1A3 17 intron2 + 127 cagggcctgggctagctgcg T/C gaattggcatgtggttctca 3183 ALDH1A3 18 intron2 + (285-300) aggaaaggttttcttttttc (T)16-17 atcaattatttggacctgga 3184 ALDH1A3 19 intron2 + 778 cgtgtgcagagtaggcttgg A/G ttttatcttgcccatgagtt 3185 ALDH1A3 20 intron2 + 1216 actcggtagagtcactcctg A/C ctggtgtcccacatccactc 3186 ALDH1A3 21 intron3 + 81 accatggggtatgggaaaaa A/C gatcacggtcctggttttgt 3187 ALDH1A3 22 intron3 + 236 gctcagcttcttgaccaagt T/G gttgtctataggcagttgag 3188 ALDH1A3 23 intron3 + 1467 ggcccggttgtaggggagga G/T atctcctttctggcctttga 3189 ALDH1A3 24 intron3 + 1725 ccacatgttccccgggtgag A/G gtagctccctcccagggtaa 3190 ALDH1A3 25 intron3 + 3777 gccagaagtagatgccccca A/G ttcagctgctgcattactgg 3191 ALDH1A3 26 intron3 + 3829 caagtcactgggccgttagc G/C tccgtgcctgcaccttgaag 3192 ALDH1A3 27 intron3 + 4299 tcactttccacagccacact G/A gccagcctggccgagaagga 3193 ALDH1A3 28 intron4 + 84 agagccccccctgactgttt C/G cctaaggcaccattcccaac 3194 ALDH1A3 29 intron4 + 126 ccactccctctccaaatggt A/G ctgccaattcttcttctaag 3195 ALDH1A3 30 intron6 + (290-291) tagagaattttcaggggggg (G) tcaaccaagagggagccaaa 3196 ALDH1A3 30 intron6 + (290-291) tagagaattttcaggggggg tcaaccaagagggagccaaa 3197 ALDH1A3 31 intron6 + 705 aacagctggtgatgagccaa T/G tttccactttcctttggtga 3198 ALDH1A3 32 intron7 + 56 ggggcgtgttatttgacacc C/T gtgagcttttcctttgacag 3199 ALDH1A3 33 intron7 + 1107 gatgctgttactctccttgg A/G gacagacactgccctgtgga 3200 ALDH1A3 34 intron7 + 1610 aagagccacacagaaccacc C/G ccctactgggctgttggaat 3201 ALDH1A3 35 intron8 + 1820 cacctgtaagtggagcggct T/C agaccaaggatcccaggatg 3202 ALDH1A3 36 intron8 + 963 gagaaaggacaggaggagga C/T acaggctctcaggaaggaaa 3203 ALDH1A3 37 intron8 + 1824 accattcttatccactaagc G/A tgtcccccaagatcttattc 3204 ALDH1A3 38 intron9 + 2384 cgcctccctcgcccctcccc C/A tccagtggacttggcagtgg 3205 ALDH1A3 39 intron9 + 24 atccccctggtgtgtgtgaa A/C ccatggtgcttgtctagggg 3206 ALDH1A3 40 intron9 + 91 gcctacagggtccctctccg T/C gaaaggaatgctgacctgtc 3207 ALDH1A3 41 intron9 + 219 actgaggcatgggaggaggg C/G gctattcccagggcagaagg 3208 ALDH1A3 42 intron9 + 495 ccagacggagagagcctggg G/A caggagaatgtatctccagg 3209 ALDH1A3 43 intron9 + 1472 ttgacttttgaggccagata C/T accgatttcttccaagagaa 3210 ALDH1A3 44 intron9 + 2038 taaacaatgtgttcctacgg G/A ctctccagggagtgtggagt 3211 ALDH1A3 45 intron9 + 2124 caaacagggtctgccagatg G/A catatgcccagcagccaggg 3212 ALDH1A3 46 intron9 + 2154 agcagccagggaggacctgc G/C gttgggcgaagcccctgtgt 3213 ALDH1A3 47 intron9 + 2197 cttttggcccctcagggagg G/A gaagagcagctcagcagcat 3214 ALDH1A3 48 intron9 + 2466 ttcttagttcctcatgtttc C/T ctctagaatgttttcgtgtg 3215 ALDH1A3 49 intron9 + 3655 gattggtcaagtggcatgca C/T ggtttatgccctctctcctg 3216 ALDH1A3 50 intron9 + 3954 gggtgcgcttttgacaactg C/G tcagtagcgtgttcacaagc 3217 ALDH1A3 51 exon10 + 88 tggaatgcgggggctcagcc A/G tggaagacaaggggctcttc 3218 ALDH1A3 52 intron10 + 8 tgccaaagaggaggtacaag G/A gggctgtggcaaggctacga 3219 ALDH1A3 53 intron10 + 307 ctctctgattttctaacaca A/C ccggtccccgagtcagtcat 3220 ALDH1A3 54 intron10 + 378 gtgggttttgccaggaatca G/A ttcaagaacctgtggattca 3221 ALDH1A3 55 intron10 + 975 aatattgtgtcattccttcc C/G ctggtagttattatggaaac 3222 ALDH1A3 56 intron10 + 1088 cagtgccaggagccaggggg C/T cttctccagatgactctgag 3223 ALDH1A3 57 intron11 + 105 ttgtttacattgtatattat A/G taccaagccctgtctcagtg 3224 ALDH1A3 58 intron11 + 274 agggctccagtacctgtgcc T/G gtggcccctgtgctgtactg 3225 ALDH1A3 59 intron11 + 1088 cagtgccaggagccaggggg T/A cttctccagatgactctgag 3226 ALDH1A3 60 intron12 + 96 ctccaatctgctgacacccc G/A tccccccccacaccgcgctc 3227 ALDH1A3 61 intron12 + 5642 tctgtgctaacgtctgcttc T/C ctcatgccccctaggctggc 3228 ALDH1A3 62 exon13 + 104 gggctccttcctcaaacatc G/C gacggcggaatgtggcagat 3229 ALDH1A3 63 exon13 + 281 ataggttgtctgtgaaatcg C/T agtcctgcctggggagggag 3230 ALDH1A3 64 3′flanking + 743 gtgagcaggaaactgtagga G/A aaggatattttccctcattt 3231 ALDH1A3 65 3′flanking + 1145 gcctcccagctaccccaccc A/G cctcaggaggggtcattcca 3232 ALDH1A3 66 3′flanking + 1185 aacctagggtgctgagaatc T/C gggtgggattaccagcaaaa 3233 ALDH1A3 67 3′flanking + 1600 acaccacgccctgcaaattg T/C tgggaacttgtcggtggcaa 3234 ALDH1A3 68 3′flanking + 1847 caggagccctgcggctgccc C/G ggttctgtgaaatggcagtg 3235 ALDH1L1 1 intron1 + 252 cgcagcgccaggactggccc G/C ccgaggatctggccggccgc 3236 ALDH1L1 2 intron1 + 544 ctcaggggctgcgctggagt C/T ccagctccagccactgcgct 3237 ALDH1L1 3 intron1 + 6596 cagatttttcttaaggtgca C/G tagccactgaggatattttt 3238 ALDH1L1 4 intron1 + 6513 caattatggtttatcttagg G/A acatgtttatagagatagta 3239 ALDH1L1 5 intron1 + 6478 atagtattcttacttagctt G/A cattctaaattttgttccct 3240 ALDH1L1 6 intron2 + 240 gtggcattagggtcctggag A/G agggctatagagaagcccag 3241 ALDH1L1 7 intron2 + 1326 gaggaggagaccggagagga G/C agccagtccagtcagggccc 3242 ALDH1L1 8 intron3 + 386 gtcctactctaacttccact G/A ccgctgctctgggcagcaca 3243 ALDH1L1 9 intron4 + 271 gggcccgttcaatagacaag G/C aaggctaaaggcagggactg 3244 ALDH1L1 10 intron4 + 356 taggattctatttctctctc C/T ttcactcgttgattctcctt 3245 ALDH1L1 11 intron4 + 608 gtgctctgataggctgtctc A/C gtcacatgcttcctgctggg 3246 ALDH1L1 12 intron4 + 664 ggtcacatggcctgagcggc A/G gggcggctcagtcacctggg 3247 ALDH1L1 13 intron4 + 785 gagggctgcttgcccctgcc C/G gaggacaggctggcagggac 3248 ALDH1L1 14 intron4 + 874 ccctggggagcccttgctgt T/G tgggcgcagcaggaagagca 3249 ALDH1L1 15 intron4 + 1349 tccctcaggctcttgctcac G/A tgggcccagactccttggct 3250 ALDH1L1 16 intron4 + 1799 ctggggctgggaaggaggca G/A ggtcctattgctggggatag 3251 ALDH1L1 17 intron4 + 1815 ggcagggtcctattgctggg G/A atagcaaccaactggatctc 3252 ALDH1L1 18 intron5 + 272 aaagcccacagggagataag A/G gtgggagttagggggcaaaa 3253 ALDH1L1 19 intron5 + 301 tagggggcaaaacgtcagcc G/A tagtgcgagcagtcttcaag 3254 ALDH1L1 20 intron5 + 343 caaggtgtgagggacagtgc G/A ggtctctggagcaatagcca 3255 ALDH1L1 21 intron6 + 926 cctgcctgggctactggctt C/T gggggcttcttctcacccac 3256 ALDH1L1 22 exon7 + 41 aacgctgaacacttcaggcc T/C ggtgcccgagggagacgctt 3257 ALDH1L1 23 intron7 + 305 cctagaatcagagagaagcc C/T tcccagggagcctgggttca 3258 ALDH1L1 24 intron7 + 837 gtccggacaaaccccatggg C/T gtggtacccccagccgtgtt 3259 ALDH1L1 25 intron7 + 866 cccagccgtgttgctgtgtc C/T ggcctaccagagtgaggcgt 3260 ALDH1L1 26 intron7 + 884 tccggcctaccagagtgagg C/T gtggcagtatggggcctggc 3261 ALDH1L1 27 intron7 + 1118 aatgttccagaaaatcatgc G/C aggcagtaagggcagaggaa 3262 ALDH1L1 28 intron7 + 1168 aaagtaaaggttcaggagaa G/A tctagcctggggctgctccc 3263 ALDH1L1 29 intron7 + 1451 cagggcacccacagcatctg T/C taagtgtcttaagaggaagc 3264 ALDH1L1 30 intron7 + 1489 caggaatgcaaagaaggcaa T/C taagtgtcttaagaggaagc 3265 ALDH1L1 31 intron7 + 1579 tcagggtgggaggggagtga G/A gagagaccagctgagcacac 3266 ALDH1L1 32 intron7 + 1691 ctggctgggctttagcttgc A/C gaaagctccagaacatcttt 3267 ALDH1L1 33 intron8 + 2627 aaagaggagagccgggggtg C/T ttgtgccaggggttggggga 3268 ALDH1L1 34 intron8 + 2646 gcttgtgccaggggttgggg G/A aactggttctgattgggcct 3269 ALDH1L1 35 intron8 + 2925 ctgctgccctccataggtcc C/G agactgaatccttcagagga 3270 ALDH1L1 36 exon9 + 4 caggtcttgctttgcagagt G/T tttggcagcggatcctcccc 3271 ALDH1L1 37 exon10 + 109 cagctgttagtgaggaagct G/T cgaggggacgatgaggaggg 3272 ALDH1L1 38 intron10 + (671-672) tggcattttcctctgtctga (AG) gtcctcttagcccaccctaa 3273 ALDH1L1 38 intron10 + (671-672) tggcattttcctctgtctga gtcctcttagcccaccctaa 3274 ALDH1L1 39 intron11 + 8 caccgatggaagtgtgagtg C/A aggcccagcaccccttctcc 3275 ALDH1L1 40 intron11 + 447 atgagccaaagcacgcctat G/A gtagatacacacgtgaacat 3276 ALDH1L1 41 intron11 + 601 ctcaaagtgagtcatttgag A/G ggagttaatgaaagactcat 3277 ALDH1L1 42 intron11 + 639 catctgcaaagggagaggga G/A ggggtagggacacagacagg 3278 ALDH1L1 43 intron12 + 684 tcctgggagaagagagggtg C/T ggccagatgagccgagaaca 3279 ALDH1L1 44 intron12 + 767 cgtctaggggtgcgaagcca A/G gttatggcgtggtcccaacg 3280 ALDH1L1 45 intron12 + 1014 tcataggttccagtcccctt C/T gcaagcccctcaattctaga 3281 ALDH1L1 46 intron12 + 1359 ctggttctgcctcagctcag C/T acagcagaggctgggtctag 3282 ALDH1L1 47 intron12 + 1734 ggtggtccaggctgctggtg G/T tcagtagggccggccgagcc 3283 ALDH1L1 48 intron12 + 1901 ttcagcagcctaactgaatt G/A acaatagaatagtcctgcaa 3284 ALDH1L1 49 intron12 − 470 gggatggggccacctctcca T/C ctctggagatgccaggctca 3285 ALDH1L1 50 intron12 − 334 aagggcagcctcttgggcca T/C gacccctttgctgtctgcag 3286 ALDH1L1 51 intron12 − 325 ctcttgggccatgacccctt T/C gctgtctgcagcaagtgggt 3287 ALDH1L1 52 intron12 − 221 gaaggaagcgagggaagatc G/C aggaaaggagagagggacag 3288 ALDH1L1 53 intron12 − 4 cccgcttcccctcaccctgg T/C caggttggcagatctcatgg 3289 ALDH1L1 54 intron13 + 34 tcccacccagtgtgagcaca T/C gcagactggcccagccatat 3290 ALDH1L1 55 intron13 + 58 gactggcccagccatatagg A/G gaactccaagggcagcacag 3291 ALDH1L1 56 intron13 + 125 ccacaactggtggcttggaa T/C gacacctgtttattagcttg 3292 ALDH1L1 57 intron13 + 126 cacaactggtggcttggaat G/A acacctgtttattagcttgt 3293 ALDH1L1 58 intron13 + 281 acctgcatccagacgagttc T/G ggtgttgacagagttcagtt 3294 ALDH1L1 59 intron13 + 299 tcgggtgttgacagagttca A/G ttccgtgtggatgcagggct 3295 ALDH1L1 60 intron14 + 121 catttatcaaacagccatcc A/G tgtgcttcttgagcacctgc 3296 ALDH1L1 61 intron14 + 157 gccaggcattgttgtaagga C/T ttgaggacaattgtatttaa 3297 ALDH1L1 62 intron14 + 206 taatctcccagtaacactgg A/C tcagtcaggtccacggtggg 3298 ALDH1L1 63 intron14 + 219 cactggatcagtcaggtcca C/G ggtgggaaacaagagtaaac 3299 ALDH1L1 64 intron14 + 2275 tctcatctgtgatgcatccg T/C cagacctctgctcccagcct 3300 ALDH1L1 65 intron14 + 2431 agaatgactgagtgatcaga C/G ctagagagccccagccccgg 3301 ALDH1L1 66 intron14 + 2660 agccaagcatttcttgggga C/T accaagaaaccttgcttggt 3302 ALDH1L1 67 intron14 + 2740 aactccaccctcaccgtcca T/C gcagctccccaggagcgtca 3303 ALDH1L1 68 intron14 + 2756 tccatgcagctccccaggag T/C gtcagagggcagaggagggg 3304 ALDH1L1 69 intron14 + 2805 ccgcacagcaggagaatggc T/C ccaagggagggagggacggg 3305 ALDH1L1 70 intron14 + (3636-3637) tctcctgggtgtgtgtgggg (G) tgtggggcagctcccctatc 3306 ALDH1L1 70 intron14 + (3636-3637) tctcctgggtgtgtgtgggg tgtggggcagctcccctatc 3307 ALDH1L1 71 intron14 + 4347 tccaggacagaaacagcagg C/T gtgagctgcctctcagaggg 3308 ALDH1L1 72 intron15 + 380 atgtcccttatgtggcttcc A/G agaccagaagtcctggagag 3309 ALDH1L1 73 intron15 + (1055-1056) gccacaatctgcagctactc (C) tcccagcttgctgctgggct 3310 ALDH1L1 73 intron15 + (1055-1056) gccacaatctgcagctactc tcccagcttgctgctgggct 3311 ALDH1L1 74 intron17 + 15 gaaaaggtgcgtggctgggg G/C tggagcagaggaggggctgc 3312 ALDH1L1 75 intron17 + 44 aggaggggctgctgtgagtg C/T gcctgggacatggcagtgct 3313 ALDH1L1 76 intron17 + 51 gctgctgtgagtgcgcctgg G/A acatggcagtgctgtccaca 3314 ALDH1L1 77 intron17 + (2224-2223) ctggtgtcatctcccagact CT/&Dgr; gtcactaaaccacaatatga 3315 ALDH1L1 78 intron18 + 140 agcgtcatcacaagcatagc G/A tggcaggcagcaggcttagg 3316 ALDH1L1 79 intron19 + (51-52) tggttcactgggacagcagc GC/&Dgr; ctggctggagggggttggag 3317 ALDH1L1 80 intron19 + 399 tcaggtcagcctgggcctga C/A catggacaggggccctggag 3318 ALDH1L1 81 intron19 + 1794 gtcctgtctgggggtcttaa G/C ggagtcatgagacttccaca 3319 ALDH1L1 82 intron19 + 1969 tgatcggggtgcggtttggg G/T cgacaggacaggagcagaga 3320 ALDH1L1 83 intron19 + 1972 tcggggtgcggtttggggcg A/G caggacaggagcagagaata 3321 ALDH1L1 84 intron19 + 2083 tgagaagagcagaggggtgt G/T ccgggtgctcgagtcacacc 3322 ALDH1L1 85 intron19 + 2119 acacctgtgtctgattaggg C/T tgattaggggtgcagagttt 3323 ALDH1L1 86 intron20 + 1388 ttaccctcttcccactcccg C/T tggactgtgagttccatgag 3324 ALDH1L1 87 intron20 + 1564 cccaggaaccaggaacagtg G/A ggagccatcaccccgccctg 3325 ALDH1L1 88 intron20 + 1873 tcagtgttaaaacatcattt G/A tgtatgtatgaaaaatattg 3326 ALDH1L1 89 intron20 + 2427 actaggattggatggacttg G/C gatcaggtctcagctctgtc 3327 ALDH1L1 90 intron20 + 2458 cagctctgtcacctgccaac C/T ggcggccccatttccctcaa 3328 ALDH1L1 91 intron20 + 2544 ccaggtgggagagccatctg C/T agcgtggtgacacccatcac 3329 ALDH1L1 92 intron20 + 2573 gacacccatcacacgggtgc C/T gtgacccggtgcttatgtcg 3330 ALDH1L1 93 intron20 + 2574 acacccatcacacgggtgcc G/A tgacccggtgcttatgtcgg 3331 ALDH1L1 94 exon21 + 33 agccaactgttttcacagac G/A tggaagaccacatgttcata 3332 ALDH1L1 95 exon21 + 87 ccttcgggcctgtcatgatc A/G tctctcggtttgctgatggg 3333 ALDH1L1 96 intron21 + 323 ccatgcattaaaccaccccc C/G acactgagtggcttggaata 3334 ALDH1L1 97 intron21 + 361 ataatcagagatttatttta C/G tcacggtctaggttcaatga 3335 ALDH1L1 98 intron21 + 478 gtcttgcgggaggcttcctc C/A gcgtggcagcctcggggttg 3336 ALDH1L1 99 intron21 + 1086 caacccaatcttgcccccgg C/T gctgcagcccggcacatttt 3337 ALDH1L1 100 intron22 + 235 gggcctggaggagacactcc A/C gccaggaggcactgggggcc 3338 ALDH1L1 101 intron22 + 313 atagcagggaggagttggcc G/A tgaagacccaggggcccgtg 3339 ALDH1L1 102 intron22 + 1214 tgggcccacttatgaatcct G/C cccgagttccctcagctccc 3340 ALDH1L1 103 intron22 + 1226 tgaatcctccccgagttccc T/C cagctccctcctaaccctag 3341 ALDH1L1 104 intron22 + 1623 ggggcttcccactgtccaga C/G aaggcggtgggagctgggga 3342 ALDH1L1 105 intron22 + 1698 attctggggagtcctggccc A/G ctatccactgccagggataa 3343 ABCA1 1 (5′flanking region − 99) acataaacagaggccgggaa G/C ggggcggggaggagggagag 3361 ABCA1 2 (intron 1 159) gcggtgttaaatggggagac G/T atgtcctagtacgagctctg 3362 ABCA1 3 (intron 1 506) aattggctatatgctcccc G/C ggactggagcggcacagtcc 3363 ABCA1 4 (intron 1 5897) gtacaaaaccctttagcttt T/G gcaaacctcctttaagaccc 3364 ABCA1 5 (intron 1 5929) ttaagacccgatttaaatgc C/T tccctcctcatgaagctctt 3365 ABCA1 6 (intron 1 5962) aagctcttctggatccactc T/C ttcccatcactaagttgaaa 3366 ABCA1 7 (intron 1 5985) cccatcactaagttgaaagt A/C agatccccttctctttactt 3367 ABCA1 8 (intron 1 11416) ttacagtgccctttatagga G/A agaaagaagaaattgtgtct 3368 ABCA1 9 (intron 1 11935) tctctgtggagcaaatagag G/A gctgtctgacacttggttcc 3369 ABCA1 10 (intron 1 12281) gaatgtttgatttgtgaaaa T/A cttaataacagtagtttttt 3370 ABCA1 11 (intron 1 12924) gtgctgacaatcttatactc T/C aggttgaacctccggggaag 3371 ABCA1 12 (intron 1 13002) gagcctcaatcacagattct C/G tctagctcacatgaagttaa 3372 ABCA1 13 (intron 1 17715) ggagcatgactttgtggaag C/T ctctcctcttccacccagag 3373 ABCA1 14 (intron 1 17848) gagggctgactgtcaccctt T/C gataggagcccagcactaaa 3374 ABCA1 15 (intron 1 21384) gtgggtgggaggaattggag G/C aggaagcttgcctaagtgtg 3375 ABCA1 16 (intron 1 23063) ggaggcacctgtgacaccca G/A cggagtaggggggcggtgtg 3376 ABCA1 17 (intron 1 23131) agtgtgcatatgtgctgacc G/A tgggagcttgtttgtcggtt 3377 ABCA1 18 (intron 2 2801) aagaaaagtgatttatttca A/G gttgctgatgcttagattgt 3378 ABCA1 19 (intron 2 2830) tgcttagattgttagagttg C/G aaagatctggcttgcatctt 3379 ABCA1 20 (intron 2 2856) tctggcttgcatcttgtaca A/G ctgacagaactggggctcag 3380 ABCA1 21 (intron 2 3187) tgatagctgttgcctgcagc A/G tacggacgttcattgcgcag 3381 ABCA1 22 (intron 2 3190) tagctgttgcctgcagcata C/T ggacgttcattgcgcagttc 3382 ABCA1 23 (intron 2 3194) tgttgcctgcagcatacgga C/T gttcattgcgcagttcctgt 3383 ABCA1 24 (intron 2 3204) agcatacggacgttcattgc G/A cagttcctgtctcctgagat 3384 ABCA1 25 (intron 2 3401) acataaagcctgtgtgctgc T/C gccaggaagactagaaacgc 3385 ABCA1 26 (intron 2 13927) gtcaccacatacctggcact A/G tgctaaggctgggaatgcag 3386 ABCA1 27 (intron 3 4163) ccagcccacttcatcttacc G/A tagttacctccttagagtat 3387 ABCA1 28 (intron 3 4262) tgtcaaagaggaactaagga T/C gccagggactttctgcttag 3388 ABCA1 29 (intron 3 4306) ccctctcatcacttctccaa C/T gctggtatcatgaaccccat 3389 ABCA1 30 (intron 5 490) gatgggcatttgaacttgtt G/A tctttaaaaagtgaaatctt 3390 ABCA1 31 (intron 5 583) tatctggggagtgggcattt T/G ctgactgaggcattggctgc 3391 ABCA1 32 (intron 5 1051) ggctacaaaactgtgctttc C/T ttgggcagtaaaagaggcaa 3392 ABCA1 33 (intron 5 3051) tagagaacaagtctaattct G/A ttttccttgaaatagtcgaa 3393 ABCA1 34 (intron 5 3127) aagtccatgattttttaggc A/G aaatggcctcctttcctctt 3394 ABCA1 35 (intron 5 5924) ctttctttcacaaaattgcc C/T cccagagctttctggaaggg 3395 ABCA1 36 (intron 5 6831) ccagtccctcagccttgcca T/C tgcttatgctggtctggaaa 3396 ABCA1 37 (intron 5 12678) gctcaccgctctgctcaccc G/C accctctggccatctcctct 3397 ABCA1 38 (intron 5 14214) cagcttggtcccagaggcct G/A gacctgggtcccagaggtcc 3398 ABCA1 39 (intron 5 14257) gctggttccccggcttggtc C/T cagaggcctggatgtgtggc 3399 ABCA1 40 (intron 5 18078) cctaccacaccatgcacgtg C/T acagccaagggttgttgact 3400 ABCA1 41 (intron 5 18795) ctgggctcttcctggacctg G/A ccagctaaaaggaaatctcc 3401 ABCA1 42 (intron 5 18948) gcattggtggtactaagaac G/A catattccctatcctatagg 3402 ABCA1 43 (intron 5 19053) ctcccccaacattaaaagtg T/C aagggatgcttattcaaatg 3403 ABCA1 44 (intron 5 19148) ggcccaagaaactgcatttt C/A gcatgctccctaaatgaagc 3404 ABCA1 45 (intron 5 19229) atgctaacagtgtagagtca C/T atgtgatgggaagcatcagg 3405 ABCA1 46 (intron 5 19405) cttgctcaatttattctgtc T/C atataactcaatattactga 3406 ABCA1 47 (intron 5 19534) catgtgaccctcttagctcc G/A cggattaactcctgtcctca 3407 ABCA1 48 (coding region gaaaccttctctgggttcct G/A tatcacaacctctctctccc 3408 474 (Leu 158 Leu)) ABCA1 49 (intron 6 210) gcaacctggcgtcatgggcc A/C gctggttaaaataaaattga 3409 ABCA1 50 (intron 6 334) acagttctgaggcaataacc G/A tggttaagggttattgatct 3410 ABCA1 51 (intron 6 2288) cttctttcaaagcttgtggt C/T cactggaccacgtatgaagt 3411 ABCA1 52 (intron 6 2322) atgaagtagaatagtttagg T/C ccagaaaggcaattaagtaa 3412 ABCA1 53 (intron 6 2820) gtgctttgatacattctgag T/G ttcagtaaagagacctgatg 3413 ABCA1 54 (intron 7 416) catcataaagatgacattgt G/A ggctgtcacagttggaaggc 3414 ABCA1 55 (intron 7 471) agaccacactatttagctta C/T ttagtaataacattgcaaag 3415 ABCA1 56 (intron 7 504) ttgcaaagaaaaattccgac G/A aagttttttcagcctaggaa 3416 ABCA1 57 (intron 7 679) gctctggtgaaattcctctc G/C ctaccccaaacatcatcatt 3417 ABCA1 58 (intron 7 1740) acaaatgctcaccctttcag C/T tggaatgattgaaattttgg 3418 ABCA1 59 (intron 7 2122) tgattaaggtggctactacc A/G ggtgctttctgcatatctcg 3419 ABCA1 60 (intron 7 7753) taggaattccaagctgtgaa T/C tttttactgaagctctttgg 3420 ABCA1 61 (intron 7 8973) atggaaatttgtttatattg A/T ctacagattgccaatattat 3421 ABCA1 62 (intron 7 8976) gaaatttgtttatattgact A/G cagattgccaatattattag 3422 ABCA1 63 (intron 7 11327) ctaacaatcttatttccatt G/C agtccttataaaagaagtgg 3423 ABCA1 64 (intron 7 )11738 ctgacgtttaagggagaccg C/T gtaggtccctttgaggactg 3424 ABCA1 65 (intron 7 12295) agtctgtaaattattgttct T/A ttttttctttagcttatgct 3425 ABCA1 66 (intron 8 387) tagcaaggccaatcatttta C/G caacacacatgcttgctaac 3426 ABCA1 67 (intron 8 697) ggaactgtctggtgtccccc A/T gcataggaagctgagccagg 3427 ABCA1 68 (intron 8 3036) ctttatgtgggaagaaattt T/G tttttttgattggggagtgg 3428 ABCA1 69 (intron 8 3176) aaatggcctggttctctgtc C/A cctttctgtctgtatgcctc 3429 ABCA1 70 (intron 8 3364) ggcagaaggcaaagcttagg A/T cctagagagtgctggaccac 3430 ABCA1 71 (intron 8 3373) caaagcttaggacctagaga G/A tgctggaccacgccactcac 3431 ABCA1 72 (intron 8 3561) cagggatttattaatgattt C/A ttgtgaaatgtttggaaata 3432 ABCA1 73 (intron 8 3654) agtgccggaatacatttgca T/C gtaagacagaacgctgcctg 3433 ABCA1 74 (intron 8 4715) ggcagaggggtctcagaatc C/T gcatttccaacaatgtctcc 3434 ABCA1 75 (coding region cgtattgtctgcgggcatcc C/T gagggaggggggctgaagat 3435 936 (Pro 312 Pro)) ABCA1 76 (intron 9 2309) cccctcaagagtcagtttaa A/G tgttggtcatgttagttgtc 3436 ABCA1 77 (intron 9 2392) atgggagggcttgtgcttca T/C gaaaacatttttccagatca 3437 ABCA1 78 (intron 10 228) tggggatggggaggactggc A/G cagggctgctgtgatggggt 3438 ABCA1 79 (intron 10 319) ttctgcggtccctggctccc C/T acctgactccaggtgaacaa 3439 ABCA1 80 (intron 11 377) gaaagaagtgtgggagcaaa A/C gcatgatgttacatgtagac 3440 ABCA1 81 (intron 11 521) agtgctctagagacaattgg G/A ttcaaatgtggagcaggctg 3441 ABCA1 82 (intron 11 2850) ctctatacaatcattatgct G/C ccattgaaataataaataca 3442 ABCA1 83 (intron 11 2976) ctccaattcggtagaaccag A/G gcttcatcttctctgtcgaa 3443 ABCA1 84 (intron 11 3056) gtttgcagctgctgtttttc C/T ggcagcacatctgtgcaggc 3444 ABCA1 85 (intron 12 340) ggcattatttgtgaaactta T/C ctaaaatcgaattcgggtcc 3445 ABCA1 86 (intron 12 381) aattaaatttttgaaatttt A/G tattaaaaattatattagta 3446 ABCA1 87 (intron 14 1728) caggctcagaggccttggcc C/T atcaccctggctcacgtgtg 3447 ABCA1 88 (coding region atgggcctggacaacagcat C/A ctctggtttagctggttcat 3448 2040 (Ile 680 Ile)) ABCA1 89 (intron 15 1382) cttttagacagaaaagttac G/A tgggatattatctcccacag 3449 ABCA1 90 (intron 15 1453) tatataaggagaaaccagtt G/A aaattacctattgaagaaac 3450 ABCA1 91 (intron 15 1567) ttctgcgtagttttgggtaa G/A tcacttatcttctttaggat 3451 ABCA1 92 (intron 15 1617) cagttgcctcatcagaaaga T/A gaacagcattacgcctctgc 3452 ABCA1 93 (intron 16 95) agttgagaacagaagatgat T/A gtcttttccaatgggacatg 3453 ABCA1 94 (intron 16 452) tggtgctttgcttgagtaat G/A ttttctgaactaagcacaac 3454 ABCA1 95 (intron 16 657) ctgttgcctcagtctgggct T/C cataggcatcagcagcccca 3455 ABCA1 96 (intron 18 1730) tgaaagttcaagcgcagtgc C/G ctgtgtccttacactccact 3456 ABCA1 97 (intron 19 426) aggaccttacagtgggtagt A/G tcaggaggggtcaggggctg 3457 ABCA1 98 (intron 19 468) aaagcaccagcgttagcctc A/G gtggcttccagcacgattcc 3458 ABCA1 99 (intron 20 876) ccctcctcatctaaagtgaa C/T acatggggctcatgtgcagg 3459 ABCA1 100 (intron 22 118) catgggatactcttctgtta T/G cacagaagagataaagggca 3460 ABCA1 101 (intron 22 560) aaagctttgccattctaggg G/A tcatagccatacagggtgaa 3461 ABCA1 102 (intron 23 102) accccttttgccatgttgaa A/G ccaccatctccctgctctgt 3462 ABCA1 103 (intron 23 287) gtcaaagaaaagagacttgt C/T aagaggtaagagccttggct 3463 ABCA1 104 (intron 23 1063) acctttcaccctcaggaagc G/A aggctgttcacacggcacac 3464 ABCA1 105 (intron 25 321) ctctttacttaagtacagtg T/G gaggaacagcggcatcagga 3465 ABCA1 106 (intron 25 376) gttagaaattcagcaacttg G/C gcccagctcagacctactga 3466 ABCA1 107 (intron 25 478) catacataggaaatgacaaa C/T gtttatggatggatagtcta 3467 ABCA1 108 (intron 25 579) tcatttaattctcaaaaaaa G/T atgaaaaaatgaacactcag 3468 ABCA1 109 (intron 27 153) aatggtaaaagccacttgtt C/T tttgcagcatcgtgcatgtg 3469 ABCA1 110 (intron 28 1058) actatcatgggagataatga C/T tatggttgtccatgattgga 3470 ABCA1 111 (intron 28 1317) caggacccagtgttctgagt C/T accctgaatgtgagcactat 3471 ABCA1 112 (intron 30 372) tatatgatttttaggttttg T/C ttatcagcttcttcgctttt 3472 ABCA1 113 (intron 30 506) ccttttaaaaagtaagcagt A/G gataaataaattcagtgaag 3473 ABCA1 114 (intron 30 1033) ctggatttcatggtgccttt G/C attttccacatgaaggttgt 3474 ABCA1 115 (coding region tcttccctttgcagagacac G/A ccctgccaggcaggggagga 3475 4281 (Thr 1427 Thr)) ABCA1 116 (intron 33 626) ggctccttgttactgatttc C/T gtcttttctctctgcctttt 3476 ABCA1 117 (intron 33 719) taatagccctcatgctagaa G/A ggagccggagcctgtgtata 3477 ABCA1 118 (intron 33 726) cctcatgctagaagggagcc G/A gagcctgtgtataaggccag 3478 ABCA1 119 (intron 33 889) ctttcctcaatgtctcagct A/G tctaactgtgtgtgtaatca 3479 ABCA1 120 (intron 33 1097) ctgtgcaccccactgtctgg G/C ttttaatgtcaggctgttct 3480 ABCA1 121 (intron 35 234) aacctatctaaacctcagtt T/C cctcatctgtgaaatggaga 3481 ABCA1 122 (intron 37 411) aactctgtacattttatcag C/T agcttatccatccattgcaa 3482 ABCA1 123 (intron 37 1224) caggcataggtgattcagag A/G tgaaaggtcaagtccctgaa 3483 ABCA1 124 (intron 37 1720) aaattaaaattactctgact G/T ggaatccatcgttcagtaag 3484 ABCA1 125 (intron 40 251) tgaaggtaaggaaaatagtg T/G tatttgcttggatccactgg 3485 ABCA1 126 (intron 40 252) gaaggtaaggaaaatagtgt T/C atttgcttggatccactggc 3486 ABCA1 127 (intron 40 319) agcactggaaaagtcaaacc A/G taactttgagaattaggtga 3487 ABCA1 128 (intron 40 957) cttgttactcttttttcctt G/C tcatgggtgatagccatttg 3488 ABCA1 129 (intron 41 146) tgatgtgggcatcccgcagc C/T ccctccctgcccatcctgga 3489 ABCA1 130 (intron 42 239) catttggtttatatgcttac A/C tttatgtgttagttattaaa 3490 ABCA1 131 (intron 42 321) aataaatggttgattttgag T/A ttgagtttcatagtccaaaa 3491 ABCA1 132 (intron 42 322) ataaatggttgattttgagt T/C tgagtttcatagtccaaaaa 3492 ABCA1 133 (intron 42 533) agatgaaaaattatgtagat G/A ataatgaatgatacggttct 3493 ABCA1 134 (intron 42 546) tgtagatgataatgaatgat A/G cggttctaaaaagacaggtt 3494 ABCA1 135 (intron 43 739) tacagccacacttaaaatgg T/A cccattatgaaatacatatt 3495 ABCA1 136 (intron 44 18) taggtgagaaaagaagtggc T/C tgtattttgctgcaaagact 3496 ABCA1 137 (intron 44 264) acaatataatttgcttgttt T/C ttaagagtataatttagtga 3497 ABCA1 138 (intron 44 279) tgttttttaagagtataatt T/C agtgatttttggtaaattga 3498 ABCA1 139 (intron 44 508) tttacattgctacataaaat C/T cccctatgtacatgtaccta 3499 ABCA1 140 (intron 44 1477) gatctcctctcctgtctctt A/T catttttgcagtagcaatgt 3500 ABCA1 141 (intron 44 1665) tggttgtaagaactgatttg G/A ttggtatagctgtgagggcc 3501 ABCA1 142 (intron 44 1956) gtgttgctcacactcaaaat T/G tctgggccttctcatttggt 3502 ABCA1 143 (intron 45 68) aatatataccttatggcttt T/C ccacacgcattgacttcagg 3503 ABCA1 144 (intron 46 608) ttatactgacttcaatagag G/C tttcagacaaaaagttgttt 3504 ABCA1 145 (intron 47 336) ttcacaattgtaaacaccac T/C acactgaacagcatcatccc 3505 ABCA1 146 (3′untranslated region aacaaaaatgtgggtgtctc C/T aggcacgggaaacttggttc 3506 7479) ABCA1 147 (3′untranslated region aggagcccactgtaacaata C/T tgggcagccttttttttttt 3507 8226) ABCA1 148 (3′untranslated region ttccagaatttgaatattaa C/T gctaaaggtgtaagacttca 3508 8697) ABCA1 149 (3′untranslated region aactattttgaagaaaacac A/G acattttaatacagattgaa 3509 9097) ABCA1 150 (5′flanking region tgacttaaatatttagacat (AT) acattttaatacagattgaa 3510 (−1033)− (−1032)) ABCA1 150 (5′flanking region tgacttaaatatttagacat ggtgtgtaggcctgcattcc 3511 (−1033)− (−1032)) ABCA1 151 (intron 5 6368) ttctgatggggttgttgctg C/&Dgr; tgagaatcatgactgggtgg 3512 ABCA1 152 (intron 5 9709) cattttctgtctgaaccccc T/&Dgr; cacccattcaggcagctgct 3513 ABCA1 153 (intron 5 13816) tccctacttctccttttttt T/&Dgr; catttgcctcctccacccac 3514 ABCA1 154 (intron 10 270 − 271) cttttcagggaggagccaaa (G) cgctcattgtctgtgcttct 3515 ABCA1 154 (intron 10 270 − 271) cttttcagggaggagccaaa cgctcattgtctgtgcttct 3516 ABCA1 155 (intron 20 611 − 612) tttagcccatcctctccccc (C) gccaccctccttattgaggc 3517 ABCA1 155 (intron 20 611 − 612) tttagcccatcctctccccc gccaccctccttattgaggc 3518 ABCA1 156 (intron 32 391 − 392) gagtgccttgggtactctct (T) gatgggggactccatgataa 3519 ABCA1 156 (intron 32 391 − 392) gagtgccttgggtactctct gatgggggactccatgataa 3520 ABCA1 157 (intron 37 847) gctgtatattgtgaatgtcc C/&Dgr; gttttcaaaagcaaagccaa 3521 ABCA4 1 (5′flanking region tgccatcataagcagaaact A/C tctctctcttcttggaagct 3522 −1005) ABCA4 2 (5′flanking region gtctagagtctttcaaagag A/T acacattctgagatttgagg 3523 −819) ABCA4 3 (5′flanking region agcaccaccccattgcaggg C/A tggaatgacagtaatgggcc 3524 −680) ABCA4 4 (intron 1 208) tgcccttcccaggaagatgt G/A tttctctgtcctcagccaca 3525 ABCA4 5 (intron 1 234) ctgtcctcagccacatgaaa A/G tcttttgcctaccgtgcctg 3526 ABCA4 6 (intron 1 510) agctcacgatcaagtcacag T/C ttaactggacacattatttt 3527 ABCA4 7 (intron 1 1527) gcttaacaaccagcataaaa G/A agagcagcatgggacacgct 3528 ABCA4 8 (intron 1 2077) caggactgtagctgctggcc T/C aaaatgagcccattcctgtg 3529 ABCA4 9 (intron 1 2174) ccctctcaatctggcctttc G/C ctggcatgggtgggcgactc 3530 ABCA4 10 (intron 1 2246) gctcccagggagatggagcc A/G ctcgggctgagggccttggc 3531 ABCA4 11 (intron 1 2364) ttctgtctggcacgcctccc G/A atggctccccacctgctacc 3532 ABCA4 12 (intron 1 4243) ctccctggggtatgcctgta C/G gcagttaagcgtcaaggaca 3533 ABCA4 13 (intron 1 4287) atgccgctctggggagggga A/C gctgagcatgattttggaag 3534 ABCA4 14 (intron 1 4309) ctgagcatgattttggaagc C/T ggcagaagaggctattgtga 3535 ABCA4 15 (intron 1 4416) tgcagcaaccgcccccgccc C/T ccgccaaaaacaaacacact 3536 ABCA4 16 (intron 1 4996) tttacccctggaacaggcag G/A ccaagctggc t/c ggtcccctc 3537 ABCA4 17 (intron 1 5007) aacaggcag g/a ccaagctggc T/C ggtcccctccctgatacaca 3538 ABCA4 18 (intron 1 5080) gtgtgtggctggtttcttag C/G aagcaccatggttccaagtt 3539 ABCA4 19 (intron 1 5152) gggagatgaacgtaagtgga G/A ggcaggcctacaaggttgca 3540 ABCA4 20 (intron 1 7110) ccactggatctgcttttgga A/G tcaagagtccttaagctcca 3541 ABCA4 21 (intron 1 7290) gatttttgttggctttgcaa T/A ggatcacagtcatttattca 3542 ABCA4 22 (intron 1 7483) tctgagcctctttccttaac T/C gcagagtgagtgg c/t tacaga 3543 ABCA4 23 (intron 1 7497) cttaac t/c gcagagtgagtgg C/T tacagagaaatctttactac 3544 ABCA4 24 (intron 2 1067) tcaagcagcagcagcaactg C/A gtggagtcttcttgaactaa 3545 ABCA4 25 (intron 2 1243) cacccagcacagggactggc A/T cacatgagatgctcctgctt 3546 ABCA4 26 (intron 3 26) tgttgagatccctaccatgc A/G ggggaggaagttgcacaccc 3547 ABCA4 27 (intron 3 101) agcatggagcactgagtgtt C/T ttgtggctttgctgagcccc 3548 ABCA4 28 (intron 3 330) tgcttgggtggagtgaatca T/C tgtaggagaaaaactcagtt 3549 ABCA4 29 (intron 3 470) tgaagtcaggtttacaaagt C/G aagtttacttcttgggagaa 3550 ABCA4 30 (intron 3 634) tgaaaaccaatgacccctct T/C ccaagaaaaatggccacata 3551 ABCA4 31 (intron 3 1016) ccttgggggagctcagtatg A/G ttcttccaggagaagcctgc 3552 ABCA4 32 (intron 3 1554) gaaagttgggtttcatgttt T/C ccaagaaaaatggccacata 3553 ABCA4 33 (intron 3 1686) ctagacattctcacagagcc A/G agggcagcaaggcggggctc 3554 ABCA4 34 (intron 3 1823) ttcacctctctccatggacc A/G agggcagcaaggcggggctc 3555 ABCA4 35 (intron 3 1938) caaattcctgggaacaaatc G/A ggttgacccagc t/g ttattct 3556 ABCA4 36 (intron 3 1951) acaaatc g/a ggttgacccagc T/G ttattctccctgtcccatca 3557 ABCA4 37 (intron 3 2063) ggctgtcagagcctacctgc G/T tgaatgggtggaagg g/a cagg 3558 ABCA4 38 (intron 3 2079) ctgc t/g tgaatgggtggaagg G/A caggtctcagagaattgggt 3559 ABCA4 39 (intron 3 2186) agacacacagagcatgggac C/T gagaggcgagcagaccctgc 3560 ABCA4 40 (intron 3 2214) gagcagaccctgccaaaact G/A ggagactgaatagatcgctc 3561 ABCA4 41 (intron 4 3182) cccccagagccacagcagcc C/G tgtctcctgggtggtcttgt 3562 ABCA4 42 (intron 4 3515) agtataataaaagcaggagc C/T atagcccccaactctcaaga 3563 ABCA4 43 (intron 4 3952) agagaagccactgtgccact G/C tgtggtcgaacttcaagacc 3564 ABCA4 44 (intron 4 4637) aatcacttgccccaaggtca C/T cttaactgttaggtgttctt 3565 ABCA4 45 (intron 4 5319) acctctaggggctcccagag A/G ccccaagaacagaaccttcc 3566 ABCA4 46 (intron 6 2266) cacccttgcagacctcagac G/A ggtcctgggggcttgctttc 3567 ABCA4 47 (intron 6 2857) ccagaggagaaagctctgcc G/A tag t/c cggcctcagttaacca 3568 ABCA4 48 (intron 6 2861) aggagaaagctctgcc g/a tag T/C cggcctcagttaaccacgga 3569 ABCA4 49 (intron 6 3078) gcaggcattaaaatgggact T/G tgcctttattgctcctgggc 3570 ABCA4 50 (intron 6 3375) ttaaatgccaaatgagttct C/G attaacaaagaaagagggaa 3571 ABCA4 51 (intron 6 3412) ggaaaatctcagtaaaccac C/T gtgacggcatctacccactt 3572 ABCA4 52 (intron 6 4635) ctttcgggtggatattgcta C/T gtcaagtgtctgggaaagcc 3573 ABCA4 53 (intron 6 −264) aaacagcaattagaatcact T/C tgaaatagtgatagtattta 3574 ABCA4 54 (intron 7 828) gatgtgggaaagttagagaa G/C agcccattgtactaatgctc 3575 ABCA4 55 (intron 7 1019) aggcttcttgactgtctaga T/C agcaagtctaatcatttgtg 3576 ABCA4 56 (intron 8 374) gtaaacacggctgtgggatg C/A ttttacaaacacaatatcgt 3577 ABCA4 57 (intron 8 874) tgatgagcttgttattggtg G/A ggtacagcctattaatttag 3578 ABCA4 58 (intron 9 605) tcgtgtctctgtcttgatct C/T tgtctggttttaggccaact 3579 ABCA4 59 (coding region 1268 aacttttgaagaactggaac G/A c/t gttaggaagttggtcaaag 3580 (Arg 423 Arg or His 423 His)) ABCA4 60 (coding region 1269 acttttgaagaactggaac g/a C/T gttaggaagttggtcaaagc 3581 (Arg 423 Arg or His 423 His)) ABCA4 61 (intron 11 5687) atcatgtaatgtactttaga C/G tcagatatataaatatttgt 3582 ABCA4 62 (intron 11 7136) gacttcccaacttaccttag T/C ggagctgtagtcacatagaa 3583 ABCA4 63 (intron 11 7180) acgctcataaatgcttctct G/A ggctgtaaaggttgaatttt 3584 ABCA4 64 (intron 11 7701) gttagacgcaggcattacct C/T gtggctttgccccagtgtga 3585 ABCA4 65 (intron 11 8073) gggatgtttgcccacatcca T/C tggcatttctcaaaaggaac 3586 ABCA4 66 (intron 11 8586) cagctgcctgcgctggagag G/A gctcaaacctcttccgccag 3587 ABCA4 67 (intron 11 11234) cccaaataattttgtttttc G/A ttttaggaattaaatttcag 3588 ABCA4 68 (intron 11 11641) aagaaacaaacatttattga C/G aacttttggtgtgtgacctg 3589 ABCA4 69 (intron 11 11808) tggtatttcttaaagaaata C/T caattccatttccttttaac 3590 ABCA4 70 (intron 11 11923) aagatcattattaatatctc A/G tcagcgtggtgtcacttaag 3591 ABCA4 71 (intron 12 305) tcaccctgtggtcgggaggt G/A tgagtgagctatccaagccc 3592 ABCA4 72 (intron 13 1461) ttgggtttcagtgtcagcat G/A tagctgtctactcagatccc 3593 ABCA4 73 (intron 14 1268) ggagctgagccccttgtcct T/C atctaggtttcccttgttct 3594 ABCA4 74 (intron 17 23) gagtcctttaaaacacaaat C/G ttaatgtttgaaatcaactc 3595 ABCA4 75 (intron 17 715) gggactcccctagagctgaa G/A tactctcccatctgtttgtt 3596 ABCA4 76 (intron 18 1282) ggaagatgaagaacctaagc C/T gcttccagaaattcatgagg 3597 ABCA4 77 (intron 20 − 195) acagattattccattgtatg C/A atgaactatgtaagccatcc 3598 ABCA4 78 (intron 23 755) ctggctgccgctggggtttc C/T tatgtccatccacggggagg 3599 ABCA4 79 (intron 26 702) tatcaaatacaactcagacg T/G cagtctcctggcccctttga 3600 ABCA4 80 (intron 27 156) cctgctttccaaacccttat C/T ttgattcttggtaacatgaa 3601 ABCA4 81 (intron 27 385) tttaaagaacagtgagtcac G/A tgacttgctctttgaaatgc 3602 ABCA4 82 (intron 28 299) gacatgccatcagaccactg C/T gagtgttcaggcagcctacc 3603 ABCA4 83 (intron 29 168) ctccttccacacttgtgtgc A/G gggacattcactacctccta 3604 ABCA4 84 (intron 29 497) gctgtcaataaggaccaaaa C/T agactaatttcaaattcctc 3605 ABCA4 85 (intron 29 567) agctgctaggaataaaaagg G/A agacaaaac g/a atccacaagc 3606 ABCA4 86 (intron 29 577) aataaaaagg g/a agacaaaac G/A atccacaagctagagatggt 3607 ABCA4 87 (intron 30 − 2494) aatcagagctcatctgctgc A/G tcatagggatcccaaaagaa 3608 ABCA4 88 (intron 30 − 2169) aatgtaacagccaaagtcct A/G gaaaaaggcaagccagttcc 3609 ABCA4 89 (intron 31 535) ctaactgtgaattatcatct T/G tgatcactgccctttgagat 3610 ABCA4 90 (intron 35 209) tctccccaacatttatgtgg C/A aagtaagtttacatttggtt 3611 ABCA4 91 (intron 37 525) taaatttgaatgagtaattc A/G tccatctcggcctcagtttc 3612 ABCA4 92 (intron 37 766) tgttgcaggctggagaaccc T/G cctatgaattgtacagggct 3613 ABCA4 93 (intron 37 856) aaaaccccatgaagtggtca A/G ggcaggcatcattatctcca 3614 ABCA4 94 (intron 38 62) tagtagagtatgtgttggtc G/A agcagagccaggggcaagca 3615 ABCA4 95 (intron 38 761) tccttgggcaagttaatctt G/A atgaagagactgggtgttct 3616 ABCA4 96 (intron 38 1315) cagagtcagactctggaaag G/T c/a ggggggataagaacacagc 3617 ABCA4 97 (intron 38 1316) agagtcagactctggaaag g/t C/A ggggggataagaacacagcc 3618 ABCA4 98 (intron 38 1561) gtattttcatgtaaattatc C/A g/a atacacagctgctatggaa 3619 ABCA4 99 (intron 38 1562) tattttcatgtaaattatc c/a G/A atacacagctgctatggaaa 3620 ABCA4 100 (intron 38 2874) ctagacaaagggg a/c agctcc C/T gcccactagaaacttgcagg 3621 ABCA4 101 (intron 40 1904) gacactgtacagccagccca A/C tcctgaccccttttcttcat 3622 ABCA4 102 (coding region 5814 ggaaataaaactgacatctt A/G aggctacatgaactaaccaa 3623 (Leu 1938 Leu)) ABCA4 103 (intron 41 122) ggaaataaaactgacatctt A/G aggctacatgaactaaccaa 3624 ABCA4 104 (intron 41 411) atttggttcccagttttatg T/G agggtcatcatccctgtgtt 3625 ABCA4 105 (intron 41 443) gttctcagtccggtttcttc G/A tatcttgcagatttatcc a/g g 3626 ABCA4 106 (coding region 5844 c g/a tatcttgcagatttatcc A/G ggcacctccagcccagcagt 3627 (Pro 1948 Pro)) ABCA4 107 (intron 43 328) tttgtagcctattcctataa A/G aatgcaccattgcttc c/g cat 3628 ABCA4 108 (intron 43 345) taa a/g aatgcaccattgcttc C/G cattacctccctccacacat 3629 ABCA4 109 (intron 43 370) acctccctccacacattttt A/G caaaa c/t gtttcagggagttt 3630 ABCA4 110 (intron 43 376) ctccacacattttt a/g caaaa C/T gtttcagggagtttactgag 3631 ABCA4 111 (intron 43 670) ttaaacagactggtccccta T/C gggcaggacagagaggatga 3632 ABCA4 112 (intron 43 822) gttaggtgctgctgacatct G/A tccagcatctgcttgactgg 3633 ABCA4 113 (intron 43 915) ggcaggacgagtcctgagca C/T gcttcactggctcagacagg 3634 ABCA4 114 (intron 43 1242) actgagctggacgctagaaa G/T aaactataggcttaagacac 3635 ABCA4 115 (intron 43 1671) tagagaagtttacttccatc G/A ggacacatgcatcttttcta 3636 ABCA4 116 (intron 43 2036) ttgaaggatactcagtaatt G/A ctttttttcttgcagtattt 3637 ABCA4 117 (intron 45 176) gtgtttggttcacacagctc C/T ggagaaaaacaagtca c/t ggc 3638 ABCA4 118 (intron 45 193) ctc c/t ggagaaaaacaagtca C/T ggcacagccttgacttggga 3639 ABCA4 119 (intron 47 238) cccaagtctctggatggggc A/G tctgatcaggatgcatgcag 3640 ABCA4 120 (intron 47 269) atgcatgcagagcctggctg G/A gatgagggagggctgctacc 3641 ABCA4 121 (intron 47 326) accacttatctcaacagatc C/G gggacctgtggcctatttac 3642 ABCA4 122 (intron 47 715) aagtcactaagctggttggt G/A ggaggaacagcacataac c/t c 3643 ABCA4 123 (intron 47 734) t g/a ggaggaacagcacataac C/T caccttatctatgctgaggt 3644 ABCA4 124 (intron 47 931) ggacactgcatagatatcta T/C agaaatagcagcatgtcagg 3645 ABCA4 125 (intron 47 1260) acactctctggtggaccatc A/C ctcatccaagagagggtaac 3646 ABCA4 126 (intron 48 1663) tctcgctcttctcttacctc T/C aggtgtttgtaaattttgct 3647 ABCA4 127 (intron 49 127) agagagccccacccacacca C/T ggtccctaccaagtccccac 3648 ABCA4 128 (5′flanking region gtaaatctcagttgaatcag (TCA)14-16 atttttcagtctggttcct 3649 (−1441)-(−1400)) ABCA4 129 (intron 1 4712-4720) gaggggcggggactataggc (A)8-10 cagcctaattcaaggatgag 3650 ABCA4 130 (intron 1 7295-7304) ttgttggctttgcaa t/a ggat CACAGTCAT/&Dgr; ttattcactcatt 3651 ABCA4 131 (intron 2 951-952) cctgtccatcagactcttct TT/&Dgr; acctctccccgaggagccca 3652 ABCA4 132 (intron 3 2642-2653) cctgggtgacagagcgagat (A)10-12 tagcatgagatattattact 3653 ABCA4 133 (intron 4 5202) cacaaagcatctgacacccc C/&Dgr; atccagccctggctaacttt 3654 ABCA4 134 (intron 6 3029-3044) cactaaaaacaaaaatttac (A)16-18 cctgaaagaaattgcaggca 3655 ABCA4 135 (intron 6 5138-5139) ttcatgacagatcagatgtt (G) cttttatggatttacaaaga 3656 ABCA4 135 (intron 6 5138-5139) ttcatgacagatcagatgtt cttttatggatttacaaaga 3657 ABCA4 136 (intron 6 5985) tttccttcttcaaacccccc C/&Dgr; agactaggagaaggtctgtc 3658 ABCA4 137 (intron 6 6094) gggacggacagaaaaagacc T/&Dgr; agtttctgttgagccaaaga 3659 ABCA4 138 (intron 6 − 161) tattttttcaattaaataaa A/&Dgr; gagttttttgtttctaaaag 3660 ABCA4 139 (intron 7 809-810) gggccgagtatgcacactga (TG) tgtgggaaagttagagaa g/c a 3661 ABCA4 139 (intron 7 809-810) tattttttcaattaaataaa tgtgggaaagttagagaa g/ 3662 ABCA4 140 (intron 8 472-484) atcttccccacctttcacta (T)10-13 ggtcttctatggggtaaagg 3663 ABCA4 141 (intron 9 48-71) gtaccctggacctcccagaa (GT)11-13 gagagagatgtgccttcctg 3664 ABCA4 142 (intron 9 554) ataggggcagaaaagacaca A/&Dgr; ccaaaagttctctctcactt 3665 ABCA4 143 (intron 10 11) catgatcagagtaagggggg G/&Dgr; ttggaggatggggaggggag 3666 ABCA4 144 (intron 11 4242) ggagaggaaatgatgttagt G/&Dgr; cctcctgtaaataggcccag 3667 ABCA4 145 (intron 11 13743-13753) tgctcttttgtgggtaatgg (T)9-11 cctcttccaggagaagaaaa 3668 ABCA4 146 (intron 13 636-637) cggggtggagggttgggagg (G) ctcatttgtcattatagatg 3669 ABCA4 146 (intron 13 636-637) cggggtggagggttgggagg ctcatttgtcattatagatg 3670 ABCA4 147 (intron 18 569-570) tgctgccctcatcttctctc TT/&Dgr; aaactagttctgtatttctc 3671 ABCA4 148 (intron 20 (− 304)-(-297) tataacctgacttttttttc (A)7-9 ggattgcttttttaaacata 3672 ABCA4 149 (intron 22 1236-1246) gctgaattagttcccttggg (T)9-11 agttaactcctgatttttgc 3673 ABCA4 150 (intron 26 4326-4635) gataatcaatgctgtaaggg (A)9-10 tggcattagagatccagacc 3674 ABCA4 151 (intron 33 115-116) taaaaccgtcttgtttgttt GT/&Dgr; ttacatggtttttagggccc 3675 ABCA4 152 (intron 36 1078) taagcagctatcacttaaca A/&Dgr; tacaaaaccagagattatca 3676 ABCA4 153 (intron 37 290-291) ccttgaccaaagcctggggg (T) cagccattcccca a/g cccctc 3677 ABCA4 153 (intron 37 290-291) ccttgaccaaagcctggggg cagccattcccca a/g cccctc 3678 ABCA4 154 (intron 38 896) ataaaaagagggggaaaaaa A/&Dgr; gaaggcagtcgctgcagggc 3679 ABCA4 155 (intron 38 1209-1210) gtggacccctgagactgact CT/&Dgr; ttccagatcttgttagggtt 3680 ABCA4 156 (intron 38 1322) agactctggaaag g/t c/a ggggg G/&Dgr; ataagaacacagccccag 3681 ABCA4 157 (intron 38 3107) gggccccacctgctgaagag A/&Dgr; gggggggtggggtttgcccc 3682 ABCA4 158 (intron 40 152) ttttctccaataatacaagt CT/&Dgr; ttccagatcttgttagggtt 3683 ABCA4 159 (intron 43 330) tgtagcctattcctataa a/g a A/&Dgr; tgcaccattgcttc c/g ca 3684 ABCA4 160 (intron 43 1354) tttaattggcccagccatgc C/&Dgr; tttggtggcttttgtcattg 3685 ABCA4 161 (intron 47 1305-1308) catcctgctgaaggagaaag AAAG/&Dgr; caccaatggcccaagcccta 3686 ABCA7 1 (5′flanking region − 1596) agaatgttggccccctcccc C/T t c/t ctgcatcctctgcagaag 3687 ABCA7 2 (5′flanking region − 1594) aatgttggccccctcccc c/t t C/T ctgcatcctctgcagaagcc 3688 ABCA7 3 (5′flanking region − 1180) ggccagtgagtgacgggcag G/A tcgcccaaatagcagcgtgc 3689 ABCA7 4 (5′flanking region − 460) agagctggggtcgtgcctcc A/G gctgggcaactgcctgtctc 3690 ABCA7 5 (5′untranslated region ctctgtcccgtcccctgccc A/G gtctcaccatggccttctgg 3691 ABCA7 6 (intron 5 91) ccccgggccaaggacctccc G/A ttccaggcatccaggctgtc 3692 ABCA7 7 (coding region 563 cagcttgttggaggccgctg A/G ggacctggcccaggaggtac 3693 (Glu 188 Gly)) ABCA7 8 (intron 8 103) gccggagggtcacggaaact A/G tttgaagaagtaggagttag 3694 ABCA7 9 (intron 8 166) tgcggaggatcagaggcaca C/T gcaggagcaaggcagagggg 3695 ABCA7 10 (coding region 955 accggaccttcgaggagctc A/G ccctgctgagggatgtccgg 3696 (Thr 319 Ala)) ABCA7 11 (intron 9 421) tttttttttttttttttttt T/A taagagatggagtctcactc 3697 ABCA7 12 (intron 9 463) gttgcccaggctggactgca G/A tgg c/t gagatcttggctcact 3698 ABCA7 13 (intron 9 467) cccaggctggactgca g/a tgg C/T gagatcttggctcactgcaa 3699 ABCA7 14 (intron 9 488) gagatcttggctcactgcaa C/T ctccgcctcctggattcaag 3700 ABCA7 15 (coding region 1184 cgcacacgctgatgtggggc A/G cctggtgggcacgctgggcc 3701 (His 395 Arg)) ABCA7 16 (intron 10 10) gagtgacggaggtgagggcc T/C gtccacctgcggggtctgtt 3702 ABCA7 17 (coding region 1824 cctgggccccggccacgtgc G/A catcaaaatccgcatggaca 3703 (Arg 463 His)) ABCA7 18 (intron 13 55) ggtgcgctggagggtgacag A/G caggggcggccccacgtggg 3704 ABCA7 19 (coding region 1824 cccttcctgctcagcgccgc A/G ctgctggttctggtgctcaa 3705 (Ala 608 Ala)) ABCA7 20 (intron 13 55) ggtgcgctggagggtgacag A/G caggggcggccccacgtggg 3706 ABCA7 21 (intron 13 78) ggggcggccccacgtgggtg C/A gcgcccccaggccaatccag 3707 ABCA7 22 (coding region 1851 cgttgcctctcacagctggg A/G gacatcctcccctacagcca 3708 (Gly 617 Gly)) ABCA7 23 (coding region 2153 cgagggcgcgcagtggcaca A/C cgtgggcacccggcctacgg 3709 (Asn 718 Thr)) ABCA7 24 (intron 15 34) ggcggggctccgggccgggt C/G gcacctgctttgcgggaggc 3710 ABCA7 25 (intron 16 8) ctggacccaaagggtgaggc A/C ctacgaggcttaatagctgg 3711 ABCA7 26 (intron 16 161) tcccgcagcttttataggcc C/T cggcccagcaggtcccggat 3712 ABCA7 27 (coding region 2385 caccccatctctgcagtgct G/A gtagaagaggcaccgcccgg 3713 (Leu 795 Leu)) ABCA7 28 (coding region 2421 cccggcctgagtcctggcgt C/A tccgttcgcagcctggagaa 3714 (Val 807 Val)) ABCA7 29 (intron 20 166) cgagacagtaagagttgggg A/G tagacagaggttcccctgga 3715 ABCA7 30 (coding region 3027 ctgctgggagaccgtgtggc C/T gtggtggcaggtggccgctt 3716 (Ala 1009 Ala)) ABCA7 31 (intron 22 1386) gggtggggcgtgagccgggg C/T tccctgaagcacccccttgt 3717 ABCA7 32 (coding region 3417 gggtggggcgtgagccgggg C/T tccctgaagcacccctttgt 3718 (Leu 1139 Leu)) ABCA7 33 (intron 23 147) ggagctctggtggctcagat G/A tcccttgggaaggcctgggg 3719 ABCA7 34 (coding region 3528 gctggcctagacgtaaccct A/G cggctcaagatgccgccaca 3720 (Leu 1176 Leu)) ABCA7 35 (coding region 4046 cccagcctgccagtgtagcc G/A gcccggtgcccggcgcctgc 3721 (Arg 1349 Gln)) ABCA7 36 (intron 30 81) ccccctgggagctctcccgg C/A ccccccggccctcagctccc 3722 ABCA7 37 (intron 32 1) caaggagcagctgtctgagg G/C tgcactgtgagtccctccac 3723 ABCA7 38 (intron 33 54) ccactgcttgccactgccct G/A tctggccccttgtaggcagg 3724 ABCA7 39 (intron 34 245) cagtactttgggaggccgag G/A caggaggactgcttgtggcc 3725 ABCA7 40 (coding region 5057 ggtgagccggatcttgaaac A/G ggtcttccttatcttccccc 3726 (Gln 1686 Arg)) ABCA7 41 (intron 38 65) ggcccactcacctttctgaa A/G gacctgcactctcccaggta 3727 ABCA7 42 (intron 40 154) ctctacctcccacacgcgga C/G caggccctgagacacccctg 3728 ABCA7 43 (intron 40 277) ctgagcccccggcgccccca T/C ccccagcgtggcccgggaac 3729 ABCA7 44 (coding region 5592 gtggcccgggaacccagtgc T/C gcgcacctcagcatgggata 3730 (Ala 1864 Ala)) ABCA7 45 (intron 41 286) ctccttgactctgccttctg T/C ggccctgcccacttgctcct 3731 ABCA7 46 (intron 41 389) tggccgttcccagtttgcag C/T cgtttcactgcctcttccat 3732 ABCA7 47 (intron 41 991) cacactatggccctgcccca C/T ac c/t cat c/g cc a/g gctc 3733 ABCA7 48 (intron 41 994) actatggccctgcccca c/t ac C/T cat c/g cc a/g gctccac 3734 ABCA7 49 (intron 41 998) tggccctgcccca c/t ac c/t cat C/G cc a/g gctccacccac 3735 ABCA7 50 (intron 41 1001) ccctgcccca c/t ac c/t cat c/g cc A/G gctccacccacacc 3736 ABCA7 51 (intron 41 1051) actcatgctggctccaccca C/T accatggccccgccccatac 3737 ABCA7 52 (intron 41 1131) tgccctgccccatgcccatt A/G tgcccctgctccacactcaa 3738 ABCA7 53 (coding region 5985 gaagcgctctgctcgcgcct G/A gccatcatggtgaatgggcg 3739 (Leu 1995 Leu)) ABCA7 54 (intron 44 201) ggcgcaggaccaggaggcgt G/C agccgggggctctgggtgga 3740 ABCA7 55 (intron 44 233) ctgggtggatttagaagaca C/T aatcaggtgtgcgttggagt 3741 ABCA7 56 (intron 44 313) agttaggggagggcctggtt A/G gtgggcggggccataggaaa 3742 ABCA7 57 (coding region 6133 tggcggccgagttccctggg G/T cggagctgcgcgaggcacat 3743 (Ala 2045 Ser)) ABCA7 58 (coding region 6159 ctgcgcgaggcacatggagg C/T cgcctgcgcttccagctgcc 3744 (Gly 2054 Gly)) ABCA7 59 (intron 45 27) acggcgccggggtcgggctg G/C gggaggcaggctgggggcca 3745 ABCA7 60 (3′flanking region 108) caagctgagtgtgcacatac G/A ggccaagtggcgattcatag 3746 ABCA7 61 (3′flanking region 376) cttacaggagcccggtgtcc C/T ggagcacaggccagggccgg 3747 ABCA7 62 (3′flanking region 687) cagcagggagacttggggag G/A g/a gggagagagttcacactgc 3748 ABCA7 63 (3′flanking region 688) agcagggagacttggggag g/a G/A gggagagagttcacactgcg 3749 ABCA7 64 (3′flanking region 1169) cctcgacctgacccacttca C/T ggggctgcagggcgggtgat 3750 ABCA7 65 (intron 9 398-422) cgtgaactaccacgtcctgc (T)22-26 aagagatggagtctcactct 3751 ABCA7 66 (intron 12 175-184) ggggactctgagggtctggt (G)8-10 actctgagggtctgggggcc 3752 ABCA7 67 (intron 30 81-87) ccccctgggagctctcccgg (C)6-7 ggccctcagctccccttccc 3753 ABCA7 68 (intron 34 349-361) agaaagagaaagagagaaag (A)12-14 cagaaatgtgctttgggtga 3754 ABCA8 1 (intron 9 204) ctggtaattaatattagata A/G ataaaaacattgagttagaa 3755 ABCA8 2 (intron 12 266) aacattatgttgttttaaac A/G taactgagtgtagaaataag 3756 ABCA8 3 (intron 30 733) ttgccatatgtataataaag T/A attcatgtttttgctagcct 3757 ABCA8 4 (intron 34 861) agactggagtttgcatgcta C/T ctaagactgtagctgattcc 3758 ABCA8 5 (intron 1 907) gaggagatcatcctcttggc C/T aatgtctattaacttcgcca 3759 ABCA8 6 (intron 1 1262) cagaaacttttgccctctct G/A taggctagctcactgtgaaa 3760 ABCA8 7 (intron 1 1537) agctctcttaaaagtatcca T/C gctgaattttctgcacctta 3761 ABCA8 8 (intron 1 7622) tcgttaacagcaatgataat T/C tagcccatccttatcc c/t a 3762 ABCA8 9 (intron 1 7639) t t/c tagcccatccttatcc C/T agaaacaacaggctcataag 3763 ABCA8 10 (intron 1 7720) tccatgtgttacaaactgcc C/T tggagaacagaaaaagagaa 3764 ABCA8 11 (intron 1 9397) cataatatatatacatatgc G/A cacacacacacatatacaca 3765 ABCA8 12 (intron 1 9519) ttgtttgcaggatatttctt T/C ttcttaagaacttcatatta 3766 ABCA8 13 (intron 1 12973) caattagttttcttcaaaaa A/G gtagaaaagttggaattgta 3767 ABCA8 14 (intron 1 13100) catataaaaaatcttgatta A/T actttggtatattttaaaaa 3768 ABCA8 15 (intron 1 13128) gcaatgccttggaactatct C/T ttaaaacacattgactttca 3769 ABCA8 16 (intron 2 420) caattagttttcttcaaaaa A/G gtagaaaagttggaattgta 3770 ABCA8 17 (intron 2 505) catataaaaaatcttgatta A/T actttggtatattttaaaaa 3771 ABCA8 18 (intron 2 819) gcaatgccttggaactatct C/T ttaaaacacattgactttca 3772 ABCA8 19 (intron 3 915) ttgtgttcgatagatcagta G/A ggtgactagttaacaatgat 3773 ABCA8 20 (intron 3 1539) aaagggaaatctgtggtgat C/T gccctgtcattcattcatag 3774 ABCA8 21 (intron 3 2341) ttcctttctttgtcaacttc C/T gtccaaattccactcaagct 3775 ABCA8 22 (intron 3 2882) tattctatattctgtactcc A/G ttaatattctataataataa 3776 ABCA8 23 (intron 3 3314) atttaaatatctatctctct A/G tatttaccatttcaaattta 3777 ABCA8 24 (intron 4 89) gaggttagtatgccaaatta G/A agcatcactatctgtcataa 3778 ABCA8 25 (intron 4 3264) ttccattggcctattatgcc C/T gtgttatatccagtgttaga 3779 ABCA8 26 (intron 4 3403) aagagaccaacaaaattctt C/G atcagcagaaaagcacagga 3780 ABCA8 27 (intron 5 389) gcttactgaatatataaatt G/C agaaaagccatgccaagcaa 3781 ABCA8 28 (intron 5 479) tgagagtggtgagtaactca A/G aatgcctggactcc g/a aggtc 3782 ABCA8 29 (intron 5 494) actca a/g aatgcctggactcc G/A aggtcccagcaggtcaatga 3783 ABCA8 30 (coding region 792 atgggtcttcgggattcagc G/A ttctggtgagtcaaacgcag 3784 (Ala 264 Ala)) ABCA8 31 (intron 6 200) cctcccaagtagctgggact G/A caggtgccg a/g caccatgcc 3785 ABCA8 32 (intron 6 210) agctgggact g/a caggtgccg A/G ccaccatgcctggataattt 3786 ABCA8 33 (intron 6 1751) gtgagttattattgtgttgg C/T tttgcagctgttttgttttt 3787 ABCA8 34 (intron 6 1808) atttcattatagttttcaaa G/T aatattgtaaaacaaaagaa 3788 ABCA8 35 (intron 6 2412) tattcctaattctaaagaat T/C ctgcccaaaacttttacctt 3789 ABCA8 36 (intron 6 2506) tggatgaataagtgaatgaa G/A agttatcttaga a/g tccattt 3790 ABCA8 37 (intron 6 2519) gaatgaa g/a agttatcttaga A/G tccatttcaggtcttccttt 3791 ABCA8 38 (intron 7 28) agtgaattaaatatctttcc A/G tccacctatagcctaaaaat 3792 (coding region 991 ABCA8 39 (Gly 331 Ser)) taaagaaatctttcctcacc G/A gcctggtcgtgttcctcctc 3793 ABCA8 40 (intron 8 74) tggaatccataggctgtaat C/T atttacaaactcagcattgt 3794 ABCA8 41 (intron 9 1417) acacatacttaaatatattt T/C ctctgttctacttttgtttt 3795 ABCA8 42 (intron 9 2504) agaggaaaattatggtttgg G/A aatgaaataaagcagaaata 3796 ABCA8 43 (intron 10 2013) tggccaaagatctttccaac C/T tgtgccagtggttcacagga 3797 ABCA8 44 (intron 10 2378) ctgaagaaaattgtcacttt G/A aagtatcttttctttttttc 3798 ABCA8 45 (intron 11 − 697) aaaaaaaaaaaaaaagagag A/G gagaaagaaaatatttgtta 3799 ABCA8 46 (intron 11 − 528) tataaaagttagaaaaaaat G/T a a/g tatgttttagaaatagat 3800 ABCA8 47 (intron 11 − 526) taaaagttagaaaaaaaaat g/t a A/G tatgttttagaaatagat 3801 ABCA8 48 (intron 11 − 342) ctcaaaggagttttagccat G/A taataacttactattaatct 3802 ABCA8 49 (coding region 1632 ggttcagtcaccatctataa C/T aataagctttcagaaatggc 3803 (Asn 544 Asn)) ABCA8 50 (intron 14 252) cttattgcaaaataagtgaa G/A ttgagtttctaagagatcaa 3804 ABCA8 51 (intron 15 130) ttttgtttttgagacggagt A/C tcgatcatctcggctcactg 3805 ABCA8 52 (intron 16 534) acatatacattcattcaaat A/G cacattttatggtgacaaca 3806 ABCA8 53 (intron 16 588) gaatcatcaggaaagtgtta C/T gcaaattctgattagtactt 3807 ABCA8 54 (intron 16 645) atttaaagaaaatttgtaga C/T gttttaggtggaatgaagaa 3808 ABCA8 55 (intron 17 431) tgtcaggtttttcttttttt T/A ttctttatgttagaaattgg 3809 ABCA8 56 (intron 17 1390) gctgtaaactcgttttgtga C/A ttaggtaccccatgattcta 3810 ABCA8 57 (intron 17 2452) cacgttatacctatagtaac G/A cggaaga g/c tctaatcatgag 3811 ABCA8 58 (intron 17 2460) acctatagtaac g/a cggaaga G/C tctaatcatgagat g/c ctt 3812 ABCA8 59 (intron 17 2475) gaaga g/c tctaatcatgagat G/C cttagcagagccaatctcta 3813 ABCA8 60 (intron 18 152) gaagaagcacaggagagagg C/T agaatcttgacatccaaagg 3814 ABCA8 61 (intron 19 7477) aaaatctattttgaaagaca C/T ttggaactaaaaaaatcttt 3815 ABCA8 62 (intron 21 196) ttgtttaaagtaaaataaaa T/C g/c aacaaaacatttttcaaag 3816 ABCA8 63 (intron 21 197) tgttaaagtaaaataaaa t/c G/C aacaaaaacatttttcaaaga 3817 ABCA8 64 (intron 21 287) actgtggtggggtgggggga G/T ggggaggggatagcattggg 3818 ABCA8 65 (intron 21 403) cctgcacaatgtgcacatgt A/G ccctaaaacctaaagtataa 3819 ABCA8 66 (intron 21 1207) cccagcc g/a gagtgcagtggc A/G ggatcatagctcactgtaac 3820 ABCA8 67 (intron 24 692) ctcctagatatagacaaaaa A/C caaggtgcacaatggccatg 3821 ABCA8 68 (intron 25 212) cctgattaatatatgggaag G/A aagggtaaggggtagtggga 3822 ABCA8 69 (intron 26 67) aataattttcagttctgtac A/G cactgtgaaacttcttttat 3823 ABCA8 70 (intron 27 515) gtgtctcccaaaccacatca G/T tttcatcttttgctattaca 3824 ABCA8 71 (intron 27 661) cctggatattatcagactta G/A aatggagaggaaaagtcaat 3825 ABCA8 72 (intron 30 1967) caaaaattagatacaagggg G/C tgaaattgactttaattgta 3826 ABCA8 73 (intron 31 112) ctctaaatgctgacccaggt C/G acactgggtagatttacaac 3827 ABCA8 74 (intron 33 401) cttctcactaggttgtgaga C/T gctgttgttaaattttatgt 3828 ABCA8 75 (intron 35 484) taacagcatcatcctg a/t tgt A/G tttattttcatagacagaaa 3829 ABCA8 76 (intron 36 258) tttgcatgtatgttggtaaa A/G cctaagtcaaaactcagtta 3830 ABCA8 77 (intron 36 375) atattattttactgtcttag C/G ctgtatattaagaaactgac 3831 ABCA8 78 (3′flanking region 674) gcggtggacatagaaagccc G/A gaagcttcttgatgtgctta 3832 ABCA8 79 (intron 1 56-57) ttttgcttttgtgtgtgagt TT/&Dgr; gtttcagaggttttgtcttt 3833 ABCA8 80 (intron 1 1180-1191) taaagtataataataaaacg (A)9-11 gaaattcctcctgtacagag 3834 ABCA8 81 (intron 1 9877-9885) ctcctgcaaataggtatgac (A)8-12 tcaactgagtacaaaaagct 3835 ABCA8 82 (intron 1 12588) gtactagagtgcactccttt T/&Dgr; gcaacaggacggccaaagga 3836 ABCA8 83 (intron 6 78) tcaatgcatctttttttttt T/&Dgr; gaaatggagtctcgctctgt 3837 ABCA8 84 (intron 9 265) gtatatggtatttttttttt T/&Dgr; gcaacaggacggccaaaaga 3838 ABCA8 85 (intron 9 2666) attttttttaaaggtatcca A/&Dgr; tagtcattctcaatttcttc 3839 ABCA8 86 (intron 11 − 447) ggatattctgggtttttttt T/&Dgr; ctacaaactcaagttttttg 3840 ABCA8 87 (intron 15 8407) gtggaataatttttgactta T/&Dgr; gcatttggtcaaataaaatt 3841 ABCA8 88 (intron 15 9458-9470) tatgtcgagtaacatatgtc (T)11-15 ctgaatgccagcttgcagtt 3842 ABCA8 89 (intron 16 54-56) tgaataatagtcatcatcat CAT/&Dgr; aattattatcattacaacta 3843 ABCA8 90 (intron 17 433) tcaggtttttcttttttttt t/a T/&Dgr; ctttatgttagaaattggac 3844 ABCA8 91 (intron 24 1462) actccatctcaaaaaaaaaa A/&Dgr; gagagaaaaaaattctgcat 3845 ABCA8 92 (intron 33 155) caatactttgcaaaaaaaaa A/&Dgr; gatctttccctgatgatatt 3846 ABCA8 93 (intron 34 184) atactgaatggttttttttt T/&Dgr; ctcctttctcatatgacctc 3847 ABCA8 94 (3′flanking region 1240) atccttggaccaaaaaaaaa A/&Dgr; ctttatctgtgctttgcgtg 3848 ABCB1 1 5′flanking − 196 gctttggagccatagtcatg T/C actcaaaatttattttatct 3849 ABCB1 2 5′flanking − 16 tactctttacctgtgaagag T/C agaacatgaagaaatctact 3850 ABCB1 3 intron 1 + 71660 cttgctggaggaagggtgct A/C gaaaatataccaaatccaag 3851 ABCB1 4 intron 1 + 80091 gaaataatattcaagttctg A/C aataatatcatgacctatag 3852 ABCB1 5 intron 1 + 103126 gatatgaatcagaattcatc T/C gtgtctcaagaaaaggtcat 3853 ABCB1 6 intron 1 + 103148 tgtctcaagaaaaggtcatg C/T gataaattaagttctgctag 3854 ABCB1 7 intron 1 + 108428 aattaatttatcatcatctg A/G tcaccatttcacacaactca 3855 ABCB1 8 intron 1 + 112042 cataagttgaaatgtcccca A/G tgattcagctgatgcgcgtt 3856 ABCB1 9 intron 2 + 491 gctctctggcttcgacgggg G/&Dgr; actagaggttagtctcacct 3857 ABCB1 10 intron 4 + 36 attaactattcaaaatactt C/T ggaaatttgacatctcctta 3858 ABCB1 11 intron 5 + 1596 ttagctctcttactgcttca T/C agtggaagaatcaaatactt 3859 ABCB1 12 intron 8 + 1789 aaacactctgaatattaaac C/T gctcctggaaccacagctca 3860 ABCB1 13 intron 14 + 24 agttgtccttgccctttgcc T/C ttctagaggtgcaaaaaata 3861 ABCB1 14 intron 14 + 81 tgcaggaagttaggaaacta C/T tataaatcggaagaagggaa 3862 ABCB1 15 intron 15 + 38 caaaccaacctgatttataa A/G aaaggaatgctctctgttta 3863 ABCB1 16 intron 17 + 73 gtttggtgggctagggctac A/G gtaggagtgggaacaagaga 3864 ABCB1 17 intron 18 + 564 caacagtaaagttacaatct G/A aaaggaatgctctctgttta 3865 ABCB1 18 intron 18 + 2062 tttccctgaggaatggttat C/T ctctgtgttccttgagtcca 3866 ABCB1 19 intron 18 + 2293 ccacatcaggttttccccag A/G ggttttagttcctcccctca 3867 ABCB1 20 intron 20 + 557 aaaaccctaaccattgacac G/A tgtgaatgttttcctgggga 3868 ABCB1 21 intron 21 + 24 cgtgcctcctttctactggt G/A tttgtcttaattggccattt 3869 ABCB1 22 intron 21 + 2725 ctgacctgtttttggctgac A/G ggttttagttcctcccctca 3870 ABCB1 23 intron 21 + 4725 tcttggtattaaaagatcca A/G agagataggaatatgtaatt 3871 ABCB1 24 intron 22 + 8507 tgcacttaggaaaaaaacaa T/C atggaaatgtgtaaaatata 3872 ABCB1 25 intron 22 + 8537 tgtaaaatatactttttttt T/A aaaaaaaaggacacatttat 3873 ABCB1 26 intron 22 + 8565 aggacacatttattcagcat T/C atgatcagactattacattt 3874 ABCB1 27 intron 22 + 8952 caccttggtttcatggtttg G/A caaagtactggcctgtacca 3875 ABCB1 28 intron 22 + 9520 caccaacaaatatctttttc A/G cagttgggtgggcatctggt 3876 ABCB1 29 intron 22 + 9836 agactctgacttagacatga C/T ggcaggggaaagagagactt 3877 ABCB1 30 intron 24 + 377 taaaatacagatgtgttgta C/A taagttctgcaagcctttgg 3878 ABCB1 31 intron 24 + 1493 ggggaggtgtccaggcacga A/&Dgr; catggagagctggacttgat 3879 ABCB1 32 intron 24 + 1495 ggaggtgtccaggcacgaac A/T tggagagctggacttgatac 3880 ABCB1 33 intron 25 + 342 tgcagccttgatcttctggg C/T tcaagcgatcctcctgcctc 3881 ABCB1 34 intron 26 + 134 cttggataaagtctgagagc C/G taaatatggtctccaagtgg 3882 ABCB1 35 intron 26 + 1272 gtccttcaattttgtggtga A/G cttaaaaacaggactctaaa 3883 ABCB1 36 intron 26 + 1394 tattaagtggtgtgttaaag A/G ttgtgctataatgaattgta 3884 ABCB1 37 intron 26 + (1987-1988) aagggctggaagagtgaaag (AAAG) gaggctatttgctcccagac 3885 ABCB1 37 intron 26 + (1987-1988) aagggctggaagagtgaaag gaggctatttgctcccagac 3886 ABCB1 38 intron 27 + 59 gcagcctctctggcctatag G/T ttgatttataaggggctggt 3887 ABCB1 39 intron 27 + 80 ttgatttataaggggctggt C/T caatgactgagtcaagaatt 3888 ABCB4 1 exon 3 + 3 aacacccttattttatagat C/T caatgactgagtcaagaatt 3889 ABCB4 2 intron 3 + 45 cagcatctctacttatacca T/C gctctgctttaaggttctct 3890 ABCB4 3 intron 3 + 498 actcaaataggtggtaggag C/T agagacaattcaatacagac 3891 ABCB4 4 intron 3 + 515 gagcagagacaattcaatac A/G gacagaagtcttagatgaga 3892 ABCB4 5 intron 6 + 1030 tagttttgccatgtagaatt G/C aaaaagtgatagatggtgtt 3893 ABCB4 6 intron 6 + 1437 gttaagcctgcttcaatcaa G/A ttagttatattcttgttcta 3894 ABCB4 7 intron 6 + 2449 ttgacttagcgacactgtta G/A catacttatctttcctgtgt 3895 ABCB4 8 intron 7 + 451 ccttgctgcacctgtgctgt A/C taagtttggcttattatagt 3896 ABCB4 9 intron 7 + 530 agtagagacaggctggcgat C/G acaccggacagagctaactg 3897 ABCB4 10 intron 7 + 152 aacagaatcatgaaattaag T/C tgttaatgatttgaaggcct 3898 ABCB4 11 exon 8 + 40 aggataaattgtttatgtcg C/T tgttaatgatttgaaggcct 3899 ABCB4 12 intron 8 + 130 ctggttgactccagatatca T/C agaaggagttgtaaaattct 3900 ABCB4 13 intron 8 + 248 aatacacaggaagcttctaa A/G taaagtaaggaagtcactct 3901 ABCB4 14 intron 8 + 531 ctaaagagtgaatggattca A/G tacgtcccttggaactcacc 3902 ABCB4 15 intron 8 + 4240 ctgaggttccagcttatctc T/A tagagatgtttacttagtct 3903 ABCB4 16 intron 8 + 4343 tgttagaagaaaaaaaggtt C/T atattacaagagggtctgac 3904 ABCB4 17 intron 8 + 4677 cccaagatatcttcataact G/C tccatagtgcctagggtgcc 3905 ABCB4 18 intron 9 + 113 tttacccagattcacctatt A/G ttatcatttttgctcccaaa 3906 ABCB4 19 intron 9 + 982 tgtcctatacagtttttgtt T/A taagtttagtaaattgatta 3907 ABCB4 20 intron 11 + 241 gcactttgggaggccaaggt A/G cataaatcacttgaggtcag 3908 ABCB4 21 intron 11 + 457 tccagcttgggtgacagagt A/G agacttcatctcaaaaaaaa 3909 ABCB4 22 intron 11 + 1337 tactcttggggagcctatca C/G cagggtgggtcagatatagc 3910 ABCB4 23 exon 12 + 3 tgtttcttttctgtccagat A/T ctctcggcatttagtgacaa 3911 ABCB4 24 intron 12 + 1288 cagaccacactaaccctcag T/C tggacctcaggatgtcagtg 3912 ABCB4 25 intron 13 + 206 tgtggataagaaaatagcat G/A tggttagaccatttgtgaaa 3913 ABCB4 26 intron 13 + 988 cagtcggtttggaagcttgc T/C accctttcttcacttcctca 3914 ABCB4 27 intron 13 + (1413-1414) tttatcttcacttatgtttt (T) ctcagttaagttatgctaat 3915 ABCB4 27 intron 13 + (1413-1414) tttatcttcacttatgtttt ctcagttaagttatgctaat 3916 ABCB4 28 intron 13 + 1931 cttgcaaatgttgctcttcc A/G caaaaaaaaaaggaaaggat 3917 ABCB4 29 intron 22 + 767 acagtgggctgatgcataga A/&Dgr; cctgtagcaatccaccagca 3918 ABCB4 30 intron 23 + 784 agtatctcctaaactcttgc T/C atgcaggaaaaattatttta 3919 ABCB4 31 intron 25 + 158 gaaatattttactgtattaa T/C gtctagaacttaaatataag 3920 ABCB4 32 intron 25 + 2920 ctgagtcttcctatacatct T/A ttccattcctcggatgctgt 3921 ABCB4 33 intron 29 + 411 cttctcttaccttgaattct A/C ggctctcgaactttgacttt 3922 ABCB4 34 3′flanking + 458 agaaaatgaaattgccctac T/C gagctaactctgaaagcaca 3923 ABCB7 1 intron 1 + 220 acggggcaggaggttctggg C/A agaggacacctggagcgctg 3924 ABCB7 2 intron 1 + 480 agttaactcccttgctgaca G/A gcgtgcttcttgataggcca 3925 ABCB7 3 intron 1 + (512-513) gataggccaaaaccgtaact AT/&Dgr; ctttccaaaacatagaccgc 3926 ABCB7 4 intron 1 + 1690 agttctccaataaggcagat G/A aagttaagataaaatttgta 3927 ABCB7 5 intron 1 + 5309 aattaatatcatttattgct G/A tattgttgtcagtgttatct 3928 ABCB7 6 intron 1 − 11274 tgcttcttttcaagccagcc A/G gctttaaaaaaaagttagct 3929 ABCB7 7 intron 1 − 11085 caggttttcagggctcatgt A/G gacctgaagaaaaatgagag 3930 ABCB7 8 intron 1 − 10037 attctactttctcaacttct T/C ttattacattatctcatcat 3931 ABCB7 9 intron 1 − 21 ccactctgaaacttccccct G/A ctttttttccttgtcagcag 3932 ABCB7 10 intron 3 + (135-136) ttctctaatgaaaaaaaaaa (A) catattaattgaccatagtt 3933 ABCB7 10 intron 3 + (135-136) ttctctaatgaaaaaaaaaa catattaattgaccatagtt 3934 ABCB7 11 intron 3 + 333 aaaacaatttgtgtgtgtgc G/A tgtgcttcaaggttaatgtt 3935 ABCB7 12 intron 12 + 524 taaccactctgccctcagta C/T gaaacacagtgccgaaccca 3936 ABCB7 13 intron 13 + 1543 atcctgtgaggtggggaagc G/A tatggctagcataaatataa 3937 ABCB7 14 intron 13 + 2400 tgttaccttactgcctcatt C/G tcattcttcccacctgctat 3938 ABCB7 15 intron 15 + 2201 ctccttcctaaccttagcaa G/C agtctggagatttacttatc 3939 ABCB8 1 5′flanking − 2272 ggcttaggcctaagggctga T/C gttggggccagtacccctga 3940 ABCB8 2 5′flanking − 2070 agctatgaaaacaagaccct G/A tccttctagaggtagcaaaa 3941 ABCB8 3 intron 1 + 25 aaacggaaaaacctactcag C/G ccctctgtctccccattcca 3942 ABCB8 4 exon 2 + 308 tgctggtcctgggggtagcc G/A tcgtggtgaggctttcccca 3943 ABCB8 5 intron 2 + 334 cccccacttaaaacatttgt C/G ccctctgtctccccattcca 3944 ABCB8 6 intron 4 + 12 cctgctccggtactgccagc C/T gcagggtgcagagttggggt 3945 ABCB8 7 intron 5 + 547 agttcatagcattctcgctc G/A gccccctcaggcctgctgct 3946 ABCB8 8 exon 7 + 57 ggcaatgtgcggactgtgcg A/T gccttcgccatggagcaacg 3947 ABCB8 9 intron 9 + 1231 tttccgcagctgcatggaca C/T cctcgcgtgccccgtttctg 3948 ABCB8 10 intron 9 + 2164 cctcttggaggtccttctag C/T gctgcctatgtggagattct 3949 ABCB8 11 intron 9 + 2645 ttcctgcctggtgcctcccc C/&Dgr; ggctgcctttagcaagtgct 3950 ABCB8 12 intron 9 + 2646 tcctgcctggtgcctccccc G/A gctgcctttagcaagtgctg 3951 ABCB8 13 intron 9 + 3229 cagggccgagcagggagtcc G/A tgggtcagctgggctccctt 3952 ABCB8 14 intron 12 + (113-114) tcctccactgccacaagggg (GG) ccttctttcctgggacaatc 3953 ABCB8 14 intron 12 + (113-114) tcctccactgccacaagggg ccttctttcctgggacaatc 3954 ABCB8 15 intron 13 + 128 tgctctcgggagaccctggc C/T gtcttcacatgtcctcagct 3955 ABCB8 16 intron 13 + 305 atccaggtctagagaagccc A/G tagtggaggtgctgagctgc 3956 ABCB8 17 intron 14 + 135 acagttgtgtcagggaagac C/G agaaccacagccaaagggga 3957 ABCB8 18 intron 14 + 159 accacagccaaaggggacag A/T gtcgttgtgtggggacaggg 3958 ABCB8 19 intron 15 + 747 gttggagccttgggctctgt A/G agggggacagagggaatcat 3959 ABCB8 20 3′flanking + 333 cctatcccctggctcacccc G/A ggacccacagtccccatctt 3960 ABCB8 21 3′flanking + 1168 ccctctttcaggggtgtgat G/A cagtgcattgatggagcagc 3961 ABCB8 22 3′flanking + (1719-1721) tagaccgcaggagccgcgcc GTC/&Dgr; ttcctaacctcgcctcggcc 3962 ABCB9 1 intron 1 + 69 agggtgccaggccaggcacg G/C gttagggggcgtctgggcac 3963 ABCB9 2 intron 1 + 8873 tgggcccagcagctggggcc T/C ggaactacctcaaaggcttc 3964 ABCB9 3 intron 1 + 8940 accagctcagcctgcccagc G/A tgcacacggcaccaagctgg 3965 ABCB9 4 intron 1 + 11410 agatccaagggatccagagg T/C tggaatgtgaccctccgtgc 3966 ABCB9 5 intron 1 + 12863 gggaagccagatgcccacaa G/A gctctgtgacttcacttcca 3967 ABCB9 6 intron 1 + 19731 gccaagtgtcaagatcgagc G/A aggggagggcctgacgaggg 3968 ABCB9 7 intron 1 + 29649 cagaatccagatgcccgtaa T/C gttgttaagaagcctgcaca 3969 ABCB9 8 intron 1 + 31793 ggccaggcggggaggggtac C/T ggccagaccggtgggcaaaa 3970 ABCB9 9 intron 1 + 37537 agagtcacagggttggggtg C/A ccccgggaaggtggcatcta 3971 ABCB9 10 intron 1 + 38293 taccagccctgtgctttcag G/A gaccatgtgacctgtcaact 3972 ABCB9 11 intron 1 + 44661 cccgaggtgcctggcttcac A/G gcaggattgccgtcctgcag 3973 ABCB9 12 intron 1 + 49576 aaagtggccccgtggcttgt C/T ccctgaagccctaaagcacc 3974 ABCB9 13 intron 1 + 64669 ccacagacaagccgggtagc C/A cacctcgcagctcaacacac 3975 ABCB9 14 exon 2 + 448 cctggttttgggccctgttc G/A tgtggacgtacatttcactc 3976 ABCB9 15 intron 7 + 3364 ggtaccaggagtcgggtatc A/G gtgggacaggaacgcgtgtc 3977 ABCB9 16 intron 11 + 113 gggccccaggagctctccca G/T actatcagcctcctgggctg 3978 ABCB9 17 exon 12 + 370 cccaggcctgcagcactgaa A/G gacgacctgccatgtcccat 3979 ABCB10 1 5′flanking − 424 tcgcgtctgcgcgctccgcc C/T ggtctgccggcgtgagaaag 3980 ABCB10 2 intron 1 + 491 acaaggggcggttgcgcccc G/T cagcggccggactcccggag 3981 ABCB10 3 intron 1 + 37 ccacttccctccgccgggcc T/G ctccttctccacacgcgggg 3982 ABCB10 4 intron 1 + 217 actcgtttgcagattttaca C/T ttgttttcttgttgacacac 3983 ABCB10 5 intron 1 + 405 gcgtttatactttttttttt T/&Dgr; aaccaaaaacacattatttg 3984 ABCB10 6 exon 3 + 185 agggccggggcccaggcttc C/T gtaggcatcagtatgatggt 3985 ABCB10 7 intron 6 + 1269 caaattcacaactgtgcctt C/G cacagaatgggttggaaaac 3986 ABCB10 8 intron 9 + 632 ccccactccacttgggtgag G/A gcaggtggatggtgatgggt 3987 ABCB10 9 intron 10 + 2373 tacctcagggcactcagaca G/C cctcaccaatcagaggctca 3988 ABCB10 10 intron 11 + 108 tccttttcctgttttttgtt T/G ttttttttttcttggagtgg 3989 ABCB10 11 intron 11 + 2379 cattggtttttagtgtattc T/A gtgttgtgcatccatcatca 3990 ABCB11 1 5′flanking − (2596-2595) tgtggtttagagctttctct (TT) gagacatttttgctaaggtt 3991 ABCB11 1 5′flanking − (2596-2595) tgtggtttagagctttctct gagacatttttgctaaggtt 3992 ABCB11 2 5′flanking − 1746 agctgaagtgaattaagcac G/A atcaactcagtactcacact 3993 ABCB11 3 5′flanking − (326-314) agggggaaagtttaaaggta (T)9-12 gtcttgttatgtttttaagt 3994 ABCB11 4 5′flanking − 135 agagggtttcccaagcacac T/C ctgtgtttggggttattgct 3995 ABCB11 5 intron 1 + 511 aaatatagatgcaaaaaaaa A/&Dgr; tgagctgtggatgcatgttt 3996 ABCB11 6 intron 1 + 581 aatttcagtttttaggtcac C/T caagccagtgggagtcacat 3997 ABCB11 7 intron 1 + (1938-1951) aaagacgttttaagggcttt (A)10-13 gaaagaaaagaaaactgtag 3998 ABCB11 8 intron 1 + 4517 aagagatggtctctagcccc CT/&Dgr; gtttgatttggggcacttac 3999 ABCB11 9 intron 1 + 5651 aaagagaataggttagtgga T/C tagtattcctgtgcttaatg 4000 ABCB11 10 intron 1 + (12200-12201) aagagatggtctctagcccc CT/&Dgr; gtttgatttggggcacttac 4001 ABCB11 11 intron 1 + 13023 gtttggctactttgattaaa G/A aagaaagaagagataataat 4002 ABCB11 12 intron 2 + 739 cctgcatctattctgaccta C/T actggggaaaacagtatgtg 4003 ABCB11 13 intron 2 + (921-922) tattttgtagttcaaaaagt 4004 (CAGATCTTCTTCAGCTAATTTAGAAATGT) tgctgtccatttgatattca ABCB11 13 intron 2 + (921-922) tattttgtagttcaaaaagt 4005 tgctgtccatttgatattca ABCB11 14 intron 3 + 644 agccacacgtttcttattgc G/A tgggaagtttaaaaaatggg 4006 ABCB11 15 intron 3 + 2231 agtgaacctgagattgagct A/G tactgaaatctctagaagag 4007 ABCB11 16 intron 3 + 2406 aaagggtggtctttaaatcc T/C tatgtttttctcatcaggtt 4008 ABCB11 17 exon 4 + 10 tttctcatcaggttacaaga T/C gagaagaaaggtgatggcgt 4009 ABCB11 18 intron 4 + 434 acaatttatagtatttctca A/G tgccccacacagtttatcta 4010 ABCB11 19 intron 4 + 518 gtagatgagtagctaaaaac G/T aaagtcagctcctgaaataa 4011 ABCB11 20 exon 5 + 120 ggcacaatgacagatgtttt T/C attgactacgacgttgagtt 4012 ABCB11 21 intron 5 + 320 gggaggtgacccatgaattt T/C acttgagtatcatctccaag 4013 ABCB11 22 intron 5 + 16076 agaagaggtaacagtaagcc T/G cctgatttacagcacacatc 4014 ABCB11 23 intron 6 + 303 atttgcaggtgtgtttgtag G/C gggcagttgagtagcttgaa 4015 ABCB11 24 intron 7 + 1141 aaaggattcagcaggcatga A/G gaaagaaaagctttgcaaga 4016 ABCB11 25 intron 8 + 2463 ccattggctaatagcaatga A/C ctatgacatggtctaactta 4017 ABCB11 26 intron 8 + 2677 tcaatgatgttacagtgaga A/C tctaatattgtattaaaccc 4018 ABCB11 27 intron 8 + 2699 ctaatattgtattaaaccca T/A gccacatgttaaatgaatct 4019 ABCB11 28 exon 9 + 24 gtgtccaagtttacggacta T/C gagctgaaggcctatgccaa 4020 ABCB11 29 intron 9 + 108 caccttggtctgtggcctcc A/G gaggaagtacttgttcaaga 4021 ABCB11 30 intron 10 + 2475 taatcattccaaaccacgga C/A tttatttcattaagaacatg 4022 ABCB11 31 intron 10 + 2478 tcattccaaaccacggactt T/A atttcattaagaacatgata 4023 ABCB11 32 intron 10 + 2711 tttacagattggaaaagcca C/T tgaagtattgcaggtccaga 4024 ABCB11 33 intron 10 + 3539 agtgactgtaattagtatca C/G ttgtgcacagagaaaaaatg 4025 ABCB11 34 intron 10 + 3623 tgcagaaggttgttctttca T/C gaccttcctgagtttcagaa 4026 ABCB11 35 intron 10 + 3661 gaattcattaataaaaataa A/T cacataatggagcgtgacat 4027 ABCB11 36 intron 10 + 5100 gggccactctttggcttggc A/G atagactgtggccaatgaaa 4028 ABCB11 37 intron 10 + 5292 gctatttggtaggaacatct G/A ggcatgatcaggtagccttc 4029 ABCB11 38 intron 10 + 5912 gagtaatattcagtaaaaaa A/&Dgr; taaagtggtattttaaatca 4030 ABCB11 39 intron 12 + 116 tgtttccagtaatagggaat G/A gaggtgtctttctctgaaag 4031 ABCB11 40 intron 12 + 326 gataaatgacaaggcaatta G/C aacaatcaggaagcacaggt 4032 ABCB11 41 intron 12 + 335 caaggcaattacaacaatca A/G gaagcacaggttcttcccaa 4033 ABCB11 42 intron 12 + 2572 cctcatccttgccaatgttt C/T cttttactggtttttgatgg 4034 ABCB11 43 exon 13 + 23 tctaaatgacctcaacatgg T/C cattaaaccaggggaaatga 4035 ABCB11 44 intron 13 + 70 atggcagtatattgatcaaa C/T agaaaggtgtagcatacatt 4036 ABCB11 45 intron 13 + (1578-1579) ttattggcctctattttttc (C) tgcccattggtcaagtatga 4037 ABCB11 45 intron 14 + (1578-1579) ttattggcctctattttttc tgcccattggtcaagtatga 4038 ABCB11 46 intron 14 + 32 catacattcctgggagaaac C/T aagaggtcatagaaggaaaa 4039 ABCB11 47 intron 14 + 80 cacaattatacacatttctt C/T tcgtatgattcccaagtcat 4040 ABCB11 48 intron 14 + 439 tattgtgtcaaaaacaattc A/G ttgtatatctccattctaag 4041 ABCB11 49 intron 14 + (1262-1263) cagcctttgcattatatttt (T) gctgtgttgtctaacaggag 4042 ABCB11 49 intron 14 + (1262-1263) cagcctttgcattatatttt gctgtgttgtctaacaggag 4043 ABCB11 50 intron 14 + 1283 gctgtgttgtctaacaggag A/C aaagagacacggatttgctc 4044 ABCB11 51 intron 14 + 1339 tgagatagatatttaggacc G/A tgaccaatttttattttggt 4045 ABCB11 52 intron 14 + 1359 gtgaccaatttttattttgg T/C tgaaaaatcttatttgaagt 4046 ABCB11 53 intron 14 + 1480 tattgattagacaataaccc G/A tctggggaagggatatttct 4047 ABCB11 54 intron 15 + 370 ccttttctaatgtctgcaca G/A cctatttaagaatattccca 4048 ABCB11 55 intron 16 + (550-559) aaagtttagtgtttctatca (T)9-12 gctacttctgatggacttct 4049 ABCB11 56 intron 17 + 188 tttctctccccaattcatgg T/G tttttggttagcttctcatc 4050 ABCB11 57 intron 17 + 194 tccccaattcatgggttttt T/G gttagcttctcatcttcttg 4051 ABCB11 58 intron 17 + (197-198) caattcatgggtttttggtt (T) agcttctcatcttcttgggg 4052 ABCB11 58 intron 17 + (197-198) caattcatgggtttttggtt agcttctcatcttcttgggg 4053 ABCB11 59 intron 17 + (289-296) ggggacttcttttaaaaaaa G/A (A)4 tctgtgtttagtgttcctct 4054 ABCB11 60 intron 17 + 1070 tcagacttgggttttcctat C/T tttcttcttgagaacaagtt 4055 ABCB11 61 intron 17 + 1651 tgttaaaatatctcattgta T/C atgctgacggatttttcttg 4056 ABCB11 62 intron 17 + 2226 ccttaagtctcctcctatca T/A gcaccttgttctcaccagct 4057 ABCB11 63 intron 17 + 2979 ctctctcttcctttctcagc T/&Dgr; ctactatttcactgttggct 4058 ABCB11 64 intron 17 + 3288 aatccccatatcctacctta T/G ccatctcatccatgaatctt 4059 ABCB11 65 intron 17 + 3289 atccccatatcctaccttag C/T catctcatccatgaatcttg 4060 ABCB11 66 intron 18 + 97 aatatgagttttctaggtat A/G tatctagcagtgtttcaagt 4061 ABCB11 67 intron 18 + 98 atatgagttttctaggtata T/C atctagcagtgtttcaagtc 4062 ABCB11 68 intron 18 + 892 ctctgaaagttagtgataca C/T cttatttgtgtttgaatcaa 4063 ABCB11 69 intron 18 + 2681 atgtatgagatcaagtcagg A/G tcaaatattagacacccata 4064 ABCB11 70 intron 18 + 2681 ggaccatcctgtggggcaat C/G gttccagaaaatgctggtat 4065 ABCB11 71 intron 18 + 5741 ctcaccggtataaatacaac C/T gtagcaaaggttttcttttt 4066 ABCB11 72 intron 18 + (5582-5883) tgcgtattccctcagttcag (C) tttttattcaagccacagca 4067 ABCB11 72 intron 18 + (5582-5883) tgcgtattccctcagttcag tttttattcaagccacagca 4068 ABCB11 73 intron 19 + 10022 tggctaagttaaaaaaaaaa A/&Dgr; gagattcaactataattgct 4069 ABCB11 74 intron 21 + 322 caagattcaatactgccccc C/&Dgr; agggggtgggtgaacagggc 4070 ABCB11 75 intron 22 + 257 ctgttcaatttcctctcgca T/C agtgattcattccacattcc 4071 ABCB11 76 intron 22 + 552 taattaatatcttgtccttg G/C ggggtaaatgagggatggta 4072 ABCB11 77 intron 22 + 569 ttggggggtaaatgagggat G/A gtagcataaacacttctcaa 4073 ABCB11 78 3′flanking + 243 aaacaccacagaatgacata G/A aactaaaggcggcaggaatc 4074 ABCC1 1 5′flanking − 1661 cattcacccttgggggaccc A/G ggccaataaaaaaatcacag 4075 ABCC1 2 intron 2 + 635 gatgtgccctacctgaccct T/C ggctcggggcagacttgggg 4076 ABCC1 3 intron 2 + 4769 gggcaggagtggactcaggg G/&Dgr; ttcctggtccaaatgggttc 4077 ABCC1 4 intron 2 + 10069 tatggaggttttctcttcct T/C tctgtgagttttctctctga 4078 ABCC1 5 intron 2 + (11965-11984) taaaagccaatcaaatcaac (T)18-20 aaacaagccacgcatttgcc 4079 ABCC1 6 intron 4 + 4302 cacctgtaatcccagcacct T/G gggaggccaaggcaagtgga 4080 ABCC1 7 intron 4 + 4394 gtctttactaaaaatacaaa A/C attagctaggcatggtggcg 4081 ABCC1 8 intron 4 + 4524 ccactgcgctccagcctggg T/C gacaagagtgaaactctgtc 4082 ABCC1 9 intron 6 + 9045 aggtccttaaactaccctgc G/A ctccaagaatcagtgcctgg 4083 ABCC1 10 intron 7 + (3059-3071) agtcttttgtatgcaccact (A)11-13 gccatttttcctgcatgacc 4084 ABCC1 11 intron 8 + (886-889) ttctatgtaacagtaagaaa GAAA/&Dgr; agcagctgccaattaaacaa 4085 ABCC1 12 intron 11 + 198 tgaattgtcaggttgatgtt C/A tccttggtggcatggcgttt 4086 ABCC1 13 intron 11 + 784 tgtggattgatccaggagat C/G aagcaatgttgtcagtactc 4087 ABCC1 14 intron 12 + 122 agccttgcctgccagttgga C/G tcacttggggagccttaaca 4088 ABCC1 15 intron 12 + (3138-3148) accccatctctattgaaaag (A)10-12 tcaatataaaaaacatttac 4089 ABCC1 16 intron 12 + 3227 tggtgatgttgagtgatggg C/T tgatcccagggtcgccccag 4090 ABCC1 17 intron 13 + 2060 tgctcattacaactattcct T/C cttggtcaggttggcaaatt 4091 ABCC1 18 intron 13 + (2061-2062) ctcattacaactattccttc (C) ttggtcaggttggcaaatta 4092 ABCC1 18 intron 13 + (2061-2062) ctcattacaactattccttc ttggtcaggttggcaaatta 4093 ABCC1 19 intron 13 + 11776 gccacctggggagggcccaa G/A cgcgtctccagggcctgtca 4094 ABCC1 20 intron 14 + 179 aaagaaagaaaacacatttg A/T cttcttgacagagaactcgc 4095 ABCC1 21 intron 16 + 219 ctagcacagagggttccctg G/T gattgtaagttacagcagcc 4096 ABCC1 22 intron 16 + 310 ggaagttctactttcaggtg C/T ggtgtgatccagggactctg 4097 ABCC1 23 intron 16 + 890 ctctccagagaaaacaatct G/T tagaaggcctgcattgaaaa 4098 ABCC1 24 intron 17 + 1171 aaccccaggctcaaagaagc G/A tgggaaataatgcatactcc 4099 ABCC1 25 intron 17 + 1332 cacctctttagtgtctgtgc A/G actgcacatttgtctcttgg 4100 ABCC1 26 exon 18 + 53 gattcagaatgattctctcc G/A agaaaacatcctttttggat 4101 ABCC1 27 intron 19 + (3373-3379) ccaagctaggcagtctcaca CA/&Dgr; tgtgcactcacgtggccggg 4102 ABCC1 28 intron 20 + 2730 gcgtgaggtctgtctctcta C/T ccttccgtccaggtgagcaa 4103 ABCC1 29 intron 20 + 3789 cttggccccagataggttcc G/C cacccccgcctttctttccc 4104 ABCC1 30 intron 20 + 2919 gatgcaaatgccgcccacca C/T cctggcacctcgtgcgttca 4105 ABCC1 31 intron 20 + 3024 cttacatcaaactggggcac G/C cacccccgcctttctttccc 4106 ABCC1 32 intron 20 + 9718 gtggctgcgctcagtgacga A/C caggagaagtgaaggctgag 4107 ABCC1 33 intron 20 + 9733 gacgaacaggagaagtgaag G/C ctgaggcttataggagggtg 4108 ABCC1 34 intron 20 + (9895-9896) gctggttcccagtgtcacac AT/&Dgr; gtgtgtgaggacaggctgca 4109 ABCC1 35 intron 20 + 9952 ggtatcattcttccttcctg G/A gtgatgtggctatttgtgtt 4110 ABCC1 36 intron 20 + 11120 gcggagtgggggcagtagtc A/G tcatcatcactgagttattg 4111 ABCC1 37 intron 20 + 11147 tcactgagttattgtgaacc G/A ggaaagagatatgatctgtg 4112 ABCC1 38 intron 20 + (11629-11631) tattttgaatatcacttctt CTT/&Dgr; tcaatgcttgggaatcacgg 4113 ABCC1 39 intron 20 + 11864 gagctccagataccacctgc C/T ccacaaccagacagcctgtt 4114 ABCC1 40 intron 21 + 3860 tggagagtgacatggtgggg G/&Dgr; tgtggtgcatatattcatat 4115 ABCC1 41 intron 22 + 878 ttaaagatcgtctattttgg G/A caagtgttaataattctcca 4116 ABCC1 42 intron 22 + (4445-4446) gtggggctggggctggggct (GGGGCT) gggtgcgtgcatgtgctaag 4117 ABCC1 42 intron 22 + (4445-4446) gtggggctggggctggggct gggtgcgtgcatgtgctaag 4118 ABCC1 43 intron 23 + 62 gttgtggctttgtctaatta T/C agaaatggatccttagagtc 4119 ABCC1 44 intron 24 + 3171 aaccatgaggctcaccatat C/T tcaaaccacgctgcacagct 4120 ABCC1 45 intron 24 + (3349-3368) ctcttgaaattggtgccagc (T)19-22 ccctgcatttaccaaatatg 4121 ABCC1 46 intron 24 + 3369 tttttttttttttttttttt T/C ccctgcatttaccaaatatg 4122 ABCC1 47 intron 24 + 3584 ccaaggatttttatttttca A/G caacaaaggaaatgatttta 4123 ABCC1 48 exon 25 + 60 gagtcggtcagccgctcccc G/A gtctattcccatttcaacga 4124 ABCC1 49 intron 27 + 4539 tcttttttactcactgcagt G/A tgaggaacaaatcacattta 4125 ABCC1 50 intron 30 + (1708-1714) gacccaacactatctcctgg (T)6-7 cttccggtcaagtgtcgggc 4126 ABCC1 51 exon 32 + 652 tggagaaaatcattttctcc C/T cttggcagtgtcccagggcc 4127 ABCC1 52 3′flanking + 158 ctgatgctcttccaggacac G/A aaaagaacccatctttgaat 4128 ABCC1 53 3′flanking + (187-199) ccatctttgaatatcaatga (T)11-13 aagtactgttccggggagaa 4129 ABCC1 54 3′flanking + 2227 cattagaataggtagtatca G/A ccagccgggcatggtggctc 4130 ABCC2 1 exon1+ 77 catattaatagaagagtctt C/T gttccagacgcagtccagga 4131 ABCC2 2 intron1+ 413 gataagttctagaactggca A/C ctaatgatatggactagaag 4132 ABCC2 3 intron2+ 192 atcaaagtggctttgatttt T/G gcataagaatggtgactctt 4133 ABCC2 4 intron2+ 1020 agtgctgcgattacaagcct G/C agccacctgcacagcctctg 4134 ABCC2 5 intron2+ 3639 gtcatatcccacccccaaat C/A gacccaataggtacaatgaa 4135 ABCC2 6 intron2+ 3930 aaaactggcaggagaatttc A/G ctggagctgcatgcaggact 4136 ABCC2 7 intron2+ 3989 agtgctgcgattacaagcct G/C agccacctgcacagcctctg 4137 ABCC2 8 intron2+ 4078 aggtttccagatgtgttccc T/C aggcattcctggtggtagga 4138 ABCC2 9 intron2+ 4171 cttattctttggtcagttgg C/T tttctaccacctcttagctt 4139 ABCC2 10 intron2+ 4257 gggtattggaaagttcttgc G/A gctgctggaggctgcggtgt 4140 ABCC2 11 intron2+ 4436 ggactagtggaagaattaga C/G ctttcctgaataaatagatc 4141 ABCC2 12 intron2+ 5227 taccataatttatgtgtcct A/G tatgacatgaatttcattgg 4142 ABCC2 13 intron2+ 5373 gttaaggatatgtgaactca A/G gtgtgtctataggataaatt 4143 ABCC2 14 intron2+ 5538 ttaatgaggttaagcacatg G/T tcatatgtttaaaagccttt 4144 ABCC2 15 intron3+ 772 ggtataaggcaagatttttt A/T aaaaaattaattgcttaatc 4145 ABCC2 16 intron3+ 1145 acatccttctcccctcagtc C/T tcggttagtggcagtattct 4146 ABCC2 17 intron7+ 1658 ggactcttaccagcttagtt G/T cctggttttctaatctaaaa 4147 ABCC2 18 exon10+ 40 tggccaggaaggagtacacc G/A ttggagaaacagtgaacctg 4148 ABCC2 19 intron11+ 1672 aactttttaagtcttaagac T/A ggaaggcctgtgtcctaggc 4149 ABCC2 20 intron12+ 148 ccctctcaccgccccatgcc A/G cttttcctcctttgtaccat 4150 ABCC2 21 intron13+ 180 catgagttttctgagcccca G/C tttatctaactataaaatga 4151 ABCC2 22 intron13+ 1497 gtgcagggtccccctgatgc T/C atagccagttcctctttaga 4152 ABCC2 23 intron15+ 169 atgagctgaaagcaaaggtt T/C tcagccccttcccctgataa 4153 ABCC2 24 intron15+ 949 ttccaggtgacacatttagt A/G cctaatttgggaaatgttaa 4154 ABCC2 25 intron16+ 984 tgttaatctagtccaatccc A/C ttagtaagaaaggaggggtc 4155 ABCC2 26 intron19+ 4059 catcctgatgcacagttatt C/T aaatttaagctccatttgtt 4156 ABCC2 27 intron19+ 10899 atgtatggagtatttatgga G/A taaagtattccatgctgtat 4157 ABCC2 28 exon22+ 51 caagcaataggattgttttc G/A atattcttcatcatccttgc 4158 ABCC2 29 intron23+ 56 tatactgaggatctttctga C/T agggaggaattattatgtcc 4159 ABCC2 30 intron23+ 432 tggcagtagagcagggtgag G/A aggattattctgcagaggaa 4160 ABCC2 31 intron23+ 734 tgagccaactactgtactag G/A cactggggcactcaatgaat 4161 ABCC2 32 intron23+ 801 atgggccagacccaactcac T/G gattttttagtgtatctgag 4162 ABCC2 33 intron26+ 154 ctggctccatcttttaccca T/C ggacgtattccttactcttc 4163 ABCC2 34 intron27+ 124 gggtccctaaagtttccttt C/G ctctaactcaaaggacctaa 4164 ABCC2 35 exon28+ 52 cagattggcccagcaaaggc A/C agatccagtttaacaactac 4165 ABCC2 36 exon28+ 84 aacaactaccaagtgcggta C/T cgacctgagctggatctggt 4166 ABCC2 37 exon28+ 129 agagggatcacttgtgacat C/T ggtagcatggagaaggtagg 4167 ABCC2 38 intron29+ 154 ttccctaggatggacacgtc A/G tttccagaactttgaaatgt 4168 ABCC2 39 intron30+ 91 gtgttaggtgatgcctggca T/C agaattttcatccaggtctg 4169 ABCC2 40 intron31+ 170 gccaaaattttacatcacgc A/G aatgaaaacgaacaaggtta 4170 ABCC2 41 3′flanking + 371 gtgaatttttattataagct C/T gttctccttaaaactttatc 4171 ABCC3 1 5′flanking − 1064 tccttctgagccccaacaag C/T ggtgctgagttggcgtctgg 4172 ABCC3 2 5′flanking − (827-820) ctggggcttcacctgtcctt (C)7-8 aaccctgatcaggctgaagc 4173 ABCC3 3 intron 1 + 1226 tatttgtacatatatgccct T/G tgtgtgtgtacgcacacacg 4174 ABCC3 4 intron 1 + (1389-1399) aaacttggggcaatggaggt (A)10-12 ctgtaaaaaggcatatttgg 4175 ABCC3 5 intron 1 + 2070 gcgcacttctccttgatgct C/T gtgagctatacacacctcct 4176 ABCC3 6 intron 1 + 4477 gcctgtagtccccagacagg G/A ggttttgccattttggcagg 4177 ABCC3 7 intron 1 + 6189 agtgaccatgaagtctgcca T/C gagggggcctctgccacgtg 4178 ABCC3 8 intron 2 + 268 ttgtatttttagtagagatg G/A ggttttgccattttggcagg 4179 ABCC3 9 intron 2 + 376 tgtgcccagccagcattctg G/C ttttaatgaggccctctccc 4180 ABCC3 10 intron 2 + 446 ctcacctgacctgcttgggg C/T catgggaatctgacaactga 4181 ABCC3 11 intron 8 + 2323 gaggctggtggtgagagcgt C/G atcgatagggcgtgcagcag 4182 ABCC3 12 intron 12 + 85 ctcattggactctaccctga C/&Dgr; accacctccacgctgctcag 4183 ABCC3 13 intron 19 + 1581 ttcttgttgccctttcaatc C/T ccctcattttattttcatgc 4184 ABCC3 14 exon 22 + 180 aacacttccctgaggctggg C/T gtctatgctgctttaggaat 4185 ABCC3 15 intron 30 + 1979 cctctgtctgttccatccct C/G tcctaccctcaccccccact 4186 ABCC3 16 intron 30 + 2340 atgcaccagccaggcctgaa A/C gaatgagtaagagttggagg 4187 ABCC3 17 3′flanking + (555-558) ttttcttgagcaagccaaca AAGA/&Dgr; gtttcttttctgcaggtcag 4188 ABCC3 18 3′flanking + 1455 aaccccgtatgattagaact G/A tagtgctgtttaggaagcca 4189 ABCC3 19 3′flanking + (1650-1659) aattcacagttaacaaagct (A)9-11 tccttgttataaattacaca 4190 ABCC4 1 5′flanking − 644 attcatctgggtcatactct C/T gagttacccggctttcttga 4191 ABCC4 2 exon 1 + 67 ggagcggagcccgcggccac C/T gccgcctgatcagcgcgacc 4192 ABCC4 3 intron 1 + (864-865) ctttgaccagcttctttccc CT/&Dgr; gtttccaatactttcacttc 4193 ABCC4 4 intron 1 + 21255 ggatggaaatggtgagcaca A/G accttggcatttaaggaccg 4194 ABCC4 5 intron 1 + 21503 ctgttttctacccactgggg T/C cagcaaatcagcccctttta 4195 ABCC4 6 intron 1 + 21900 tgatgctcaaagcaatacaa C/G tagaaaatataggaggctgg 4196 ABCC4 7 intron 1 + 22005 aagggggagtcatactccag C/T gtgcattttagtttgtgctt 4197 ABCC4 8 intron 1 + (22256-22264) tttgtgttgttatttgcgtc (T)8-9 cctggaaggaagtgattggc 4198 ABCC4 9 intron 1 + 27784 ccagggaactggtggcacac C/G ctgagtctgctaggtgggct 4199 ABCC4 10 intron 1 + 27821 ggctaaagactcacaacctg A/T gggaaggggccaggaaagaa 4200 ABCC4 11 intron 1 + 27837 cctgagggaaggggccagga A/G agaaaggaagccatggccta 4201 ABCC4 12 intron 1 + 27880 gggtgttatttgggacccca C/T gcccatccaggccgacagag 4202 ABCC4 13 intron 1 + 40310 accaagcaggggaggtgaga A/T ttgtgcagactggggatatt 4203 ABCC4 14 intron 1 + 40372 ttgcttgaataaaaggatgc G/A agtcactgtattggtgaagt 4204 ABCC4 15 intron 1 + 40413 ttctttcaaatccaattcct G/A actgatttccttgccttcca 4205 ABCC4 16 intron 1 + 40958 gaagtttaccgaaaaacaaa A/G caagaaactccccagtaaaa 4206 ABCC4 17 intron 1 + 50060 tgtggctatggggaacatga G/A gctcatagaaactgaagact 4207 ABCC4 18 intron 2 + 181 gcctgggggaaactcctgtt G/T cctgtgcctccgtagaggtc 4208 ABCC4 19 intron 2 + 254 gaggtctgtccctctaggtg G/A aagtgttgtggttggaggag 4209 ABCC4 20 intron 2 + 290 aggaggttgtctggcttatc T/C gtgctactgatggggcttca 4210 ABCC4 21 intron 2 + 543 ttacgaagctttttcctcat T/C gtaggttctgggataaagaa 4211 ABCC4 22 intron 3 + 557 ggccttgcacctgggctggc G/A gtggtgccccagaggctgga 4212 ABCC4 23 intron 3 + 718 gtgtgtcttccttgttgtcg G/A agtggattgctggttggaag 4213 ABCC4 24 intron 3 + 801 acattccatgaaaaatcaaa G/A acagccagaagggcaataac 4214 ABCC4 25 intron 3 + 1022 aggggtggatgttgctgttg T/C tacaaaagggtggctttaaa 4215 ABCC4 26 intron 3 + 1471 tgctggggtgtcccagcgat A/G gtgtttccacatggccccga 4216 ABCC4 27 intron 3 + 1490 tagtgtttccacatggcccc G/A atcagtttcagttggaaaga 4217 ABCC4 28 intron 3 + (1833-1834) gggctgccagccacttgggg (G) tggggtctctaacccacaga 4218 ABCC4 28 intron 3 + (1833-1834) gggctgccagccacttgggg tggggtctctaacccacaga 4219 ABCC4 29 intron 3 + 1870 cagatggtgactggactaca G/A tgagatttgggtaagctttt 4220 ABCC4 30 intron 3 + 1927 gaagtagaggctgtagaagc G/A tgaatttctcctgagacttg 4221 ABCC4 31 intron 3 + 1970 gacaggccccactctggtgc A/T aggagcatggtaatctttac 4222 ABCC4 32 intron 3 + 2039 gatcgaggggagctttaata T/C gggtacagttggtggagagc 4223 ABCC4 33 intron 3 + (2067-2068) ttggtggagagctggtcttt (CTTT) tagcggggtggttattgggc 4224 ABCC4 33 intron 3 + (2067-2068) ttggtggagagctggtcttt tagcgggggtggttattgggc 4225 ABCC4 34 intron 3 + 3563 cattgactgatggtctgggc G/a gatgtcaagttccctgtttt 4226 ABCC4 35 intron 3 + 3696 tgcttggcaaggatgaagac C/G ccagatgagtcactagtatg 4227 ABCC4 36 intron 3 + 4093 aagtaatccttggatttttt T/C ttttcttttccttctagcag 4228 ABCC4 37 intron 3 + 4097 aatccttggatttttttttt T/&Dgr; cttttccttctagacagtgaa 4229 ABCC4 38 intron 3 + 9724 aaaaaccagcattactcacc A/G atgagcccatttgcttgact 4230 ABCC4 39 intron 3 + 9988 aaaggcaaagagcactgagc G/A tctggctgatagcccaggtg 4231 ABCC4 40 intron 3 + 10952 gttaaaattgcattccctac A/G tcttgttcagaaggtaagcc 4232 ABCC4 41 intron 3 + 11125 gctcaatttctgctgtgttt A/G atttttgactccacactacc 4233 ABCC4 42 intron 3 + 11244 ccaagagcctggaatcctcc C/&Dgr; aagtctggttcttttcccca 4234 ABCC4 43 intron 3 + 11916 gtcttgaccaaaaaaaaaaa A/&Dgr; tttagctctacatgatggtg 4235 ABCC4 44 intron 3 + 12047 actatactccagcatgggtg A/G cagagcaagcaatatctgaa 4236 ABCC4 45 exon 4 + 205 tgaggttacgagtagccatg T/G gccatatgatttatcggaag 4237 ABCC4 46 intron 4 + (412-414) ttatggaaatttttgttgtt GTT/&Dgr; cattaaaaccttcacttaca 4238 ABCC4 47 intron 4 + (9757-9756) tgacatctgtcatttttttt (T) cctgctgcacaaatctcttc 4239 ABCC4 47 intron 4 + (9757-9756) tgacatctgtcatttttttt cctgctgcacaaatctcttc 4240 ABCC4 48 intron 4 + 6373 atgttttgttctagatagta C/G agttttcttgtaatctcaaa 4241 ABCC4 49 intron 4 + 6267 acttccaccattcacagtat T/C gttcttaatggcatgcggat 4242 ABCC4 50 intron 4 + 6095 agatccttcatttcctaggg T/C gtacaaatttcaaggctttt 4243 ABCC4 51 intron 4 + 6057 ttgctatgctagattgattt C/T ctccccaagagttgttaatt 4244 ABCC4 52 intron 4 + 5295 agttgtctggcttacagtag A/G tgcttactaaatggtagctt 4245 ABCC4 53 intron 4 + 803 agcttcacctgtttcagccc C/T gcttccatgagcttcacctg 4246 ABCC4 54 intron 4 + 736 attcagcagcctccacatcc C/T ccttctccgtacttctgtcc 4247 ABCC4 55 intron 4 + 728 gcctccacatcctccttctc C/T gtacttctgtcctagctagg 4248 ABCC4 56 intron 4 + 624 ccacccagtgtccctcagtt A/C gaactgtccccagttctctg 4249 ABCC4 57 intron 4 + 470 ttgatactccatatttgtca C/T ttcccattgaacacattgaa 4250 ABCC4 58 intron 4 + 411 ggtgaagagactaaggcccc G/A tgtgtttaataatgttgcac 4251 ABCC4 59 intron 4 + 323 tgttcctctgacagcctctc C/T gttcttccctaatttggctc 4252 ABCC4 60 intron 4 + 246 gtccttttgtacttgggggc A/G tgtccaaattcattaaatga 4253 ABCC4 61 intron 4 + 199 agatttttcttcttcctacc C/T ctcgctttgctgtcctgaca 4254 ABCC4 62 intron 5 + 73 ccttttattctttctggagg C/T aggggctcactctgttcaca 4255 ABCC4 63 intron 5 + 403 aagggatcacgccttgttgc G/A caggctggtctcaagattct 4256 ABCC4 64 intron 5 + 937 ccagaatggcttcacctgtg G/C tgggtgcttggctttctgct 4257 ABCC4 65 intron 6 + 150 ggctcagccaagggggcctc C/T gtccttatgctgaaggcaaa 4258 ABCC4 66 intron 6 + (380-381) tgtgttagagctgttttcac (AT) gtgtatatatgtgtgttatt 4259 ABCC4 66 intron 7 + (380-381) tgtgttagagctgttttcac gtgtatatatgtgtgttatt 4260 ABCC4 67 intron 8 + 894 tttgttgttgttgcccagga A/T ggtctcaaactcctgggttc 4261 ABCC4 68 intron 8 + 82 tatttagcatcactatgttc C/G agtgtaatgacatttaactc 4262 ABCC4 69 intron 8 + 100 tccagtgtaatgacatttaa C/T tctctcataaccaaaacgtg 4263 ABCC4 70 intron 8 + 5212 tcagggaattgtggtccaat A/T tgcagctagggaagaaatcc 4264 ABCC4 71 intron 8 + 5444 gaaaccttaatttcccctca T/G gtacatagtttctggtggga 4265 ABCC4 72 intron 8 + 8969 tcaccctcctgagtgactag A/G gaaagtccagctagcccctc 4266 ABCC4 73 intron 8 + 9106 ccagtgctcaataggtttac T/C gtgtgcatagtttttatttt 4267 ABCC4 74 intron 8 + 9412 tgtttgtaagtgcaggatgg G/A ggacacatctctgccctgta 4268 ABCC4 75 intron 9 + 116 tggcttgcttatttactgaa A/G ctatgttacaaagattctca 4269 ABCC4 76 intron 9 + 1384 cacggcaggaagctgcaccc T/C ggggctggagatgatgtctg 4270 ABCC4 77 intron 9 + 1459 agatttgggagcagagggcg A/G gggtctcttctgagggtact 4271 ABCC4 78 intron 9 + 1632 agcagcactcctgcccagcc C/A cactgcctccgtcctcccct 4272 ABCC4 79 intron 9 + 3630 gtaaatttttcattttgaag G/&Dgr; ttatcttgatctcttattcc 4273 ABCC4 80 intron 9 + 3830 ggtgttccacccttcaggga C/T gccagattcattttgaagaa 4274 ABCC4 81 intron 9 + 3940 gagcatttaccaaagtgtgt C/T gtgcagaagaatagccactt 4275 ABCC4 82 intron 10 + 1504 gggcaaggctgcattgcagt G/A gcttattcttgtctcgagtg 4276 ABCC4 83 intron 11 + 1817 ttttagggagttgagaaaca G/C atggcaaattttgctagttt 4277 ABCC4 84 intron 11 + 3342 actggaattattctggcttg T/C aggtacagagattgcatgtg 4278 ABCC4 85 intron 11 + 3377 catgtgtaatcaaaacctgc T/C ggacagaaatggtcctgagc 4279 ABCC4 86 intron 11 + (3610-3625) tcctggccaccctcccccgc (A)15-17 gtcctagaggaaaaaatagg 4280 ABCC4 87 intron 11 + 3737 ataagttcatcgagctaaaa A/G tatatttgagataaaataat 4281 ABCC4 88 intron 11 + 6953 agagtagagacaaagaaatg C/A caccttgatctgtaagaggg 4282 ABCC4 89 intron 13 + 442 ctatgacaggttagaagtga G/C gtccttgggaccaacatagg 4283 ABCC4 90 intron 13 + 449 tgacgtccttgggaccaaca T/C agggctttcttgggaaggct 4284 ABCC4 91 intron 13 + 633 tgaacacttaaaacccacag G/A catgtaggcctggcttgcct 4285 ABCC4 92 intron 13 + 645 acccacaggcatgtaggcct G/T gcttgcctttgaaactagtt 4286 ABCC4 93 intron 13 + 3306 aatgttctcaacgagttaga A/C aattggattgaacaatatgc 4287 ABCC4 94 intron 14 + 252 taatttagaactttttgttt A/G cctcttccatgacttaattc 4288 ABCC4 95 intron 15 + 124 tggattctgtggtttcaggg C/T tctattccatgatattggta 4289 ABCC4 96 intron 15 + 1552 tttggacttctgcctgtttc C/T ccacagctttgtcaacagag 4290 ABCC4 97 intron 16 + 157 cctactggtgttccatgtcc G/A ttacaaagacctgcgaaaaa 4291 ABCC4 98 intron 17 + 329 cccaaattgtggttcatttt T/C aaaaaaatgtatttatctaa 4292 ABCC4 99 exon 18 + 56 atggaggaggaaatgtaacc G/A agaagctagatcttaactgg 4293 ABCC4 100 intron 19 + 7202 aattaaaaataatgtttttt T/&Dgr; cacataacaatggttatatg 4294 ABCC4 101 intron 19 + 7445 ttttggcataatttttaatc T/C actagaatgttctgattcat 4295 ABCC4 102 intron 19 + 9018 tacgtgatggcctgaagaga A/G aaaccgtacattggttcttt 4296 ABCC4 103 intron 19 + 11388 aagagttcagagattttggg A/G gttggaggaaaaaatagcat 4297 ABCC4 104 intron 19 + 11646 cattatttttaatttttttt T/&Dgr; cctcctgttggtgtcagaat 4298 ABCC4 105 intron 19 + 13517 gagaaacttacattattttt A/T aaaaatgctataactagtcc 4299 ABCC4 106 intron 19 + 21033 tgggagtgccctgggctagc G/A ctgaaacttcaggttttcag 4300 ABCC4 107 intron 19 + 21095 agacttttggaagaagcaga A/T ctgaaggtaagactgagtaa 4301 ABCC4 108 intron 19 + 21634 gtgctatttctgagcactca C/T ggccccattgggcatgggct 4302 ABCC4 109 intron 19 + 21715 tgttttgctcaccccctaca C/T agcttgccctcatgcttctc 4303 ABCC4 110 intron 19 + 23090 agcaacagacttggagactt G/A agcttctaaaagtttcatta 4304 ABCC4 111 intron 19 + 24297 cgaatgtgatgaatgtggga A/G cctttttgagatagcagcac 4305 ABCC4 112 intron 19 + 25947 gagtctaaattaaatatgag C/A aaaactagaaaccatttaaa 4306 ABCC4 113 intron 19 + 30193 acagatttgcaagagtctac A/C aaagtgataatattctgtca 4307 ABCC4 114 intron 19 + 36938 aagccgagtcaatctcttgg C/G tatcttctgtggactacttt 4308 ABCC4 115 intron 19 + 37322 gttcccatgagggctgaccc C/T gcctcacccctggtaaccgc 4309 ABCC4 116 intron 19 + (38361-38362) cggggttagcttccctagct (T) gcggagggtttctgagaaaa 4310 ABCC4 116 intron 19 + (38361-38362) cggggttagcttccctagct gcggagggtttctgagaaaa 4311 ABCC4 117 intron 19 + 38746 taaagacatgctggtaatta T/C gtaaaataaagataagtcaa 4312 ABCC4 118 intron 19 + 42343 tgtaagggcagaatcagcag C/T aacgattggatgttcccgga 4313 ABCC4 119 intron 19 + 44733 agcaggctggggaaaaaaaa A/&Dgr; tacagaggttatcattatgt 4314 ABCC4 120 intron 20 + (405-419) aagggcaaatacttaggcac (T)13-15 ggatagaaccaggtgtggtt 4315 ABCC4 121 intron 20 + (637-648) ctaagtcttaagctgtcttt (A)12-13 ccaacaatcctacagaaata 4316 ABCC4 122 intron 20 + 842 caagctggggcacttttttt T/&Dgr; tcccaagtgtttattttgga 4317 ABCC4 123 intron 20 + 843 aagctggggcactttttttt T/C cccaagtgtttattttggaa 4318 ABCC4 124 intron 20 + 1347 ggacctctgatttttttttt T/&Dgr; cttttgcaaacatttttaaa 4319 ABCC4 125 intron 20 + (14553-14567) tccctacacacccctcatct (A)13-15 tcagcagcttgactgagctt 4320 ABCC4 126 intron 20 + 15487 ggttttttccagtgtgatag C/T acatgtagaaagcagtactg 4321 ABCC4 127 intron 20 + 16161 gcgttgagtcatgaagccga T/C agtgccgcttgtgcatcgca 4322 ABCC4 128 intron 20 + 30891 acgtcccccactgttctatc C/T ttctcaagaagcaagcgttg 4323 ABCC4 129 intron 20 + 31180 ccttgcacgtgctcatacat G/A tcatttgctattgttatcat 4324 ABCC4 130 intron 20 + 31283 gtgttaaagctaaaaaaaaa A/&Dgr; ccctgttagacattttgact 4325 ABCC4 131 intron 21 + 4204 ttgaccctgccctgaaaccc A/T gttggagataaaacagtggc 4326 ABCC4 132 intron 22 + 1026 gtgccctactccacgtaaaa A/C tcttctgtagctcaactgag 4327 ABCC4 133 intron 23 + 377 gcctggtgcatgaggttgag A/G aaaattctcagcaggagagt 4328 ABCC4 134 intron 25 + 4122 cccttttgattaaaattgca C/G/T tgggacaagaaccaccccca 4329 ABCC4 135 intron 25 + 6418 ttgcactgaggtaatggctg C/A agaaattaaagtgagggtat 4330 ABCC4 136 intron 25 + (8765-8775) tgcatcctgtgatttttttc (T)5-11 aatcctgccgcctggatctc 4331 ABCC4 137 intron 26 + 67 tatgtttaattgcttttact G/C ttattgctttttttaattgg 4332 ABCC4 138 intron 26 + (101-109) taattggatgaaaggattgt (T)8-9 cacccaatagagcatgtttt 4333 ABCC4 139 intron 28 + 391 tagatatgatcttttttttt T/&Dgr; aaatctctattgtgaagtag 4334 ABCC4 140 intron 29 + 2569 atcctcttttttctaatacg C/T accactatctccacattaaa 4335 ABCC4 141 intron 29 + 7820 gaaaaacaacctgtgtcctg C/T ttggaggttcagcatattct 4336 ABCC4 142 intron 30 + 6269 tagatgttctttgggcattg A/G aaagatggtgttatctgttt 4337 ABCC4 143 intron 30 + 6320 gtttaataaggtttaattag C/T tctactttgttaattacatt 4338 ABCC4 144 intron 30 + 6474 ctttgatgctatggttttca A/G tccacagatgttcataactt 4339 ABCC4 145 intron 30 + 6519 ttccactatgaattatattt C/T ctgccattttaacacacctt 4340 ABCC4 146 intron 30 + 6574 aatggttttggtcctaaatc C/T acactggttcaaaactagac 4341 ABCC4 147 intron 30 + 6680 aggtgtgtctcctgtatatg A/G cgtggttaggttttactctg 4342 ABCC4 148 intron 30 − 704 acgtttatcagaaaacctgt A/C tctcttctagttcagctaga 4343 ABCC4 149 intron 30 − 228 atctatgaatcagagtgatc A/G gaactaaaatggatctacag 4344 ABCC4 150 intron 30 − (14-5) acattctttttatgcttacc (T)9-10 ctaggtatacttcaaaagaa 4345 ABCC4 151 exon 31 + 146 agtccgttccgaaggcattt G/T ccactagtttttggactatg 4346 ABCC4 152 3′flanking + 173 atttttaaaggagtaggaca A/G agttgtcacaggtttttgtt 4347 ABCC4 153 3′flanking + (430-440) tgtaccccttactccccatc (A)10-11 tggatacatggttaaaggat 4348 ABCC4 154 3′flanking + 556 aaaggtgctttgatactgaa G/A gacacaaatgtgaccgtcca 4349 ABCC4 155 3′flanking + 1144 cctccctgaaattgcatata T/C gtatatagacatgcacacgt 4350 ABCC4 156 3′flanking + 1426 tttaggtgactgaaattgca A/T cagtgatcataatgaggttt 4351 ABCC5 1 intron 1 + 628 ttctgccacacagagccgcg G/C gtggctttgtgtttatcaca 4352 ABCC5 2 intron 1 + 1834 tgagttccagtgacctcctc C/T gtttcaaactgctcaccgcc 4353 ABCC5 3 intron 1 + 3055 agaaagtctttaaaaaaaaa A/&Dgr; ccaacctttctattgtatac 4354 ABCC5 4 intron 2 − 20280 gaatgcatcgctactaagta T/C ttttgtaagttcagacacca 4355 ABCC5 5 intron 2 − 20260 tttttgtaagttcagacacc A/T tctagaatctgcttgaccgt 4356 ABCC5 6 intron 2 − 19204 tgaaataaagcattcgcaca C/T ctacccactttcttcgggac 4357 ABCC5 7 intron 2 − 19043 agaaagtctttaaaaaaaaa A/&Dgr; ccaacctttctattgtatac 4358 ABCC5 8 intron 2 − 18824 gaatgcatcgctactaagta T/C ttttgtaagttcagacacca 4359 ABCC5 9 intron 2 − 18807 tttttgtaagttcagacacc A/T tctagaatctgcttgaccgt 4360 ABCC5 10 intron 2 − (18735-18734) atagaagcttaaactcacaa (A) cacgtactctacatagatga 4361 ABCC5 10 intron 2 − (18735-18734) atagaagcttaaactcacaa cacgtactctacatagatga 4362 ABCC5 11 intron 2 − 15903 taccaaagcctgctcatgga G/A gtagaaagcaagactgacat 4363 ABCC5 12 intron 2 − 15901 ccaaagcctgctcatggagg C/T agaaagcaagactgacatgt 4364 ABCC5 13 intron 2 − 15847 tggatggaacctcaaaggcc G/A tcttgcccagtccccattta 4365 ABCC5 14 intron 2 − 15605 aggagacgccacgacactga C/T agctgtacctgacctgaggg 4366 ABCC5 15 intron 2 − 13571 ccgattgtgccccagatacc G/A ctttatttgaggggtgtgcc 4367 ABCC5 16 intron 2 − 13402 taccctgctgttgtccggcc G/T ccaggaagggattggattgt 4368 ABCC5 17 intron 2 − 13325 cccagaggcctccgtgcagg G/C gaaaagcccttggttgccct 4369 ABCC5 18 intron 2 − 7293 tttgttaggataaaattgca C/T tgagtgcctgttctaaacca 4370 ABCC5 19 intron 5 + 374 ccgggctggtgagccagcac C/T gggaacataccaagtgcctg 4371 ABCC5 20 intron 5 + (2212-2213) cgcctcctgcagtgctctct CT/&Dgr; tggtgaatgctaactctgct 4372 ABCC5 21 intron 5 + 3283 acccagagagagtctgggtt C/T tggaattcagcgtagctacc 4373 ABCC5 22 intron 5 + 3469 ttggctttcttttgttgtgg C/T tttttgttttatttttgtca 4374 ABCC5 23 intron 7 + 443 cacttttattaaagacagta C/T gattacataacatttggccc 4375 ABCC5 24 intron 7 + 458 cagtacgattacataacatt T/G ggcccatcctagcaagcagg 4376 ABCC5 25 intron 9 + 176 caaaacaaaacaaacaaaca A/G acaaaaaaaaaataccacat 4377 ABCC5 26 intron 9 + 214 catatggagatgatgctgtg G/T tcctctccttactggacctg 4378 ABCC5 27 intron 10 + 703 tgtgggctggaattccttga T/C gttgccactgcatagattag 4379 ABCC5 28 intron 10 + 3580 catggggctggagctgtgaa A/G accagtaggtactggcatgt 4380 ABCC5 29 intron 10 + 3655 atcctttgaataactcttta G/A gggagagaaatgatggaaat 4381 ABCC5 30 intron 10 + 3854 gaagtttagaatcatgacac T/C tcggggaagataggatcagg 4382 ABCC5 31 intron 10 + 5040 ctttgaagacatgagagttt C/T ttggcaagaagatgttctct 4383 ABCC5 32 intron 10 + 5316 cagttaaatgtcattaggtc C/T gctttaggctggctgagggg 4384 ABCC5 33 intron 12 + 234 tgactgttgtcccagctgga G/A ccatttggtctcatgccttc 4385 ABCC5 34 intron 12 + 300 tgccacaggtatgcccgtgt A/G ttgaaaatgtcagagataag 4386 ABCC5 35 intron 12 + 318 gtattgaaaatgtcagagat A/G agagatgagcagacacccta 4387 ABCC5 36 intron 12 + 1545 gtagcatccctaaaccaaga C/T aaatgtctactatcagtccc 4388 ABCC5 37 intron 13 + 20 ggcaaggaatgtttggcttc T/C gtcatgctttccatcttggc 4389 ABCC5 38 intron 14 + 278 ttctatccagatatttttaa A/G actacaagtaagcgtgtgca 4390 ABCC5 39 intron 16 + 1663 tgactggagacttttttttt T/&Dgr; aaatattattagatcaattc 4391 ABCC5 40 intron 16 + 1664 gactggagactttttttttt A/T aatattattagatcaattca 4392 ABCC5 41 intron 17 + 20 ggtaatggccttttttgaaa T/G ttttagatttgtcatcaaag 4393 ABCC5 42 intron 18 + 232 ggacacctgcaggctatctg C/T tctcatccgttgtgtattag 4394 ABCC5 43 intron 19 + 249 ggaccagtaggaacagagcc G/A tccctgggccctgaccactc 4395 ABCC5 44 intron 20 + 846 ttaaccagaagaaaaaaggc G/A gtggggtggggagacagcca 4396 ABCC5 45 intron 20 + 1154 tcttgagacgaaaaaaaaaa A/&Dgr; tcagagcatccaggtttcta 4397 ABCC5 46 intron 22 + (1424-1425) gaggaaatgcagcggaatat (AT) caactctggttttaacaggg 4398 ABCC5 46 intron 22 + (1424-1425) gaggaaatgcagcggaatat caactctggttttaacaggg 4399 ABCC5 47 intron 24 + 132 atcccacagaatctccagca A/G tctctcaaccgtgcttggaa 4400 ABCC5 48 intron 24 − 874 gtgctggagaggttaggatt A/G cggtcagtggtggtacaaag 4401 ABCC5 49 intron 24 − 630 tgatgataaaaattacccaa G/A cagttatatcacagcatttt 4402 ABCC5 50 intron 24 − 102 acagggtggcagctacctct G/C tgtggctactatggttgtcc 4403 ABCC5 51 exon 25 + 120 taccgagaaaacctccctct C/T gtcctaaagaaagtatcctt 4404 ABCC5 52 intron 26 + 263 ctgggcccagggctctgctc C/T gtgacttcggacaagttatt 4405 ABCC5 53 intron 26 − 3257 ccgagggtgaattgctgtgt T/C gtctcacactttgggagata 4406 ABCC5 54 intron 27 + 873 gttttttcctctgctctatc G/A ggattcttctcatttgaaga 4407 ABCC5 55 intron 29 + (2733-2734) gtgtccaaaggaaggacacg (TGTCCAAAGGAAGGACACG) 4408 cttatgttctccttgtggcc ABCC5 55 intron 29 + (2733-2734) gtgtccaaaggaaggacacg cttatgttctccttgtggcc 4409 ABCC5 56 intron 29 + 2959 acatgattttccacggctac A/G tagaagtccatcataggaat 4410 ABCC5 57 intron 29 + 4020 aataaaaaaataagggggga G/A gtgcacgcagggctagttga 4411 ABCC5 58 exon 30 + 684 cccctctgccgcctccccac G/A gccgctccaggggtggctgg 4412 ABCC5 59 exon 30 + 947 agtctatccacagagagtcc C/T actgcctcaggttcctatgg 4413 ABCC5 60 exon 30 + (1145-1160) tcaccgcagtcgtcgcacag (TC)6-8 ccctcaaagtctgcaacttt 4414 ABCC5 61 3′flanking + 4 attattttggattttgtaaa A/C ctcttcgtgtatcaaacaat 4415 ABCC5 62 3′flanking + 2008 cccgcagacctggcacagcc C/&Dgr; tgttctcaaaggggagctcc 4416 ABCC5 63 3′flanking + 2052 cccagctaggacaggccagc A/G ccaggcagttaggaccgtgg 4417 ABCC7 1 5′flanking − 834 gctaaaacactccaaagcct T/G ccttaaaaatgcgcactggg 4418 ABCC7 2 5′flanking − 729 cctccttgcagatttttttt T/&Dgr; ctctttcagtacgtgtccta 4419 ABCC7 3 exon 1 + 125 tagcagggaccccagcgccc G/C agagaccatgcagaggtcgc 4420 ABCC7 4 intron 1 + 6200 ctatgtgagacgttaagaag G/A tagaggtggccaagaaggaa 4421 ABCC7 5 intron 1 + 7538 agttctctttcttagcatgg C/A ctacagaggtgcaactacct 4422 ABCC7 6 intron 1 + 13519 gaaacttaaatcttgagtca T/C acaattgtgtctacatactg 4423 ABCC7 7 intron 1 + 14110 attacacagtattttttttt T/&Dgr; aattttggggaaagtcgatt 4424 ABCC7 8 intron 1 + 14293 gccaggcagattcctgactc C/&Dgr; tataacccagagcttatcag 4425 ABCC7 9 intron 1 + 14316 taacccagagcttatcagag C/G atttatgtccccaaagagaa 4426 ABCC7 10 intron 1 + 14433 cagaataacaatgatggctc G/A gaaaaatatgggtatttctg 4427 ABCC7 11 intron 1 + 14824 acgttttgacagttgcacaa G/C tttctttctttaagctttaa 4428 ABCC7 12 intron 1 + 23401 aatatttttgaaaatcacta C/G ggtatcctgcatagtgattt 4429 ABCC7 13 intron 3 + 879 gaaaaatttcagttcataca C/A ccccatgaaaaatacattta 4430 ABCC7 14 intron 3 + 922 acttatcttaacaaagatga G/C tacacttaggcccagaatgt 4431 ABCC7 15 intron 3 + 933 caaagatgagtacacttagg C/T ccagaatgttctctaatgct 4432 ABCC7 16 intron 3 + 13704 tttttccaaataaaaaaaaa A/&Dgr; tcaggtgatatctgtaaatg 4433 ABCC7 17 intron 3 + 13758 tattaaagaacatgatgctt A/C aaacagattagggaaaacta 4434 ABCC7 18 intron 4 + 240 ctctgttgtagttttttttt T/&Dgr; ctcctaatcatgttatcatt 4435 ABCC7 19 intron 4 + 376 ttatgttcagcaagaagagt A/G taatatatgattgttaatga 4436 ABCC7 20 intron 4 + 586 tgtccagacaagagaccaaa T/C tgccgaggcatcatttaggt 4437 ABCC7 21 intron 4 + 1089 tttcaatctgaacattttac G/A taagtgaagactttgttaga 4438 ABCC7 22 intron 4 + 1615 aaagttaggtggtattgtat C/T tgtcttcctttctcaatgtt 4439 ABCC7 23 intron 4 + 1946 aatacaaacaaacttgagct T/C tgcctatacttttcaagaat 4440 ABCC7 24 intron 6 + 783 tatctaagttttggagtcaa A/G tagcactttgtttgaatccc 4441 ABCC7 25 intron 6 + (1104-1131) gattgattgattgattgatt (GATT)6-7 tacagagatcagagagctgg 4442 ABCC7 26 intron 7 + (731-732) gtagcaatgagaccattttt (T) cttcagttgagctccatgtt 4443 ABCC7 26 intron 7 + (731-732) gtagcaatgagaccattttt cttcagttgagctccatgtt 4444 ABCC7 27 intron 7 + 1434 gaatgtttggttgtaacctg T/C ataatctggcatgaaattgt 4445 ABCC7 28 intron 8 + 752 catgctctcttctcagtccc A/G ttccttcattatatcaccta 4446 ABCC7 29 intron 8 + 1109 tatggccaagacttcagtat G/A cgtggacttaattcttcctt 4447 ABCC7 30 intron 8 + 1312 atgaagacattcattttttt T/&Dgr; ctccgtccaatgttggatta 4448 ABCC7 31 intron 9 + (6521-6522) gtgtgtgtgtgtgtgtgtgt (GT) ttttttaacagggatttggg 4449 ABCC7 31 intron 9 + (6521-6522) gtgtgtgtgtgtgtgtgtgt ttttttaacagggatttggg 4450 ABCC7 32 intron 10 + 2119 gaacactttatagttttttt T/G ggacaaaagatctagctaaa 4451 ABCC7 33 intron 11 + 3867 tttttcttcaagaaattaga A/&Dgr; gaggggagaaattggtttaa 4452 ABCC7 34 intron 11 + 11844 tgaatcaaaatcatctaaaa A/&Dgr; gctttcagaaaccagacttt 4453 ABCC7 35 intron 11 + 12144 atattaaacagagttacata T/C acttacaacttcatacatat 4454 ABCC7 36 intron 11 + 20975 gtgtggatagtaaatgccag G/A gtaaatcacatagcatctaa 4455 ABCC7 37 intron 11 + 27057 atggaagagaagttttagta G/A aggggaggaaggaggaggtg 4456 ABCC7 38 intron 11 + 27131 gagagagacttttttttttt T/&Dgr; aaggcgagagtttactacct 4457 ABCC7 39 intron 13 + 152 gtattaactcaaatctgatc T/A gccctactgggccaggattc 4458 ABCC7 40 intron 13 + 287 tttgcagtatcattgccttg T/C gatatatattactttaatta 4459 ABCC7 41 intron 15 + (85-86) atacatatatatgcacacac AT/&Dgr; aaatatgtatatatacacat 4460 ABCC7 42 intron 15 + 106 taaatatgtatatatacaca T/A gtatacatgtataagtatgc 4461 ABCC7 43 intron 15 + 3341 ggaagtataaatttgtaaat A/C actgagacccaaacttacaa 4462 ABCC7 44 intron 15 + 5556 tgctattgactaatagtaat A/T attttagggcagctttatga 4463 ABCC7 45 intron 15 + 5919 tggtagttctatgtggaaac C/A gtgaggaaataattttatat 4464 ABCC7 46 intron 17 + 2479 caaaaaggtatggaagtcag A/C ggagaaggagacccctatgt 4465 ABCC7 47 intron 18 − 81 aagtatgcaaaaaaaaaaaa A/&Dgr; gaaataaatcactgacacac 4466 ABCC7 48 intron 19 + 751 cattaataaaataacaaatc A/G tatctattcaaagaatggca 4467 ABCC7 49 intron 19 + 820 tgacatttgtgatatgatta T/C tctaatttagtctttttcag 4468 ABCC7 50 intron 21 + 1532 ttacctttaacttttttttt T/&Dgr; atgccttttactttctctat 4469 ABCC7 51 intron 21 + 1607 atgcttttggagttgggtct C/T ataaatgtatagaaatgttt 4470 ABCC7 52 intron 21 + 11260 atgtggaacaatcatgacta T/C atgccttttactttctctat 4471 ABCC7 53 intron 22 + (130-131) agaatcaatattaaacacac AT/&Dgr; gttttattatatggagtcat 4472 ABCC7 54 intron 23 + 1837 ctgtcctaaagtttaaaaag A/&Dgr; aaaaaaaaaggaagaaggaa 4473 ABCC7 55 intron 24 + (7100-7112) cctttacaaactcttagaca (T)12-14 agtttaacatgttacaaaac 4474 ABCC7 56 intron 25 + 237 actcttcccccttgtcaaca C/T atgatgaagcttttaaatac 4475 ABCC7 57 exon 27 + 115 gggtgaagctctttccccac C/T ggaactcaagcaagtgcaag 4476 ABCC7 58 exon 27 + 334 ggatgaattaagtttttttt T/&Dgr; aaaaaagaaacatttggtaa 4477 ABCC8 1 5′flanking − 1099 aaaggggctgaaggggtctt T/C cttttgtgttcccctgactg 4478 ABCC8 2 5′flanking − (424-422) caccccaccaccaccaccac CAC/&Dgr; aaggtaacgttctgccccac 4479 ABCC8 3 intron 1 + 1212 agcctgggcaacatagtgag A/G ccccccccgccctttctaca 4480 ABCC8 4 intron 2 + 1003 aggaggactgtgaatcccag C/A ctgcatgtttgggtcggatt 4481 ABCC8 5 intron 2 + 1253 catctcactaaggaagaatc C/T agtaaccagcaaggatgaga 4482 ABCC8 6 intron 2 + 1382 cccagactgcactcctgcag T/C gctgcctggctcctgtagtt 4483 ABCC8 7 intron 2 + 2371 tttcagagctgtctggaaat T/A tagggggcaggtgggagggg 4484 ABCC8 8 intron 3 + 1957 ccctacccctagcccagggg C/T ccccacatgagtatgaatgg 4485 ABCC8 9 intron 3 + (2088-2089) agagaacccttcattaacca (CCA) gggcgtggctgaccagtgtc 4486 ABCC8 9 intron 3 + (2088-2089) agagaacccttcattaacca gggcgtggctgaccagtgtc 4487 ABCC8 10 intron 3 + 2204 taaagcacaagttatcaccc G/A tggatggatttgtccttttc 4488 ABCC8 11 intron 3 + 2286 ttatctccccttgaaaggac A/G ctccacagagccagaaattc 4489 ABCC8 12 intron 3 + 2312 cagagccagaaattctagaa C/G agggaaaagtggaggggagg 4490 ABCC8 13 intron 3 + 2356 ctgtgaactgcagggacaga A/G ggaaatgggtattgggagaa 4491 ABCC8 14 intron 3 + 2359 tgaactgcagggacagaagg A/C aatgggtattgggagaatgg 4492 ABCC8 15 intron 3 + 2370 gacagaaggaaatgggtatt G/A ggagaatggccagccctcca 4493 ABCC8 16 intron 3 + 2382 tgggtattgggagaatggcc A/G gccctccaaggggctgatgt 4494 ABCC8 17 intron 3 + 4910 ggggacagccttcagctgtg G/A aattcctccagtcctagaga 4495 ABCC8 18 intron 3 + 4969 cattattccagtcctgaggc A/G tgagagcagaaggccgatgc 4496 ABCC8 19 intron 3 + 5003 ccgatgcttctgccctccat C/G ctaatgtcctcctgcaggga 4497 ABCC8 20 intron 3 + 5019 ccatcctaatgtcctcctgc A/C gggacccaaggtggatggca 4498 ABCC8 21 intron 4 + 14 ggtgagggtaagcaggccac C/T tgggccagggtggggtggga 4499 ABCC8 22 intron 4 + 187 agacactgcatctggcccac G/A tgtgctctaccccagggtcc 4500 ABCC8 23 intron 4 + 204 cacgtgtgctctaccccagg G/C tcccagagggagaggggggt 4501 ABCC8 24 intron 4 + 254 gttcgctgaggttggcggat G/A actttccgtagaaagggaag 4502 ABCC8 25 intron 4 + 357 tgtattcatatcgtcacgct G/C gtaaatgaatgagtaagtgt 4503 ABCC8 26 intron 5 + 92 ggcattaggtcaaaatcctg G/A tgggacaaaaggggaaactg 4504 ABCC8 27 intron 6 + 4205 tctgtagaaagtacatgggg C/A catgaagatcattggcttga 4505 ABCC8 28 intron 6 + 5519 gattcccagggaatgttaaa A/C aggaccgggtcttcctaaac 4506 ABCC8 29 intron 6 + 5575 tctgacccagtaccagccag G/C ggggcaagtttccatccccc 4507 ABCC8 30 intron 6 + 6587 gttgccatctgagatcttgc C/T ggaagtacacaagagaccct 4508 ABCC8 31 intron 6 + 6747 ttccactggccttttctgct C/T agtaattgctacattacagg 4509 ABCC8 32 intron 9 + 191 gaggaagctgcctcccggtg A/G ggacaggaagcgggcatggc 4510 ABCC8 33 intron 10 + 1963 cccaggagtccaacctccct T/G tgtccagctagaccatggtg 4511 ABCC8 34 intron 10 + 2724 cctgggacatgttttcttat A/G taaacagcatcaaaagatgt 4512 ABCC8 35 intron 10 + 2938 gcccgcccaggactcctcac G/C tgtccaagtcacctagggag 4513 ABCC8 36 intron 10 + 3094 tccgaggatgtgtttttttt T/&Dgr; ccctccgttagtcagcagtg 4514 ABCC8 37 intron 10 + 3368 tcctgctcatatgcggcacc A/G tcagacttctgggcaggcaa 4515 ABCC8 38 intron 10 + 8897 ggtattgattaaaagcctca C/T gggcagagaaattcgccatc 4516 ABCC8 39 intron 11 + 308 tgtgtattgtagaagtgatg G/A gaaatccagaacagaaagct 4517 ABCC8 40 intron 11 + 1171 gccctctcatttcccttcca G/A tgctgagcgtttccagtgtg 4518 ABCC8 41 exon 12 + 7 gcctctgtccacagactttc G/A tgggccacgtcagcttcttc 4519 ABCC8 42 intron 12 + 356 accaagaatgaggccatccc G/T tccccacgtggctgccccat 4520 ABCC8 43 intron 12 + 934 tgggttcaaagatggaatgg G/T gcataactcagcaaaattat 4521 ABCC8 44 intron 12 + 1370 gggagggaggctggacaggg C/G atgaaggcagagcctggtgg 4522 ABCC8 45 intron 15 + 412 ggaggtgggacccaggatgg C/T gtttcttgggaccacaagga 4523 ABCC8 46 intron 15 + 688 actcccccggccccactcac A/G tctgccaccttccctccctg 4524 ABCC8 47 intron 16 + 4464 actcattccaagtattgatc G/A agaagagaggtaggtactgg 4525 ABCC8 48 intron 16 + 4574 ttgaagatcttaagttgttt T/C ggagagcttactgtgtgctg 4526 ABCC8 49 intron 16 + 5011 tgcacttgccgcctacttat T/G ccagacccaatgattgggtc 4527 ABCC8 50 intron 16 + 7608 tatagattaatgaggctctg A/G gtccctcaaaaccttccctc 4528 ABCC8 51 intron 16 + 7730 cccttacctctccaaaaaac A/G cttgagataccctagaggtg 4529 ABCC8 52 intron 16 + 8369 ttgcaaactgagttagggcc T/C ggagagcttactgtgtgctg 4530 ABCC8 53 intron 16 + 9708 tgcacttgccgcctacttat T/G ccagacccaatgattgggtc 4531 ABCC8 54 intron 17 + 651 tatagattaatgaggctctg A/G gtccctcaaaaccttccctc 4532 ABCC8 55 intron 17 + 692 cccttacctctccaaaaaac A/G cttgagataccctagaggtg 4533 ABCC8 56 intron 17 + 1541 ctcaggatcttcctggagga C/T atggttcactcccatgagag 4534 ABCC8 57 intron 18 + 580 actaagcagatttctaccaa C/T tgcacctccccatccccttg 4535 ABCC8 58 intron 18 + 658 gaacaagcccctgagaatgc C/T ttccgcaccccctactcccg 4536 ABCC8 59 intron 18 + 660 acaagcccctgagaatgcct T/C ccgcaccccctactcccgcc 4537 ABCC8 60 intron 19 + 93 gcccttccatcgatcaccca T/C acccagccatctcactcccc 4538 ABCC8 61 intron 19 + 123 tctcactccccaggtgctta T/C ctgcactccagcctctccat 4539 ABCC8 62 intron 19 + 219 cataggggagagggcaggaa C/T ggagggaagggagagagccc 4540 ABCC8 63 intron 19 + 845 tagtatttaacctgcccaaa C/T gctgtgtgaagtgctgacct 4541 ABCC8 64 intron 20 + 338 tcccctccacaagcttagac A/G aacaggattctcctgtgact 4542 ABCC8 65 exon 21 + 10 tttggtgacagggcatcaac C/T tgtctggtggtcaacgccag 4543 ABCC8 66 intron 21 + 192 caaggatagcacaaatgacc C/&Dgr; attgcagacttcagatggag 4544 ABCC8 67 intron 23 + 17 gaaggtgggtatatccaggg A/G tggccaagcagccacccctg 4545 ABCC8 68 intron 23 + 67 gttctgctagaacctgaact C/T ataaaggtcttcctgtcctt 4546 ABCC8 69 intron 26 + 268 gtgagcgtctgcacatccaa G/C taaagattgttttctcctcc 4547 ABCC8 70 intron 26 + 308 cgataagtgggtgtaatttg C/T ccatccccacccatgagttc 4548 ABCC8 71 intron 26 + 348 cagctccctgccctcccctc A/G ctctctctccctcagccagc 4549 ABCC8 72 intron 26 + 807 gacagctgctgagtcaggcc G/A agccggcagctgagaaaggc 4550 ABCC8 73 intron 26 + 834 cagctgagaaaggcggcagt G/C gtcagatgggcttgagaaac 4551 ABCC8 74 intron 28 + (118-121) cctccaaaaaataaaaacaa AAAA/&Dgr; cagaaatgaaggaaatagaa 4552 ABCC8 75 intron 28 + 1348 tggggtaagcggaagacggg G/A ttgaacgctttgagtttggt 4553 ABCC8 76 intron 29 + 1253 ctcttagggatcttgtctaa G/T taaagaagagcagagcaaag 4554 ABCC8 77 intron 29 + 1589 cagatcccagcttcctgtaa A/G cagcctcagatcaggccaaa 4555 ABCC8 78 intron 29 + 2322 gcgcctcacactcctataac G/A cgcacatgccctgatgcaca 4556 ABCC8 79 intron 29 + 2348 atgccctgatgcacacacat T/C ttcaacacgcacttactcta 4557 ABCC8 80 intron 29 + 2418 agacacgtcaccctcccaca C/T gtctccaccctgggggtgtg 4558 ABCC8 81 intron 29 + 2494 tcagtcccctcagacacatg C/A cctctctccacgcagagaca 4559 ABCC8 82 intron 29 + 2735 gcggccaaggagagtgatga C/T ggcagcccaggttgatcaga 4560 ABCC8 83 intron 30 + 386 gctcctggggctccagcctt C/T gcagcccttgtgtgtgtctg 4561 ABCC8 84 intron 33 + 93 ggcttcgcagtcacctcgtg G/T ccctccagggccgaggcctc 4562 ABCC8 85 intron 33 + 358 agggacctgggggcagacag C/T gaggccacccttgtattgag 4563 ABCC8 86 intron 38 + 54 cccagggacaggactggcct G/C ttgtggccgtcatcagtgca 4564 ABCC8 87 intron 38 + 466 aggacattctggccacatgc C/&Dgr; tcatcctcctcctccaagcc 4565 ABCC8 88 intron 38 + 529 tggcccccaccgcgggtggt A/G ttcccaccatcctgacccgc 4566 ABCC9 1 intron 3 + 38 tgttgtttctccttaaagag C/A tatttgtttttccccccaaa 4567 ABCC9 2 intron 3 + 305 gctggccttctggcttgcag T/A agttgtattttaagaatcag 4568 ABCC9 3 intron 3 + 320 tgcagaagttgtattttaag A/G atcagagctcttgtgaggag 4569 ABCC9 4 intron 3 + 631 ttctgtggaaatcagaggct G/C tctaaaatattcctaatttt 4570 ABCC9 5 intron 3 + 8644 tggacgcactcaacattttc A/G agttattactccttcaactc 4571 ABCC9 6 intron 4 + 757 aggatatcatgaaacactga A/C tcttagtaaaaactatcttt 4572 ABCD3 16 (intron 9 1493) tcatcttcttccataggctt A/G ggtgtggagaggagatagaa 4643 ABCD3 17 (intron 13 1534) tctgttgagttggggatcct A/G tggaaacctcttccttcatc 4644 ABCD3 18 (intron 16 4310) gaaaagtgaatgctgagtag G/T ttagccaggcttgatttaga 4645 ABCD3 19 (intron 20 273) ttctaaaagttcagagaaac T/A ctgtagctcattattcctgg 4646 ABCD3 20 (intron 20 1664) ctcaaaagaaaaaaaaaaaa A/C aaaaaacacatgatccataa 4647 ABCD3 21 (intron 20 6693) cttaaggtttgtgttttact C/T tgagcaattagtatttccca 4648 ABCD3 22 (intron 21 7171) atcataaacagagaaataat A/G tcttaaatgagctctgaaaa 4649 ABCD3 23 (intron 22 1220) ctagaaatcaaaggcattta A/G aatatagccaagcctttatg 4650 ABCD3 24 (intron 22 1358) agtagcaaaataatcatcac G/A ccagtgatcatgtgaaggag 4651 ABCD3 25 (intron 4 4448-4461) taactttcttgtagttagcg (T)11-14 aactgttttactttttaggg 4652 ABCD3 26 (intron 5 268) gttttttggcattttttttt T/&Dgr; aaccttcagtccaggttttc 4653 ABCD3 27 (intron 5 891-902) ttggtgtaaaacctgtagtg (T)10-13 aacaaatgcaaatatagtgt 4654 ABCD3 28 (intron 7 1226-1227) gggaatggggggtgtatcta (T) tacaactttccatgtaattt 4655 ABCD3 28 (intron 7 1226-1227) gggaatggggggtgtatcta tacaactttccatgtaattt 4656 ABCD3 29 (intron 8 1129) cagatttacttttttttttt T/&Dgr; aatcttgaatacttactagc 4657 ABCD3 30 (intron 13 1595-1596) tgaaacataataaagcacac (TA) gttatcattaatactttatg 4658 ABCD3 30 (intron 13 1595-1596) tgaaacataataaagcacac gttatcattaatactttatg 4659 ABCD3 31 (intron 16 7337-7351) ttaattacttcacagactga (T)13-15 caggttcgatctggggctaa 4660 ABCD3 32 (intron 18 12) gttcctcaggtaagacctag C/&Dgr; ttgagttatctttgatctaa 4661 ABCD3 33 (intron 20 1652-1670) gcaagactctgtctcaaaag (A)17-20 cacatgatccataatagagg 4662 ABCD3 34 (intron 20 2262-2273) ttaatccatttttgtaaatc (T)11-13 accttaaattagcaactatc 4663 ABCD3 35 (3′untranslated region taaaataaagttgagcttag (T)8-9 aaaaaaaaaacaaagcaaca 4664 2072-2079) ABCD3 36 (3′untranslated region gttgagcttagttttttttt (A)10-11 caaagcaacaaattaactag 4665 2080-2091) ABCD3 37 (3′untranslated region acttattttctgttcagatt (A)16-19 ctcagatatcctatacaacc 4666 3349-3368) ABCD4 1 (intron 1 276) tggcattctttttttgaaaa G/A aagaacctcaggtgcacaaa 4667 ABCD4 2 (intron 1 329) cttctcagttcttgacaccc T/C gtgggccaatgcaaggctcc 4668 ABCD4 3 (intron 3 171) ttaagcacgttgatcttgct A/G ttggcccacgtgggactgat 4669 ABCD4 4 (intron 3 449) cctacccctcattcagtagg G/A gggctaccacctgctcactc 4670 ABCD4 5 (intron 5 273) gacaggggctacctgagagg G/T aacaggagtcagggctgagg 4671 ABCD4 6 (intron 7 240) tagtcttagtggcctagcgt G/A gggcctgaaattgtcaaatg 4672 ABCD4 7 (intron 7 267) gaaattgtcaaatgaatgaa T/C gcctcatcctcttgctggtg 4673 ABCD4 8 (coding region 910 tctatggagacctgagtccc G/A cagagcttagcaccctggtc 4674 (Ala 304 Thr)) ABCD4 9 (coding region 981 atcagctgcttcacccagct C/A atcgacctgtccacgacgct 4675 (Leu 327 Leu)) ABCD4 10 (coding region 1102 gcgagatcctgggcgagagc G/A agtggggcttggacacgtga 4676 (Glu 367 Lys)) ABCD4 11 (intron 13 191) tggattgggcccactactca T/C agcagctcctgaggcaggta 4677 ABCD4 12 (intron 13 262) acgcgtatgtcaaacaccca A/G ggtcggattctggggcccct 4678 ABCD4 13 (intron 17 848) cctctgctcctctggcccat C/G cttctccctgaggcagggct 4679 ABCD4 14 (intron 17 946) gtgggaggagaagcagcggc G/A gcagagggcagggctttgat 4680 ABCD4 15 (intron 18 41) ggcctgaggaggagaaagaa C/T ccaaaggctcagcctggcca 4681 ABCD4 16 (3′untranslated region 2 gcccaggtctaggtttctgt G/A ggggacactgaatctcccag 4682 AGCG1 1 (5′flanking region − 386) gcaataatcattggctagag G/A tattgtgatatgatgtcatt 4683 AGCG1 2 (intron 1 199) caccaaatattggtgagctg C/T ctggatttgggagatgcagt 4684 AGCG1 3 (intron 1 291) acttggggtccggtgtgagg A/C tcctgcactcggtttctgtg 4685 AGCG1 4 (intron 1 318) actcggtttctgtgatggtg T/A gtgcaggggagtcacaagtt 4686 AGCG1 5 (intron 1 468) ggtcccaacgggtttctaga T/C ccctccagagaagcctttgg 4687 AGCG1 6 (intron 2 434) ctgggtacaggttttgttcc G/A gttggtctgctattgagtat 4688 AGCG1 7 (intron 3 1839) ttaaaatgagttgtttttct C/G ctaaagcctttagggagttg 4689 AGCG1 8 (intron 3 3076) tttgtcacttccttcgtctc C/T ggctctacttccctgggggt 4690 AGCG1 9 (intron 3 3352) gttccttggaggaaacgtgg G/A gtacacagtggttccagtta 4691 AGCG1 10 (intron 3 8030) acagtgaagcacaaggcagc C/T gaagacacagcaggcaggtc 4692 AGCG1 11 (intron 3 8066) aggtcaggtctgtgtgcaca T/C tggcaggctgc a/g tgcagacc 4693 AGCG1 12 (intron 3 8092) ggctgc a/g tgcagaccagcct C/T ggcccaggtggagaagcaga 4694 AGCG1 13 (intron 3 8285) ctggacatgtgactcccctg C/T acccaccctcacaagcacca 4695 AGCG1 14 (intron 3 8860) cagggtgatagggagtccaa T/C tggacacaggttcagtttgc 4696 AGCG1 15 (intron 4 2319) gggggtgaacagagggcaga G/A gcctgggcatcttcactcag 4697 AGCG1 16 (intron 4 2557) gaagggaagaagcagcagca A/G gaaagaagccccctggccct 4698 AGCG1 17 (intron 5 139) tgacccagggcaccctagag T/A ggcgcccggctccgatcgct 4699 AGCG1 18 (intron 5 177) gctgcccctgcccctccgcc A/C gggccacctggagcctcggg 4700 AGCG1 19 (intron 6 13) cagttactgtaagtgctgtt T/C ccaggggtggtca g/a gaatct 4701 AGCG1 20 (intron 6 27) gctgtt t/c ccaggggtggtca G/A gaatctccctttctggtttt 4702 AGCG1 21 (intron 6 1191) gctaagcagagttaggcccc G/A gctagtccttgaatgagaga 4703 AGCG1 22 (intron 6 1449) atgctggagcccctgagttc G/A gtgggcatacaaggggtggc 4704 AGCG1 23 (intron 6 2282) ctcgcatcacgcagttttca C/T gatcctattaattgggtgag 4705 AGCG1 24 (intron 6 3853) cctgggcttcagcaggggcc T/C cacacctgcaatgggtg c/t ct 4706 ABCG1 25 (intron 6 381) cc t/c cacacctgcaatgggtg C/T ctggggagagggtgcagatg 4707 ABCG1 26 (intron 6 4175) tccaaagcccagatttggtg T/C ttttggggctcttttggaat 4708 ABCG1 27 (intron 7 4) ctggtggaggaagaaaggta G/A ggagggcggctgctttgtgt 4709 ABCG1 28 (intron 7 576) agctcaggaggtgtctggaa C/T gccacacagtgcaggagttt 4710 ABCG1 29 (intron 7 1426) aattctccttctcaacttaa A/G gaaatattttatagaaaaat 4711 ABCG1 30 (intron 7 2342) agagcctgcaatgggccgcc G/A agggacctgcccatgactca 4712 ABCG1 31 (intron 7 2399) gaggggttgacagacaggat A/G tgtctg c/g tgtgttccagctg 4713 ABCG1 32 (intron 7 2406) tgacagacaggat a/g tgtctg C/G tgtgttccagctgctggttt 4714 ABCG1 33 (intron 7 2911) ccctctctgtgcccactgtt G/C tcccaacaccagcctgttct 4715 ABCG1 34 (intron 7 4363) tataatagattcctagcaga A/G aacataattgtgagaggaac 4716 ABCG1 35 (intron 7 4752) gctttcagagcccattcaca C/T aagggtctcattttattagg 4717 ABCG1 36 (intron 7 5026) ccaggtctgtgggatttcag G/A ccaaaaaggagcgtagcaag 4718 ABCG1 37 (intron 7 5532) gggttaaatattccgggcag C/T gccaagtcagattatctgta 4719 ABCG1 38 (intron 7 5681) gctaaagtgcatggaaggca T/C catgaataaatcctttcagg 4720 ABCG1 39 (intron 7 9243) gcctgagagcgctggcagta G/A gaagggtcgccagtgtggac 4721 ABCG1 40 (intron 7 11371) gggctctcttggagcccttt T/G tctctcccagccctgcgtct 4722 ABCG1 41 (intron 7 12420) gggatttcgaatctcaacac T/C ctgagctctgtgctttcccc 4723 ABCG1 42 (intron 7 12985) ctattggcaggtcgtgaaca T/C tgttcttggatttgcaaata 4724 ABCG1 43 (intron 7 20041) acatggccggcttcccttct T/C cctc g/a gaatggcctggaatt 4725 ABCG1 44 (intron 7 20046) gccggcttcccttct t/c cctc G/A gaatggcctggaattcgatc 4726 ABCG1 45 (intron 7 21058) acaagacttagaatttgacc G/A tgattttaaaactattctaa 4727 ABCG1 46 (intron 7 26189) ttcttggatgtggccatgca C/T gggggcaagggtttgatgag 4728 ABCG1 47 (intron 7 27453) atcatgtggtttgggggaaa G/C ctgggaccccacttggtaca 4729 ABCG1 48 (intron 7 29810) attgtttctcctggttttgt T/C tgtgttgactttccctttaa 4730 ABCG1 49 (intron 10 2116) aaacagggcttgagtcctcc G/A taagggacaggagaccttcc 4731 ABCG1 50 (intron 13 1196) tgaaaagaaaatggatgagt G/A gaa a/c ccaaaagagagaaaat 4732 ABCG1 51 (intron 13 1200) aagaaaatggatgagt g/a gaa A/C ccaaaagagagaaaatgtgg 4733 ABCG1 52 (intron 13 2041) aagcagaggcttttccaccc G/A gagactcaagaagctgctcc 4734 ABCG1 53 (intron 13 2490) gtggtgaagtagagctgagc A/T cacgggggagccctccatcc 4735 ABCG1 54 (intron 13 2822) cagcaggctccgtgctgaag T/C cacagcaagccaggcccttg 4736 ABCG1 55 (intron 13 2850) agccaggcccttggcctgcc G/A gagctggaagacccagaaca 4737 ABCG1 56 (intron 13 2919) gcctcccaggagtagctaca C/T gggacccgaaggcagatggc 4738 ABCG1 57 (intron 13 3506) ggcagcctgggctgccgaga T/C cctccctggagcgcccgccg 4739 ABCG1 58 (intron 13 3538) cgcccgccgggaagccccag G/A ggggctggagctaca a/g gtgg 4740 ABCG1 59 (intron 13 3554) ccag g/a ggggctggagctaca A/G gtggccttgcaggttttttg 4741 ABCG1 60 (intron 13 3721) ccagctcatgggcaggggtg C/T ggagggaaaggcacccacag 4742 ABCG1 61 (intron 13 3921) gaagaccagcagtcgatgcc A/G gctgggaagagggctctgcc 4743 ABCG1 62 (intron 13 3979) acccaccagccttttccaga C/T agccttccagaagctgtttc 4744 ABCG1 63 (intron 13 4291) gagccgctggagtagggtcc G/A cttgctatggctcccagggg 4745 ABCG1 64 (intron 13 4968) tattgactggacaccttctc C/T gtatggggcactgggctagg 4746 ABCG1 65 (intron 16 672) atcagtaacgggtcactaac G/A gatgctgctgagtggggcag 4747 ABCG1 66 (intron 16 891) tggcccactgttgagggtgt G/A ggtgaccagaggggcctgga 4748 ABCG1 67 (intron 18 1616) ctggaggagaagacaggata A/C agtctaagacgtg c/t tgtcac 4749 ABCG1 68 (intron 18 1630) aggata a/c agtctaagacgtg C/T tgtcacagagttcagggtcc 4750 ABCG1 69 (intron 18 1674) gcttccaaaggccgcatccg G/T gttgttctctgagc c/t gagga 4751 ABCG1 70 (intron 18 1689) atccg g/t gttgttctctgagc C/T gaggacggctttgcgaacgc 4752 ABCG1 71 (intron 19 446) tggctgacagtgaacacagc G/A gctgcttctccagaacttta 4753 ABCG1 72 (intron 22 243) acccggagagccatggcagg A/C ccaagtgttctggacgttgc 4754 ABCG1 73 (3′flanking region 1257) atggggcccacagccctgcc T/C cagaagcagctttggtctcg 4755 ABCG1 74 (3′flanking region 1438) gggggaagagcttgggaacc A/G tgagggctgttaggctgcaa 4756 ABCG1 75 (3′flanking region 1518) tgaagggtgaactggagtag G/C tgaggattctgcagttgacg 4757 ABCG1 76 (intron 3 3754-3755) ctccaccctgcacctccctg (G) cctccttgatttccctcatc 4758 ABCG1 76 (intron 3 3754-3755) ctccaccctgcacctccctg cctccttgatttccctcatc 4759 ABCG1 77 (intron 3 7848-7854) cagtttccagaatttggggg (A)6-7 tcccataagctgtcatactt 4760 ABCG1 78 (intron 4 190-191) tgtcgagagctccccttgcc (C) tggttgatcctcagggttct 4761 ABCG1 78 (intron 4 190-191) tgtcgagagctccccttgcc tggttgatcctcagggttct 4762 ABCG1 79 (intron 4 198-206) agctccccttgcctggttga TCCTCAGGG/&Dgr; ttctacttagaatgcct 4763 ABCG1 80 5′untranslated region cgcagctcaagcctcgtccc (CGC)8-10 ccccggggcatggcctgtct 4764 (−713)-(−741) ABCG1 81 (intron 6 376-387) tcttgccttgagctcaagag (A)10-12 tagccaggtttctgcgcatg 4765 ABCG1 82 (intron 7 19944-19945) ctgatgaggaggggaggggg 4766 (CACCAGGCAGCAGACTCTGATGAGGAGGGGAGGGGG) caccaggcagcagactctga ABCG1 82 (intron 7 19944-19945) ctgatgaggaggggaggggg 4767 ABCG1 83 (intron 7 25136-25137) catgaacttgcctgaccata (G) ccctgtgaggagctagggct 4768 ABCG1 83 (intron 7 25136-25137) catgaacttgcctgaccata ccctgtgaggagctagggct 4769 ABCG2 1 (intron 1 152) tcatttgaaagtgggtatgc G/A gtttaaaactgacagttcaa 4770 ABCG2 2 (intron 1 614) agctagtcataaataaatac G/A ccagagtagtaaggaagaga 4771 ABCG2 3 (intron 1 10002) cctcatgaatggtatacatg T/A cccaacatatctctttcgat 4772 ABCG2 4 (intron 1 10123) acagtggtccctttgggtgc G/A tatacccaaatccctgcata 4773 ABCG2 5 (intron 1 10768) ataggaataattgagaacag G/A gtctgaagaactctgcagga 4774 ABCG2 6 (intron 1 10791) ctgaagaactctgcaggaaa T/C g/a aaaatagttccctgctttt 4775 ABCG2 7 (intron 1 10792) tgaagaactctgcaggaaa t/c G/A aaaatagttccctgctttta 4776 ABCG2 8 (intron 1 14183) tcacttaaggctttgcaggg T/G gtctaggacacagaaagaga 4777 ABCG2 9 (intron 1 14934) aaagtgtctttaaaatttcc A/G tcttgagtcagtgagctatt 4778 ABCG2 10 (intron 1 14955) tcttgagtcagtgagctatt G/T aaattcaagcaataagttat 4779 ABCG2 11 (intron 1 17251) ctgtttgggaacagcaactc A/C atcataggcagagagaaagt 4780 ABCG2 12 (intron 1 17347) atttcaaacctgtttcacaa G/A ttgttaagctcatcttaagg 4781 ABCG2 13 (intron 1 17626) gaaggtgcataacaacttcc T/G acataaagtctggagctata 4782 ABCG2 14 (intron 1 18369) ctattgcttttctgtctgca G/T aaagataaaaactctccaga 4783 ABCG2 15 (coding region 34 atgtcgaagtttttatccca G/A tgtcacaaggaaacaccaat 4784 (Val 12 Met)) ABCG2 16 (intron 2 36) tgtaaaaagacagcttttta A/G tttacctacagtgaacctca 4785 ABCG2 17 (intron 2 4230) caaccctaaattggagggcc C/T gggcgtggtgattgagaaag 4786 ABCG2 18 (intron 2 4518) gttgacagacttttatagtg A/C gggacactgacctgcatgca 4787 ABCG2 19 (intron 2 6278) atgtatgtaccacgtcttca T/C attcttaaaggatgacccta 4788 ABCG2 20 (intron 3 10) ggcaaatcttcgtgagtata A/G gagagtataagtaagcgttt 4789 ABCG2 21 (coding region 421 tgacggtgagagaaaactta C/A agttctcagcagctcttcgg 4790 (Gln 141 Lys)) ABCG2 22 (intron 6 3203) tcctattctgttttaataaa A/G gcattgaatttaggtttgct 4791 ABCG2 23 (intron 6 3287) gtcaggctgaactagagcaa A/G caatctaaaggcaagaatag 4792 ABCG2 24 (intron 9 5974) tatactaataaatggtgtgt A/T taagtttttatctctaattg 4793 ABCG2 25 (intron 10 1908) gacgcttatgtgcagcctat G/T ttgatgtctggaaaggctga 4794 ABCG2 26 (intron 10 2094) ccctgagggctgaggtatct G/A gattatttccagacttgcta 4795 ABCG2 27 (intron 11 20) tgtgagtaggtctttgttct A/G ggaacggggctgtccagcag 4796 ABCG2 28 (intron 11 1447) tgttcttcaaggaaagcccc C/T gtcaaagaaggaaaagaagc 4797 ABCG2 29 (intron 12 49) atgtctttagtcttgcctat G/T ggtgaagtcagttgcacctt 4798 ABCG2 30 (intron 12 1566) tatgcagttacatggacaga C/T acaacattggagaccgaggg 4799 ABCG2 31 (intron 13 40) gctctgataaggaattgttt C/T tttccttcatttcttcctgc 4800 ABCG2 32 (intron 13 1823) ttactcaagcaggcctgact C/T ttagtatttgctttttgtag 4801 ABCG2 33 (intron 14 497) ctaatgaaaacaaacaagaa T/C gaaagattgtcactgtaaat 4802 ABCG2 34 (intron 14 815) taactctttggaaacttctt A/G aaatttaaaactgtttacct 4803 ABCG2 35 (intron 15 110) ccaggggcactgaatttttc C/T gagcctacgttttctcatcc 4804 ABCG2 36 (intron 15 566) gccgcatagtcatgtgttgt T/A gtttttaaattaacttggaa 4805 ABCG2 37 (intron 15 639) aacaagaaacacttgaataa G/A ttgagaaaaaaccccgtttt 4806 ABCG2 38 (intron 15 1197) tgagtagctgggattacagg C/T gcccaccaccacacctggct 4807 ABCG2 39 (5′flanking region gttgggatggctacactcac TCAC/&Dgr; aaagcctgatggcccgtttc 4808 (−998)-(−995) ABCG2 40 (intron 13 405) ctgctagtttattttttttt T/&Dgr; aactttttaatttatgttt 4809 ABCG2 41 (intron 13 692-702) tcaatatgtttctgcttatc (T)9-11 aatggttacttaatcctaat 4810 ABCG2 42 (intron 15 645-650) aaacacttgaataaG/Attgag (A)7-8 ccccgttttcacataatgtt 4811 ABCG4 1 (intron 1 84) ggcctgggtgtcccatgttc G/A gaaagtcctgcaccagtggg 4812 ABCG4 2 (intron 2 77) gaacacagaaggtattctga A/G agggcattgacccccatcct 4813 ABCG4 3 (coding region 679 tggtgtccctcatgaagtcc C/T tggcacaggggggccgtacc 4814 (Leu 227 Leu)) ABCG4 4 (intron 7 95) ggcctcctaggggtagagat C/T tcaccgtcgcctgccttccc 4815 ABCG4 5 (intron 7 158) cttgcccttgggaagtgagt G/A tgaatctaaactgagctctc 4816 ABCG4 6 (intron 8 106) ccccagaggcattgcaacca A/G tgggtgctaggaagaaccta 4817 ABCG4 7 (intron 11 1120) acgagataagtga t/c ggtcat A/G tggccagggaggaaggggac 4818 ABCG4 8 (intron 11 1173) gggggacagcttgaacaaga A/G tgtggaggcaggatggacac 4819 ABCG4 9 (3′untranslated region 2) gagtgacaggcacatacatg A/C gaacaggccatctcagccct 4820 ABCG5 1 (intron 3 40) ccctggcccccccgcccgcc C/A cgggggcttaggctacactg 4821 ABCG5 2 (intron 4 841) gcttggaggcatcttgaatg C/T gcctcatccaaactggactg 4822 ABCG5 3 (intron 4 1145) gagcaaatccagcccacagc G/A tgtaaaat c/a ctgataagtaa 4823 ABCG5 4 (intron 4 1154) cagcccacagc g/a tgtaaaat C/A ctgataagtaattcagtggg 4824 ABCG5 5 (intron 4 1690) acagagatgagaaggaggct T/C gggaatctaccctggctggt 4825 ABCG5 6 (intron 4 1806) tcttttgttccagaatatat T/C tatatctagtttatttatgc 4826 ABCG5 7 (intron 4 1878) atttcagatatgtccattct C/T tgggtgggtcaaagctacat 4827 ABCG5 8 (intron 4 2052) gggtgtctggaaacaaaact C/T attaccatatgagtatcttc 4828 ABCG5 9 (intron 4 2108) tccccctggggtttctgcag A/T tagaggtaatcagtacaggg 4829 ABCG5 10 (intron 4 2230) agcttcttgattagaaattc G/A gtaaagaattttttttagtc 4830 ABCG5 11 (intron 4 2318) ggagttacaggctttaagta G/C agcgaagagaattggaagaa 4831 ABCG5 12 (intron 4 2367) ttaaatgtggctgggggtta C/T aaattgggtccccatttaag 4832 ABCG5 13 (intron 4 2464) gattatatgtctttgatgtg A/G actcacactgagattgtacc 4833 ABCG5 14 (intron 4 2586) aaagcatttatgataataaa G/A tttcaaaacccaaacactta 4834 ABCG5 15 (intron 6 1318) cagagacattcaaagtgcat C/T gctacccttgtgatcacaca 4835 ABCG5 16 (intron 9 164) caactattgagttaccaaca T/C gttaatatgaatgagctcac 4836 ABCG5 17 (intron 9 365) gtaccgttagcttctctttg A/G agctgattttaggacagcca 4837 ABCG5 18 (intron 10 64) tcatggagctagtgggactc G/A tgcagggagagctccagggt 4838 ABCG5 19 (intron 10 2406) tcaacaagcctgcttactgc G/A gttagttgtgaccattgtct 4839 ABCG5 20 (intron 10 2442) tgtctaagtaatttaatgtt T/G tcctatgagagctgaaggag 4840 ABCG5 21 (intron 11 4150) aaggccctgaaatggctgtt G/T ctggctattgttccgagctc 4841 ABCG5 22 (intron 11 4623) caaacagaaagaattttata C/T cttttgattgacagaaaata 4842 ABCG5 23 (intron 11 4737) attttcacaatgaatgttgg T/G tcggtctctccttccttttt 4843 ABCG5 24 (intron 11 4791) ggttagttctaactttctac G/A ttggtaccttcaactttctg 4844 ABCG5 25 (3′untranslated region 2) tgaggattaaaataaaaaac C/T gtaggaatgggctcaacagt 4845 ABCG5 26 (3′flanking region 1560) catagcactcagcaagaaac G/C tgtgctaaagactgaggttc 4846 ABCG5 27 (intron 4 1078-1080) gggcacagctccctgggagc AGG/&Dgr; agaactcccgatagcagagt 4847 ABCG5 28 (intron 10 2321-2327) agcgggttgggtgagccctt TAACATT/&Dgr; aggtaggtgtggtgttggc 4848 ABCG5 29 (intron 11 422-433) ggaattaagactagtcagac (A)10-12 gcctgcaggataaaagactg 4849 ABCG5 30 (intron 11 3988-4004) ctttttttgtagtctggtcc (T)15-17 cttttcctgttcttactctg 4850 ABCG5 31 (3′untranslated region taccctaaaacttaaagtat (A)11-13 cctaccgaaaaaaaaaaaaa 4851 2719-2731) ABCG8 1 (5′untranslated region aagagagctgcagcccaggg G/T cacagacctgtgggccccat 4852 ABCG8 2 (intron 1 898) cctttgactgaattcgggat A/G tggcaggatttgaagcagga 4853 ABCG8 3 (intron 1 1548) cctcacaacctgaaaggcca G/T gtgtaaattgagaaattcta 4854 ABCG8 4 (intron 1 1611) tggtacgggggagccacttc C/T agcccgagccacaacctgtc 4855 ABCG8 5 (intron 1 3245) tgggacaatgaagcaatgtg T/C acagtgacagcggagagggc 4856 ABCG8 6 (intron 1 3430) gggttgaggtgggaatggaa A/C tctggagttctactcactgg 4857 ABCG8 7 (intron 1 3509) tacacaaatcagcttaaaga T/A ctctcatgtacacaccacca 4858 ABCG8 8 (intron 1 3980) gaaaataaaccctggtcaga C/T gcttgaggtcagcctccctc 4859 ABCG8 9 (intron 1 4123) aagggtgttctgggctcccc G/A taagtgtttgttgggtgcat 4860 ABCG8 10 (intron 1 5354) cagcttctaaaggagcccct A/C atctctcctgtct t/c ccacag 4861 ABCG8 11 (intron 1 5368) gcccct a/c atctctcctgtct T/C ccacagggcctccaggatag 4862 ABCG8 12 (coding region 161 ggaggtcagagacctcaact G/A ccaggtagaggcacgcctgg 4863 (Cys 54 Tyr)) ABCG8 13 (intron 2 86) gaaataaaagggtgggccca C/A cttgcaggccctctgccc c/g c 4864 ABCG8 14 (intron 2 105) a c/a cttgcaggccctctgccc C/G caaggacagagtccagtcca 4865 ABCG8 15 (intron 4 43) gacccccaggtccaagaagc C/T acagtgtccatgccccgctc 4866 ABCG8 16 (intron 6 1035) caggaggacaggccgcccct C/T gccctctgtactcacattct 4867 ABCG8 17 (intron 6 1085) cacagaaaggtcacctccct C/A cctgtgctcaggtggcagcc 4868 ABCG8 18 (intron 6 1184) gcacctgccgacctggccat C/T ggggaataatttaaagtaac 4869 ABCG8 19 (coding region 1199 tggggcggtgcagcagttta C/A gacgctgatccggtaattat 4870 (Thr 400 Lys)) ABCG8 20 (intron 8 137) gaaaaaaacagcatccagca G/A ggcgttggtggcttatgcct 4871 ABCG8 21 (intron 9 412) ttctcttttcctttccctta T/C tttttaggttactcagagag 4872 ABCG8 22 (intron 10 343) aggaagcagaggttcagaga G/A gctacgtggctctccaaggc 4873 ABCG8 23 (intron 10 614) cttttaaacgtttataataa T/C ggcagtgaaggtgctggctt 4874 ABCG8 24 (coding region 1695 gcctccttcttcagcaatgc C/T ctctacaactccttctacct 4875 (Ala 565 Ala)) ABCG8 25 (intron 11 82) tgctttcatctggagatgga C/T acttatcacttagatccaac 4876 ABCG8 26 (intron 1 2882-2893) tctcttagaaatggataaga (T)11-13 gacagagtctcacgctgtgg 4877 ABCG8 27 (intron 1 3654) tttatctttcccattttttt T/&Dgr; ctgtataattttgggtcttt 4878 ABCG8 28 (intron 1 5045) tcagagcacagaggtttttt T/&Dgr; atagaactctctccggtcaa 4879 ABCG8 29 (intron 9 292-302) tggctttactgtgcctattt (A)10-12 tgagagacttgggcaatatg 4880 ABCG8 30 (intron 9 417-418) tttcctttccctta t/c ttttt (T) aggttactcagagagggcaa 4881 ABCG8 30 (intron 9 417-418) tttcctttccctta t/c ttttt aggttactcagagagggcaa 4882 ABCG8 31 (intron 10 28-34) ggcagggttgagagcaagtg (C)7-9 acccaccagggtgggggtaa 4883 ABCG8 32 (3′untranslated region 2) tcctggggacagtgaggaca A/&Dgr; tgaccctacagatgctcagc 4884 ABCE1 1 (5′flanking region − 158) aactcagattctcggcacct C/T cagcagctggcttcgccaac 4885 ABCE1 2 (intron 9 237) ctgaaattatatgcaaattc C/T gtagctttataggaagcaga 4886 ABCE1 3 (intron 9 4203) ttgtgtaggaagctgataca T/G taatttgacatatgagatgt 4887 ABCE1 4 (intron 10 1811) ccaagaaacttcagctttct C/T ttcacttaaatataggaaac 4888 ABCE1 5 (intron 17 2301) atatccagaaacagatggta T/C gtgcagaacaggttgtacag 4889 ABCE1 6 (3′untranslated region 1 tggatgattagactgactct G/C agaatattgataagccattt 4890 ABCE1 7 (intron 1 5349-5363) tttgtctgggttggttgggg (T)13-16 gagactgggtctgactctca 4891 ABCE1 8 (intron 1 5845-5854) tacatttgtcaaaatttata (T)9-10 gcagataatcatttcatctc 4892 ABCE1 9 (intron 5 836-851) taaattcacatgattctgta (T)14-16 aggatcctcctgactggcag 4893 ABCE1 10 (intron 8 1153-1169) tctttcaaacttatatttgc (T)13-17 catagtttcatgtttgatga 4894 ABCE1 11 (intron 9 1023-1024) ttgctctgtttcaaatctct (T) attcatgggccagcagctcg 4895 ABCE1 11 (intron 9 1023-1024) ttgctctgtttcaaatctct attcatgggccagcagctcg 4896 ABCE1 12 (intron 9 2338-2346) agtgtagatggacctcgggg (A)8-9 ctagttaaggaaaagtaata 4897 ABCE1 13 (intron 9 3213-3221) ttccaattttccattgttac (T) cttgccagattactcctgaa 4898 ABCE1 14 (intron 10 284-299) tcctctgcattttggcttct GCAGTATTACTGTAGT/&Dgr; 4899 atttgtcattttcaaattaa ABCE1 15 (intron 10 840-853) ttttttggtttctttctttc (T)13-14 aatcttggaggaatcttttt 4900 ABCE1 16 (intron 16 1163-1172) gattagaaatccaggttaaa (T)9-10 gttttgcacaaaaatattac 4901 ABCE1 17 (intron 16 1372-1382) taaaatttaatcaaaattga (T)10-11 ctcttagtcctcaaaccctt 4902 ABCF1 1 (5′untranslated region gccagccccatcggggttcc C/T cgccgccggaagcggaaata 4903 ABCF1 2 (intron 1 101) gcacgagactgaccgggccc C/G tgcgggagttactgcgcatg 4904 ABCF1 3 (intron 20 69) tgactttaaccgaccacctc C/T ctctcttctcgggcagaaaa 4905 ABCF1 4 (intron 23 35) agtgtgccctcatccctgct C/A catggggaccaagctgtagt 4906 ABCF1 5 (intron 7 342-354) acagagcgagactccgtctc (A)10-14 gaaaaaaaaaaaaaacattt 4907 ABCF1 6 (intron 7 356-369) cgtctcaaaaaaaaaaaaag (A)13-15 catttcatcagacctgtctt 4908 ABCF1 7 (3′untranslated region 2) tcagccggccccgagagtga A/&Dgr; gctttccttcccagaagtct 4909 ABCF1 8 (3′flanking region attaatttgatcaattgtct (T) aatatgtcgtactctagatt 4910 1067-1068) ABCF1 8 (3′flanking region attaatttgatcaattgtct aatatgtcgtactctagatt 4911 1067-1068) GAT1 1 (5′untranslated region − 1 gcagctcggactcagctccc G/A gagcaacccagctgcggagg 4912 GAT1 2 (5′untranslated region − 2 gaaggcctcagcccccagcc A/G ctgggctgggcctggcccaa 4913 GAT1 3 (intron 3 150) caatagaacaaccttttctc G/A ggctcatgccgccctgaccc 4914 GAT1 4 (intron 4 211) ttctctgggcttccccactc A/C gttctccagcctgcctgctc 4915 GAT1 5 (intron 5 33) gagacttcccatgataacct C/T ccagggcttcacccccaaac 4916 GAT1 6 (intron 6 168) gaaccagatgcccccagcct C/T gactcagtcccagtctccac 4917 GAT1 7 (intron 1 58-71) ggaagatgggggcctttgtt (A)13-15 gtacatggagaaattaactg 4918 GAT1 8 (intron 3 1306-1319) aataggttgaggaggagcag (A)12-15 tcaagagtgtggagggggca 4919 GAT2 1 (intron 4 842) ttgacctccaaaagtgtttg G/A attacaggcatgggccattg 4920 GAT2 2 (intron 5 183) ccacatccatcattcgagac A/C a/c actcgtctcagctgccatg 4921 GAT2 3 (intron 5 184) cacatccatcattcgagac a/c A/C actcgtctcagctgccatga 4922 GAT2 4 (coding region 1269 actagactgctagtgtcctc C/T ggtgagcccagtcccatagg 4923 (Ser423Ser)) GAT2 5 (3′unstranslated region 17 ataaatgtgtacatgagtgt A/G tgaacacaaatacataaggt 4924 GAT2 6 (3′flanking region 1386) tgtagcagcccacatcgcca G/A tgttcacctgagagagagag 4925 GAT3 1 (5′flanking region − 463) ttcctgagaggcaaatcccc T/C tcccctactcgggaggtgcc 4926 GAT3 2 (5′untranslated region − 1) cctgcccacagctctggctc G/A tcttgccccagtgccatgac 4927 GAT3 3 (coding region 153 (Pro51 cctgtccaccactgtcgccc G/A ccccacaatgcctccacagg 4928 GAT3 4 (intron 2 177) gcaccaagacccttggcttc T/C tcccactcagagtccaagca 4929 GAT3 5 (intron 2 6201) gctcatcctctctggtcctt T/G tgccccagcacaggttcctc 4930 GAT3 6 (intron 3 79) tctgctccacccgtgcaccc G/C caaagaggcaaagagctggg 4931 GAT3 7 (coding region 723 tggcgttggctgcagttaac T/A gtgtccattcccttcttcgt 4932 (Thr241Thr)) GAT3 8 (intron 5 524) tcgaagtacaaaggaaagtt T/C aaagagaagcctgagcctgg 4933 GAT3 9 (intron 7 386) gaccaatgggtttcagactc G/A aagacaaaaattatgtttat 4934 GAT3 10 (intron 9 81) attgtcctgtcctctaccca G/A gggagccatcctttatgaac 4935 GAT3 11 (5′flanking region tacatttggtccccaggggg (G) aagcggctgatcaggagaga 4936 (−661)-(−660) GAT3 11 (5′flanking region tacatttggtccccaggggg aagcggctgatcaggagaga 4937 (−661)-(−660) GAT3 12 (intron 8 211-212) tctgacttggactgggcaaa AA/&Dgr; gtatggtggtatctggatag 4938 GATP1 1 (5′flanking region − 916) acagagtagatgttcaataa G/A tatttgttgtatctgtgaga 4939 GATP1 2 (5′flanking region − 843) tagtgcagcgactatgcctt G/A atgtgtgtgtgtttgggatt 4940 GATP1 3 (5′flanking region − 526) aaatgtgtgcctgtatgtta T/C acatctgtacatatatttcc 4941 GATP1 4 (5′flanking region − 172) acaaacacaactcaaagtat G/A tgtgttattaaaagtagcta 4942 GATP1 5 (intron 1 206) ttgattcaggcaagttagtc C/G taaatggctttgagagactt 4943 GATP1 6 (intron 1 454) caacataacaataatttcct G/A taagaaaaatggccattttg 4944 GATP1 7 (intron 1 999) gtttagcaaggttagatatt A/G atgtggatgttaagacaaaa 4945 GATP1 8 (intron 1 1223) ttgctagaagctagtaggac C/T agctttataaatacagagat 4946 GATP1 9 (intron 1 1326) aactagttaggcaacccatg T/C gttttaggg g/a aaaagcaatg 4947 GATP1 10 (intron 1 1336) gcaacccatg t/c gttttaggg G/A aaaagcaatgaggtcatgat 4948 GATP1 11 (intron 1 1498) atagtttgctcttaagaata C/T actctgagaaggtttatagt 4949 GATP1 12 (intron 1 5041) ttatgctcccgaggagttag C/T tctctaaatgcataaggaga 4950 GATP1 13 (intron 1 9532) aaagactgggagcacttccc A/G atgacaaatactagactaga 4951 GATP1 14 (intron 2 961) aaaaagttatatagaaatat A/G agtgtcactcctttctagtt 4952 GATP1 15 (intron 2 1110) gtctactagtgttcaactcc T/C ttagatcttagcctgtatca 4953 GATP1 16 (intron 2 1419) aaagcctaagaaggatgcag T/C gcaatagcctatgtgagaag 4954 GATP1 17 (intron 2 3339) tatggtttgcaaaaaactta T/C cctctctaggagcaatgctt 4955 GATP1 18 (intron 3 66) caggaaatgaagttgcactt T/C cctctctaggagcaatgctt 4956 GATP1 19 (intron 3 205) tcagttttgtcaatttacac A/G atggggatttgggacctttt 4957 GATP1 20 (intron 3 6377) aatgaatagactttgagtta C/T tggatttttagtggataaat 4958 GATP1 21 (intron 3 7238) tgaatgtcacattttttaaa G/A tttgtgttccttatctcata 4959 GATP1 22 (intron 4 1016) ttttattctggattcatgtt T/C gtggaaattgcagtagtcca 4960 GATP1 23 (intron 5 110) tccacaatgatgagtagagt A/G tcttggcacagttggccttc 4961 GATP1 24 (intron 6 496) agtgtctgaattataagcca A/G ttttatagttggttgggacc 4962 GATP1 25 (intron 7 1934) aaagtgaaaggaaattaaaa G/C tgagaacttgagcctgaatg 4963 GATP1 26 (intron 7 2140) tagaatgtaccaaatgaatc A/G gcatctctgaggatgggacc 4964 GATP1 27 (intron 7 2365) tgaaatcttctttatcaact C/T gattttcctccagactttac 4965 GATP1 28 (intron 8 88) gcaaactcctaagttgaagt G/C ttttaggatattttttgact 4966 GATP1 29 (intron 9 534) tcatattttgtattttaaag G/A ttatctgggttttactgaaa 4967 GATP1 30 (intron 9 1286) tattcttctgagataaatca T/C tgaaggagtggctatgtggt 4968 GATP1 31 (intron 11 215) ttcactcctattcctcgcta C/T ttttcttccttatttcttag 4969 GATP1 32 (intron 11 663) ttcttcttcttttggagctc T/A aaagtagagttcagttaatc 4970 GATP1 33 (intron 11 999) atcatcactgcatgagagtt A/G gaattatctaactttgtgat 4971 GATP1 34 (intron 11 16727) tttcttttatttacaaactt A/G tttacttttcaggtgtatga 4972 GATP1 35 (intron 12 48) ctatcagaacaatattatta T/G tattattttttattacactt 4973 GATP1 36 (intron 12 686) tatgttttgataaactttgc C/A gtacaaataaagaaaattga 4974 GATP1 37 (intron 12 708) tacaaataaagaaaattgaa A/G tatttccaaataaatcaagt 4975 GATP1 38 (intron 13 418) tctctggtctccaaaatcat A/G tattttctccctcttta c/a at 4976 GATP1 39 (intron 13 436) at a/g tattttctccctcttta C/A attttgctgaaacaatcttc 4977 GATP1 40 (3′untranslated region 2) gtctttaagaacctaaaaaa C/A ctcttaactcaaaataataa 4978 GATP1 41 (3′flanking region 57) agtgactaaagtttttctta C/A aaacaagtgtctgaatcaaa 4979 GAPT1 42 (3′flanking region 572) aatacactatggttatttat G/A tgtactataaatggagtgag 4980 GATP1 43 (3′flanking region 788) atttcctaaatgatcagatg C/T atcatatgaaaaaagaaagc 4981 GATP1 44 (3′flanking region 1356) aggtgactgacataaatggg G/A gcagaggacataatgaggtt 4982 GATP1 45 (5′untransalted region attttctaatctgtattaaa (A) gcgttccaggtatttttgta 4983 (−189)-(−188) GATP1 45 (5′untranslated region attttctaatctgtattaaa gcgttccaggtatttttgta 4984 (−189)-(−188) GATP1 46 (intron 4 725-726) tgatctttaatagcggggaa AA/&Dgr; caggcaagtacgctatagtt 4985 GATP1 47 (intron 4 1082-1083) attgagtcaggaaaccaaaa CA/&Dgr; gtttcaaaaatttgaaaaat 4986 GATP1 48 (intron 4 2301) aatgtcatgtcttttttttt T/&Dgr; aatgcagagtgtacaaagga 4987 GATP1 49 (intron 9 241-46) attgtatgtgcatgtgggtg TGTGTG/&Dgr; catgattgtctttgtgatat 4988 GATP2 1 (5′flanking region − 2574) ggataaggcaacccctatgt A/G tcactgctgcaggagaggga 4989 GATP2 2 (5′flanking region − 1723) tctttcagacttcaaaggcc A/G tgatatttcatcagagctgt 4990 GATP2 3 (5′flanking region − 1180) tgcttatttaacaggcataa T/G ctttggtctcctgagccaga 4991 GATP2 4 (5′flanking region − 811) tatgtgcatatgtgtataca G/A gtaaaagtgtgtatatatgt 4992 GATP2 5 (intron 1 7188) aatcatttgaaatttaagaa A/G aaaatatgttcagagaaaaa 4993 GATP2 6 (intron 1 7331) gtgaaatgaggaacaaagtg T/C ccacctttttttcctgaata 4994 GATP2 7 (intron 1 7391) agagagatgtgaaatagtat T/G tttctggggaagtaggggaa 4995 GATP2 8 (intron 1 7886) ttgttagtagaaagaaaatc G/A aagcctaaaactaaaggaag 4996 GATP2 9 (intron 1 7958) ttgctattatataatttttt T/A a/t aaaaaagatttcctaatat 4997 GATP2 10 (intron 1 7959) tgctattatataattttttt t/a A/T aaaaaagatttcctaatat 4998 GATP2 11 (intron 1 8036) ggaaaaaatggggtgaaatt A/T atcaaagggcagcttattac 4999 GATP2 12 (intron 1 9164) acattatattctatataaaa G/T agtcagttgaagtaaaaagt 5000 GATP2 13 (intron 2 193) tgattaagtatttctttggc G/A aaatttttgatgcttaatag 5001 GATP2 14 (intron 2 1020) ttgagtaacatttaggccaa G/A tggcagtcataaggaaaaag 5002 GATP2 15 (intron 2 14865) agaggaattaatcataagag G/T tttatttggctaaagtgaca 5003 GATP2 16 (intron 2 14931) gttagttaataacagaaaaa A/T tatcagaaattttaaaaaaa 5004 GATP2 17 (intron 2 15417) ttctaaaataagtaagctaa A/T tattctatattatactacta 5005 GATP2 18 (intron 2 20823) ttgtataagagatacaaaac A/C aattcctactaggggaaata 5006 GATP2 19 (intron 2 20852) ctaggggaaataaagcttca G/C taaggaggtggcattaagct 5007 GATP2 20 (intron 2 21360) ttcaaaagctgtatttctca T/C tagtgctttttgtgaataaa 5008 GATP2 21 (intron 2 21467) tatatacacaatacctgtcc A/G gaagatgtggtataagccaa 5009 GATP2 22 (intron 2 21621) tatcaatacttatgaagaga A/G ctaactattctaactaggga 5010 GATP2 23 (intron 2 22760) ttccccacctcctgttggtt C/G tcctcttaaacttctccttg 5011 GATP2 24 (intron 2 23199) cctatctgcacataacatta C/T aaacttatggcaattata a/g a 5012 GATP2 25 (intron 2 23218) a c/t aaacttatggcaattata A/G aactcaatacatattatact 5013 GATP2 26 (intron 2 23330) gcccttgttcctgttcctct G/A tacctgcctcaactacatag 5014 GATP2 27 (intron 2 23673) ctggagacggtagctcaaac T/C gaggatgaaaatagacattt 5015 GATP2 28 (intron 3 89) ggttatcaactggggtaaat T/G tatctctcacaggcaatttg 5016 GATP2 29 (intron 3 224) tgctaaatattctataatgc A/G caaagaatgatgtaactgaa 5017 GATP2 30 (intron 4 97) ccctttaaataggcagttac C/A ttttgagaagatacccacta 5018 GATP2 31 (intron 4 568) ttcatgatccaaattgtggc A/G acgtatttccaggcaacaag 5019 GATP2 32 (intron 4 599) aggcaacaagatagaagaag A/G aaagaataagaagcaacaaa 5020 GATP2 33 (intron 4 753) aaaatagacattattccaag T/A taccaagttcccggttaaaa 5021 GATP2 34 (intron 4 781) ttcccggttaaaaatcccaa G/C tataattactgtggaaggaa 5022 GATP2 35 (intron 4 1196) aaggaccacaatctagatca G/T cattgctctaaatatgccat 5023 GATP2 36 (intron 4 1229) tatgccataatatgtgacac T/C tttgcacctggtatttctac 5024 GATP2 37 (intron 4 1623) catctagttgaaatggatta G/C atttttattttactacattt 5025 GATP2 38 (coding region 388 attctaaagaaactaatatc A/G attcatcagaaaattcaaca 5026 (Asn130Asp)) GATP2 39 (coding region 452 taatcaaattttatcactca A/G tagagcatcacctgagatag 5027 (Asn151Ser)) GATP2 40 (intron 5 165) ttaatatacacagttcgccc A/T ttaacaacacaggtttaaac 5028 GATP2 41 (intron 5 189) acaacacaggtttaaactac G/A c g/a ttttcacttctatgcaaa 5029 GATP2 42 (intron 5 191) aacacaggtttaaactac g/a G/A ttttcacttctatgcaaatt 5030 GATP2 43 (intron 5 507) atataactttgctttcattg C/T aaaaggcaaact a/g ttatatc 5031 GATP2 44 (intron 5 520) ttcattg c/t aaaaggcaaact A/G ttatatcatttaaagacttt 5032 GATP2 45 (intron 5 856) agtcatgataaacctaatag A/G ataaaacaacaaaaaagaaa 5033 GATP2 46 (intron 5 1157) acagataatttttacttgtt T/C gtgcttttctgtatgatatg 5034 GATP2 47 (intron 5 1226) ccttgattgtaataatctcc A/C c a/c tgccaagagtggggccag 5035 GATP2 48 (intron 5 1228) ttgattgtaataatctcc c/a c A/C tgccaagagtggggccaggt 5036 GATP2 49 (intron 5 1384) actgttctcgtggtaatgaa G/T aagtctcacaagatctgatg 5037 GATP2 50 (intron 5 1348) ttataaatgagagttcccct G/A caaaagctctcttgcctgcc 5038 GATP2 51 (intron 5 1407) ttgctcttccttcatcttcc G/A ccatgattgtgaggcccccc 5039 GATP2 52 (coding region 521 gtcatacatgtggatatatg T/C gttcatgggtaatatgcttc 5040 (Val174Ala)) GATP2 53 (coding region 571 gggagactcccatagtacca T/C tggggctttcttacattgat 5041 (Leu191Leu)) GATP2 54 (coding region 597 ctttcttacattgatgattt C/T gctaaagaaggacattcttc 5042 (Phe199Phe)) GATP2 55 (intron 7 33) agaacaaggtaccatgataa C/T gtctttctaagcacacatgc 5043 GATP2 56 (intron 7 267) caaaataaccaaatgtaaaa T/A gtctccctcccaaactgact 5044 GATP2 57 (intron 7 1260) gtaatctcacatttctctgc A/G tttacacttggtaaaacttt 5045 GATP2 58 (intron 7 2273) ttctcacgtcctatctagcg C/T gattatgacccttagttact 5046 GATP2 59 (intron 8 207) gtggaagagaattaggtttg T/C actttttagcagggagaaac 5047 GATP2 60 (intron 8 546) tcgggagaagtttctcccta T/C gtaattagagtaatattt a/t t 5048 GATP2 61 (intron 8 565) a t/c gtaattagagtaatattt A/C ttttggtaattatctatcta 5049 GATP2 62 (intron 8 668) taagtaatgtaaattaggat G/T catcagcatttgacagtgcc 5050 GATP2 63 (intron 8 739) tggagaaccattgagagtca A/G taaacaaagagaatgacttg 5051 GATP2 64 (intron 9 112) atttttagtaatacaggataa G/C tataattttcttgtatctt 5052 GATP2 65 (intron 9 266) ttagaggtagtatctgtata A/G ttggatcttataatttagtg 5053 GATP2 66 (intron 9 305) tgctaagatctgagacaaac C/G cttttgtaattataatcatt 5054 GATP2 67 (intron 11 10224) tacacttgttccataaaaaa T/C tcctctatattattcctagt 5055 GATP2 68 (intron 11 10359) attaatagattcaacgtgag G/C ttcccttaaactttagccta 5056 GATP2 69 (intron 11 10916) cttatatagaaagaaatcca C/G aaaactattttaccttttat 5057 GATP2 70 (intron 11 10997) aatatattagtttgaacaag T/C gagacttcactaaatataat 5058 GATP2 71 (intron 11 11018) gagacttcactaaatataat G/A caatgtatttgcagcactgt 5059 GATP2 72 (intron 12 442) aacattccaaaacttttaat C/T ga c/t t c/a acagcatgacttt 5060 GATP2 73 (intron 12 445) attccaaaacttttaat c/t ga C/T t c/a acagcatgacttttat 5061 GATP2 74 (intron 12 447) tccaaaacttttaat c/t ga c/t t C/A acagcatgacttttataa 5062 GATP2 75 (intron 12 907) aatgaaaagaagctggcaga T/C tgaaacatactgaatgagag 5063 GATP2 76 (intron 113 65) tatatatatatatatatata C/T acacacacatacatatatta 5064 GATP2 77 (intron 13 870) aattctgagtatcctatttc G/A atgtatccaatctgtggcac 5065 GATP2 78 (intron 13 1935) taaaaaaaaaaaaagtctgc T/C tttacagcaattgagccaag 5066 GATP2 79 (intron 13 2261) aacgaatcctccaaattttt G/C aacttttatttaatcaaaat 5067 GATP2 80 (intron 14 248) tcaaggataataaccaactt G/A tcaaaaatcagagataatag 5068 GATP2 81 (intron 14 2463) atttgtttactaatatggaa C/G cttcttcaagacatattttt 5069 GATP2 82 (intron 14 2857) tcatcatgtatttccaggac A/T cctggcaagatgctcctcag 5070 GATP2 83 (intron 14 11458) atctccagaggtcctgctgt C/T tccccaaagtccactgaccc 5071 GATP2 84 (3′untranslated region 22) ataataaaacaaactgtagg T/C agaaaaaatgagagtactca 5072 GATP2 85 (3′untranslated region 24) tcttaataaaacaaatgagt A/G tcatacaggtagaggttaaa 5073 GATP2 86 (3′untranslated region 25) cagagtttgaactataatac T/G aaggcctgaagtctagcttg 5074 GATP2 87 (3′untranslated region 25) gcctgaagtctagcttggat A/G tatgctacaataatatctgt 5075 GATP2 88 (intron 1 457-458) taattggcaaacataaaaaa (A) caggtgtctcaaagtcacat 5076 GATP2 88 (intron 1 457-458) taattggcaaacataaaaaa caggtgtctcaaagtcacat 5077 GATP2 89 (intron 1 753-7538) gatcagcattacaaccaaga (G) atggagaatgacattcagga 5078 GATP2 89 (intron 1 753-7538) gatcagcattacaaccaaga atggagaatgacattcagga 5079 GATP2 90 (intron 1 10032-10035) tgtgtgattctatattactt ACTT/&Dgr; gtttcaaatttctctccaca 5080 GATP2 91 (intron 1 10058-10061) ttcaaatttctctccacaaa TTTA/&Dgr; tttttctattaaattgtaat 5081 GATP2 92 (intron 2 413-423) acttatttaaaaattctttt (A)11-13 caaaaacaggattttaaaaa 5082 GATP2 93 (intron 3 1595-1603) ttgccaagtaattcaagtgc (T)8-10 gtatttaaaacaacttttca 5083 GATP2 94 (intron 4 10-23) ttcatgggatagtaagtgtt (A)12-14 cctctgtgccactatcagta 5084 GATP2 95 (intron 5 1567-1572) gtgaatataaattacttgta CTTGTA/&Dgr; atttcaagcagatgcaactg 5085 GATP2 96 (intron 5 1577-1585) attacttgtacttgtaaatt (A)9-10 taagtagaataattaagagt 5086 GATP2 97 (intron 8 1939-1941) ttctctaactccttctactc CTT/&Dgr; atttcaagcagatgcaactg 5087 GATP2 98 (intron 10 3077-3078) aaattctttatctacttttt (CTT) ttccctctttctctgctttc 5088 GATP2 98 (intron 10 3077-3078) aaattctttatctacttttt ttccctctttctctgctttc 5089 GATP2 99 (intron 11 11011) aacaag t/c gagacttcactaa A/&Dgr; tataat g/a caatgtattt 5090 GATP2 100 (intron 12 1160-1169) agcatgacatggtagagatg (A)9-11 gcatttttaacatttgttaa 5091 GATP2 101 (intron 12 1310-1312) tccatcttaatataaaatgt TGT/&Dgr; ctactcaaaaggagaagtct 5092 GATP2 102 (intron 13 9-34) tacgagcactaggtatgatg (A)24-27 tatatatatatatatatata 5093 GATP2 103 (intron 13 35-64) aaaaaaaaaaaaaaaaaaaa (TA)10-21 c/t acacacacatacatat 5094 GATP2 104 (intron 13 1379-1387) aaaattattcaccacaatac (A)8-10 caaagtaaagttatgaacac 5095 GATP2 105 (intron 13 1916-1928) aattctcttaaaataatgtt (A)11-13 gtctgc t/c tttacagcaa 5096 GATP2 106 (intron 14 588-596) caattatactttacctcttt (A)8-10 ctaatttcaaattcatatat 5097 GATP8 1 (5′flanking region − 1413) aataggggcttaataactct G/C aaacttatgatttctcatat 5098 GATP8 2 (intron 1 38962) atgaaattagtttaaaaata G/A caaccttaactatactcctc 5099 GATP8 3 (intron 2 253) acagacttaccaacaaagaa T/G tatccttcccaaaatgtcta 5100 GATP8 4 (intron 2 329) actcatggtttgcaaattaa C/G tttttaggaaactttatctc 5101 GATP8 5 (intron 2 2568) ccattctggtgctttctttc G/A tgaaactattttccatcagt 5102 GATP8 6 (intron 2 2679) ctcttattgctcttcttcca T/C gttttaatctaaataattta 5103 GATP8 7 (intron 2 2753) caggaaactttcacaaagcc C/A ctaattaatttaagctccct 5104 GATP8 8 (intron 2 3132) tggtttaatgtaggagagtt T/C accttcacagttaaattaca 5105 GATP8 9 (intron 2 3193) aatgtcttgggcatatttgc A/G ttcatttggggca t/c tcagtt 5106 GATP8 10 (intron 2 3207) atttgc a/g ttcatttggggca T/C tcagttctactagatacaaa 5107 GATP8 11 (coding region 334 gaactggaagtattttgaca T/G ctttaccacatttcttcatg 5108 (Ser112Ala)) GATP8 12 (intron 3 76) agaattttatttttatactt G/A taagtgggcagttacctttt 5109 GATP8 13 (intron 3 2443) tcaatttcatgttgctctta C/T agttataggtattctaaaga 5110 GATP8 14 (intron 4 67) taatcacgtctataaagttt C/G tgatattctttaacaaaatt 5111 GATP8 15 (intron 4 91) tattctttaacaaaattgat T/A taagaacaaataggaagaac 5112 GATP8 16 (intron 4 197) ggtttgaactgcacctgttc G/A cttatatgcagcttttgtcc 5113 GATP8 17 (intron 4 813) tttaacagaataaaaaaaaa T/A attttgtaacgacaaaagaa 5114 GATP8 18 (intron 4 974) atatgcaccttaaaaataac C/G tggatttttaaatatgtaat 5115 GATP8 19 (intron 4 1003) taaatatgtaatgtacataa G/T gaatattatgcatattttgt 5116 GATP8 20 (intron 6 155) cattaataatcagaataaaa A/G agaaatttagctcctattta 5117 GATP8 21 (intron 6 750) atccaactggggtttagatt T/G cctctttctgcctctcctcc 5118 GATP8 22 (intron 6 780) gcctctcctccatctgcacc C/T tctcttttcctcagcaaaca 5119 GATP8 23 (intron 6 1248) ctatgccctgtaatctcaca C/T ttccctttatttaaaattgg 5120 GATP8 24 (intron 6 1500) tcgtgtctgtgttagcatat A/G ataactcatcagggtttgtg 5121 GATP8 25 (intron 6 2008) ataacataaatgagtaaaga A/G tatcaagggcaggaaattag 5122 GATP8 26 (intron 6 2087) actactctccccatacacac T/C aaaactcatgtgctccccag 5123 GATP8 27 (intron 6 12305) tcatctatggaggactgcaa T/C cattatcattatttcccaga 5124 GATP8 28 (intron 7 363) taacaaatgataccagccat C/G atactattctctggtaatag 5125 GATP8 29 (intron 7 411) cctttattttttgagaacct G/A gtggatgatattaaga c/a gta 5126 GATP8 30 (intron 7 428) cct g/a gtggatgatattaaga C/A gtatatagatcactgtaata 5127 GATP8 31 (intron 7 634) aaaattatatatatacatat A/G taatcttacctaagtattca 5128 GATP8 32 (intron 7 1791) tgtttttttaagggtagtga T/C gtgaatagtaaagcgaattt 5129 GATP8 33 (intron 7 2000) agttgagcaaattgctctca G/A gtagcataatgtcacttgaa 5130 GATP8 34 (intron 7 2043) gtttattgatccatttttta A/G tggatcaacattgtagtgag 5131 GATP8 35 (intron 7 2171) atttattttgagcaaaggtc G/A c g/a actct c/t cttagaaagc 5132 GATP8 36 (intron 7 2173) ttattttgagcaaaaggtc g/a c G/A actct c/t ttagaaagcct 5133 GATP8 37 (intron 7 2179) tgagcaaaggtc g/a c g/a actct C/T ttagaaagcctcacaaat 5134 GATP8 38 (intron 7 2219) atttctccatcttgt a/g ata T/A catcgttgttctgcatttga 5135 GATP8 39 (intron 7 2261) cagatattaatatatatttt A/T ttattgaaatatgttatttt 5136 GATP8 40 (intron 8 150) acaaaatttctccatcttgt A/G ata t/a catcgttgttctgcat 5137 GATP8 41 (intron 8 154) aatttctccatcttgt a/g ata T/A catcgttgttctgcatttga 5138 GATP8 42 (intron 8 1303) ttttttttgagatggagtct C/T gctctgttgcccaggctggg 5139 GATP8 43 (intron 8 1372) aagctccgcctcccaggttc T/G ccacccttctcttaaagaaa 5140 GATP8 44 (coding region 1272) tccttcttgtttcaacttct A/G tatttccctctaatctgcga 5141 (Leu24Leu)) GATP8 45 (intron 10 63) tcacagatttgatttaataa A/T tacttatcaaatcttcctat 5142 GATP8 46 (intron 10 911) cttgcccaatatcctaccaa C/T gtattattaaacggcatgga 5143 GATP8 47 (intron 10 972) tcctagtttccttgaagata G/A gctacaactttagtaaactt 5144 GATP8 48 (intron 10 1101) tccctggtcctgtgttgtcc A/T g t/c agtgaagacctgaaagag 5145 GATP8 49 (intron 10 1103) cctggtcctgtgttgtcc a/t g T/C agtgaagacctgaaagagag 5146 GATP8 50 (intron 10 2027) cccattttcatgagtggcta A/G g/a ttttgtcccgtttcaaaact 5147 GATP8 51 (intron 10 2028) ccattttcatgagtggctaa/g G/A ttttgtcccgtttcaaacta 5148 GATP8 52 (intron 10 2372) tgtatttggtaaatgtattt G/T ttaatatttcaaaaactatt 5149 GATP8 53 (intron 11 10538) caacagaggatcaatgtaaa T/G gaaatctcttaaattaaaca 5150 GATP8 54 (intron 12 55) ataaatattaatgttaaata C/T taaagactgaatgcaattaa 5151 GATP8 55 (intron 12 1802) taaaatgaatcggtaaaaca T/G tcatgtataaatcactgtca 5152 GATP8 56 (intron 12 2612) ataggcatataatactcttt C/A ttccctctgtatatagggag 5153 GATP8 57 (coding region 1833 aacagctgtggagcacaagg G/A gcttgtaggatatataattc 5154 (Gly611Gly)) GATP8 58 (5′flanking region tacataacatatacctatat CTAT/&Dgr; gttatgtgtctgcttatata 5155 (−1590)-(−1587) GATP8 59 (5′untranslated region agcatcagcaacaattaaaa ATATTCACTTGGTATCTG/&Dgr; 5156 (−28)-(−11) tagtttaataatggaccaac GATP8 60 (5′untranslated region tattcacttggtatctgtag TTTA/&Dgr; ataatggaccaacatcaaca 5157 (−7)-(−4) GATP8 61 (intron 4 213-214) ttc g/a cttatatgcagctttt (T) gtccaaccaaacagaaggag 5158 GATP8 61 (intron 4 213-214) ttc g/a cttatatgcagctttt gtccaaccaaacagaaggag 5159 GATP8 62 (intron 4 505) tataactttctctttataaa G/&Dgr; atgcaaaatgttatagcatt 5160 GATP8 63 (intron 4 616) aatgaagtggaggaaaaaaa A/&Dgr; tgatttcaagttttctgtct 5161 GATP8 64 (intron 4 804-812) acatccatgtttaacagaat (A)9-11 t/a attttgtaacgacaaaag 5162 GATP8 65 (intron 4 855) agattgtttaaccaaattag G/&Dgr; aaactattattcaacacact 5163 GATP8 66 (intron 7 619-628) ttttatatatgaattaaaat (AT)4-5 catat a/g taatcttaccta 5164 GATP8 67 (intron 7 1773-1779) attttctatattatgaactg (T)7-8 aagggtagtga t/c gtgaata 5165 GATP8 68 (intron 8 1270-1290) tagtgtgccacccttctctc (T)19-23 gagatggagtct c/t gctc 5166 GATP8 69 (intron 10 665) aactcaaaggcttttttttt T/&Dgr; ccatgtgacacatatcctgt 5167 GATP8 70 (intron 11 247-250) aaaaatcttaaggcacacac TGAT/&Dgr; tgacagttgccttgattgta 5168 GATP8 71 (intron 12 1622-1630) aaataaattgttggcatcta (T)8-10 atttttctaagggtcgctgt 5169 GATP8 72 (3′untranslated region cctgatgcctttaaaaaaaa A/&Dgr; tgaaacactttggatgtatt 5170 2464-2465) TAP1 1 5′flanking − 673 agctaagagtcaaagcaccc G/C ctttttccaccagcctcgcg 5171 TAP1 2 5′flanking − 646 ccaccagcctcgcgtgcctg T/G tcccttcacggacactctag 5172 TAP1 3 5′flanking − 563 ttgcaagcgctggctgctac A/C ggcgacctccctgcgctccc 5173 TAP1 4 5′flanking − 236 gctttgcgcgcggcgctaac G/T tgtgtagggcagatctgccc 5174 TAP1 5 intron 3 + 408 aaggaaactgaggccaagac C/T ctaaatgctgaaactgcaca 5175 TAP1 6 exon 4 + 153 ccctcaccatggtcaccctg A/G tcaccctgcctctgcttttc 5176 TAP1 7 intron 4 + 289 gtatttctttagcatccaag G/T ggcatagctgtgtctctttc 5177 TAP1 8 intron 4 + 291 atttctttagcatccaaggg C/G catagctgtgtctctttctc 5178 TAP1 9 intron 5 + 1139 ttccttcaggttaatgactg C/T ggttctttgtgtcccctcca 5179 TAP1 10 intron 7 + 375 gtctctgcccttgtctttgc C/T gcttcttctatctctactcc 5180 TAP1 11 3′flanking + 71 agcgcacttttcagctgcgg G/A tgtctcctcttttatcatcc 5181 TAP1 12 3′flanking + 129 aactgcatcaccttttccct T/C aagctttttaattcctatga 5182 TAP1 13 3′flanking + 459 cattcagggaggcccaggtc G/A tgtgacgtcgacagttgctg 5183 TAP2 1 intron 3 + 8 tctcctttggcaggtaggtg G/A tgggcagctgggtccatttg 5184 TAP2 2 intron 4 + 104 cttcacccgtatgccaggac C/T tggggatgcttttctcttgt 5185 TAP2 3 intron 10 + 219 gcagcagtggtgctccctcc A/G tgggcagccccgtcaggtcc 5186 TAP2 4 intron 11 + (317-319) atggtgcccaggtggatgtg GTG/&Dgr; tccatctcattcctgtcttt 5187 TAP2 5 exon 12 + 19 agctgcaggactggaattcc T/C gtggggatcgcacagtgctg 5188 TAP2 6 exon 12 + (356-357) aggtggggtggggtggggtg GG/TGGTGGGGTGGA ggctgtctgtgtcc 5189 OCTN1 1 intron1+ 6602 aggcgagccaggttatgtgg C/T gaaggataaggcctcttccc 5190 OCTN1 2 intron1+ 6790 gacaaaaggggaaaaccttc C/T gtgataggcaggtttgtgga 5191 OCTN1 3 intron1+ 14019 cactgtctcccactgggccc G/A ccatgtcactgttaaccaca 5192 OCTN1 4 intron1+ 14136 ccggtttcctaagaaaagcc T/C tttctaaaggacccctctta 5193 OCTN1 5 intron1+ 14266 agctttccaaaaagacactt G/T cggcaccataactccccaaa 5194 OCTN1 6 intron1+ 14412 cttggggcaaacggccactg C/T gtgtgcatggctcttcctgt 5195 OCTN1 7 intron1+ 15776 acataggagacacttctttc G/A gatctcagtattcagaacaa 5196 OCTN1 8 intron1+ 15817 ctgtgcttctgcgaataagc A/G gactacttcggatactgtaa 5197 OCTN1 9 intron1+ 15889 agagccagttttggagcccc G/A tctggcaagcaggcaggccc 5198 OCTN1 10 intron1+ 16063 acctctgtctgctgcagaat A/G aggtgtgatataaatatgtg 5199 OCTN1 11 intron2+ 1105 atatttccacaaggtccttg C/A gtacactgctccatgctttt 5200 OCTN1 12 intron3+ 1022 cttctgtcaagttgccagga T/C ggaaatattccaactctact 5201 OCTN1 13 intron3+ 1217 tccccttcctgcagggggaa G/A gagcggggcaagattttctt 5202 OCTN1 14 intron3+ 1596 aagccagagaagctctctcc G/A tgggaatgggaacaaggtgg 5203 OCTN1 15 intron3+ 1720 ggagcctccaagcctcccct G/A tgtgagcgggtgaggcaggg 5204 OCTN1 16 intron3+ 2104 tatgagactcgttgtgttgg G/A ttctcaggtctgaaagttta 5205 OCTN1 17 intron3+ 8323 cctttccccttttctaagtg G/C tgatagtttgaactctaact 5206 OCTN1 18 intron4+ 926 tttttggaactcacaattta G/T actagacctcatggttgccc 5207 OCTN1 19 intron4+ 1055 cacctgtctgacgagatagc G/A caggtcaggtgggctcactc 5208 OCTN1 20 intron5+ (1197-1202) caacaacaacaacaacaaca ACAACA/&Dgr; ttgggagtgtctaacacttc 5209 OCTN1 21 intron5+ (2071-2083) gttctgctcattgctcatgc (T)11-13 caaaaaaagaaactaaggca 5210 OCTN1 22 intron5+ 2781 tgatcattcctagaaaaaag G/A acactcacatttggagagga 5211 OCTN1 23 intron6+ (882-917) tcctactctatgatggcagc (AC)15-18 gatgatcgtcagaactggta 5212 OCTN1 24 intron6+ 924 acacacacacacacgatgat A/C gtcagaactggtagatttag 5213 OCTN1 25 intron7+ 511 attattgatagtaatagaaa T/C acatatttcttaataataag 5214 OCTN1 26 exon8+ 124 ggtcaggaacatggcggtgg G/A ggtcacatccacggcctcca 5215 OCTN1 27 intron8+ 3514 acacacacacctgaaaacat G/A tatgaattctcaggaaaggt 5216 OCTN1 28 intron8+ 3902 aagcaagatgaggatctgtt T/C ttctcctgtgtgagtaaagc 5217 OCTN1 29 intron8+ (4064-4089) gtgaacataatacttagttg (T)18-26 gagtctcatagccctgtgga 5218 OCTN1 30 3′flanking + 115 aaccaaatgattatatgcag T/A attcctatccagaaaacctt 5219 OCTN2 1 5′flanking − 225 cggcgctagaggagcgagtt C/T ggactcggaccccaaggcct 5220 OCTN2 2 5′flanking − 124 gctggcagaggccgggcctc G/T ccaggtccccaggacaggcc 5221 OCTN2 3 5′flanking − 13 ggcgccgctctgcctgccag C/G ggggcgcgccttgcggccca 5222 OCTN2 4 intron 1 + 232 ggtggtcagtctggcctccc G/A tcctgatggccactttgaag 5223 OCTN2 5 intron 1 + 314 atggccctgtgtgtccagga C/T ttactctagttggggttggg 5224 OCTN2 6 intron 1 + 5055 catgtggtacctagcagcat G/A tctgactgttgatacggtca 5225 OCTN2 7 intron 1 + 6437 gaagcttggcctcacacaca G/C aggccggcaccctgtcatca 5226 OCTN2 8 intron 2 + (173-174) tagtaagaagagccaacaaa TC/&Dgr; atctgactccgtaattcttg 5227 OCTN2 9 intron 2 + 608 agcaggttatttgtataatt C/A taaagcttttaactcaagga 5228 OCTN2 10 intron 2 + 4370 taatttattgatatccaagt G/A ccctctataatagatgctca 5229 OCTN2 11 intron 5 + 969 caccagaaaggggtcctgtg C/T gcaaaggtcaggcaggagtg 5230 OCTN2 12 exon 10 + (1028-1044) ttagcctcctggtttgtgtc (T)16-18 aaaacagaatcactctggca 5231 OCT1 1 intron 1 + 7715 tagtcctgactcacacatgg G/T tctgtgcttttcgtcctcct 5232 OCT1 2 intron 2 + 97 ggtggagaacatgaccagtt G/A gaattaactgcagaagctgc 5233 OCT1 3 intron 2 + 797 gtggagttgtgtgaacaact C/G tttaaaagagtgtggggagg 5234 OCT1 4 intron 2 + 1768 cgtgaactggagagggtctg T/C gggcactgcccggctgagct 5235 OCT1 5 intron 3 + 1244 gcagatggtaaaggagcaga C/T gcggaaagcgacggtcaggg 5236 OCT1 6 intron 4 + 865 agcgtccagtggtaggaaag G/T ctccacaggtggcaatccca 5237 OCT1 7 intron 4 + 1028 gtcatctctgctcttctccc A/G cttcttcatttttatagtac 5238 OCT1 8 intron 4 + 1040 cttctcccacttcttcattt T/G tatagtactattggtattat 5239 OCT1 9 intron 4 + 1485 agcctgcccttcccctgcct C/T gtccttgtgaaacagggatc 5240 OCT1 10 intron 4 + 1997 tgagggattacagccccaac G/A tggggagggcaggctgcact 5241 OCT1 11 exon 5 + 9 tggtgttcgcaggtgtgtgc C/T ggagtcccctcggtggctgt 5242 OCT1 12 exon 5 + 20 ggtgtgtgccggagtcccct C/G ggtggctgttatcacaaaaa 5243 OCT1 13 intron 6 + 379 gaggaagttccattcctcat A/G tctaaacaccctagagaccc 5244 OCT1 14 intron 6 + 2125 tattgacccaaatctgttct C/A acaatgtaaatatgactgta 5245 OCT1 15 intron 6 + (2935-2953) tttctccatctgcgaggggc (T)18-20 cttcagtctctgactcatgc 5246 OCT1 16 intron 7 + (6-7) ttttatctcacctggtaagt (TGGTAAGT) tggtaagttgtctgctttc 5247 OCT1 16 intron 7 + (6-7) ttttatctcacctggtaagt ( tggtaagttgtctgctttc 5248 OCT1 17 intron 7 + (1780-1781) gttttcttttcccttttttt (T) catggagaaagaacagagaa 5249 OCT1 17 intron 7 + (1780-1781) gttttcttttcccttttttt catggagaaagaacagagaa 5250 OCT1 18 intron 8 + 3247 ccaggccaaacaattccatt G/T tcatggccactgggccaagg 5251 OCT1 19 intron 8 + 10521 cccttaaccaatgaacgcca G/A tggcagatccctcattctga 5252 OCT1 20 intron 10 + 393 tcagattctttagtaacttt G/C ttcacaaaattcttttgaca 5253 OCT1 21 3′flanking + 1755 tgaatgatgtttttcaaatg T/C gtattaaaaatgtcctctct 5254 OCT1 22 3′flanking + 1799 ctttcttagaatcctcttgg G/&Dgr; caaaacttctgaggaaggcc 5255 OCT2 1 intron 2 + 1329 tggcagcagaagggaagagg G/&Dgr; ataaaagtggaggcacaggc 5256 OCT2 2 intron 2 + 1867 cctctgtcaaggtaagtact C/&Dgr; attattcttcccccaaaggc 5257 OCT2 3 intron 9 + (340-343) cagcaggcccctaactctct CTCT/&Dgr; gctgatttccacccttcctg 5258 OCT2 4 intron 9 − 396 atacataattcattactttt A/G tttgctagaaatgatccaag 5259 OCT2 5 intron 9 − 386 cattacttttatttgctaga A/C atgatccaagtttctgactt 5260 OCT2 6 intron 9 − 86 atagaaaaatgctaaaaaaa A/&Dgr; gttttaaacaaaaataaggg 5261 OCT2 7 intron 10 + 1725 tggaagaggcctttgaatcc G/A agcggaggtcacacactcgc 5262 OCT2 8 intron 10 − 195 caagataattttaggaataa C/T tctgtcgacatgagttatca 5263 OCT2 9 exon 11 + 328 gttttctggagggttttttt T/&Dgr; ccatctttgtatttttttaa 5264 OCT2 10 exon 11 + 427 aggcaaacaaaatagaaaaa A/T gtgtgaaaaacagtaaagtt 5265 OCT2 11 exon 11 + 455 aaacagtaaagttgggagag G/A agcatctattttcttaaaga 5266 OCT2 12 3′flanking + 34 agaatgtatgtcaagaattt T/A agataggcctttcagtaaca 5267 NTCP 1 exon 1 + 307 tatggcatcatgcccctcac G/A gcctttgtgctgggcaaggt 5268 NTCP 2 intron 1 + 607 cccagcacccactccagata G/C gccagccccatctcagccac 5269 NTCP 3 intron 1 + 702 gcagaaatcagcaagggctc G/A ctcctggagacgcagcacac 5270 NTCP 4 intron 1 + (3950-3966) cacatcacctaacagcttgc (T)14-17 gagaaataggcatgtaaaga 5271 NTCP 5 intron 1 + 5597 aaggacatattattcaggct C/G tgagtgtcataatttatttt 5272 NTCP 6 intron 2 + 4808 cctatggagaagcaactacc C/T ggggccacttgtctcagcag 5273 NTCP 7 intron 2 + 5032 acacctggagactagcagag G/C cagctttcccaccaggatca 5274 NTCP 8 intron 2 + 5046 gcagaggcagctttcccacc A/T ggatcatatcaaattatgtg 5275 NTCP 9 intron 3 + (8-21) gcctcaatggacggtaggta (T)12-15 aagaaagggtctcactctgt 5276 NTCP 10 intron 4 + (484-495) taatataacccagaataaag (A)10-13 gattcctcaactctagttac 5277 NTCP 11 intron 4 + (728-754) tgcactttaacaccaatttt (A)25-27 caggacattcaaacccactt 5278 NTCP 12 intron 4 + 747 taaaaaaaaaaaaaaaaaaa A/C aaaaaaacaggacattcaaa 5279 NTCP 13 intron 4 + 1339 ccccagtggaaacactaaat C/A aaagcaacgtatttctttgg 5280 NTCP 14 intron 4 + 1545 accacggacaagaagaggta G/C atcaattgggggttggaggg 5281 NTCP 15 3′flanking + 559 caagacaatatagttttcgg G/A tatcagtttggcaaatgtgc 5282 PEPT1 1 exon 1 + 25 ctgccaggagcacgtcccgc C/T ggcaggtcgcaggagccctg 5283 PEPT1 2 intron 1 + 88 cgagggccgggaggcgcgaa G/A ggtacgcggcggcgggaagc 5284 PEPT1 3 intron 1 + 106 aagggtacgcggcggcggga A/T gcggggcgacccgaaggccc 5285 PEPT1 4 intron 1 + 248 cgaggttgcgatcctggccc G/A cccgcccgtggggcactgta 5286 PEPT1 5 intron 3 + 326 tggagcgggacgggacccag C/A gggtgacggcaggggcggca 5287 PEPT1 6 intron 1 + 1238 tttagcatttccagcagatc C/T aatcccgagagctgttagag 5288 PEPT1 7 intron 1 + 3001 tcttatatgctgggaagaag C/T gtcagtaagaaaaagcagcc 5289 PEPT1 8 intron 1 + 5673 ttgggaagtgccacagccac G/C gggcacagggacagggtctt 5290 PEPT1 9 intron 1 + 5679 agtgccacagccacggggca C/G agggacagggtcttccacag 5291 PEPT1 10 intron 1 + 5917 aaattcacaaaatgtacttc C/T ataagaaggctcgttaaaag 5292 PEPT1 11 intron 1 + 5966 ctaggcatttagaacttcta C/T aatctgcccctagtgacaag 5293 PEPT1 12 intron 1 + 9255 tggtcatttcaggcctcttc A/G gcctatgattttagatagtt 5294 PEPT1 13 intron 1 + 10278 catgacccatgtaggcggga A/G aagcagccctgtagcagcag 5295 PEPT1 14 intron 1 + 20251 aagaagagcctgtgtttatt C/T agtgattgcaatgtgttggg 5296 PEPT1 15 intron 1 + 20509 aaacaccacttctgcatttg C/A gctttctaagatagcaatcc 5297 PEPT1 16 intron 1 + 20532 tttctaagatagcaatcctg T/C tgacacaggtacattaagat 5298 PEPT1 17 intron 3 + 55 agagcgggagtggccataac C/&Dgr; agtcctaactttgtttcccc 5299 PEPT1 18 intron 5 + 1720 atcctctcttttactggaaa C/A aataaagctacaaaagaacc 5300 PEPT1 19 intron 5 + 1790 gctactgttttatgttttcc G/A gatggtaaattattagatgg 5301 PEPT1 20 intron 5 + 1860 agtttgcatttgactatcac G/A ctgcattcctgtgagctggc 5302 PEPT1 21 intron 5 + 1943 aggcccactgagggaaactg G/A ggaaaagagaggccttctac 5303 PEPT1 22 intron 8 + 1478 tgttttcagatcttagtagt A/G catggaataggaccgttttc 5304 PEPT1 23 intron 8 + 1898 ttaaatattagtggtaaaag A/G aaacatagactcaatctctt 5305 PEPT1 24 intron 10 + 388 ttaaatagtttagacatttt C/T gattttctaaagaaaactgc 5306 PEPT1 25 intron 11 + 985 atccataaggtactcagtga C/T tggcctgtatgaagaactca 5307 PEPT1 26 intron 11 + (1022-1045) ctcaaacaggggtagatttc (T)20-24 gagtcaagagtctcactctg 5308 PEPT1 27 intron 11 + 1320 tgtgagccactgcacctggc C/T aatttcctgactttctatga 5309 PEPT1 28 exon 16 107 tggagagatggtgacacttg G/C cccaatgtctcaagtaagta 5310 PEPT1 29 intron 18 + 6048 tttgttgttgggtttttttt T/&Dgr; gttgttgttgttttgttttg 5311 PEPT1 30 intron 18 + (6141-6142) tcactgcagcctccgccccc (T) gggttcaagcaattatcctg 5312 PEPT1 30 intron 18 + (6141-6142) tcactgcagcctccgccccc gggttcaagcaattatcctg 5313 PEPT1 31 intron 18 + (6241-6242) tatttttagtagagacgggg (G) tttcaccatattggccaggc 5314 PEPT1 31 intron 18 + (6241-6242) tatttttagtagagacgggg tttcaccatattggccaggc 5315 PEPT1 32 intron 18 + 12102 gtgggaattctagctaaggc C/T cgtgtggatctgtctcaggt 5316 PEPT1 33 intron 18 + 12203 gacctgagtttaattcatag C/A cattttctcccagcacctaa 5317 PEPT1 34 intron 18 + 12307 gaaaggttaaattattcttt A/G cactgctgaggtgtacacta 5318 PEPT1 35 intron 20 + 79 tcacaaacacttaggacata A/G tatgatttaactagagtgat 5319 PEPT1 36 exon 23 + (348-370) tcttttttctttttcttttc (T)18-23 gagacagagttttgctcttg 5320 PEPT1 37 exon 23 + 790 ccacattggtcatcttccct A/G tcacacaaatgatgttattt 5321 PEPT1 38 3′flanking + 2 aaataaatttctgttcttaa G/A cctaagtgttcatgtatctc 5322 EPHX1 1 intron 1 + 110 tgcaaaatgtgtcttactag C/T ttctagtgcataaaatattg 5323 EPHX1 2 intron 1 + 143 aaatattggtggagctcttc G/A ctgtgctgggccagtcacca 5324 EPHX1 3 intron 1 + 1097 aatccagagagggagataga T/G tggaagttcaagggtggaca 5325 EPHX1 4 intron 1 + 1717 ttccaagacagagcgagggg T/C gctgctggggcgtggtttgc 5326 EPHX1 5 intron 1 + 1772 aactcgatgctttctcctcc G/T tctgggtcctaactgcagtg 5327 EPHX1 6 intron 1 + 2054 gaaatgtaacaggcaacact A/G tggacacagaaagtagatta 5328 EPHX1 7 intron 2 + 1414 atttccaaaatctgtttggg G/T gtaactgaaacacttgggaa 5329 EPHX1 8 exon 3 + 174 taccctcacttcaagactaa G/A attgaaggtatgtttgcaaa 5330 EPHX1 9 intron 3 + 6583 ctgtcaataccatgaagggg G/C ggcgggggcactaagggtgg 5331 EPHX1 10 intron 4 + 34 agaggttccataactgcccc G/A tcctcgccaagggtgggccc 5332 EPHX1 11 intron 4 + 63 aagggtgggcccggtgttcc C/T accaggctctccttccggcg 5333 EPHX1 12 intron 5 + 154 gcagtgcctgaggcacgttg G/A cttggatcctcctgtctgta 5334 EPHX1 13 intron 5 + 276 tgctggaccaagctctggga T/C agccctgagcagaactcccc 5335 EPHX1 14 exon 6 + 130 gatgtggagctgctgtaccc C/T gtcaaggagaaggtattcta 5336 EPHX1 15 intron 8 + 206 ggtgcctggctcccgggcgg C/A cctcagtaccgctccccagt 5337 EPHX1 16 intron 8 + 353 tggccctcccagaaaagaga A/G ggccctcagtgaggggagag 5338 EPHX1 17 3′flanking + 708 aggtgcagactcatgcactc A/G gccctgaagaggtgagagag 5339 EPHX2 1 5′flanking − (523-522) aaagtcactggatatgcccc (C) tcccccgccccccaacacgg 5340 EPHX2 1 5′flanking − (523-522) aaagtcactggatatgcccc tcccccgccccccaacacgg 5341 EPHX2 2 5′flanking − 522 aaagtcactggatatgcccc T/C cccccgccccccaacacggt 5342 EPHX2 3 5′flanking − 521 aagtcactggatatgcccct C/T ccccgccccccaacacggtc 5343 EPHX2 4 5′flanking − 516 actggatatgcccctccccc G/C ccccccaacacggtcttatg 5344 EPHX2 5 5′flanking − 515 ctggatatgcccctcccccg C/G cccccaacacggtcttatgt 5345 EPHX2 6 intron 1 − 74 tggctgcttctcaatgaata T/C gaacagtgtctgtttccatg 5346 EPHX2 7 intron 3 + 72 gagcattaggtcagaatcca T/C tgaagtgagctttgagatca 5347 EPHX2 8 intron 4 + 473 gtgtgtctctactttaatct A/G caaaaggtgattgaatggag 5348 EPHX2 9 intron 5 + 276 caagagtgggatgttcaagg C/T catcctgacctcacttttga 5349 EPHX2 10 intron 8 + 8 tctgctcctcccggtgggtg T/C gctgtcttgcagctgtctta 5350 EPHX2 11 intron 9 + 1573 atgtcgtgaagactgatgaa C/T gatggacggctgcactgctc 5351 EPHX2 12 intron 10 + 207 gaacaggatggagatgagct T/C gtttatttgtcttttaatga 5352 EPHX2 13 intron 12 + 911 tgaagagacctcgacatgtc G/T catcccacatactacaggga 5353 EPHX2 14 intron 12 + 2425 atcttctcagctgagcaaac C/T gaggctcagagggcttaacc 5354 EPHX2 15 intron 12 + 2460 ttaaccccaactggcccaag G/A ccaggtacatgattgggtca 5355 EPHX2 16 intron 12 − 281 aagtcctttcaagagattat T/C ataagtagtaccttctcatt 5356 EPHX2 17 intron 12 − 268 agattattataagtagtacc T/G tctcattataggaatattga 5357 EPHX2 18 exon 13 + 50 cctgagtcggactttcaaaa G/T cctcttcagagcaagcgatg 5358 EPHX2 19 intron 13 + 1739 ttgtcgtaacagggttttca G/T atgagcatatttcctttgta 5359 EPHX2 20 exon 14 + 33 atgcataaagtctgtgaagc G/A ggtaagagacatgcttggga 5360 EPHX2 21 intron 14 + 314 ggattgagagcttacctcta T/C gggggtcacctcgtgtatgc 5361 EPHX2 22 intron 14 + 878 attcccttattccttcacac C/T gtctgtcactcattcattca 5362 EPHX2 23 intron 14 + 948 gcacaggctgggtatgaagc T/C ggggctgcatgctcagctac 5363 EPHX2 24 intron 15 + 259 agagggttttcactactttt C/T agtcatggctcctcagagaa 5364 EPHX2 25 intron 16 + 459 tcctcatttgtcaagcagaa G/C atgagtttccaatctctggg 5365 EPHX2 26 intron 16 + 645 gtaagtgaacacactgctac G/A tgccagacttcctgccagac 5366 EPHX2 27 intron 16 + 985 gtcattatcatcatatgacc G/A atgaaaatgaccaaactgca 5367 EPHX2 28 3′flanking + 12 aggtggccttacacacatct T/C gcatggatggcagcattgtt 5368 EPHX2 29 3′flanking + 374 tgttcacggagaatgcacgg C/T atggggatgaaccctttccc 5369 EPHX2 30 3′flanking + 544 tagccacctgcctttctccc G/A gcttccctagcagagtttgc 5370 COMT 1 5′flanking + 1287 cgtatgatattccccattct G/A agtccagaatacctagaaat 5371 COMT 2 5′flanking + 1217 tgtgagtatgggaaggggaa G/A cttttctgtctgttgtcccc 5372 COMT 3 5′flanking − 503 caggggctccaggaggacga G/A tgtgtatcctcccattgctc 5373 COMT 4 5′flanking − 425 gagaagttgggaagtctggc C/T agtggggccggtgcctggtg 5374 COMT 5 5′flanking − 277 cccagccccagtttccccac C/T tgggaagggggctacttgtg 5375 COMT 6 intron 1 + 12058 ctggcccatggaagggaggg G/A agggggccccgacggggcca 5376 COMT 7 intron 1 + 12070 agggaggggagggggccccg A/G cggggccacagtaaaggagt 5377 COMT 8 intron 1 + 18831 tgtgtatgttcttggtaaac C/T agcccttggtcttacacatc 5378 COMT 9 intron 2 + 832 cctctcctttggccacccgt G/C actacccccaactccgggcc 5379 COMT 10 intron 3 + 90 ggagaagctgttatcacccc A/G cggggccacagtaaaggagt 5380 COMT 11 intron 3 + 425 ccccaaggtgggcggttcgg T/G gattcagagagggcagctct 5381 COMT 12 intron 3 + 671 ggctcctgctctttgggaga G/A gtggggggccgtgcctgggg 5382 COMT 13 intron 3 + 676 ctgctctttgggagaggtgg G/T gggccgtgcctggggatcca 5383 COMT 14 intron 5 + 75 tcagcctcagcctctccaaa G/C agccaggcattccagtagag 5384 COMT 15 intron 5 + 310 accagacaccagggcagaaa C/T ggcacaggaccaaggagatg 5385 COMT 16 intron 5 + 346 agatggggtggggaagggcc G/A ctctgggcccagcctgctct 5386 COMT 17 intron 5 + 3023 aaggcagccgccctgctcaa G/A gcctaggccattgtcctcct 5387 GAMT 1 intron 1 + 429 ctcggaaagctgagctcagg G/A agacagctgtccccggggtg 5388 GAMT 2 intron 5 + 1411 ggtgacctggtgccatcccc G/A accaggagacgcaggtgccc 5389 GAMT 3 3′flanking + 626 cactgacctccttgccctga G/A agaaggccggctcctgtgct 5390 PNMT 1 intron 1 + 429 ctcggaaagctgagctcagg G/A agacagctgtccccggggtg 5391 PNMT 2 intron 1 + 35 ctgaggcacgagggacaaga G/T gtcgtcgggggatgaaagca 5392 HNMT 1 5′flanking − 211 cagaggcagatgacagtctt C/T cgttaaagatttcactgctg 5393 HNMT 2 intron 1 + 5409 aatataactgatataattgg A/G acatttcatgttggcctagt 5394 HNMT 3 intron 2 + 2561 cacttgtgcttggacaagaa A/G agaaggcctacaagaaaaag 5395 HNMT 4 intron 2 + 2895 caatcagaaatgtaagaaaa A/C ctccaagaaaaatttaagtt 5396 HNMT 5 intron 2 + 3977 accaaacttggaagtgtaaa G/A ttatgcatgtatgttcatgt 5397 HNMT 6 intron 2 + 5296 ttaacatagtgagtttggag T/C cccaggattttattttcctt 5398 HNMT 7 intron 2 + 13317 caaccctcatgaattcttag C/T tgggatgggtccctataaca 5399 HNMT 8 intron 2 + 14682 gtagatgagcaaatgagttc A/&Dgr; ggagagatttaaatacccta 5400 HNMT 9 intron 2 + 15406 gtctatgcattcatgcatcc G/A tctaaccagctgtctaccta 5401 HNMT 10 intron 2 + 28943 atgtgacttaaacttcaggt A/G tatcaatatcccttgaatgt 5402 HNMT 11 intron 4 + 49 cagaaagaagacttttcaga A/G tatatatataatgaatatct 5403 HNMT 12 intron 4 + (1942-1943) tttgagaaaaatttaaggta (A) tcttctatggcccacttcca 5404 HNMT 12 intron 4 + (1942-1943) tttgagaaaaatttaaggta tcttctatggcccacttcca 5405 HNMT 13 intron 4 + 2405 ccctgtgaccaagcagataa C/A ctcatgctttatttagtcca 5406 HNMT 14 intron 5 + (80-81) cctgtgtttgaaagaagctt (TT) atatattttgtcttcattat 5407 HNMT 14 intron 5 + (80-81) cctgtgtttgaaagaagctt atatattttgtcttcattat 5408 HNMT 15 intron 5 + 235 ctttcttttgggaaaatatg T/C ctttgtcttctatatatgaa 5409 HNMT 16 intron 5 + (702-703) tacttacaggttgattttag (AT) acacagcagactctgtcttc 5410 HNMT 16 intron 5 + (702-703) tacttacaggttgattttag acacagcagactctgtcttc 5411 HNMT 17 intron 5 + 749 ttacaccagaccccatactt T/G aacaccatatgtcacaaaat 5412 HNMT 18 intron 5 + 1101 gtaggcagcctattcttgat T/G atattcatcaatcatacaga 5413 HNMT 19 intron 5 + 1137 acagaaaaagtattgtagac G/A gaaataacaattcattgaga 5414 HNMT 20 intron 5 + 1348 aagggagcatgaatagtcca C/G aagtaactgagaactgatta 5415 HNMT 21 intron 5 + 1673 caaaagaaagggagtaaaga C/G tcaacaatcagttagctttt 5416 HNMT 22 intron 5 + 2022 attttatttggggctttcta C/T gtctctctctcctaagccta 5417 HNMT 23 intron 5 + 2285 tgtcatacttaactcttaaa G/C atccagagtaaatgatggag 5418 HNMT 24 intron 5 + 4159 taccagttgacccagcaacc C/T tcttatagagtagtttaaat 5419 HNMT 25 intron 5 + 4501 aatgatccacaaaattacta C/G tcattgttttctttcaatga 5420 HNMT 26 intron 5 + 5251 cacacacacacacacacaca C/G caaatggaagcagccagaca 5421 HNMT 27 intron 5 + 5802 gaaaaagaaaatctggctta C/T tataagaccaagagtcatct 5422 HNMT 28 intron 5 + 6189 tccaattccaccttctccta G/C agcatatcctgcagttacct 5423 HNMT 29 intron 5 + 6297 gtcttggttcatctcttgag T/A taaattagatctgggaactt 5424 HNMT 30 3′flanking + 458 tatgtcactctcaagaactc C/T tataagaccaagagtcatct 5425 HNMT 31 3′flanking + 993 ctgaaaatgaacactgaacc G/A ttaatcatactgatatgtac 5426 HNMT 32 3′flanking + 1793 gtggagcacagcattttagg G/A cttgatatttgcttattata 5427 NNMT 1 5′flanking − 228 ataattttcctgacgagctc A/T agtgctccctctggtctaca 5428 NNMT 2 intron 1 + 44 ccccactaatgtgagtcata T/C agatggagtctcagggcacg 5429 NNMT 3 intron 1 + 149 ggataaaaacgaatattggt A/G tagcgattccacagtttaca 5430 NNMT 4 intron 2 + 158 agataggcccatgtgtgtgc G/A tgttagtaaatttgtgtatg 5431 NNMT 5 intron 2 + 433 gctgtagccatccaagccta T/C agaacttggctgtgagtgtg 5432 NNMT 6 intron 2 + 10826 atcatctgactggtaagttc C/T agttctgtggtaactcaagt 5433 NNMT 7 intron 2 + 13630 atttcatggagggaagtcca T/C ggtagaagcaggctgctagg 5434 NNMT 8 3′flanking + 71 ggctcagtggttggggccca A/G tggttcatctaggacgggac 5435 PEMT 1 intron 1 + (297-299) attgtgtgagactcagaggt TGT/&Dgr; ccgtgttagtctttgggatt 5436 PEMT 2 intron 1 + 817 tcatgaagcctgtaaggcac A/G tctctgccccaagcagcttc 5437 PEMT 3 intron 1 + 830 aaggcacatctctgccccaa G/A cagcttctaatccagttctt 5438 PEMT 4 intron 1 + 1035 gagttctctgaaggagctaa T/C accagttagtgttttgaaga 5439 PEMT 5 intron 1 + 1573 agtgggcaggggagactaac C/T gggtgtgtgaggggtgggct 5440 PEMT 6 intron 1 + 1759 gatttttcttaaagaaagaa A/G gaaagaaacatacaacatac 5441 PEMT 7 intron 1 + 2768 gcatcttgctgtccacaggc C/A ggggcacctccaggattcag 5442 PEMT 8 intron 1 + 2785 ggccggggcacctccaggat T/C cagaagatgactccagtagg 5443 PEMT 9 exon 1 + 162 agctcagcagacctcctggc C/T gtggtgggtagctcctttcc 5444 PEMT 10 intron 2 + 4598 ccgtgggttttttttttttt t/&Dgr; cttcatttctttggttgctg 5445 PEMT 11 intron 4 + 39 actgtccagacgggagtatc C/T cactgcttggtgagccccac 5446 PEMT 12 intron 4 + 1317 accgtccccagctggcccca G/A cctcctgacatgggcctctg 5447 PEMT 13 intron 4 + 1355 ctggagccaggctgcagccg A/C agtgcctggccatcctggcg 5448 PEMT 14 intron 4 + 5925 gtccaggcactgtggcccta C/T gtgggagtctccagtctcca 5449 PEMT 15 intron 4 + 6028 ggcagtggtccaaggaccag G/C atggactccctcttctcacc 5450 PEMT 16 intron 4 + 6078 atctgtaccctcgcggactc C/T acctggcttcgtgccatcac 5451 PEMT 17 intron 4 + 6089 cgcggactctacctggcttc A/G tgccatcacccccgccagat 5452 PEMT 18 intron 4 + 6379 tcaggtgtcccctccctcat G/A cctcctcaccctgccctctc 5453 PEMT 19 intron 4 + 7339 tgtaaggaatcctgccaaga C/T ggcagatgcacacggggtca 5454 PEMT 20 intron 4 + 7619 ctcctgcacatgtgctccag A/G gaggaaaggcatttgacagg 5455 PEMT 21 intron 4 + 8858 ggcatgtgtgtgtgtgtgta T/G gtgtgtgagtgtgtgcatgt 5456 PEMT 22 intron 4 + 9029 tttctggaccagaaagcgtc G/A tcctctgccagggcctcttg 5457 PEMT 23 intron 4 + 9056 gccagggcctcttgcacttg C/T gggaaagctgagctgagctg 5458 PEMT 24 intron 4 + 9512 ctgagctgggcagcagcatt A/G ctctgtgtgctgctggcact 5459 PEMT 25 intron 4 + 9523 agcagcattactctgtgtgc T/C gctggcactggcctggtggg 5460 PEMT 26 intron 4 + 9622 gacaaagtgtacaacaaggt G/A tctcgaactgggtcagctca 5461 PEMT 27 intron 4 + 10776 ccattcctgggtcttctttg G/A aggctgaatgaaattccatg 5462 PEMT 28 intron 4 + 10912 tctgccccactttgctcaga G/C gtgcaacaaggccttcagga 5463 PEMT 29 intron 4 + 11590 ggacactggcctgatgcaga G/C gtgtggtctctctcctgcag 5464 PEMT 30 intron 4 + 12090 ggccagggcacccctaccag G/C ctgagtcccacctgtccagc 5465 PEMT 31 intron 4 + 12263 tacccgccttcccagatgga G/A cgggctgctcatgggactta 5466 PEMT 32 intron 4 + 12448 tctggtcccctctcctgctt G/A tagtttcctgggctaaaatc 5467 PEMT 33 intron 4 + 12730 tgggaccagtgccgccacca C/T ggcccaaggacctggtgttc 5468 PEMT 34 intron 4 + 13240 gggctccaggcacacagcgg T/C cccagtacacctgtcgcttt 5469 PEMT 35 intron 4 + 13494 tccgtggaactcagagatgg T/C acctccctgcgaggtggggc 5470 PEMT 36 intron 4 + 13817 aactctcccctgctgctgag A/G cagatcttggagcctcggcc 5471 PEMT 37 intron 4 + 14773 ccgccctgtgcttcatgccc C/T ctatgcctctcactgcctgg 5472 PEMT 38 intron 4 + 14951 gtcctgaggcccctcccacc G/A ggggcttctcaaccacacac 5473 PEMT 39 intron 4 + 16896 gctgtgactgtcttggagac T/C gggtcttggcgggcctggtg 5474 PEMT 40 intron 4 + 19439 ccaggagcctctgaggcagc G/A ggggcttctcaaccacacac 5475 PEMT 41 intron 4 + 19557 attttgtcagcatgtcacgt C/T cctttcataatgaagcaagg 5476 PEMT 42 intron 4 + 20051 acagcactgcgggagccacg A/G catctgcagacgcatttgat 5477 PEMT 43 intron 4 + 20816 tggactctctggcgtccatc C/T agccacttcagtgcgacgtg 5478 PEMT 44 intron 4 + 21196 ggctggctgggccctgggat C/G atcgtgacaggctttagtgg 5479 PEMT 45 intron 4 + 21528 acaggtgggagccgaggctc G/T ggaggtgggccgggctgagc 5480 PEMT 46 intron 4 + 21596 ccgcttccccgtgctctggc C/T gtagcagaaagtgtcccact 5481 PEMT 47 intron 4 + 22672 agcctcccactgccttgtgg C/T tgaggggagggggccgggtc 5482 PEMT 48 intron 4 + 22713 tctaacgctgtcttctttgt A/T ctgaaaaccaaacaccttct 5483 PEMT 49 intron 4 + 23010 tgccgggcagcggggaggga G/A ggcgagtggttcccccaagt 5484 PEMT 50 intron 4 + 23588 gtgcaggcgccctgcatccc C/T gcagccaagttctgggcgga 5485 PEMT 51 intron 4 + 23627 gacactgccctgagccagga C/T ggtgaggtgggacgccttcc 5486 PEMT 52 intron 4 + 23941 tgaggggttgggactctaca G/A aggagagtggactcacgggg 5487 PEMT 53 intron 4 + 24091 gacacctcttcactgtcagc G/T ctgagacacgcccctgccct 5488 PEMT 54 intron 4 + 25348 caggccagttggaatcctac G/A tagagtgaaagcatctcagc 5489 PEMT 55 intron 4 + 25603 taagcagttaacactgatgc G/A tgatgaaaattccaacagca 5490 PEMT 56 intron 4 + 31540 cctccaggtggcaggaacac T/C gtgaggagcatgcaacgtgc 5491 PEMT 57 intron 4 + 31637 gtgggctgggacgccaggac G/A gtgaggggcttcaaggtgtg 5492 PEMT 58 intron 4 + 31642 ctgggacgccaggacggtga G/A gggcttcaaggtgtgtttgt 5493 PEMT 59 intron 4 + 35593 ggaggagctgaaagagctgg G/A gctcgggatcaggtggttca 5494 PEMT 60 intron 4 + 35647 actttgaggcaccaccgcac C/A tgtccgtgcgtgagggagac 5495 PEMT 61 intron 4 + 35862 tcccagtggtggctctgtcc C/T cgtctcagccgagcactcag 5496 PEMT 62 intron 4 + 35882 ccgtctcagccgagcactca T/G cggccagggtggctggactc 5497 PEMT 63 intron 4 + 37141 ccacaggccggatgccttga T/C acttctcagctgcagggctg 5498 PEMT 64 intron 4 + 38862 tggagagaccacctcagaca C/G caaggacgggcatgccatgg 5499 PEMT 65 intron 4 + 38872 acctcagacagcaaggacgg G/T catgccatgggtcccggcag 5500 PEMT 66 intron 4 + 39140 atgtctcaaatctccctccc C/T gggaaatctaggcacaggtc 5501 PEMT 67 intron 4 + 39635 caggcccaggagcaggtggg G/T cctcctcacaggagcagggc 5502 PEMT 68 intron 4 + 39713 actctgagcatgctggctcc C/T tccttctttccagggcagca 5503 PEMT 69 intron 4 + 40436 cctggttgtgcttcggaccc G/A gaggcagacagaggaggcct 5504 PEMT 70 intron 4 + 47485 acaatgactgttggagccct C/T gagcaggctgtgtcacgtgg 5505 PEMT 71 intron 4 + 48131 actgggggatcctgaatccc G/A cctcctgatgccagtggagc 5506 PEMT 72 intron 4 + 48558 cacagtgtgaactgttaggc C/G acagccacatcttgccggag 5507 PEMT 73 intron 4 + 48702 gagatgggggcggttcggga G/A gcaaaagcaggaaggcagaa 5508 PEMT 74 intron 4 + 50302 gcatgtgcatgggcagaggc T/C gttcccatctgagtgggacc 5509 PEMT 75 intron 4 + 54102 ggccgcgtgctcctgcagcc A/T tgggctcctctggcagttct 5510 PEMT 76 intron 4 + 54220 cccagggacagatcttctcc G/A ccagacgtctctttctgcct 5511 PEMT 77 intron 4 + 54371 gcagataatgtgcagctggg G/A tgcatgtggttgttgctccc 5512 PEMT 78 exon 5 + 79 tggcctgctactctctaagc G/C tcaccatcctgctcctgaac 5513 PEMT 79 intron 5 − 6796 ggaggaagtcagcttcttac A/C gatggtggctcccagctttc 5514 PEMT 80 intron 5 − 6636 ttttctcctctcaccttttg T/C gttcagaggcagaggtgtgc 5515 PEMT 81 intron 5 − 6448 gttgggccaggctctgacag G/A accctcgggaccagctcctg 5516 PEMT 82 intron 5 − 5218 ggagccctggctgaagaagc C/G ttacgaccaaggcctggagg 5517 PEMT 83 intron 5 − 4824 ggacaggccgggggttgagc G/A gctgcatgaaggagggaggg 5518 PEMT 84 intron 5 − 4249 tcaccagagtgatttcctcg C/A ggcaggtgcctggggtagcc 5519 PEMT 85 intron 5 − 4230 gaggcaggtgcctggggtag C/T cactgggcggggtccatgag 5520 PEMT 86 intron 5 − 4182 ggagagtaaggggtgggggg G/A cacttaggacagggaagctg 5521 PEMT 87 intron 5 − 3369 ccaggtggggccgtgtgcct G/C tggcctggtgtgtggcccag 5522 PEMT 88 intron 5 − 2625 cagggaagctgggccctgaa C/T gagctgggcttttgggccac 5523 PEMT 89 intron 5 − 1200 attattgtgagcatgggaag A/T gcacatttggtcacacatgt 5524 PEMT 90 intron 6 + 606 gcctggctagacgcccacca A/G tgaccctgatgatggcagca 5525 PEMT 91 intron 6 + 1229 tttggtccaggaagggggac G/A gcagccaggagcgtctggat 5526 PEMT 92 intron 7 + 716 atggagatgtgctcccccgg C/G gggtcagaggacctgcggtc 5527 PEMT 93 intron 7 + 1537 ctctgggggacgcataagcc G/A cctccagaggacatcagcca 5528 PEMT 94 intron 7 + 1718 gggcttccaggtgtctgagc T/C ccccggcatgtaggacccca 5529 PEMT 95 intron 7 + 2695 ggctttgggggaccctggac C/T catttctagaaaacagcctt 5530 PEMT 96 intron 8 + 140 ccagggctcccaggtcagag C/T ggccatggtagcttacaatg 5531 PEMT 97 3′flanking + 179 tacttaggaggcgtcagggg C/T tcacctggccatggccatgg 5532 PEMT 98 3′flanking + 394 gatgacactgtcattcctaa A/G tgaatggccttgtgctgacc 5533 ALDH1A1 1 intron 1 + 564 cattatttcttcaaccaagt T/C tgttgccattggaacagata 5534 ALDH1A1 2 intron 1 + 710 gttctgagagtaactctgaa C/T tttgcctgtttcacactgct 5535 ALDH1A1 3 intron 1 + 3868 ccctttttatatccagaata C/G aacctaaacttctttctcta 5536 ALDH1A1 4 intron 2 + 2933 taagtatgctatactatatt T/C gatagatatactatactata 5537 ALDH1A1 5 intron 2 + 1646 caatgtgattaactgaatac C/T gcaaatatgcactatatatg 5538 ALDH1A1 6 exon 3 + 54 caggcttttcagattgaatc C/T ccgtggcgtactatggatgc 5539 ALDH1A1 7 intron 3 + 157 taggccccttaacattgaac T/G attctcaaatagtaatctgc 5540 ALDH1A1 8 intron 3 + 339 tgagtctcctagaatgatat G/A ttaggtttattcaagcattt 5541 ALDH1A1 9 intron 3 + 655 agcaattagatgagtcagag C/A ataatatagttgggggaggg 5542 ALDH1A1 10 intron 3 + 735 gaagccaatttaacataaac C/A aataccaagatcaggtttca 5543 ALDH1A1 11 intron 3 + 863 acaagtatggttaatcaaag G/A accatttattactcaaatat 5544 ALDH1A1 12 intron 3 + 1757 agatgacaagatttcttcta T/A ttcaaaaattccctagcaca 5545 ALDH1A1 13 intron 5 + 90 ttctctaaaacagatagatg C/A ttatgtatttgttaaatgtg 5546 ALDH1A1 14 intron 6 + 213 caggaagccaaacacaaaag T/C ttggtgtcaaacagtcaact 5547 ALDH1A1 15 intron 6 + 1323 ttttgaattaaattcttata C/T tgtaacttttaaacttttta 5548 ALDH1A1 16 intron 7 + 638 gcaaaagaaagtggtggaag C/A atactgtaccatgcaaaaaa 5549 ALDH1A1 17 intron 9 + (1462-1463) aatggaattctatgtttttt (T) gttgtgattatttatctatc 5550 ALDH1A1 17 intron 9 + (1462-1463) aatggaattctatgtttttt gttgtgattatttatctatc 5551 ALDH1A1 18 intron 9 + 1757 tgatctagaatttagtttct A/G taaatgaatagaatccagtg 5552 ALDH1A1 19 intron 12 − 1383 aatcccacttattactctcc T/G gagagcttcaagtacctata 5553 ALDH1A1 20 3′flanking + 40 ttttaagtacaagttttggt T/C acagtgatttcttcttgtca 5554 ALDH1A2 1 5′flanking − 716 cagggatcctcattctgagc C/G cgaggcgagggggactcgca 5555 ALDH1A2 2 intron 1 + 314 cggtcccgactgccacgggg G/&Dgr; aaggcgtcggaaccacttag 5556 ALDH1A2 3 intron 1 + (664-675) ttttgaactgaagaacttac (T)11-13 ataacgaacattgacatctt 5557 ALDH1A2 4 intron 1 + 1370 gcatgcagcttagaagtttt A/G ttttatgagggtctctaacc 5558 ALDH1A2 5 intron 1 + 1557 ggtacgtttttcagaattta A/&Dgr; tttggaagctcttccaattc 5559 ALDH1A2 6 intron 1 + 1934 tcagctctttagtgagactt C/G taaattttctaagacaagca 5560 ALDH1A2 7 intron 1 + (1971-1980) agcataatagacaagcagta (T)9-11 aaacgtgaagagcaaaagct 5561 ALDH1A2 8 intron 1 + 2295 tactgtaagacaatatgtta T/C tgttttttgtcttgctaaac 5562 ALDH1A2 9 intron 1 + 2387 ttgggacccacatagagtca C/T tacttaaaataaatgaccag 5563 ALDH1A2 10 intron 1 + 2841 aggaatgtgctttttaaaac T/&Dgr; agatggtgttagtcaaggag 5564 ALDH1A2 11 intron 1 + 3035 gacttttataattttgtata A/G ctgatattataggaatacac 5565 ALDH1A2 12 intron 1 + 3319 aaagagttatgttttttttt T/&Dgr; ctgcatctgatattatatgg 5566 ALDH1A2 13 intron 1 + 3474 ttgtctttttatttattcat T/C taaacttctgttttctgagg 5567 ALDH1A2 14 intron 1 + 4186 ccttccaaacctttacttaa G/C attgtctgttttagtcataa 5568 ALDH1A2 15 intron 1 + 4222 cataacttgtcagtcaaact A/G catgttaatagagaacttca 5569 ALDH1A2 16 intron 1 + 4254 aggacttcaggttttttttt T/&Dgr; aaatactttttcataactat 5570 ALDH1A2 17 intron 1 + 4397 cccttccactacatgggcct A/G tgttaccatgtgaaattatc 5571 ALDH1A2 18 intron 1 + 5935 aactccaggttgcaaataga T/C gtttctggtattttaagtag 5572 ALDH1A2 19 intron 1 + 6206 ttttgaaagcoctcctagca T/G ttctttaatttctttattga 5573 ALDH1A2 20 intron 1 + 9559 agataaattgatgaattatt C/T actctgtgctgctgatagat 5574 ALDH1A2 21 intron 1 + (9631-9632) taaaaagaatttctaaaaga (AAGA) ccttttttttgaataactct 5575 ALDH1A2 21 intron 1 + (9631-9632) taaaaagaatttctaaaaga ccttttttttgaataactct 5576 ALDH1A2 22 intron 1 + 12731 ctgaaatagaaacctttcag T/A gtaccttgcagagcagtgaa 5577 ALDH1A2 23 intron 1 + 13442 cagtgtcataaagatccaac G/A gaaatcaaaatatttcatat 5578 ALDH1A2 24 intron 1 + (14173-14176) tctaaaaaaataaataaata AAAA/&Dgr; gagaaaattaagtttaagat 5579 ALDH1A2 25 intron 1 + 14586 actcatttattggttcaaag C/G cttcttcaaccttaaaatat 5580 ALDH1A2 26 intron 1 + 14595 ttggttcaaagccttcttca A/G ccttaggatatgcattgagg 5581 ALDH1A2 27 intron 1 + 14711 gtttgagacattaacttcta A/G ttcaactaaagatgctagtt 5582 ALDH1A2 28 intron 1 + (15327-15337) aaagagcacagtagaaagac (T)9-11 aaccctagcaatactattga 5583 ALDH1A2 29 intron 1 + 17258 atcagtacaatgtgttgggc A/G tacaacacttaatttaaaat 5584 ALDH1A2 30 intron 1 + 18277 taatacaaatcatttgaagc A/G tttactattaaaaaaacaaa 5585 ALDH1A2 31 intron 1 + 18734 ctttgagcacctactgcatt T/A taagtgctgttaagatgtgg 5586 ALDH1A2 32 intron 1 + 19081 ttaatcacctcaatctttaa C/T gaatttcttgatttttcttt 5587 ALDH1A2 33 intron 1 + 21514 aatcaggatatggggggttc G/A ttctttattctgccacaaat 5588 ALDH1A2 34 intron 1 + 21732 cattttsaaatagtgcttta A/G taggacttggctgttaaagt 5589 ALDH1A2 35 intron 1 + 21865 tggcataggtttaaaaatgt C/T tgttgtaggactcttttcca 5590 ALDH1A2 36 intron 1 + 26282 taaagaaggagaaaaaaaaa A/&Dgr; ctaatctgagactttgcagg 5591 ALDH1A2 37 intron 1 + 27805 ggatgatgctaoccaaggaa T/C tgcacacttccagacagtac 5592 ALDH1A2 38 intron 1 + 28204 tcactccattttttaactgt C/G cttcctaaatgtgtggttaa 5593 ALDH1A2 39 intron 1 + 28521 tctttgttacacttcttaaa T/C cggggtatcagataatcttc 5594 ALDH1A2 40 intron 1 + 49478 gaataaaaggatagggacat G/T ggtaagaccactttttccct 5595 ALDH1A2 41 intron 1 + 49834 gcctctcaattttctcatgt G/T taatagagagaaaaccctgc 5596 ALDH1A2 42 intron 1 + 50351 gactgactggttcataagtt C/G agaaatttcactgtggtcct 5597 ALDH1A2 43 intron 1 + 51181 tgttattaccatagtagttc C/T gtaacacttggcccttgact 5598 ALDH1A2 44 intron 3 + 654 ttaacctctcttgagtaaaa G/A gaatccttcagaaccagagg 5599 ALDH1A2 45 intron 3 + 668 gtaaaaggaatccttcagaa C/T cagaggggatggtacggacc 5600 ALDH1A2 46 intron 3 + 712 catacacttctgctccgttt G/T ccctgtcattctgtgagcca 5601 ALDH1A2 47 intron 3 + 1273 tattcatactgtgaaaaagg T/A gtttcatggtgaagaaattc 5602 ALDH1A2 48 intron 3 + 1743 ccacacctaaatgagattcc C/T gttttaaacactctcaacct 5603 ALDH1A2 49 intron 3 + 2891 tgcacatatatactcattgt A/G gtttttactaggaactacac 5604 ALDH1A2 50 intron 3 + 2919 ctaggaactagaccaaactg G/A cagtactagaaatcttttta 5605 ALDH1A2 51 intron 3 + 3054 tggaaagttctggggactta G/C tatctctccatttctcttcc 5606 ALDH1A2 52 intron 4 + 290 cattgtgctagattaggtgc T/C ggggtaggtatgaaggggca 5607 ALDH1A2 53 intron 4 + 388 ctccttgccctcctgaaaca T/C ataagatctactctttggaa 5608 ALDH1A2 54 intron 4 + 461 gattatggctgattttcagt G/T tctttttaatatttttctct 5609 ALDH1A2 55 intron 4 + 506 tctatatttctcgaacggcc G/A tgaattactttcataatcta 5610 ALDH1A2 56 intron 4 + 1952 ttggtccccactccacctgt C/G atttcattattaaaacaaca 5611 ALDH1A2 57 intron 4 + 2079 ctctatttggcctaacggta C/T cttggttttcttttacttcc 5612 ALDH1A2 58 intron 4 + 2519 ttgggtcataagagctctct C/G catggtgtctcanacagatg 5613 ALDH1A2 59 intron 4 + (2840-2851) tttgtctctgcatacttggc (T)11-13 cacagtgaagtctggaatat 5614 ALDH1A2 60 intron 4 + 7231 aataggatacaaatacacaa A/T gatagtgattcagatcctaa 5615 ALDH1A2 61 intron 4 + 7958 taaaatcgtttttattgtta C/T taggtatataaaatttgcta 5616 ALDH1A2 62 intron 4 + 8090 tctgattttatcactgttta C/T agattgcttagtcatactca 5617 ALDH1A2 63 intron 4 + 12823 tgttagcctgtagctaaatg C/T ttttcaaatatgtgaacggt 5618 ALDH1A2 64 intron 4 + 12939 atgaggtccgacttttaaga T/C ttttgtctacattttcttcc 5619 ALDH1A2 65 intron 4 + 14935 tattgatggagttcttttta T/G aaatggacttttaccttctt 5620 ALDH1A2 66 intron 4 + 15321 gcatttgtgtgtctgagaga C/T atatccagaaatatgctatg 5621 ALDH1A2 67 intron 4 + 15412 tttcaagtttatttctgttt T/G tttttttttttttttttttg 5622 ALDH1A2 68 intron 5 + 1888 aatccaaacatctgtacttt G/T tagtggacaagatttatgtc 5623 ALDH1A2 69 intron 7 + 9166 gaaaagctactttattcaaa G/A ataaaagtattttaagaaaa 5624 ALDH1A2 70 intron 7 + 9914 aagctggagaaaatactagg C/T tttcctcaacagtgatttcc 5625 ALDH1A2 71 intron 7 + 18942 tttggaggggaactaatccc G/A tgacttctaggttatctctt 5626 ALDH1A2 72 intron 7 + 19820 ttcacccctcattttaggtt A/G ggggaggtggcttgctacag 5627 ALDH1A2 73 intron 7 + 19826 cctcattttaggttagggga G/A gtgtcttgctacagttttag 5628 ALDH1A2 74 intron 7 + 19913 cgtgaatcattcagtatttt A/G tttaaaaataccagtttgaa 5629 ALDH1A2 75 intron 7 + (20110-20111) catgatttattctctaacta (ACTA) tgctaagtcaaagattctgc 5630 ALDH1A2 75 intron 7 + (20110-20111) catgatttattctctaacta tgctaagtcaaagattctgc 5631 ALDH1A2 76 intron 7 + 21857 acaatgaaaattaagaaagg A/T gaagagggaagaagnagaga 5632 ALDH1A2 77 intron 7 + 21929 tacaagacacaggcatcttt A/G actagtttactgggatctct 5633 ALDH1A2 78 intron 7 + 23308 ggctttcacttcggaaacct G/T tgggttataacaaagtactg 5634 ALDH1A2 79 intron 7 + 23554 gacattggtgaaaaccaggg C/T tgtttaggagtgtcctgtcc 5635 ALDH1A2 80 intron 7 + (23701-23703) catctgagatttgccttgtg GTG/&Dgr; tttaccgagttagtgggtgc 5636 ALDH1A2 81 intron 7 + 26479 gatacatgaacaatttgttt T/C atcctcatgatatctttcaa 5637 ALDH1A2 82 intron 7 + 26561 taaaggccacaatgcagtga T/C tgaaatctccagttacattt 5638 ALDH1A2 83 intron 7 + 26662 tttccttagtccttccatca C/T gaaactaaagctgtcttcca 5639 ALDH1A2 84 intron 8 + 76 tttatatctccacttttgat G/A ggacactagcaaaagatatt 5640 ALDH1A2 85 intron 8 + (700-711) accatctcattcagtgattc (T)11-12 ccctccacttgttgccaggc 5641 ALDH1A2 86 intron 8 + 724 ttttttttccctccacttgt T/C gccaggcagagctgctttcc 5642 ALDH1A2 87 intron 8 + 800 cagattgcttgaatttcagc C/A ccagcttggaatttgcagag 5643 ALDH1A2 88 intron 8 + 1251 gatttctgtgaaaattgaga G/A gatctggcaacctggggctc 5644 ALDH1A2 89 intron 8 + 1627 ggcccctccccaggcaaagc G/A gtgagaacatggctgtttcc 5645 ALDH1A2 90 exon 9 + 141 tggagcgggccaagaggcgc G/A tagtggggagtccctttgac 5646 ALDH1A2 91 intron 9 + 778 aaccagtctggacagatccc T/C tgtagcttgtgaaagtgtag 5647 ALDH1A2 92 intron 9 + 801 tagcttgtgaaagtgtagga A/G gtgaagggctggctcacttc 5648 ALDH1A2 93 intron 9 + 868 tctgaaggcctcgtgtactt T/C agtggggtggggagggccac 5649 ALDH1A2 94 intron 9 + 1338 aatttttgcctctttttact A/G tcaatacaacttgctaagtt 5650 ALDH1A2 95 intron 10 + (227-229) ctatgtgcttatgattatta TTA/&Dgr; gccaacagaacaatcagaat 5651 ALDH1A2 96 intron 10 + 316 ctaaatgtcggtcactggga T/C gttaaccaggatagagaatc 5652 ALDH1A2 97 intron 10 + 368 ctttacatctctgcaagaga G/A ggacaaggagcaaatcagcc 5653 ALDH1A2 98 intron 10 + 660 gtaaacttgcattgaaatgt G/A gaaagcaggtaaaggaatca 5654 ALDH1A2 99 intron 11 + 104 tggggaataccaaaagcaac C/T aaagttcaccagaaaagggg 5655 ALDH1A2 100 intron 11 + 229 aaacttctaaaagaaatacc A/G tgccagtcagatiatgtgct 5656 ALDH1A2 101 intron 12 + 117 catacattcaacaaacattt C/T gtggagcacatgctactata 5657 ALDH1A2 102 intron 12 + 691 gatagggaagatcactgtga A/G ctggaaaaatctcggaaacc 5658 ALDH1A2 103 intron 12 + 1934 catcttgtctagattgcatg T/C ttgtttgtttgtttgtctct 5659 ALDH1A2 104 intron 12 + 1973 ctacttacccccaaaacatg T/A tttctctttcttaaatgacc 5660 ALDH1A2 105 intron 12 + 2722 ccagagtgactccagtatac C/A tcactgcccaggacccacag 5661 ALDH1A2 106 intron 12 + 3855 cacttgaaagcaaccataat T/C gtgaggtttctgatgctgtg 5662 ALDH1A2 107 intron 12 + 4185 ttgctttaagcgaaatgaac T/C atacggacaggagaacaggc 5663 ALDH1A2 108 intron 12 + 4991 acaggaacacttagacatgc A/G acccactcccaccctccgtc 5664 ALDH1A2 109 intron 12 + (5018-5019) cccaccctccgtcttggggg (G) aggaaagcacactactgtcc 5665 ALDH1A2 109 intron 12 + (5018-5019) cccaccctccgtcttggggg aggaaagcacactactgtcc 5666 ALDH1A2 110 intron 12 + (5051-5052) actgtcccaaagaactaata (A) ctgaaccagtgctgccttgt 5667 ALDH1A2 110 intron 12 + (5051-5052) actgtcccaaagaactaata ctgaaccagtgctgccttgt 5668 ALDH1A2 111 intron 12 + (5300-5302) ttaaagttttaaaaaaactt CCT/&Dgr; taaaaactactcatgagatg 5669 ALDH1A2 112 intron 12 + 5405 catcccaggacttgctgttc G/C caggtgataaactgcacctc 5670 ALDH1A2 113 intron 12 + 5435 aactgcacctccccaggact C/A ccgctgcactcacatgcagc 5671 ALDH1A2 114 3′flanking + 449 tttgggccgggaacaatttt T/C caaggttgtaaagccaaatt 5672 ALDH1A2 115 3′flanking + 597 acctgggatattcctgaccc A/C atctggttttcttttaccca 5673 ALDH1A2 116 3′flanking + 669 atagagactggaagtcatca T/C gtgcagttcaccgcttctga 5674 ALDH1A2 117 3′flanking + 1122 cgtgctccactgagctcctc T/G gtcacaccccattcttgccc 5675 ALDH1A2 118 3′flanking + 2214 tgcagctgtaaaaagaaatc T/C gtaaatggtgaccgtactac 5676 ALDH1A3 1 5′flanking − 1425 cagtgttagccagccgatat C/T ggtcaaggctgccccgctcg 5677 ALDH1A3 2 5′flanking − 1379 ccattatcccctttccccgg C/T ctcagctgtgcactccaggc 5678 ALDH1A3 3 5′flanking − 1270 aacttacccctctatccagc T/A ctatccagaaggacaccagg 5679 ALDH1A3 4 5′flanking − (1214-1213) acggaggcctcaaaacagga (GGA) aaataagcagacccctcccc 5680 ALDH1A3 4 5′flanking − (1214-1213) acggacgcctcaaaacagga aaataaggagacccctcccc 5681 ALDH1A3 5 5′flacking − 1103 gcacagcttttgtcaggagt C/T cgtgcctccggtctttgttc 5682 ALDH1A3 6 intron 1 + 986 gccttaactttccccacctt T/G ggcttctcttgatttttgct 5683 ALDH1A3 7 intron 1 + 1462 gtacaggatttcaaaatact G/A tatatagaaaccagacagta 5684 ALDH1A3 8 intron 1 + 1661 cctgttgtcttggtcggtgc G/A cascctttgccagttaaagg 5685 ALDH1A3 9 intron 1 + 2360 agaggatagaagtcccttct A/G atttagagggcctctttctt 5686 ALDH1A3 10 intron 1 + 2516 tgaaaacatattctttttga G/A tttagctgagtggcctgttg 5687 ALDH1A3 11 intron 1 + 2624 cctgagacaccttacagctc C/T gtcctgcttccatgtcattc 5688 ALDH1A3 12 intron 1 + 3255 tttcatctttctacaaatgg G/C cccctcttcctggctgcact 5689 ALDH1A3 13 intron 1 + (3643-3656) gcttcagaggtttttgtggg (T)12-14 aacattctatcaacttttaa 5690 ALDH1A3 14 intron 1 + 4265 ccaaaagccctctcttttaa T/C atgacattaataagacaatt 5691 ALDH1A3 15 intron 1 + 5187 caagatggataagacgtcac C/T taaggtccttagcatgttga 5692 ALDH1A3 16 intron 2 + 43 ctctaagtaattcaattatg G/T atgaccaaaggataacgaaa 5693 ALDH1A3 17 intron 2 + 127 cagggcctgggctagctgcg T/C gaattggcatgtggttctca 5694 ALDH1A3 18 intron 2 + (285-300) aggaaaggttttcttttttc (T)16-17 atcaattatttggacctgga 5695 ALDH1A3 19 intron 2 + 770 cgtgtgcagagtaggcttgg A/G ttttatcttgcccatgagtt 5696 ALDH1A3 20 intron 2 + 1216 actcggtagagtcactcctg A/C ctggtgtcccacatccactc 5697 ALDH1A3 21 intron 3 + 81 accatggggtatgggaaaaa A/C gatcacggtcctggttttct 5698 ALDH1A3 22 intron 3 + 236 gctcagcttcttgaccaact T/G gttgtctataggcagttgag 5699 ALDH1A3 23 intron 3 + 1467 ggcccggttgtaggggagga G/T atctcctttctggcctttgc 5700 ALDH1A3 24 intron 3 + 1725 ccacatgttccccgggtgag A/G gtagctccctcccaggctaa 5701 ALDH1A3 25 intron 3 + 3777 gccagaagtagatcccccca A/G ttcagctgctgcattactcg 5702 ALDH1A3 26 intron 3 + 3829 caagtcactgggcccttagc G/C tccgtgcctgcaccttgaag 5703 ALDH1A3 27 intron 3 + 4299 tcactttccacagccacact G/A gccagcctccccgagaagga 5704 ALDH1A3 28 intron 4 + 84 agagccccccctgactgttt C/G cctaaggcaccattcccaac 5705 ALDH1A3 29 intron 4 + 126 ccactccctctccaaatggt A/G ctgccaattcttcttctaag 5706 ALDH1A3 30 intron 6 + (290-291) tagagaattttcaggggggg (G) tcaaccaagagggagccaaa 5707 ALDH1A3 30 intron 6 + (290-291) tagagaattttcacgccggg tcaaccaagagggagccaaa 5708 ALDH1A3 31 intron 6 + 705 aacagctggtgatgagccaa T/G tttccactttcctttgctga 5709 ALDH1A3 32 intron 7 + 56 ggggcgtgttatttcacacc C/T gtcagcttttcctttgacag 5710 ALDH1A3 33 intron 7 + 1107 gatgctgttactctccttcc A/G gacagacactgccctgtgga 5711 ALDH1A3 34 intron 7 + 1610 aagagccacacagaaccacc C/G ccctactgggctgttggaat 5712 ALDH1A3 35 intron 7 + 1820 cacctgtaagtggagcggct T/C agaccaaggatcccaggatc 5713 ALDH1A3 36 intron 8 + 963 gagaaaggacaggaggagga C/T acaggctctcaggaaggaaa 5714 ALDH1A3 37 intron 8 + 1824 accattcttatccactaagc G/A tgtcccccaagatcttattc 5715 ALDH1A3 38 intron 8 + 2384 cgcctccctcgccccctccc C/A tccagtggacttggcagtgg 5716 ALDH1A3 39 intron 9 + 24 atccccctggtgtgtgtgaa A/C ccatggtgcttgtctagggg 5717 ALDH1A3 40 intron 9 + 91 gcctacagggtccctctccg T/C gaaaggaatgctgacctgtc 5718 ALDH1A3 41 intron 9 + 219 actgaggcatgggaggaggg C/G gctattcccagggcagaagg 5719 ALDH1A3 42 intron 9 + 435 ccagacggagagagcctggg G/A caggagaatgtatctccacc 5720 ALDH1A3 43 intron 9 + 1472 ttcacttttgaggccagata C/T accgatttcttccaagagaa 5721 ALDH1A3 44 intron 9 + 2038 taaacaatgtgttcctacgg G/A ctctccagggagtgtggact 5722 ALDH1A3 45 intron 9 + 2124 caaacagggtctgccagatg G/A catatgcccagcagccaggg 5723 ALDH1A3 46 intron 9 + 2154 agcagccagggaggacgtgc G/C gttgggcgaagcccctgtgt 5724 ALDH1A3 47 intron 9 + 2197 cttttggcccctcagggagg G/A gaagagcagctcagcagcat 5725 ALDH1A3 48 intron 9 + 2466 ttcttagttcctcatgtttc C/T ctctagaatgttttcgtgtg 5726 ALDH1A3 49 intron 9 + 3655 gattggtcaagtggcatgca C/T ggtttatgccctctctcctg 5727 ALDH1A3 50 intron 9 + 3954 gggtgcgcttttgacaactg C/G tcagtagcgtgttcacaagc 5728 ALDH1A3 51 exon 10 + 88 tggaatgcgggggctcagcc A/C tggaagacaagsggctcttc 5729 ALDH1A3 52 intron 18 + 8 tgccaaagaggaggtacaag G/A gggctgtggcaaggctacga 5730 ALDH1A3 53 intron 10 + 307 ctctctgattttctaacaca A/C ccggtccccgagtcagtcat 5731 ALDH1A3 54 intron 10 + 378 gtgggttttgccaggaatca G/A ttcaagaacctgtggattca 5732 ALDH1A3 55 intron 10 + 975 aatattgtgtcattccttcc C/G ctggtagttattatggaaac 5733 ALDH1A3 56 intron 10 + 1088 cagtgccaggagccaggggg C/T cttctccagatgaccttgag 5734 ALDH1A3 57 intron 11 + 105 ttgtctacattgtatattat A/G taccaagccctgtctcagtg 5735 ALDH1A3 55 intron 11 + 274 agggctccagtacctgtgcc T/G gtggcccctgtgctgtactg 5736 ALDH1A3 59 intron 11 + 1088 cagtgccaggagccaggggg T/A cttctccagatgaccttgag 5737 ALDH1A3 60 intron 12 + 96 ctccaatgtgctgagacccc G/A tcccccccacaccgccgctc 5738 ALDH1A3 61 intron 12 + 1537 gggccttggttggggccttt G/T tgtggctctcttttgagatt 5739 ALDH1A3 62 intron 12 + 1660 gtccccctcccacctcagtc C/&Dgr;10 tgctttgtagtccatccgtg 5740 ALDH1A3 63 intron 12 + 5642 tctgtgctaacgtctgcttc T/C ctcatgccccctaggctggc 5741 ALDH1A3 64 exon 13 + 104 gggctccttcctcaaacatc G/C gacggcggaatgtggcagat 5742 ALDH1A3 65 exon 13 + 281 ataggttgtctgtgaaatcg C/T agtcctgcctggggagggag 5743 ALDH1A3 66 3′flanking + 743 gtgagcaggaaactgtagga G/A aaggatattttccctcattt 5744 ALDH1A3 67 3′flanking + 1145 gcctcccagctaccccaccc A/G cctcaggaggggtcattcca 5745 ALDH1A3 68 3′flanking + 1185 aacctagggtgctgagaatc T/C gggtgggattaccagcaaaa 5746 ALDH1A3 69 3′flanking + 1600 acaccacgccctgcaaattg T/C tgggaacttgtcggtggcaa 5747 ALDH1A3 70 3′flanking + 1847 caggagccctgcggctgcgg C/G ggttctgtgaaatggcagtg 5748 ALDH1B1 1 intron 1 + 134 cgttgcactgtaggactcct C/T ccacgtcccctaatcccatc 5749 ALDH1B1 2 intron 1 + 367 gcagttcccgcggatagaga A/G ggtccggtccttcgggctgt 5750 ALDH1B1 3 intron 1 + 405 tgtgggtgaactgtaaaaaa C/T tgcctgtattcaggaggata 5751 ALDH1B1 4 intron 1 + 2002 cttcaactaatctgggaaca C/T tacactctgtttaattttca 5752 ALDH1B1 5 intron 1 + 2157 tgggaaagctgaeaagggat G/T ctgagacctgtggttggggg 5753 ALDH1B1 6 exon 2 + 192 ccgacggtcaaccctaccac T/C ggggaggtcattgggcacgt 5754 ALDH1B1 7 exon 2 + 265 cgtgaaagcagcgggggaag C/T cttccgcctggggtccccat 5755 ALDH1B1 8 exon 2 + 329 gcggggccggctgctgaacc G/T cctggcagacctagtggagc 5756 ALDH1B1 9 exon 2 + 614 acttgccccggcactcgcca C/T aggcaacactgtggttatga 5757 ALDH1B1 10 3′flanking + 168 aaagtgcaactgtaagaccc G/A tagagaaaaactctggttcc 5758 ALDH1L1 1 intron 1 + 252 cgcagcgccaggagtggccc G/C ccgaggatctggccggccgc 5759 ALDH1L1 2 intron 1 + 544 ctcaggggctgcgctggagt C/T ccagctccagccactgcgct 5760 ALDH1L1 3 intron 1 − 6596 cagatttttcttaaggtgca C/G tagccactgaggatattttt 5761 ALDH1L1 4 intron 1 − 6513 caattatggtttatcttagg G/A acatgtttatagagatagta 5762 ALDH1L1 5 intron 1 − 6478 atagtattcttacttagctt G/A cattctaaattttgttccct 5763 ALDH1L1 6 intron 3 + 240 gtggcattagggtcctggag A/G agggctatagagaagcccag 5764 ALDH1L1 7 intron 2 + 1326 gaggaggagaccggagagga G/C agccagtccagtcagggccc 5765 ALDH1L1 8 intron 3 + 386 gtcctactctaacttccact G/A ccgctgctctgggcagcaca 5766 ALDH1L1 9 intron 4 + 271 gggcccgttcaatagacaag G/C aaggctaaaggcagggagtg 5767 ALDH1L1 10 intron 4 + 356 taggattctatttctctctc C/T ttcactcgttgattctcctt 5768 ALDH1L1 11 intron 4 + 608 gtgctctgataggctgtctc A/C gtcacatgcttcctgctggg 5769 ALDH1L1 12 intron 4 + 664 ggtcacatggcctgagcggc A/G gggcggctcagtcacctccc 5770 ALDH1L1 13 intron 4 + 785 gaggctggcttgcccctgcc C/G gaggacaggctggcagggac 5771 ALDH1L1 14 intron 4 + 874 ccctggggagcccttgctgt T/G tgggcgcagcaggaagagca 5772 ALDH1L1 15 intron 4 + 1349 tccctcaggctcttgctcac G/A tgggcccagacctcttggct 5773 ALDH1L1 16 intron 4 + 1799 gtggggctgggaaggaggca G/A ggtcctattgctggggatag 5774 ALDH1L1 17 intron 4 + 1815 ggcagggtcctattgctggg G/A atagcaacccactggatctc 5775 ALDH1L1 18 intron 5 + 272 aaagcccacagggagataag A/G gtgggagttagggggcaaaa 5776 ALDH1L1 19 intron 5 + 301 tagggggcaaaacgtccgcc G/A tagtgcgagcagtcttcaag 5777 ALDH1L1 20 intron 5 + 343 caaggtstgagggacagtgc G/A ggtctctggagcaatagcca 5778 ALDH1L1 21 intron 6 + 926 cctgcctgggctagtggctt C/T gggggcttcttctcacccac 5779 ALDH1L1 22 exon 7 + 41 aacgctgaacacttcaggcc T/C ggtgcccgagsgagacgctt 5780 ALDH1L1 23 intron 7 + 305 cctagaatcagagagaagcc C/T tcccagggagcctgggttca 5781 ALDH1L1 24 intron 7 + 837 gtcnggacaaaccccatggg C/T gtggtacccccagccgtgtt 5782 ALDH1L1 25 intron 7 + 866 cccagccgtgttgctgtgtc C/T gccctaccagagtgaggcgt 5783 ALDH1L1 26 intron 7 + 884 tccggcctaccagagtgagg C/T gtggcagtatggggcctggc 5784 ALDH1L1 27 intron 7 + 1118 aatgttccagaaaatcatgc G/C agccagtaagggcagaggaa 5785 ALDH1L1 28 intron 7 + 1168 aaagtaaaggttcaggagaa G/A tctagcctggggctgctccc 5786 ALDH1L1 29 intron 7 + 1451 cagggcacccacagcatgtg T/C ccagagacctgcaaagacag 5787 ALDH1L1 30 intron 7 + 1489 caggaatgcaaagaaggcaa T/C taagtgtcttaagaggaagc 5788 ALDH1L1 31 intron 7 + 1579 tcagggtgggaggggagtga G/A gagagaccagctgagcacac 5789 ALDH1L1 32 intron 7 + 1691 ctggctgggctttagcttgc A/C gaaagctccagaacatcttt 5790 ALDH1L1 33 intron 8 + 1632 tcaggtttgcatttgttcac T/C gtgcacattcagagttccac 5791 ALDH1L1 34 intron 8 + 1799 gctcaagtcctcctctagct G/C ttcaccgtgcagccccctaa 5792 ALDH1L1 35 intron 8 + 1986 ggtggaggggcctggcctgt G/T gctgttcaggagaacgctcc 5793 ALDH1L1 36 intron 8 + 2002 ctgtggctgttcaggagaac A/G ctccaagagcctgctgtggg 5794 ALDH1L1 37 intron 8 + 2627 aaagaggagagcggggggtg C/T ttgtgccaggggttggggga 5795 ALDH1L1 38 intron 8 + 2646 gcttgtgccaggggttgggg G/A aactggttctgattgggcct 5796 ALDH1L1 39 intron 8 + 2925 ctgctgccctccataggtcc C/G agactgaatccttcagagga 5797 ALDH1L1 40 exon 9 + 4 caggtcttgctttgcagagt G/T tttggcagcggatcctcccc 5798 ALDH1L1 41 exon 10 + 109 cagctgttagtgaggaagct G/T cgaggggacgataaggaggg 5799 ALDH1L1 42 intron 10 + (671-672) tggcattttcctctgtgtga (AG) gtcctcttagcccaccctaa 5800 ALDH1L1 42 intron 10 + (671-672) tggcattttcctctgtctga gtcctcttagcccaccctaa 5801 ALDH1L1 43 intron 11 + 8 caccgatggaagtgtgagtg C/A aggcccagcaccccttctcc 5802 ALDH1L1 44 intron 11 + 447 atgagccaaagcacgcctat G/A gtagatacacacgtgaacat 5803 ALDH1L1 45 intron 11 + 601 ctcaaaatgagtcatttgag A/G ggagttaatgaaagactcat 5804 ALDH1L1 46 intron 11 + 639 catctgcaaagggagaggga G/A ggggtagggacacagacagg 5805 ALDH1L1 47 intron 12 + 66 ctgggcagtggcacggggag G/&Dgr; acttctgtggaggccctttt 5806 ALDH1L1 48 intron 12 + 478 ctattaaaaaaaaaaaaaaa A/&Dgr; tttaagccagggagaaaggg 5807 ALDH1L1 49 intron 12 + 684 tcctgggagaagagagggtg C/T ggccagatgagccgagaaca 5808 ALDH1L1 50 intron 12 + 767 cgtctaggggtaggaagaca A/G gttatggcgtggtcccaacg 5809 ALDH1L1 51 intron 12 + 1014 tcataggttccagtcccctt C/T gaaagccccctaattctaga 5810 ALDH1L1 52 intron 12 + 1359 ctggttctgcctcagctcag C/T acagcagaggataggtctag 5811 ALDH1L1 53 intron 12 + 1734 ggtggtccaggctgctggtg G/T taagtagggcgggcggagcc 5812 ALDH1L1 54 intron 12 + 1901 ttcagcagcctaagtgaatt G/A acaatagaatagtcctgcaa 5813 ALDH1L1 55 intron 12 − 470 gggatggggccacatctcca T/C ctctggagatgccaggctca 5814 ALDH1L1 56 intron 12 − 334 aagggcagcctcttgggcca T/C gacccctttgctgtctgcag 5815 ALDH1L1 57 intron 12 − 325 atcttgggccatgacaaatt T/C gctgtctgcagcaagtgggt 5816 ALDH1L1 58 intron 12 − 221 gaaggaagcgagggaagatc G/C aggaaaggagagagggacag 5817 ALDH1L1 59 intron 12 − 4 cccgcttcccctcaccctgg T/C gcaattggcagatctcatcg 5818 ALDH1L1 60 intron 13 + 34 tcccaggcagtgtgagcaca T/C gcagactggaccagccatat 5819 ALDH1L1 61 intron 13 + 58 gaatggcccagccatatagg A/G gaactaaaagggcagcacag 5820 ALDH1L1 62 intron 13 + 125 ccaaaactggtggcttggaa T/C gaaaaatgtttattagcttg 5821 ALDH1L1 63 intron 13 + 126 cacaaatggtggattggaat G/A aaacctgtttattagattgt 5822 ALDH1L1 64 intron 13 + 281 acctgcatccagacgagtta T/G ggtgttgacagagttcagtt 5823 ALDH1L1 65 intron 13 + 299 tcgggtgttgacagagttca A/G ttccgtgtggatgcagggct 5824 ALDH1L1 66 intron 14 + 121 catttatcaaacagccatac A/G tgtgcttcttgagcacctgc 5825 ALDH1L1 67 intron 14 + 167 gccaggcattgttgtaagga C/T ttgaggacaattgtatttaa 5826 ALDH1L1 68 intron 14 + 205 taatctcccagtaacactgg A/C tcagtaaggtccacggtggg 5827 ALDH1L1 69 intron 14 + 219 cactggatcagtcaggtcca C/G ggtgggaaacaagagtaaac 5828 ALDH1L1 70 intron 14 + 2275 tctcatctgtgatgcataag T/C cagaaatctgctcccagcat 5829 ALDH1L1 71 intron 14 + 2431 agaatgactgagtgatgaga C/G ctagagagccccagcccagg 5830 ALDH1L1 72 intron 14 + 2660 agccaagcatttcttgggga C/T accaagaaaccttgcttggt 5831 ALDH1L1 73 intron 14 + 2740 aactccaccctcaccgtccg T/C gcagctccccaggagcgtca 5832 ALDH1L1 74 intron 14 + 2756 tcaatgaagatccccaggag T/C gtcagagggaagaggagggg 5833 ALDH1L1 75 intron 14 + 2805 ccgaacagcaggagaatgga T/C ccaagggagggagggaaggg 5834 ALDH1L1 76 intron 14 + (3636-3637) tctcctgggtgtgtgtgggg (G) tgtggggcagctcccctatc 5835 ALDH1L1 76 intron 14 + (3636-3637) tctcctgggtgtgtgtgggg tgtggggcagctcccctctc 5836 ALDH1L1 77 intron 14 + 4347 tacaggacagaaacagcagg C/T gtgagctgactctaagaggg 5837 ALDH1L1 78 intron 15 + 380 atgtcccttatgtcgcttca A/G agaacagaagtactggagag 5838 ALDH1L1 79 intron 15 + (1055-1056) gccacaatctgcagctactc (C) tcccagcttgctgctgggct 5839 ALDH1L1 79 intron 15 + (1055-1056) gccacagtctgaagctacta tcccagcttgctgctgggct 5840 ALDH1L1 80 intron 17 + 15 gaaaaggtgagtggctgggg G/C tggagcagaggaggggctgc 5841 ALDH1L1 81 intron 17 + 44 aggaggggctgctgtgagtg C/T gcctgggacatggcagtgat 5842 ALDH1L1 82 intron 17 + 51 gctgctgtgagtgcgcctgg G/A acatggcagtgctgtccaca 5843 ALDH1L1 83 intron 17 − (2224-2223) atggtgtaatctcccagaat CT/&Dgr; gtaaataaaaaaaaatatga 5844 ALDH1L1 84 intron 19 + 140 agcgtcatcacaagcatagc G/A tggcaggcagcaggcttagg 5845 ALDH1L1 85 intron 19 + (51-52) tggttcactgggacagcagc GC/&Dgr; ctggctggagggggttggag 5846 ALDH1L1 86 intron 19 + 399 tcaggtcagcctgggcctga C/A catggacaggggccctggag 5847 ALDH1L1 87 intron 19 + 608 caaccagatttatccaatca A/G ccacacctggaagagcaggc 5848 ALDH1L1 88 intron 19 + (669-670) atgggccatcctgagtccgc (C) ttgggaggtttgtaatccct 5849 ALDH1L1 88 intron 19 + (669-670) atgggccataatgagtccac ttgggaggtttgtaatgcct 5850 ALDH1L1 89 intron 19 + 1794 gtcctgtctgggggtcttaa G/C ggagtaatgagaattccaca 5851 ALDH1L1 90 intron 19 + 1969 tgatcggggtgcggtttggg G/T cgacaggacaggagaagaga 5852 ALDH1L1 91 intron 19 + 1972 tcggggtgcggtttggggcg A/G caggacaggagaagagaata 5853 ALDH1L1 92 intron 19 + 2083 tgagaagagcagaggggtgt G/T ccgggtgctcgagtcacacc 5854 ALDH1L1 93 intron 19 + 2119 acacctgtgtctgattaggg C/T tgattaggggtgcagagttt 5855 ALDH1L1 94 intron 20 + 1388 ttaccctcttcccacctccg C/T tggactgtgagttccatgag 5856 ALDH1L1 95 intron 20 + 1564 cccaggaaccaggaacagtg G/A ggagccatgacccggccctg 5857 ALDH1L1 96 intron 20 + 1873 taagtgttaaaacatcattt G/A tgtatgtatgaaaaatattg 5858 ALDH1L1 97 intron 20 + 2427 aataggattggatggacttg G/C gatcaggtctcagctctgtc 5859 ALDH1L1 98 intron 20 + 2458 cagctctgtcacctgccaac C/T ggcggccccatttccatcaa 5860 ALDH1L1 99 intron 20 + 2544 ccaggtgggagagaaatatg C/T agcgtggtgacacccatcac 5861 ALDH1L1 100 intron 20 + 2573 gacacccatcacacgggtgc C/T gtgacccggtgcttatgtcg 5862 ALDH1L1 101 intron 20 + 2574 acacccatcacacgggtgcc G/A tgacccggtgcttatgtcgg 5863 ALDH1L1 102 intron 21 + 33 agccacctgttttcacagac G/A tggaagaccacatgttcata 5864 ALDH1L1 103 exon 21 + 87 ccttcgggcctgtcatgatc A/G tctctcggtttgctcatggg 5865 ALDH1L1 104 intron 21 + 323 ccatgcattaaaccaccccc C/G acactgagtcgcttggaata 5866 ALDH1L1 105 intron 21 + 361 ataatcagagatttatttta C/G tcacggtctaggttcaatga 5867 ALDH1L1 106 intron 21 + 478 gtcttccgcgaggcttcctc C/A gcctggcagcctcccggttg 5868 ALDH1L1 107 intron 23 + 1086 caacccaatcttccccccgg C/T gctgcagccccgcacatttt 5869 ALDH1L1 108 intron 22 + 235 gggcctgcacgacacactcc A/C gccaggaggcactgggggcc 5870 ALDH1L1 109 intron 22 + 313 atagaagggagcacttgccc G/A tgaagacccaggggcccgtg 5871 ALDH1L1 110 intron 22 + 1214 tgggcccacttatgaatcct G/C cccgagttccctcagctccc 5872 ALDH1L1 111 intron 22 + 1226 tgaatcctcccggacttccc T/C cagctccctcctaaccctag 5873 ALDH1L1 112 intron 22 + 1623 ggggcttcccactgtccaga C/G aaggcggtgggagctgggga 5874 ALDH1L1 113 intron 22 + 1688 attctggggagtcctggccc A/G ctatccactgccagggataa 5875 ALDH1L1 114 3′flanking + 145 gagagacaggacgaaatggg C/T gtgggtcatctcggccccca 5876 ALDH1L1 115 3′flanking + 239 tgggaaacaggtgggaagac G/A gggattgagctgggtgagcc 5877 ALDH1L1 116 3′flanking + 288 ggaagcagctcagactccct C/T agcagatggccccggcccct 5878 ALDH1L1 117 3′flanking + 1513 agggtcgcctcagaccccgg A/C gtgctcctgccatgtccagc 5879 ALDH1L1 118 3′flanking + 1707 cggtgccccttgccctagca C/T gtgccacttatatcagaaca 5880 ALDH1L1 119 3′flanking + 1709 gtgggacttgccctagcacg C/T gccacttataccagaacaga 5881 ALDH1L1 120 3′flanking + 1745 acagatgagtccatgtcaac C/T gcttcctgagttccctttgt 5882 ALDH1L1 121 3′flanking + 1843 ctgcctctcagcccacaccc G/A ggccgctcacactcctccca 5883 ALDH2 1 intron 3 + 1766 aaattggtggctcatcctgc C/&Dgr; tggcccccggtccccgcggc 5884 ALDH2 2 intron 8 + 52 gaaggtagccctccccacct G/C tgttgtcgctccagccgatc 5885 ALDH2 3 intron 8 + 69 cctgtgttgtccctccaccc G/A accctgtcgcccccccggtg 5886 ALDH2 4 intron 9 + 5197 gctttcttatgaccttggtc C/A attccccagctgtcgggccg 5887 ALDH2 5 intron 11 + 114 gagctgggctcagtttctcc T/C gggtcagggtgtgaggtcga 5888 ALDH2 6 3′flanking + 411 ggatatgatctctgcccctc T/C tctgctgtgggcaaacagct 5889 ALDH2 7 3′flanking + (432-433) tctgctgtgggtaaacagct TC/&Dgr; tgtttcatgcatttactttt 5890 ALDH2 8 3′flanking + 488 ccaataagaatgtgcttgaa G/T gcttcaggcacccaaccggt 5891 ALDH3A1 1 5′flanking − 758 ctgcaggcgggtgagggtgg C/A gggaagcgcctggtgagagg 5892 ALDH3A1 2 5′flanking − 308 agtccccaaagctggaagag C/T cccatgccaggctgaatcaa 5893 ALDH3A1 3 5′flanking − 294 gaagagctccatgccaggct G/A aatcaatcagcagcccccac 5894 ALDH3A1 4 5′flanking − 3 gtcccctcttggctcttgcc G/A ctccaggagncccagttacc 5895 ALDH3A1 8 intron 1 + 2323 actgtctcctttctttcgga C/T ctttgcgatgtttacaatac 5896 ALDH3A1 6 intron 1 + 2499 cccgatttgccactatactt T/C cgtgtattcctagcaggaat 5897 ALDH3A1 7 intron 1 + 2943 caggggctaccaaggcaccc A/G gggcccacgcgtctgagtga 5898 ALDH3A1 8 intron 5 + 72 cacacatgactgcacctaat G/C ccgtgggtccactctgagta 5899 ALDH3A1 9 intron 7 + 633 cgcgtgggggtctctgcgcc G/A tccaactctggcttgtttcc 5900 ALDH3A1 10 exon 8 + 36 cggacgtggacccccagtcc C/G cggtgatgcaagaggagatc 5901 ALDH3A1 11 intron 9 + (40-41) gcggcccccctctgggcccc (C) agggcggggcacactcaccc 5902 ALDH3A1 11 intron 9 + (40-41) gcggcctccctctgggcccc agggctgggcacactcaccc 5903 ALDH3A1 12 intron 9 + 322 cacagtgtggatgccctggg G/&Dgr; acaccctagacattggccac 5904 ALDH3A2 1 intron 1 + 39 gggtgtggggaaacgggccc C/T cgccgcgcactcgtccactg 5905 ALDH3A2 2 intron 3 + 2491 tgccgcgaagaaaccggcac T/A gctgagttccacaggcagct 5906 ALDH3A2 3 intron 3 + 2595 ttctgtacatcaacttgtga T/A ggattgaggccagctctcct 5907 ALDH3A2 4 intron 3 + 2775 taccgctttgcccctgacca G/A gggcaaactcttcaataact 5908 ALDH3A2 5 intron 3 + 3424 aggcacttctgcacacaccc G/A cgcctcaggcatttcccctg 5909 ALDH3A2 6 intron 3 + 3676 atgttgaagagattcctgat G/A ttagacgttaggattcattt 5910 ALDH3A2 7 intron 4 + 481 tagaaaataagaggtttcac G/T ttctctctgctaaatccggt 5911 ALDH3A2 8 intron 4 + 769 acccggctttatacctgaac G/A tcttgcaggcagagccaaaa 5912 ALDH3A2 9 intron 4 + 796 aggcagagccaaaagccaca A/G ccaggagagtctgtaccgaa 5913 ALDH3A2 10 intron 5 + 254 attagttgtggcatatactt T/G tttcaaaaaagttaaataat 5914 ALDH3A2 11 intron 6 + 137 aatcctgctttctggtatac T/C gtacctgtagcttttgttat 5915 ALDH3A2 12 intron 6 + 923 aggcgaatgaatggcaagag G/A aaggggctatcctgattagc 5916 ALDH3A2 13 intron 7 + 331 tgctcttttctgatgaatcc A/&Dgr; cacggcattgctgaataaca 5917 ALDH3A2 14 intron 8 + 643 tttagaacatgacctgcctg C/T ctctcccacatgtcagatga 5918 ALDH3A2 15 intron 8 + 666 ctcccacaggtgagatgact G/A actcagctctttatttctcc 5919 ALDH3A2 16 intron 9 + 2129 tgttttcatttttaaaaaaa G/T gtttgactttggaattcatg 5920 ALDH3A2 17 exon 10 + (1894-1895) ttggcttgtctactaataca CA/&Dgr; tctgcttcaaaatgaacaca 5921 ALDH3A2 18 3′flanking + 31 gtaggtgtcaactttttttt T/&Dgr; ctcattttaaaattcttagc 5922 ALDH3A2 19 3′flanking + 106 gtgtgttggccgtggtggtt G/A gcagctatagtaaataggtt 5923 ALDH3A2 28 3′flanking + 1630 aaaagcacgtgcgaaacaca A/G ttaatcatgtcttaccgtat 5924 ALDH3B1 1 5′flanking − 1485 cggcctgtccacacccacac C/T agcttgaacctcatccccac 5925 ALDH3B1 2 intron 1 + 464 catgaatgactctgggaaag A/G atcattcttagcaatggact 5926 ALDH3B1 3 intron 1 + 2269 aaatggaatccaaacagcaa G/C agacctcccctcaccggtca 5927 ALDH3B1 4 intron 2 + 1349 actgagcttctgccaccggc C/T gcctgccggccttcatgaga 5928 ALDH3B1 5 intron 2 + 1820 tccgtgtggaaggcaccttc C/G cccagcctcagtggctagga 5929 ALDH3B1 6 intron 2 + 2046 aacctcaggcgctgcctcag C/G cagggagccagcctggcccc 5930 ALDH3B1 7 intron 2 + 2939 aagcacgcactgaacatgga G/A tgagtgagtgaecgaatgaa 5931 ALDH3B1 8 intron 3 + 7 tgcccaagaacctggtgagc C/T ggccgggctgaggcgggcag 5932 ALDH3B1 9 intron 4 + 36 gccccttccggccaccctcc T/C ccgctcgaggcctcaggccc 5933 ALDH3B1 10 intron 6 + (116-117) attctcctctctctctctct CT/&Dgr; ggaccaggctgggagcagtc 5934 ALDH3B1 11 intron 6 + 263 cagaccctcatacgtgaccc T/C gctgccccccaggctcttag 5935 ALDH3B1 12 intron 6 + 1298 gtagacagagctggactcca T/G ccttgggtgataagggatcc 5936 ALDH3B1 13 intron 6 + 1411 gccagggtcacaagcagagg C/T gggaggsgccaaggggtttg 5937 ALDH3B1 14 exon 7 + 185 acctgcgtggcccccgacta C/T gtcctatgcagccctgagat 5938 ALDH3B1 15 exon 7 + 339 tgcgggcattgctgggctgc G/A gcgtgtggccattgggggcc 5939 ALDH3B1 16 intron 7 + 249 ccagggctccagggctcagc G/A tgctaagatgaactcccatc 5940 ALDH3B1 17 intron 7 + 277 atgaactcccatcccaccac C/T ggctatcctgaaaggctgta 5941 ALDH3B1 18 intron 7 + 498 gaccaaggtcgggggattct C/T tgtgtcccacaggccctgag 5942 ALDH3B1 19 intron 8 + 14 cagccaggtgggggtgcggc C/T gggctgggcagggtcaggag 5943 ALDH3B1 20 intron 8 + 49 caggagcccgcagtgggcag C/T acaagtggtggcagcagggg 5944 ALDH3B1 21 intron 8 + 111 tcaggactttgggatggtgg A/T cctcttagctctgtctctgc 5945 ALDH3B1 22 intron 8 + 3219 atcctgatggggctcaaggc A/G gcctcacgcacatcctgttc 5946 ALDH3B1 23 exon 9 + 33 gtgctgacccagaccagcag C/T gggggcttctgtgggaagga 5947 ALDH3B1 24 intron 9 + 946 tcccaggcccccgagctgac C/A cttcttggtggccgtggccc 5948 ALDH3B1 25 intron 9 + 1067 aggctccccaagcctgggtc C/T ctcttgcccccacccactct 5949 ALDH3B1 26 exon 10 + 137 ccgcaatcgccgcgccgcct G/A aggatgctgctggtggccat 5950 ALDH3B1 27 exon 10 + 397 cgctcccaaccatcagagcc G/A aggtgggaggcatgggaaac 5951 ALDH3B1 25 exon 10 + 1198 ctcttccccatgctgctcat C/T ctcctgggccccatccactc 5952 ALDH3B1 29 exon 10 + 1475 caggggtggaggtgagtttc G/A tctcctgtctctctggctga 5953 ALDH3B1 30 3′flanking + 15 cctggcaatacttacatcct A/G gtgatttgctttctgtgcat 5954 ALDH3B1 31 3′flanking + 60 caacagggctgtggaccaag G/C ccctggcgttgggtaacaat 5955 ALDH3B2 1 intron 1 + 98 agggaaggggatgtgtgccc G/A tggcccgtgggtcagggggc 5956 ALDH3B2 2 intron 1 + 157 atggctccaggggccatggg T/C acggggcttcctcaggacag 5957 ALDH3B2 3 intron 1 + 354 tctgtggacagacaaggatt C/G ggtcgggggcaccagggctg 5958 ALDH3B2 4 intron 1 + 851 tatgacaggtccatcaggcc T/G caccttcctgtgtgtcttat 5959 ALDH3B2 5 intron 1 + 894 ctcagcatctgcccccacag T/G gcttttgcacacgttggttc 5960 ALDH3B2 6 intron 1 − 463 aaagaaccctcccagtccct C/G gtttagtcccagaagggagg 5961 ALDH3B2 7 exon 2 + 61 gccttcaactgagggcgcac G/A cggccggccgagttcggggc 5962 ALDH3B2 8 intron 2 + 9 ggacctgcataaggtgggcc A/G tggagaatgggccggggcag 5963 ALDH3B2 9 intron 2 + 23 gggccgtggagagtgggccg G/C ggcaggggctggagcagcgt 5964 ALDH3B2 10 intron 2 + (180-181) ttcactcctgaacactcaca (A) gccaccctgtgatgcagact 5965 ALDH3B2 10 intron 2 + (180-181) ttcactcctgaacactcaca gccaccctgtgatgcaggct 5966 ALDH3B2 11 exon 3 + 72 gactacgctctcaagaacct T/G caggcctggataaagcatga 5967 ALDH3B2 12 intron 8 + 375 ctgcagcatcctaacctcac C/T gtcgcgactcaaggctgccg 5968 ALDH3B2 13 intron 8 + 463 aatcacccccatggcacccc G/A accgtcactgacagggtgct 5969 ALDH3B2 14 exon 9 + 33 atgctggagcggaccagcag C/A ggcagctttgcaggcaatga 5970 ALDH3B2 15 exon 10 + 428 aggtgtcctcactcacccca C/T cctcccnaattccagccctt 5971 ALDH5A1 1 5′flanking − 1303 gaaattgattaaactctact G/A ttatcgcttctgccatatgt 5972 ALDH5A1 2 5′flanking − 301 gtgaaaaggtgacagcagtc C/T gcaggtgcatctactggcga 5973 ALDH5A1 3 5′flanking − 221 ggtcgcgccaggagagaagc C/T gcgcggcgcttagggcaagg 5974 ALDH5A1 4 5′flanking − 175 agggcggcgcggcggtgcag C/G gagaaagacgcggagagagc 5975 ALDH5A1 5 5′flanking − 174 gggcggcgcggcggtgcagc G/A agaaagacgcagacaaacgg 5976 ALDH5A1 6 exon 1 + 106 gcggcctggtccctgcctcc G/C ggcctgcgcccgcggcggcc 5977 ALDH5A1 7 intron 1 + 326 cctaaccgtggaggggcggg G/A agaaaggggaggggtgtcac 5978 ALDH5A1 8 intron 1 + 5551 gtctgtacaaaaaaaatttt T/G ttttaattagctcagcatga 5979 ALDH5A1 9 intron 1 + 5585 gtacaaaaaaaatttttttt T/&Dgr; aattagctgagcatgatgat 5980 ALDH5A1 10 intron 2 + 306 gttttggttgtttttttttt T/&Dgr; aaacttgtttttgtacattt 5981 ALDH5A1 11 exon 3 + 107 cggagacattatccacaccc C/T ggcaaaggacaggcgggccc 5982 ALDH5A1 12 intron 3 + 201 gtggtggcagtgagtggaat G/T atgcatttctaatgcctgca 5983 ALDH5A1 13 exon 4 + 42 atcacccggaaggtgggggc C/T gccctggcagccggctgtac 5984 ALDH5A1 14 intron 4 + 2306 atcgtcjcttataaatcagt T/C tgctaggtataaaatccttg 5985 ALDH5A1 15 intron 4 + (2334-2346) tataaaatccttggctcaca (T)11-13 acttgattatcttaaatgta 5986 ALDH5A1 16 intron 4 + 2456 tataagtcaacttttttttt T/&Dgr; acctagatacacaaaagtgt 5987 ALDH5A1 17 intron 4 + 2501 tttggtttttttcggccttt A/G tctttaaaaaccaataatgt 5988 ALDH5A1 18 intron 4 − (64-46) atctatttatttctcttttc (T)16-18 cagtttggtaaattgttggc 5989 ALDH5A1 19 intron 4 − 27 ttcagtttggtaaattgttg G/C cacatgtttcctgtttctct 5990 ALDH5A1 20 intron 5 + (4621-4624) tttgaatagataaacactta CTTA/&Dgr; tatggttgaaaaattaacac 5991 ALDH5A1 21 intron 5 + (4677-4678) accatgacaagtctcaccct (C) accccaaccctgactcacct 5992 ALDH5A1 21 intron 5 + (4677-4678) accatgacaagtctcaccct accccaaccctgactcactc 5993 ALDH5A1 22 intron 7 + (432-443) aaaaaatgatgttaaaaggc (A)10-12 tgaaaacaaaaaagtcattt 5994 ALDH5A1 23 intron 7 + (3243-3244) cagtccttgtgtgtgtgtgt GT/&Dgr; cccccaaacacactgctgga 5995 ALDH5A1 24 intron 7 + 4957 tttttgaaaaaaaaaaaaaa A/&Dgr; tggaactagttatacttttc 5996 ALDH5A1 25 intron 8 + 2717 gatcacctggaactcacagg C/T gtggtaggagacgtgcagcc 5997 ALDH5A1 26 3′flanking + 2711 cagtgagtgccttggggaag G/A agccagcatgtgaaatcatg 5998 ALDH5A1 27 3′flanking + 2777 gtccatggtgtgcgcttata G/A aatgtttgctaaactgaact 5999 ALDH6A1 1 5′flanking − 1303 ctctaaagcagaaccaagag G/C aaaagcatgggagtatacca 6000 ALDH6A1 2 5′flanking − (1273-1270) ggagtctaccaaaacaactt AATT/&Dgr; gttacttgaaatgacttgca 6001 ALDH6A1 3 intron 1 + 437 tgcccttgctcccttccccc A/T ccctacttcactatccatgg 6002 ALDH6A1 4 intron 1 + 835 gttcccaccccaaaatgagc T/&Dgr; cttctagtgctacacaccgt 6003 ALDH6A1 5 intron 1 + 1294 atattccttgctgcgatcct T/C gttctgttctagtatctttt 6004 ALDH6A1 6 intron 1 + 1447 gagtcattgagaaccttaag A/G aagtattttgtccttttcca 6005 ALDH6A1 7 intron 1 + 2536 agtcttgccatctctttcta T/C gttagccactgacataggct 6006 ALDH6A1 8 intron 1 + 2703 caggagagcaaggacttcct G/T ataaagcatatagcaagtag 6007 ALDH6A1 9 intron 2 + 2802 gcaacaatgctaatgggtgt T/C tcttagcaaatgaagaaaag 6008 ALDH6A1 10 intron 2 + 2333 gtttgtttgtttgtttgttt G/&Dgr; tttttttcagccaactgtaa 6009 ALDH6A1 11 intron 4 + 138 gactctctcccttgtactgc A/G tctcctccagtcttattctt 6010 ALDH6A1 12 intron 4 + 200 aaagaggaacattcttgcat T/C aatttctatttgtgtgtctt 6011 ALDH6A1 13 intron 5 + 291 ggcaagtcagtgtaccctgc G/A ccccttcattggcctgaacc 6012 ALDH6A1 14 intron 7 + 209 tcccgggttcaagcgattct G/A ctgcctcagcctccccacta 6013 ALDH6A1 15 intron 8 + 287 gcctcctgagcagcttggac C/T acaggtgcgggccaccacct 6014 ALDH6A1 16 intron 9 + 877 gatatcaaaatataaacata C/T agacatatttgggaggcaaa 6015 ALDH6A1 17 intron 9 + 885 aatataaacatacagacata T/G ttgggaggcaaaggagtgaa 6016 ALDH6A1 18 intron 11 + 40 ttttgtcttttcctttaaga A/C attttcttaaagatattcag 6017 ALDH6A1 19 3′flanking + 520 cctgcaaagttttctttagc C/T cctcttttatcccacaatac 6018 ALDH6A1 20 3′flanking + 1026 cgtgttggtcaggctggtct T/C gaactcctgacctcaggtga 6019 ALDH6A1 21 3′flanking + 1035 caggctggtctcgaactcct G/C acctcaggtgatccgcctgc 6020 ALDH8A1 1 5′flanking − (837-836) gctgaacattgttaatatat (AT) tcattagccaattgtgttcc 6021 ALDH8A1 1 5′flanking − (837-836) gctgaacattgttaatatat tcattagccaattgtgttcc 6022 ALDH8A1 2 5′flanking − 702 gggatctgaagcccttgcta C/T atgtgtcacacatgtttttg 6023 ALDH8A1 3 5′flanking − 642 gcacatctaggaagatgtga G/A cagccactgtggccccggtt 6024 ALDH8A1 4 5′flanking − 84 atgctctctgagagcgtcag G/T tgccctcccacattcactga 6025 ALDH8A1 5 intron 1 + 5437 gcattggttgaaatggagcg T/C gtttctttgtttctatggta 6026 ALDH8A1 6 intron 1 + (5836-5855) gtcagaatccatctaaaaaa (CAAAA)4-5 atgagctgtgtggagacct 6027 ALDH8A1 7 ercn 3 + 146 cactacacggtgcgggcccc G/T gtgggagtcggtgagtgctg 6028 ALDH8A1 8 intron 4 + 1033 aggtctttttgctatgtcac C/T ccacggccagggcaggagtg 6029 ALDH8A1 9 intron 4 + 1037 ctttttgctatgtcacccca C/T ggccagggcaggagtgctgg 6030 ALDH8A1 10 intron 4 + 1662 tctctcctgagaccaagaac G/A tctggatagatgatgagtta 6031 ALDH8A1 11 intron 4 + 2046 agtcctgggcatttaaacag A/C cttgacagataaacttcctt 6032 ALDH8A1 12 intron 6 + 1146 ttttccagatgcaagagact C/G ccttgttctctctccttctg 6033 ALDH8A1 13 intron 6 + 1744 ttcttcttcttcttcttctt C/T tttcttttttaacatgtact 6034 ALDH8A1 14 intron 6 + 9802 tgagtgtgaattctaacttt A/T ctgtttattagctctatgaa 6035 ALDH8A1 15 exon 7 + (1089-1098) tacagtgagaccttgtcttt (A)9-10 tgctgcaaaaccaaaaataa 6036 ALDH8A1 16 3′flanking + 848 ctcagctgagtccccttgac T/C ttaatcactttagtgaagaa 6037 ALDH9A1 1 exon 1 + 121 actgtgtggggtatggcggg G/A tggtggggagaatgtggtgt 6038 ALDH9A1 2 intron 1 + 67 cgcggatttcccggccagcc C/G ccgtttcctgtgttctgcag 6039 ALDH9A1 3 intron 1 + 103 tgcagcgttgacttgagcac A/G agacagtgacagtggagagt 6040 ALDH9A1 4 intron 1 + 1818 gaatttttgagaaaaaaaaa A/&Dgr; tgttcctttggggttgcctt 6041 ALDH9A1 5 intron 2 + 5891 tcaggaacaggaagtaaaga G/A gtttacatttctaaatttct 6042 ALDH9A1 6 intron 2 + 6398 atcaaaaacanttgtctgat T/G atcgtgctctgaacctgcct 6043 ALDH9A1 7 intron 2 + 9677 atgacgctgagtttggtgct A/G ttcttttgtttttcttgcct 6044 ALDH9A1 8 intron 2 + 9991 gggagaagtgagggacctac C/T cttggcttctaatctttcat 6045 ALDH9A1 9 intron 2 + 10198 ttgtcagagacatctttgat A/G atccttacgtactatatcag 6046 ALDH9A1 10 intron 2 + 10256 ttagtagataactttttttt T/&Dgr; gtaaggatggagaataatag 6047 ALDH9A1 11 intron 2 + 11382 catattcaattcttttatgt T/C ctttagaccaaagaaaggca 6048 ALDH9A1 12 intron 2 + 11455 taaacctttaagctcatcat C/T ggaccatctattgaatttct 6049 ALDH9A1 13 intron 2 + 12044 atttaaagtgaaagctattt C/T tagttttaaaaattgagcag 6050 ALDH9A1 14 intron 3 + 334 ctatttagcaaActtttttt T/&Dgr; gacagtgtataaagttttca 6051 ALDH9A1 15 intron 3 + 368 gttttcaacaattgatattg G/&Dgr; aaggttggtagggcctagga 6052 ALDH9A1 16 intron 4 + 191 ccctcaaggagcttatagtt T/A aggttgtacacaatcatgtc 6053 ALDH9A1 17 intron 4 + 557 tagaacaaattgtaatgtta A/G aaagcattactgttaggaca 6054 ALDH9A1 18 intron 5 + 830 agttcaagatgattttgtag G/C ttcagggcctagttgactta 6055 ALDH9A1 19 intron 5 + 838 atgattttgtaggttcaggg C/T ctagttgacttagcatgcaa 6056 ALDH9A1 20 intron 6 + 120 agaaaagttgcacaaatagt A/C caaagaattcccatgtacct 6057 ALDH9A1 21 intron 6 + 2569 attaaaatctgctttaaata T/C ttttttgggggagaggacac 6058 ALDH9A1 22 intron 8 + 1414 ccgatcttcaaaaaattagc T/C gggggtggtggtgcacactg 6059 ALDH9A1 23 intron 9 + 664 aaagttcacatttttttttt T/&Dgr; ataacttcatggtcaagagc 6060 ALDH9A1 24 intron 9 + 2170 taatgcacacattttttttt T/&Dgr; cttcatagggacatccaacg 6061 ALDH9A1 35 exon 11 + 587 aaaacaaaaaacaaaaaaaa A/&Dgr; ccttgttcctttataggttc 6062 ADH1 1 (5′flanking region − 55) atcatgtgtggaactggaat C/T gggtgttattcaagcaaaaaa 6063 ADH1 2 (intron 1 268) acatttgcggtaaagcgata A/G tttattccaagctaatcatg 6064 ADH1 3 (intron 3 443) aatgga g/c gctacatggctat G/A gctgaatgagcatgaccttt 6065 ADH1 4 (intron 6 56) tacaacttggaggatgcatt T/G aggctgcagaatatatgttt 6066 ADH1 5 (intron 8 74) gtctagcagaaaatgaaaag G/A tggaaggatgagaaaaatta 6067 ADH2 1 (intron 2 340) ctattttttaaagcgtgcat T/C cttacataagacttaaatat 6068 ADH2 2 (intron 3 91) aaggcaatgagagaggaaag T/G gcttgcacaaggtcaccgcg 6069 ADH2 3 (intron 3 205) atgtattgtacccttcaacc A/G ttatgtaccgagtatctact 6070 ADH2 4 (intron 7 108) acaattgacaaggcaagatt T/C tgaaaacaaatcaaaaataa 6071 ADH2 5 (intron 3 1721-1723) actgcatagaaatttaagaa GAA/&Dgr; cttgttttattcctctccag 6072 ADH2 6 (3′untranslated region gttaatgctttcccaccttc AG/&Dgr; gggaaggatttgaattttga 6073 2305-2306) ADH3 1 (5′flanking region − 254) tgagagaagagaagcaggaa C/G ttgagagaggaggaagagag 6074 ADH3 2 (intron 2 355) tatgccttcttctatattat A/G caagacaaaaattttaggat 6075 ADH3 3 (intron 3 32) acactcagggaacatgcctt G/A gttcaccatcacaagattag 6076 ADH3 4 (intron 4 6) ctgcttgaaaaatgagtaag C/T ttctgatgctttctttgcac 6077 ADH3 5 (coding region 453 agcaccttctcccagtacac A/G gtggtggatgagaatgcagt 6078 (Thr 151 Thr)) ADH3 6 (coding region 815 ttcgtttgaagtcatcggtc A/G gcttgacaccatggtatgat 6079 (Arg 272 Gln)) ADH4 1 (5′flanking region − 482) acagccagagacccagaacc A/C tcagggctggttgatggact 6080 ADH4 2 (5′flanking region − 437) catcaggtgggacaaaaaga G/A tagctccttagcagtgacta 6081 ADH4 3 (5′flanking region − 234) actcaagcatatgtgcaacc A/G agtacatgaaaagaatttgt 6082 ADH4 4 (5′untranslated region − 3) ggtaagttaaatgggcgatt C/G tgaggagtagaaatttcctt 6083 ADH4 5 (5′untraslated region − 2) ttcaataaaagaaaaaagaa T/A ttaaaaaatcttggagctca 6084 ADH4 6 (intron 1 707) ttatatttgaaattaaaaat A/G taatttgaggctagaaaaaa 6085 ADH4 7 (intron 5 619) tcaaagagggatctcacaat T/C ggacatctcaacctgcttat 6086 ADH4 8 (intron 5 1755) tttacgcacacaattactca T/C taataaaaaatttaaaaaat 6087 ADH4 9 (intron 5 3425) actgagactctggagcaata T/C aitaagaatcatactgaaca 6088 ADH4 10 (intron 1 1181-1189) ggtaaactttaatacacctg (T)9-11 caagaaataaaaaatgtaat 6089 ADH4 11 (intron 5 2828) tccagtcaaagtcgacctaa A/&Dgr; tttccaggagttgttcttcc 6090 ADH4 12 (intron 7 15) ttggtggtcagttttttttt T/&Dgr; cttcatagctttaaattctt 6091 ADH5 1 (5′flanking region − 115) taactgctgtaaagttacac G/A g/a ggaagccctttcccgacaa 6092 ADH5 2 (5′flanking region − 114) aactgctgtaaagttacac g/a G/A ggaagccctttcccgacaaa 6093 ADH6 1 (intron 3 249) tgaaactggccttgaaagta C/A aaatgagacaaaaatttatg 6094 ADH6 2 (intron 6 1072) taacccctatactgtattgc A/G tcactttctaacaggcagct 6095 ADH6 3 (coding region 885 gtctgtgtggttgttggggt G/A ttgcctgccagtgttcaact 6096 (Val 295 Val)) ADH6 4 (intron 7 1292) gttgagaaacactgcctagt C/A ccgtctgtggtcctggaatt 6097 ADH6 5 (intron 7 1616) ctatcacagaataatccgca T/C agaacactaagcagattacg 6098 ADH7 1 (5′flanking region − 520) tgtgcagacacagaaagttt T/C acttaactttctacacctaa 6099 ADH7 2 (intron 1 361) tcagtagcatgtgctgcact C/T gctgcagtagttcaatggga 6100 ADH7 3 (intron 3 183) aacctcaacctttagaaggc A/G aaccttacggtgtttataaa 6101 ADH7 4 (intron 4 76) tgaattgaattaattaatac G/A tgtatttgatgtatcaaaca 6102 ADH7 5 (intron 6 615) tggcatagcgtaaagagact T/A ggaaaaatggaataaagcca 6103 ADH7 6 (intron 8 532) aagtctaaccatatcaccaa T/C ttagtatgccattgtactat 6104 ADH7 7 (intron 8 651) gctctgatttatttcaagta G/A gccacaaaatttccttattt 6105 ADH7 8 (intron 8 727) ttcagatccctgtaagccag G/A tattatttttaccattttta 6106 ADH7 9 (intron 8 1207) tctccacatttggtctagcc T/C acaggatcatcatattatga 6107 ADH7 10 (intron 8 1691) tccctcatctcattgcccac G/A ctcattgctttaattcagtc 6108 ADH7 11 (3′untranslated region 13 atttacattttgtaaggcta T/C aattgtatcttttaagaaaa 6109 ADH7 12 (3′untranslated region 14 gatatagtaaatgcatctcc T/C agagtaatattcacttaaca 6110 ADH7 13 (3′untranslated region 15 aaacacttgttatgagttaa C/G ttggattacattttgaaatc 6111 ADH7 14 (3′untranslated region 18 aatataaacatagagctaga A/G tcatattatcatacttatca 6112 ADH7 15 (3′flanking region 865) tacatcaaaagaaataaatc C/T aagaaggaataaacacattt 6113 HEP27 1 (5′flanking region − 191) tcagcactctgtgtctagct A/T aaggtttgtaaatgcaccaa 6114 HEP27 2 (5′untranslated region − 1) gaacccatcaattccgtaca C/A attttggtgactttgaagag 6115 HEP27 3 (intron 1 1941) aaatttaccctaaccagcct G/C actctctgccactttctgtt 6116 HEP27 4 (coding region 211 ttgtgtgccacgtggggaag G/A ctgaggaccgggagcagctg 6117 (Ala 97 Thr)) HEP27 5 (intron 4 1070) tgtctcagttcacaggatca T/C gactctttttctcgaaactg 6118 HEP27 6 (3′flanking region 362) ggctttgtgtgtgctccatt A/G tctgaactgggcctgctggg 6119 UGT1A1 1 (5′flanking region − 1337 tctttcccttttgacttcaa A/C tcagtcatcagaatttcccc 6120 UGT1A1 2 (coding region 211 cctcgttgtacatcagagac G/A gagcattttacaccttgaag 6121 (Gly 71Arg)) UGT1A1 3 (intron 1 2925) gcatttgggaagggaaaatc T/G aattaaaagcctaaactaaa 6122 UGT1A1 4 (intron 1 3442) agactcggccttttccagat G/T agcttcagtgtaagagtggg 6123 UGT1A1 5 (intron 1 3512) ttaagtaagccatttaccaa C/T gctcagaagaaagaacttga 6124 UGT1A1 6 (intron 1 3665) tcttgctacaaaccaaaaaa T/C gcagcatggtggtggggagg 6125 UGT1A1 7 (intron 2 15) cagacagtaagaagattcta T/C accatggcctcatatctatt 6126 UGT1A1 8 (intron 4 574) agatttaaaactccaattta C/T ataaaaagttcccataatag 6127 UGT1A1 9 (3′flanking region 125) tatagaggttcacacacaca C/T gccttcattgcgtgtgcatg 6128 UGT2A1 1 (5′flanking region − 1602) ataacatcttctgcagagaa A/C cttcaatggaaatacactca 6129 UGT2A1 2 (5′flanking region − 1480) tacagattatctttggtgat G/C ggagagcttagaagagacat 6130 UGT2A1 3 (5′flanking region − 1406) atttcagaagatttattaac A/T tgaaaaggatcactctg c/t tt 6131 UGT2A1 4 (5′flanking region − 1388) acatggaaaggatcactctg C/T ttattcacagacatatgcat 6132 UGT2A1 5 (5′flanking region − 935) aaattattcaatctctttgg G/A cagtggtttctttttctttg 6133 UGT2A1 6 (intron 1 535) cattgatcaggctgatttat C/T catgctaagcttatttaatt 6134 UGT2A1 7 (intron 1 642) tatattgatcatgttgatac A/C tttatacacatatttgtcta 6135 UGT2A1 8 (intron 1 1448) aggtgcttacaggcaacatc C/T acatagcagtctgtggctgg 6136 UGT2A1 9 (intron 1 2000) gacacattagcttcttttct A/G cagatctctgttctaaaaca 6137 UGT2A1 10 (intron 1 3118) cttaaaattctttaatgaaa T/G cattgcaacaaatttatatc 6138 UGT2A1 11 (intron 1 3191) ataaatagaacaactcccta A/T gtttacttctctgcagtgga 6139 UGT2A1 12 (intron 1 3770) atcaccagataatttactat C/T cattaaggagtaggtcatca 6140 UGT2A1 13 (intron 1 4584) tgattggttagaatctttga A/C aaatcttctagtatcattcc 6141 UGT2A1 14 (intron 1 4854) tactctgtgcattgttaata G/A cctatcacttgtggtctgcc 6142 UGT2A1 15 (intron 1 − 19146) ctgtttaaattctcattcaa C/T ggccacatggttaaaataaa 6143 UGT2A1 16 (intron 1 − 19085) tagacaaagaccctttcaat A/C aacaaagttagaaatgtgtt 6144 UGT2A1 17 (intron 1 − 18346) atggcaatatttttagaaat G/A ttaactcccaataatgaata 6145 UGT2A1 18 (intron 1 − 18218) tatatcattattttaactta T/G agatagcactagccctaatt 6146 UGT2A1 19 (intron 1 − 17937) ctcctaataatttggactca C/T catacttattcagcactatc 6147 UGT2A1 20 (intron 1 − 12585) ttccacacagggacaagtca A/G cagaggaaatttttcttgct 6148 UGT2A1 21 (intron 1 − 11430) eacaaaggtttattttctta C/G agttctgatggctagaggtc 6149 UGT2A1 22 (intron 1 − 10761) tttaaaatatgcatgtattt T/G ccacttttaaaaactatatc 6150 UGT2A1 23 (intron 1 − 381) aaatcctccctccttccttc C/T tttcccaggccccactctac 6151 UGT2A1 24 (intron 1 − 329) ttccctttctccttttctcc A/G tctctctctcttcctctctc 6152 UGT2A1 25 (intron 1 − 41) ttttctcctcagcaaacata T/A aagctaatttcctccatcca 6153 UGT2A1 26 (intron 2 263) caccttgatactggacttgg T/C gggacagaaaaccagatcat 6154 UGT2A1 27 (intron 2 454) agaaagcccattgaaataag G/C cagggtttttaggttttaat 6155 UGT2A1 28 (intron 2 554) aaaaacttttttgagttgac A/T atggtgagtttagtttctga 6156 UGT2A1 29 (intron 2 1113) ctgcaggcaagctctagtga A/T tgtttattataggaaataat 6157 UGT2A1 30 (coding region 922 (Gly308) gtgttgtggtattttctgtg G/A gatcaatggtcaaaaacctt 6158 UGT2A1 31 (intron 3 − 217) aagcttagaagtgataaata T/C caaaacaataatactatcct 6159 UGT2A1 32 (intron 3 − 194) aaacaataatactatagtgg G/A tagactattagtacaagact 6160 UGT2A1 33 (coding region 1171 acggagtccctatggtggga G/A ttcccatgtttgctgatcag 6161 (Val391Ile)) UGT2A1 34 (intron 5 1546) tttttaaaattcagaaactc A/G g/a ttatggtgtattcttacaa 6162 UGT2A1 35 (intron 5 1547) ttttaaaattcagaaacct a/g G/A ttatggtgtattcttacaaa 6163 UGT2A1 36 (intron 5 2505) taattgacttttattaatac G/A tacatgttgtataagtcata 6164 UGT2A1 37 (intron 5 2639) tagactattacaaagttgtt A/G gttgctgacaattttgttca 6165 UGT2A1 38 (intron 5 4009) gaatccaggctggaactttt C/A ttccagacacaaaccaaaat 6166 UGT2A1 39 (intron 5 4311) atacagacactgtccttttc C/A tcacaaacatacagatgtgt 6167 UGT2A1 40 (intron 5 4616) acttttttatgtctacattt G/C atcatactgtgttcagcata 6168 UGT2A1 41 (intron 5 4717) tgcaagaattatattttctc C/A acgtaactatggccttaaac 6169 UGT2A1 42 (coding region 1524 gctatatttttggtcataca A/G tgttgtttgttttcctgtca 6170 (Gln508Gln)) UGT2A1 43 (3′untranslated region 1 aaggagtttaacaaaaacac G/A tctcccatcctgtttccaaa 6171 UGT2A1 44 (3′flanking region 685) aatctagaaaataattatca T/C ttttataaaatttttagtca 6172 UGT2A1 45 (intron 1 (−18967)-(−18965) ctcccaattagattgattag TAT/&Dgr; gagttcctggggttactggt 6173 UGT2A1 46 (intron 1 (−18862)-(−18803) aatacattcttcccccttca (AC)14-17 atacttactggcctatttat 6174 UGT2A1 47 (intron 1 (−17463)-(−17447) aaacttagaaacctctattc (A)16-27 gtaaagaaaatggcagagaa 6175 UGT2A1 48 (intron 1 − 10860) attcaatgcaactttttttt T/&Dgr; gtaatggcagaattagaaca 6176 UGT2A1 49 (intron 2 528-538) ctgttaggaaacaattggtt (A)8-10 cttttttgagttgacA/Tatgg 6177 UGT2A1 50 (intron 2 1514-1533) ttgtgtgtatgtgtatgttt (GT)9-11 tattttaatgaattaatatc 6178 UGT2A1 51 (intron 5 916-917) gcttagtatattatatatat AA/&Dgr; gtctatatatatagcttagt 6179 UGT2A1 52 (intron 5 1163) caatatttatgtcatttttt T/&Dgr; ctcacatttactgtgtttcc 6180 UGT2A1 53 (intron 5 3819-3038) agacagacagacacacaaac (AC)8-12 tcaacacatgtaaactactc 6181 UGT2A1 54 (intron 5 4785) tatcttcaatgaaaataaaa A/&Dgr; caaaaattgtccaatttctg 6182 UGT2B15 1 (5′flanking region − 277) ccgaacaggcaggagcctct C/A acttgccactgttcttaaca 6183 UGT2B15 2 (intron 1 670) catcaaagaaaataggggcc A/T aattaagggagagcacatat 6184 UGT2B15 3 (intron 1 775) ctaattatattaagatctta A/C gatgaaccaagacagtagta 6185 UGT2B15 4 (intron 2 2183) cagagtttcaccatgttggc C/T aggctggtcttgaactcctg 6186 UGT2B15 5 (intron 2 2430) tatttcaaaagaataagact C/G ttgccaaaaagtatcaagtg 6187 UGT2B15 6 (intron 2 4806) aaaaaattactccaatagct C/T ctga c/g cctctcatcttagat 6188 UGT2B15 7 (intron 3 129) ctaattatctcagacatgtg T/C tcaaa g/a caaaaacatatatg 6189 UGT2B15 8 (intron 3 424) caataacaataagcaggtat T/C gaaaaaactttgaaatgcat 6190 UGT2B15 9 (intron 3 493) ggc t/a gtttttacttcccatg C/T attggaataggtctatttag 6191 UGT2B15 10 (intron 3 906) gccctctctgaatgatctat G/A caagtccttgctgaaaacac 6192 UGT2B15 11 (intron 3 1036) tcagtaccttagtttggtac T/C agacatggtaatgactggct 6193 UGT2B15 12 (intron 3 1544) aataaatatataggttatta C/G taatttgctacttttttatt 6194 UGT2B15 13 (intron 3 5550) gtgtggtgaatcaatgtgtg C/T tgcttgtgggcagtactcca 6195 UGT2B15 14 (intron 3 5720) ttttttaaaagttaattttt C/A ttggggatttccctgcaggg 6196 UGT2B15 15 (intron 4 134) atcaaatttaactactttat A/G tttattttccagtcttagta 6197 UGT2B15 16 (intron 5 6627) ttttaatgttgatatcttta T/C atttatccttcagctataaa 6198 UGT2B15 17 (coding region 1568 (Lys23 tttccgaaagcttgccaaaa A/C aggaaagaagaagaaaagag 6199 UGT2B15 18 (3′untranslated region 1 ggatttaatacgtactttag C/T tggaattattctatgtc a/t at 6200 UGT2B15 19 (3′untranslated region 1 ag c/t tggaattattctatgtc A/T atgatttttaagctatgaaa 6201 UGT2B15 20 (intron 2 1980-1981) aagagagtagcagaataagg (AGG) acaagggataaatgactagt 6202 UGT2B15 20 (intron 2 1980-1981) aagagaataacaaaataaga acaaggaataaataactc 6203 UGT2B15 21 (intron 3 605-618) ctagccaagtagatttagag (A)11-15 cttgtctgctctgctgactt 6204 UGT2B15 22 (3′untranslated region aagtataatttaaaaaaagc (A)11-14 tacaactcttttttttaaac 6205 1957-1968) UGT8 1 (coding region 677)Pro226 gcagaagtacaacctgctgc C/T ggagaagtccatgtatgatt 6206 UGT8 2 (coding region 741)Ala247 atgctgtgtactgacgtagc A/G ctggaattcccaagacccac 6207 UGT8 3 (intron 2 53-54) ttgacaatcaataictcctt GT/&Dgr; ttagtgcacaggtcccagta 6208 GSTA1 1 (5′flanking region − 266) ttgcaaaaagagcaaaatct C/A ggtgaaatgtattgtgtaaa 6209 GSTA1 2 (intron 2 1220) gagacacaggctttcctaag A/C tatgacaacaccataactag 6210 GSTA1 3 (intron 4 1813) aaaggcacccactggaggtg A/C attattttgccatcacctga 6211 GSTA1 4 (intron 5 732) gaagagtgttgtcatgaagg T/C ggagtcactgcccaagggag 6212 GSTA1 5 (intron 6 333) ttatcccatatgtgcccaca A/G tgagccggtctgagcagagc 6213 GSTA1 6 (3′flanking region 412) ctttcttatgcatttgcaaa A/C caatgattctgtctgctgtg 6214 GSTA4 1 (intron 1 280) gcattggtggaaggtgggct C/T ggatcgtccccgggcctggc 6215 GSTA4 2 (intron 3 176) ggaaatcacttcttattcaa T/C agttccataaaagctggccg 6216 GSTA4 3 (intron 4 94) acaccacatttactttatgt C/G ttacatagttagtgagatca 6217 GSTA4 4 (intron 5 1062) cacacttgtgcacatgcaga C/T acccatgggcatccaagagt 6218 GSTA4 5 (coding region 487 cagatgtgattttactccaa A/G ccattttagctctagaagag 6219 (Thr 163 Ala)) GSTA4 6 (intron 6 595) tgagctctgagagcaaatga G/A agatgtt a/g gcaccctaaaca 6220 GSTA4 7 (intron 6 630) taaacatcaccccaaaggat T/A cctaccattctccttctgag 6221 GSTA4 8 (intron 6 3943) tcttcgtagtatctaatacc T/C tttttgttagccttaaagtt 6222 GSTA4 9 (3′untranslated region 10) taataacaaccgaatgtcta G/A taaatgactctcctctgagc 6223 GSTA4 10 (intron 5 370-371) gttgtcgaacagctgtctca (TA) gctgacatcctccctgataa 6224 GSTA4 10 (intron 5 370-371) gttgtcgaacagctgtctca gctgacatcctccctgataa 6225 GSTM1 1 (5′flanking region − 694) tacgaagtggctaatttaca C/T agtacttagccagatgaccg 6226 GSTM1 2 (5′flanking region − 661) gatgaccgaaggactcagta C/T ccgagggcccctaacagaaa 6227 GSTM1 3 (5′flanking region − 658) gaccgaaggactcagtaccc G/A agggcccctaacagaaaaca 6228 GSTM1 4 (5′flanking region − 656) ccgaaggactcagtacccga G/A ggcccctaacagaaaacaca 6229 GSTM1 5 (5′flanking region − 537) tagaggggagactaagccct G/C ggagtagctttcggatcaga 6230 GSTM1 6 (5′flanking region − 525) taagccctgggagtactgtt C/G ggatcagaggaagtcctgct 6231 GSTM1 7 (5′flanking region − 465) aattaaattcccaggttggg G/A ccaccactttttagtctgac 6232 GSTM1 8 (5′flanking region − 383) gcggagcgaaggctgaggga C/T accgcgggcagggaggagaa 6233 GSTM1 9 (5′flanking region − 382) cggagagaaggctgagggac A/T ccgcgggcagggaggagaag 6234 GSTM1 10 (5′flanking region − 378) gagaaggctgagggacaccg C/T gggcagggaggagaagggag 6235 GSTM1 11 (5′flanking region − 343) agggagaagagctttgctcc G/A ttaggatctggctggtgtct 6236 GSTM1 12 (intron 2 118) tgctggagctgcagctggtc T/C cttccctgagcccgggtgag 6237 GSTM1 13 (intron 3 233) agtgagtgcccggtctcctc T/C ctgctcttgcttatgggaag 6238 GSTM1 14 (intron 4 26) tgtgggtggctgcaatgtgt G/A gggggaaggtggcctcctcc 6239 GSTM1 15 (intron 5 140) actatcagcagttattctca C/T gactccaatgtcatgtcaac 6240 GSTM1 16 (intron 5 577) ctgccaccccattagaagga A/G ctttctactttccctgagct 6241 GSTM1 17 (intron 5 645) gctggtctggatccagaggc T/A gccaggtgcttgggcgctcc 6242 GSTM1 18 (coding region 519 caccgtatatttgagcccaa G/C tgcttggacgccttcccaaa 6243 (Asn 173 Lys)) GSTM1 19 (coding region 528 tttgagcccaagtgcttgga C/T gccttcccaaatctgaagga 6244 (Asp 176 Asp)) GSTM1 20 (intron 7 2421) cagcaccgtgtagaatcttc A/G taagtgttagctgttactgt 6245 GSTM1 21 (3′flanking region 42) atttgctcctggccatctac C/T cagactgtctgtctgtctgt 6246 GSTM2 1 (intron 1 7) ggaacatccgcggggtgagc C/G agggtccgctgggcggtggg 6247 GSTM2 2 (intron 1 45) gggacgggggtgcgtggggg C/T ggggaagtgtggagcagctg 6248 GSTM2 3 (intron 3 70) gactgcatctcctctcccca G/C cttagaggtgttaagatcag 6249 GSTM2 4 (intron 3 224) agcaggccctggtctcctct T/C tgcccttgcatatgggaagg 6250 GSTM2 5 (intron 5 100) ttgattccttctggtgagtt C/A ttggtcttgctgactctaag 6251 GSTM2 6 (intron 5 341) tcctcttggtgggttcatgg T/C ctggctggcttcaggagtga 6252 GSTM2 7 (intron 5 696) acctttagctagacacagag C/T gctgatttgtgcatttacaa 6253 GSTM2 8 (intron 5 723) ttgtgcatttacaatccttt A/G gctaggcagaaaagttctcc 6254 GSTM2 9 (3′untranslated region 10 ctcagccccgagctgtcccc G/A tgttgcatgaaggagcagca 6255 GSTM2 10 (3′flanking region 139) ttctgctgggcatagtaagg C/T gcttgagaattcttgctccc 6256 GSTZ1 1 (5′flanking region − 546) agcagggcccaccagccgac C/A gcctcgaagcgccgtgagcc 6257 GSTM2 2 (5′flanking region − 321) tgtctgaccagccgccccgc T/C aaggagtcacaagagggcag 6258 GSTM2 3 (intron 1 2890) aaaatactgcatcaaaacca G/A gccacgctctgttgggggga 6259 GSTM2 4 (intron 1 2896) ctgcatcaaaaccaggccac G/A ctctgttggggggacaccaa 6260 GSTM2 5 (intron 2 255) tctcccaacactgctctcca A/G agccccttggcaaccatgtt 6261 GSTM2 6 (intron 2 1560) caccactgtttaaggccgtg G/C gggggcagagttaaacacaa 6262 GSTM2 7 (coding region 94 (Lys 32 ccttgaaaggcatcgactac G/A agacggtgcccatcaatctc 6263 GSTM2 8 (intron 4 297) agaaggaggagtttgctggc C/T ctgtcccctctggtccaggg 6264 GSTM2 9 (intron 6 94) tatctgaaccagccctccag G/A ctgctttgggcctgacagtt 6265 GSTPi 1 (intron 1 269) ctcccccgggctccagcaaa C/G ttttctttgttcgctgcagt 6266 GSTPi 2 (intron 2 134) ccccgggcctccttcgtgtt C/T cccgcctctcccgccatgcc 6267 GSTPi 3 (intron 5 438) gtgtgtgcgcgtgcgtgtgc G/A tgtgtgtgcgtgtgtgtgtg 6268 GSTPi 4 (intron 6 162) cccgctggctgagtccctag C/T ccccctgccctgcagatctc 6269 GSTT1 5 (5′flanking region − 103) taaagagtgtcccaggcgtc C/T gtgcagcccaatggggcaca 6270 MGST1 1 (promoter region − 1879) ttaataaatgtttattcaat T/G aaaccaactgctaatattct 6271 MGST1 2 (promoter region − 508) tctggaccctgaacaggagg G/C gacatcgtgacaaagcaaat 6272 MGST1 3 (promoter region − 314) cctggagattttaactttct G/A cgaagtttttaaaaacaact 6273 MGST1 4 (promoter region − 131) atcagcaggcgatccttact G/C tgggcgggtaaatcaggtga 6274 MGST1 5 (intron 1b 36) ggagaaggggaccgcatgca A/G agggtggcaggcagggaggg 6275 MGST1 6 (intron 1c 456) ccccttgggacggttctcac C/T tgtgccccacttccccagtc 6276 MGST1 7 (intron 1c 719) gcccgcaagcattgctgtat A/G gcacccaggcctccagtgag 6277 MGST1 8 (intron 1c 985) cgagtaaaatttttctaccg C/G tttgttttagagtggtgtct 6278 MGST1 9 (intron 1c 1428) gtaaagggaaagggcgttcc T/A caactgagaagtgaagattc 6279 MGST1 10 (intron 1c 2914) ctcatcaggtgtgtgtcgga T/G gcttggtgctggccagtctc 6280 MGST1 11 (intron 1c 4274) attgtaatagattatcaaag G/T tgatgaaagtagtgtacata 6281 MGST1 12 (intron 1c 4276) tgtaattgattaacaaaggt G/T atgaaagtagtgtacataat 6282 MGST1 13 (intron 1c 4767) gccttcatcttcagcacatt C/T ccaattatacttccaattcc 6283 MGST1 14 (intron 2 2379) ttctcaaatttcattataca G/C tattcttcaacccaaagttt 6284 MGST1 15 (intron 2 2767) tttaactatagatgccttct T/G ctcctcttgtgtttgattta 6285 MGST1 16 (intron 2 2974) tcactgcagcctcaacctct C/T gggctcaggtgatcctccaa 6286 MGST1 17 (intron 2 3083) aaaaaatttgtagatatggg T/G actccctatgttgcccaggc 6287 MGST1 18 (intron 2 3106) tccctatgttgcccaggctg A/G tcttgaattcttgggctcaa 6288 MGST1 19 (intron 3 1495) gtcagacaatggccttcagc G/A tcctctctttgcagaatatg 6289 MGST1 20 (intron 3 1703) ttctcttctaagaagaagtc T/C gtgcagatacttagcacaaa 6290 MGST1 21 (intron 3 2528) ttttggagacacttttcaga G/C agagcgtttccagcatcttc 6291 MGST1 22 (intron 3 2557) tccagcatcttccctttcca T/C ttttaagttagacttttttt 6292 MGST1 23 (intron 3 2731) atacacatatggaacaatta A/C ctaaaaacttaaggtaatat 6293 MGST1 24 (intron 3 3032) agagacatttagaatatatt C/A cctttaaaggtagagaataa 6294 MGST1 25 (intron 3 3045) atatattccctttaaaggta G/C agaataacccttcactgaga 6295 MGST1 26 (intron 3 3289) ggtttatagtgttccccccc T/A ccgggcccccaaaagaccca 6296 MGST1 27 (intron 3 3976) ggaaagctggggaactgttt G/T cctggaacagagtctcaaaa 6297 MGST1 28 (intron 3 4288) ccattctatttgtcaactgc G/A taacacaggcgtagaagtgg 6298 MGST1 29 (intron 3 4298) tgtcaactgcgtaacacagg C/T gtagaagtggacattgtttt 6299 MGST1 30 (intron 3 4429) attggaggtgacgatatctc T/C gtgatgctgggggagaaatc 6300 MGST1 31 (intron 3 4519) tttaatagaaaatggtattc C/T tgtcttttctttcccatctc 6301 MGST1 32 (intron 3 4817) attgctatagaagagagtaa C/T gtaaagcagaaatagttttc 6302 MGST1 33 (intron 3 6077) tttgaaattagtgtctttaa T/C agttatctttttccacagag 6303 MGST1 34 (3′untranslated region 60 gggtaaacccattttgaata T/C tagcattgccaatatcctgt 6304 MGST1 35 (3′flanking region 147) tatttgctttccttctctct C/T tgttttctttttctctgaaa 6305 MGST1 36 (3′flanking region 237) cagcacgtttttcctatgaa C/T aagacattctccaaataact 6306 MGST1 37 (intron 1c 904-923) tgcgattatctttggtaatt (A)16-19 ggcaaatcagtccaaatttg 6307 MGST1 38 (intron 1c 3433-3434) ccccttcaatactagaacaa (AA) gcagacacattaaatgttac 6308 MGST1 38 (intron 1c 3433-3434) ccccttcaatactagaacaa gcagacacattaaatgttac 6309 MGST1 39 (intron 1c 5146) actatttcaatttttttttt T/&Dgr; ggagggggagacagagtctc 6310 MGST1 40 (intron 2 552-563) cccagcattataagaatgac (T)10-12 aagtgcagatgtggggaggg 6311 MGST1 41 (exon 3 172-173) tagcatttggcaaaggagaa AA/&Dgr; tgccaagaagtatcttcgaa 6312 MGST1 42 (intron 3 152-158) agaaaactggatgtctgaaa TTGACA/&Dgr;(GTCCAATAT) 6313 cactgcacttgtatgtgttg MGST1 43 (intron 3 2198-2200) ggattttagattcctcccta CTA/&Dgr; ttctttccgaccttccaccc 6314 MGST1 44 (intron 3 2567-2568) ccctttccatttttaagtta (A) gacttttttttttcacctct 6315 MGST1 44 (intron 3 2567-2568) ccctttccatttttaagtta gacttttttttttcacctct 6316 MGST1 45 (intron 3 2571-2580) tttccatttttaagttagac (T)9-11 cacctctctcgttacttcag 6317 MGST1 46 (intron 3 3288-3289) ggtttatagtgttccccccc (C) tccccgcccccaaaagaccc 6318 MGST1 46 (intron 3 3288-3289) ggtttatagtgttccccccc tccccgcccccaaaagaccc 6319 MGST1 47 (intron 3 4682-4683) tcctcttcatgtctctatgt (GAGATGTTGTGGCTCACAT) 6320 tcctcttcatgtctctatgt 6321 MGST1 47 (intron 4682-4683) agtcatcctctttgtgagac MGST1 48 (3′flanking region 1359-1 acacacacacacacacacac CC/&Dgr; tgctctggagttgggcaact 6322 MGST1 49 (3′flanking region 1899-1 ttagaatagtttctaactat ACT/&Dgr; tttactcccaagagaagctt 6323 MGST1L1 1 (5′flanking region − 105) tgctgccgctgccgtggggc G/A gggcgtgggcggtgctggct 6324 MGST1L1 2 (intron 1 277) agtgtctgtgagagaagcag G/A ttctggagggtggagtgtgg 6325 MGST1L1 3 (intron 2 8030) ggggttatacagagcccctc C/G gcccccaccacacatatgca 6326 MGST1L1 4 (intron 2 8499) gtatggcaggagtggggtcc C/T ggcaagccatagaggtatgg 6327 MGST1L1 5 (3′untranslated region 46 cgccacctgtgaccagcagc T/G gatgcctccttggccaccag 6328 MGST2 1 (5′flanking region − 46) ggtcagcattcaaagtcaag A/T agcgccatttatcttcccgt 6329 MGST2 2 (intron 1 176) ggtcacccatgccgcctgct A/C ccctccttcccaggggcaag 6330 MGST2 3 (intron 1 204) tcccaggggcaagcagagac T/C gagaacattccagagattag 6331 MGST2 4 (intron 1 373) ttacaagtgttccaaaggaa A/T cgtgcctgcttctaaacctg 6332 MGST2 5 (intron 2 − 3245) cctcgtgatttgcccacctc G/A gcctcccaaagtgctgggat 6333 MGST2 6 (intron 2 − 1998) aggccgaggtgggcggatca T/C gaggtcaggagatcgagacc 6334 MGST2 7 (intron 2 − 1640) tgtttattccttgcatagcc A/G taatataaagtatgaatttt 6335 MGST2 8 (intron 3 41) actgtgttctaatgatgact A/G tgatgcttaaacgattaagg 6336 MGST2 9 (intron 3 453) atcagagtgctatgttgcag A/G tatatgaactttggcttcat 6337 MGST3 1 (5′flanking region − 520) acaaaaaggccctaacagcg A/C taaatccattcacttcggga 6338 MGST3 2 (5′flanking region − 355) cgcctaaaaccgctacggtg G/A ctctgctggggacaaattat 6339 MGST3 3 (5′flanking region − 234) ctgggggagtagatatatgt T/A tttgagaatgagaggagtaa 6340 MGST3 4 (intron 1 74) agcctttgcgcaggcacctc C/T atatttcagcctatgcgagc 6341 MGST3 5 (intron 1 682) agaaaatgccccttctttat G/C tggggtggcagcacggagcc 6342 MGST3 6 (intron 1 832) cgagtttacaagctacataa T/C agcgtcgggggcaagtaagt 6343 MGST3 7 (intron 1 1919) aataaaattcctgagtttct G/C tcactcgctcttacagtacc 6344 MGST3 8 (intron 1 1991) tgtaattaggcaacaggaaa A/G ttgtactatctttcaaatgc 6345 MGST3 9 (intron 1 4458) tcttccatcctcctaacata T/C agttagcttccactctccaa 6346 MGST3 10 (intron 1 4676) tgaatatgcaatgcaattgt C/G gggggatagttacttttcat 6347 MGST3 11 (intron 3 278) cagcataacccatctaaacc G/C atgttgactctcccacccct 6348 MGST3 12 (intron 4 423) cttgcctttttgttgtgggg T/G gtggggtggtcacagaaaag 6349 MGST3 13 (intron 4 506) gtgcagagaagaaaacaaag T/C ggggaaggtggaaaggggat 6350 MGST3 14 (intron 4 − 162) tcacagatattttattttcc C/T gactgaaactaacttaattc 6351 MGST3 15 (intron 4 − 130) acttaattctacctaatttg C/G gtggggagtagttggccaaa 6352 MGST3 16 (intron 4 − 105) ggagtagitggccaaatcat C/G aaattgttaactttttgcta 6353 MGST3 17 (intron 4 − 65) aacatattgtgtaatcaacc C/T taggtgttaaaaaaggtttg 6354 MGST3 18 (intron 5 105) atcccagcactttgggaggc G/C aaggcaggcagattgcttga 6355 MGST3 19 (intron 5 197) aaaaaatacaaaaattagcc G/A gatgtggtagtgcacacctg 6356 MGST3 20 (intron 5 222) tggtggtgcacacctgtagt C/T ccagctacttgggaggctga 6357 MGST3 21 (intron 5 374) cttatgctactatatttttt T/C ttcttgggaatttgagaaaa 6358 MGST3 22 (3′untranslated region 51 atgacttacctttatttcca G/T ttacattttttttctaaata 6359 MGST3 23 (3′flanking region 166) agtctgattgtggtgatgta G/T gtatagtcatgccacagtga 6360 SULT1A1/ST 1 (5′flanking region − 1597) gcagagtaaagggactcact C/G aagaagaggaacgtgggggt 6361 SULT1A1/ST 2 (5′flanking region − 1491) gagaggtatattcatgaaga G/T tccaggaaaaggtaaagatt 6362 SULT1A1/ST 3 (5′flanking region − 1376) cggtttcatatgttactgat C/T a/a taca a/g tgaaatcctaagt 6363 SULT1A1/ST 4 (5′flanking region − 1375) ggtttcatatgttactgat c/t A/G taca a/g tgagatcctagctc 6364 SULT1A1/ST 5 (5′flanking region − 1370) catatgttactgat c/t a/g taca A/G taagatcctaggtaaaac 6365 SULT1A1/ST 6 (exon 1B − 65) aaccctgcattccccacaca G/A cacccacaatcagccactgc 6366 SULT1A1/ST 7 (intron 1B 442) gagccaccctgcctaggcct G/A tgcttttgctgagtcatcag 6367 SULT1A1/ST 8 (exon 1A − 197) gctgggggtcccagcaggaa A/G tggtgagacaaagggcgctg 6368 SULT1A1/ST 9 (exon 1A − 159) ctggctggcagggagacagc A/C caggaaggtcctagagcttc 6369 SULT1A1/ST 10 (exon 1A − 95) gagaccttcacacaccctga T/C atctgggccttgcccgacga 6370 SULT1A1/ST 11 (intron 1A 60) ctggttttcagccccagccc C/T gccactga c/g tggctttgtga 6371 SULT1A1/ST 12 (intron 1A 69) agccccagccc c/t gccactga C/G tggctttgtgagtgcgggca 6372 SULT1A1/ST 13 (intron 1A 174) tgtgatggtggtaagggaac G/A ggcctggctctggcccctga 6373 SULT1A1/ST 14 (intron 6 11) catgaaggaggtgagaccac C/G igtga a/t gcttccctccatgt 6374 SULT1A1/ST 15 (intron 6 17) ggaggtgagaccac c/g tgtga A/T gcttccctccatgtgacacc 6375 SULT1A1/ST 16 (intron 6 35) gaagcttccctccatgtgac A/T cctgggggccggcacctcac 6376 SULT1A1/ST 17 (intron 6 71) ctcacagggacccaccaggg T/C cacccagccccctcccttgg 6377 SULT1A1/ST 18 (intron 6 100) ttggcagcccccacagcagg C/A cc g/a gattccccatcctgcct 6378 SULT1A1/ST 19 (intron 6 111) gcagcccccacagcagg c/a cc G/A gattccccatcctgccttct 6379 SULT1A1/ST 20 (intron 6 270) ctccctgccaaaaggtgtgc C/T acccagggccacagtcatgg 6380 SULT1A1/ST 21 (intron 6 488) ttttacttttcctgaatcag C/T aatccgagcctccactaagg 6381 SULT1A1/ST 22 (intron 6 509) aatccgagcctccactgagg A/G gccctctgctgctcagaacc 6382 SULT1A1/ST 23 (coding region 600 ccctctgctgctcaaaaccc C/G aaaagggagattcaaaagat 6383 (Pro 201 Pro)) SULT1A1/ST 24 (coding region 638 gatcctggagtttgtgggac A/G ctccctgccagaggagaccg 6384 (His 213 Arg)) SULT1A1/ST 25 (coding region 645 gagtttgtggggcactccct G/A ccagaggaaaccgtggactt 6385 (Leu 215 Leu)) SULT1A1/ST 26 (coding region 902 gctgtgagaggagctcctgg G/A gtcactgcagagggagtgtg 6386 (Gly 301 Ser)) SULT1A1/ST 27 (coding region 973 taaaatatgaattgagggcc T/C gggacggtaggtcatgtctg 6387 (Trp 325 Arg)) SULT1A2/ST 1 (5′flanking region − 547) tgttctttcttggttctatg G/C atccatgctctgctccaccc 6388 SULT1A2/ST 2 (5′flanking region − 425) tgtgggttgcactgggccag G/A acccctggcaccttcaaaac 6389 SULT1A2/ST 3 (5′flanking region − 358) ctttccagggcctgcctatc C/T ca g/t ctttctcctccaatccc 6390 SULT1A2/ST 4 (5′flanking region − 355) tccagggcctgcctatc c/t ca G/T ctttctcctccaatccctcc 6391 SULT1A2/ST 5 (5′untranslated region − actgcgggcgaggagggcac A/G aggccaggttcccaagaact 6392 SULT1A2/ST 6 (intron 1A 85) ctgactggccttgtgagtgc G/A ggcaagtcactcagcctccc 6393 SULT1A2/ST 7 (coding region 20 catggagctgatccaggcca T/C ctc t/c cgcccgccactggagt 6394 SULT1A2/ST 8 (coding region 24 (Ser 8 S gagctgatccaggaca t/c ctc T/C cgcccgccactggagtacgt 6395 SULT1A2/ST 9 (intron 2 34) gccacccaccctctcccagg T/C ggcagtccccaccttggcca 6396 SULT1A2/ST 10 (intron 5 77) cagcaaccctgtgtcggcac T/C ccctgcccacttctccagtg 6397 SULT1A2/ST 11 (intron 6 684) actggggtcccaggggtcga G/C gagctggctctatgggtttt 6398 SULT1A2/ST 12 (coding region 704 gttcaaggagatgaagaaga A/C ccctatgaccaactacacca 6399 (Asn 235 Thr)) SULT1A2/ST 13 (3′untranslated region 89 gctctgagctgtgagagggg T/C tcctggagtcactgcagacc 6400 SULT1A2/ST 14 (3′flanking region 98) cctccccgctccagctcctc A/T acttgccctgtttggagagg 6401 SULT1A2/ST 15 (3′flanking region 817) ccactgactcccggcttgcc A/C aggctgccagggctggcaaa 6402 SULT1A2/ST 16 (3′flanking region 1006) cctctcccctggaggctgct T/C tacccgctgtgggggcgcat 6403 SULT1A2/ST 17 (3′flanking region 1464) tcccgtagcccaggcaagtt C/T ggtgaccagagagcagcccc 6404 SULT1A2/ST 18 (intron 4 1728) tcagcttcctcctttgccaa A/&Dgr; cccagagatgagctggccta 6405 SULT1A3/ST 1 (coding region 843 cgcttcgatgcggactatgc G/A gagaagatggcagactgcag 6406 (Ala 281 Ala)) SULT1C1 1 (intron 3 2280) gcaaatttttggtattttta G/T tacagtcagggttttaccat 6407 SULT1C1 2 (intron 3 3742) gcagatctcactttctggca G/A attccctgaatttgctcccc 6408 SULT1C1 3 (intron 3 4453) ttcatagggcttttccctca C/T ttgttttgtaattttgtata 6409 SULT1C1 4 (intron 3 5234) gaaaagcgactagaggcagg A/G gagctttgcagttcttctaa 6410 SULT1C1 5 (intron 3 6175) tggctggcaggaaggtgagg G/C agtcctctcttctctggtcc 6411 SULT1C1 6 (intron 4 205) acatgaaggcaggatccaga T/C tgaatgtttggagggaacta 6412 SULT1C1 7 (intron 4 408) ggctcacgcctgtaatccca G/C cactttgggaggccgaggcg 6413 SULT1C1 8 (intron 4 429) cactttgggaggccgaggcg G/C gtggatcacaaagtcaggag 6414 SULT1C1 9 (intron 3 2106-2115) tgcagtggtcgtttgtttgg (T)8-11 gagacaaagtgtggctgtgt 6415 SULT1C1 10 (intron'4195-4210) atgcccagctaattttggta (T)10-13 agagacaggatttcaccatg 6416 SULT1C2 1 (5′flanking region − 110) tcctgttaactcacagagaa C/T ggaagggctggaacgggacc 6417 SULT1C2 2 (coding region 15 (Asp 5 G acactaatggccttacacaa C/G atggaggattttacatttga 6418 SULT1C2 3 (intron 1 297) gtagacttgtttatttattc A/C ttcccaatctaggcccttat 6419 SULT1C2 4 (intron 1 363) gagtgtgtgagctagacagg T/G gatcctgagtctgatttggg 6420 SULT1C2 5 (intron 1 2300) gggctactatgagcagccac C/T acctcaggaaggatgacttc 6421 SULT1C2 6 (intron 2 455) aagacttggaagcaaataga T/G aaaaaaaaaatcgtagaaat 6422 SULT1C2 7 (intron 4 55) caaaatctccaaacaggcta G/A aaggaaagaatcttttcttt 6423 SULT1C2 8 (intron 4 111) ctgccttctttaatggaaca T/C tctcacttctcttcaggaat 6424 SULT1C2 9 (intron 5 1657) ctttgtgtttactttgtttt T/C acttggtacaaaagtgttgt 6425 SULT1C2 10 (intron 5 2082) tctgctcctagagatggagg c/A gtcccacagccacagtgatg 6426 SULT1C2 11 (intron 6 933) agctagtgaacccctcccac A/G taactgtatttcaggggcag 6427 SULT2A1 1 (intron 2 478) ggactggctgctgtacacac T/C tcgtcttactgtgtgtaaat 6428 SULT2A1 2 (intron 3 382) caaaaccctcttaatattct G/A tttctatctgtctcagaact 6429 SULT2A1 3 (intron 3 409) tctgtctcagaactgattgc A/G tgactctaggatcgctatat 6430 SULT2A1 4 (intron 5 249) agctggaaattacaggcaca C/T gccaccacacccagctaatt 6431 SULT2A1 5 (intron 5 395) aggcatgagccagggcgccg G/A gccaatttatcaactttaat 6432 SULT2A1 6 (3′flanking region 33) ttccttgttaaaagtcacca G/C ggttggccaggc a/g cggtggt 6433 SULT2A1 7 (3′flanking region 46) gctacca g/c ggttggccaggc A/G cagtggttcaggcccccaac 6434 SULT2A1 8 (3′flanking region 199) ttagccaggcgcattggctc A/G tgtctgtaatcccagcactt 6435 SULT2B1 1 (intron 2 4162) ctctccccgcggcctaccat C/T cgcacacaggtgatctacat 6436 SULT2B1 2 (intron 3 879) gagggcatccagctctgggg G/A ctggacctgggggtttgtgg 6437 SULT2B1 3 (intron 4 3882) ttccacgctccttccggggc C/T gagcgccccccccccgccga 6438 SULT2B1 4 (intron 5 1780) cctgcagaagggggtccctt C/T catgtccaaacagtaatggc 6439 SULT2B1 5 (intron 5 1814) taatggctgcagcatggagc G/A gtgtggaggcattgagacag 6440 SULT2B1 6 (coding region 789 ccctcttctccaggggtctg C/T ggcgagtggaagaaccactt 6441 (cys 263 cys)) SULTX3 1 (intron 1 332) cctgcttctccctttacctg G/T ctgactgtatgaccttggac 6442 SULTX3 2 (intron 1 1167) caggaatggctaagcgtatc G/A ttggcttctgtggccactca 6443 SULTX3 3 (intron 1 2872) cattctcactgatgcagagg G/A aagcttctgggcctgggcgt 6444 SULTX3 4 (intron 1 6242) cacccttggcttttaccagc A/G tggaaacattttacctgaat 6445 SULTX3 5 (intron 1 6601) gcgtgggcttctggagggag C/T gagaggagagtggagggcgg 6446 SULTX3 8 (intron 1 6768) agcttgaaatgagccagact C/T ccctgggacctgttgacccc 6447 SULTX3 7 (intron 1 6905) agtactttgttttatcctcc C/T catcctcacaactttgccat 6448 SULTX3 8 (intron 1 7464) gccaggatcccttgagagac G/A acatgaacacagccaggagc 6449 SULTX3 9 (intron 1 7833) tgcttcgggctgggcttggc G/A ggggcagctgtgctccaggc 6450 SULTX3 10 (intron 1 8189) caaactggggcccttaatgc C/T gcacaccagagcctcctttc 6451 SULTX3 11 (intron 1 8316) ctctcacacaagggcggagc C/G ccttccccttgaggcagagc 6452 SULTX3 12 (intron 1 8617) agacagaggctggggccaag C/T cagggttgccggagcttccc 6453 SULTX3 13 (intron 1 8631) gccaagccagggttgccgga G/T cttcctggactggtcaggcc 6454 SULTX3 14 (intron 1 9493) ccccccccccagagcggccc G/A ccgtgctctgtgtcgagggc 6455 SULTX3 15 (intron 1 10306) caggcggggagcctgaatgc C/T gcagtcgtgagggtggccag 6456 SULTX3 16 (intron 1 11987) ccataaaataatgatatcag T/C acactttttggaaatttgag 6457 SULTX3 17 (intron 1 13085) ctctgtgcccggtgttgaga C/A aggccatgccctagagtcct 6458 SULTX3 18 (intron 1 13108) gccatgccctagagtcctgg G/A gagttccaccccagaacagc 6459 SULTX3 19 (intron 2 700) gaaccatctgggagtcgttc C/T gtactgccgtgccgagggcc 6460 SULTX3 20 (intron 2 818) agccatagtagctagccagc G/A atcagcgctgggaggggagc 6461 SULTX3 21 (intron 2 1677) accccacggccccggaaccc C/T accccttccttcctcctctg 6462 SULTX3 22 (intron 4 4954) gcgtgccgaaggcgggaggg C/T cgggatggctcaagaggtga 6463 SULTX3 23 (intron 5 3632) ccagcggacccccacaccag C/T ggtcagagaacattgtcttt 6464 SULTX3 24 (intron 5 3662) acaccgccggccaaggccgc C/T gaagtgctgcaataaagaaa 6465 SULTX3 25 (intron 6 1874) cctgatctcagagagctgac A/G atggaaagaattctaaacga 6466 SULTX3 26 (intron 6 2133) agaccggtgcctgcagttta T/G cccacagctcagcccgccct 6467 SULTX3 27 (intron 6 2524) ggaagggccagggctgcctg T/C gatgcccagagcagtgcact 6468 SULTX3 28 (intron 6 2573) agatcatactcgctcctggg A/G cgcccaccaaacaccggcca 6469 SULTX3 29 (3′flanking region 12) gttcccggcgttgcgtcgag C/G gtttctgcttgtgggggtag 6470 SULTX3 30 (3′flanking region 445) tccaaagcctgtcttcctga T/G ttcctgtggaaggagagtcc 6471 SULTX3 31 (intron 1 6418) ctctccctgttagtgtgggg G/&Dgr; cagctctttccagtgtcctg 6472 SULTX3 32 (intron 5 2458) cccttaaagggaagttcatc C/&Dgr; ttctctgccttccaggctcc 6473 TPST1 1 (5′flanking region − 298) acccgccaccatgnccagct A/C attttttttgtatttttttt 6474 TPST1 2 (intron 1 3520) agaaaagcagattaatgtaa C/G agtgacgcttagacaacaag 6475 TPST1 3 (intron 1 3610) ggcagaaagagaatatagca A/G ctattaaacacaaataaatt 6476 TPST1 4 (intron 1 20820) tattgctgtccacctggtca A/G tgtgtcctctggataagtgc 6477 TPST1 5 (intron 1 − 6761) aatacaatacttattctgta T/C aattctagagggcccagaga 6478 TPST1 6 (intron 1 − 544) tagaacaagtgaatatttta C/T gttcttagtggtttatggtt 6479 TPS71 7 (intron 1 − 526) tacgttcttagtggtttatg G/T ttggcagttttcccccaaca 6480 TPST1 8 (intron 1 − 234) tcaagacatttaataatgca C/T acgtttcagccaaccctttt 6481 TPST1 9 (intron 1 − 48) ttatagtgggtttaagcatg A/G tttctaaaaaatttaaataa 6482 TPST1 10 (intron 2 − 18944) aaaacattagaactgggaag G/A ttaaaaaatctttagtcttt 6483 TPST1 11 (intron 2 − 18687) tctgtgcaccctaataacat A/G tttccttaaaactagtacta 6484 TPST1 12 (intron 2 − 18501) ttggaaggtaacttaatgta A/G gtgcctgaaaaacagggata 6485 TPST1 13 (intron 2 − 159) gaatggggatttccctcagt C/G ctgcccactggctgctcttg 6486 TPST1 14 (intron 2 − 19) acctgttgccttaaactcac G/A cctgctttgtttttccaggt 6487 TPST1 15 (intron 3 158) cgctggggaagaaagatcag C/G gtctgggacttgttgatttt 6488 TPST1 16 (intron 3 3779) agcagggcacgtcaccctcc C/T ggcacacccatgtgttcacc 6489 TPST1 17 (intron 4 292) ttgttattttcattatgaac C/T atgaaatatttaagctggaa 6490 TPST1 18 (3′untranslated region 15 gttgtctgtacatgttctaa T/G gttttgtagaacacgtgtgc 6491 TPST1 19 (3′flanking region 264) acggtgcttggcctgcatta C/T cattttgtagtgaagtttct 6492 TPST2 1 (intron 2 578) tcacctatcatcctcactgc G/A aggatgccaggatacctccc 6493 TPST2 2 (intron 2 789) cttaagccatcgtgcaggtc A/G ttgctgtcttctgctcactt 6494 TPST2 3 (intron 3 2009) cccaggctggagtgtagtgg T/C gtgatct c/t ggctcactgcaa 6495 TPST2 4 (intron 3 2017) ggagtgtagtgg t/c gtgatct C/T ggctcactgcaacctccgcc 6496 TPST2 5 (intron 3 2035) ctcggctcactgcaacctcc G/A cctcccgggttcaagcagtt 6497 TPST2 6 (intron 4 104) aatgttcagtctctcaattc C/T tggtcgtctgatttgttcct 6498 TPST2 7 (intron 4 379) taaataaataaactattggt C/T cctttcttgtcttataaggt 6499 TPST2 8 (intron 4 588) tacagcagcctgatacttct C/T ggcttgagccatcctctcac 6500 TPST2 9 (intron 4 626) caccccaggctcctgagtag C/T taggactgcaggtgcacgcc 6501 TPST2 10 (intron 4 718) cccaggctggtctagaactc C/G tggccgtaagggatgcccct 6502 TPST2 11 (intron 4 873) gttgatggccttatttatac G/A tttccattacagcttctagt 6503 TPST2 12 (intron 4 949) caaatatttgaaaatgggac C/G caggcccgaggaagagcttt 6504 TPST2 13 (intron 4 1033) taagctcagcatttctgagc G/A tgtgctgattttaggaaata 6505 TPST2 14 (intron 4 1051) gcgtgtgctgattttaggaa A/G taaacagttatcgtattgaa 6506 TPST2 15 (intron 4 1356) gattcaacgtacataccagc C/T gacattgacaggtggatggc 6507 TPST2 16 (intron 4 1707) gtctccttaaaaggtggctc G/T ctgcccctggctcgccccag 6508 TPST2 17 (intron 5 215) aagaccagcctgaccaaaac G/A gtgaaaccccgtctctacta 6509 TPST2 18 (intron 5 341) tgggaggcagaggtcgcagt G/A agctgagatcgcgccgttgc 6510 TPST2 15 (intron 6 31) ggacttcactgggggttccc G/A ctgcttctgggtggecccgg 6511 TPST2 28 (intron 6 273) gtttgtctgacactggggac A/G gggcaggaagcaccactatg 6512 TPST2 21 (intron 6 693) aaagggatttttttgaactt G/C gtaattcaaagatttaagat 6513 TPST2 22 (intron 6 1635) ccctgggtacagagttggcc T/G tgaacaaacatgagtccttc 6514 TPST2 23 (3′untranslated region 11 cttccccactttcagatctc C/T gcaaatggcttcattgccaa 6515 CST 1 (intron 1b 6302) agagctccccagagaggact A/G tgaggctgcatgatgcatga 6516 CST 2 (intron 2a 1004) gagtgagacccccatctctg C/T aaaattttttttaaaaagta 6517 CST 3 (intron 2a 1395) atgcctaagtttacagtagc T/C aggcaggaaaggcacaacca 6518 CST 4 (intron 1d 473) ccagagcctgaggttggtgc T/A ggggcccctccatggctgcc 6519 CST 5 (intron 2b 726) ctatctctccagtgcctctc T/C gcccctgtctggaccctgct 6520 CST 6 (intron 2b 745) ctgtccctgtctggaccctg C/A tggggggccacagagcaggc 6521 CST 7 (coding region 55 tcactagtttcctgctgctg C/A tgtactcctatgccgtgccc 6522 (Val 29 Met)) CST 8 (intron 3 308) tcgtctgaggtcaggagttc G/A agaccagcctggccaacatg 6523 CST 9 (intron 3 853) ttttgtcctataaaatggca G/A tttcatgtggcccaagctga 6524 CST 10 (Asn 66 Asn)) gaggcagtgatccgggccaa C/T ggctcggcgggggggtgcca 6525 ST1B2 1 (intron 1 80) acttgtccataaaatcatta C/T cattctaaataaagttaata 6526 ST1B2 2 (intron 2 − 352) aacatttaaatagtcattta T/C agcaatgcacaggcataata 6527 ST1B2 3 (intron 2 − 85) attacataatgctaaaaaat G/A tcttgaaaaactggttggca 6528 ST1B2 4 (intron 4 460) gtacttgacattaaaaaata T/C ctgatgttt a/g tatatccata 6529 ST1B2 5 (intron 4 470) ttaaaaaata t/c ctgatgttt A/G tatatccataaatagctaat 6530 ST1B2 6 (intron 4 518) tttaagattgtcctcatatt C/G ttacttcctttggttactaa 6531 ST1B2 7 (intron 4 616) aatgtttatgaaaatagact T/C ttatctggttttagtggcct 6532 ST1B2 8 (intron 5 58) ctgcatcatgctgtaaaagg G/A gtgatatttgctttccaact 6533 ST1B2 9 (coding region 612 taatagaatccaaaggagga A/C atcaagaagatcattagatt 6534 (Glu 204 Asp)) ST1B2 10 (intron 6 582) aatacattacttccatttaa G/A tagcctgcccatcgcggctt 6535 ST1B2 11 (intron 6 3130) agatgtaaaaaattattcaa A/T ttttaaaagccggaaaaatt 6536 ST1B2 12 (3′untranslated region 90 cctaaagtgcctaaaccaca C/A atcggaagaaacaagagatt 6537 ST1B2 13 (3′flanking region 55) tcagatcccagttttgttcc T/G ttgattctgagtttccaaat 6538 ST1B2 14 (3′flanking region 328) tttgacccaggacactgtgt T/G ccactgctgtctaccgagtt 6539 ST1B2 15 (3′flanking region 446) gtagttcagattttggaaat C/A ttttttctatatcataccta 6540 CHST1 1 (intron 1 3900) gccctgcccccactcccaga C/G ttgcggccctccagcccctt 6541 CHST1 2 (intron 1 6520) cctcccccagaggagctggg C/T acactggggccttgtgttgt 6542 CHST1 3 (intron 1 7963) aaaacattcatgggggatta G/C tgctggctacgtcagagtca 6543 CHST1 4 (intron 1 9173) gcgctgccacagatcaggcc G/A aggtgggggacagaaatgcc 6544 CHST1 5 (intron 1 9701) cccagaattctgaatacagc A/G gcgatgacgggactacgagg 6545 CHST1 6 (intron 1 12132) aacagatccacaggaccaga C/A agcaaaggggaggaacatgc 6546 CHST1 7 (intron 1 12465) atgcagggaaggggcttggc G/A caaaactgtcaactgagata 6547 CHST1 8 (intron 1 12561) atgctccctggtccactttc G/A ctttgagtttcaggtagctg 6548 CHST1 9 (intron 3 529) ccatggtctgcaggggtcct T/G catgctcaggggattggggt 6549 CHST1 10 (intron 3 617) agaggacagaggaaagagga C/A cacctggagaactgggcgcc 6550 CHST1 11 (intron 3 796) aagaggcttccgcagctgtc C/T gcaggttaaatcctggggtg 6551 CHST1 12 (intron 3 818) caggttaaatcctggggtgc A/G aggaatgtttgttcagctcc 6552 CHST1 13 (3′flanking region 762) ataactggtacaggtttact G/C gtgtctacactggcagagaa 6553 CHST1 14 (intron 1 7874) gttttccccttgccttgcct T/&Dgr; cattttcatcacctcatttt 6554 CHST1 15 (3′flanking region 335-3 cacactgccacacctggcta (T)12-15 ggattttagtagagacgggg 6555 CHST2 1 (5′flanking region − 260) agccggacagtccgccgggc G/A gtgatccgggggccgctccc 6556 CHST2 2 (5′flanking region − 56) gcgctggggaccagcggccg C/T gcccgcctgggagtcgcggc 6557 CHST2 3 (3′flanking region 218) aggagtgaaacacatctttg T/A attctaaaggcagaaaccaa 6558 CHST2 4 (3′flanking region 383) gcagagaccaatgttttggt G/C ctgagctgggttcagaaaaa 6559 CHST2 5 (2340 flanking region 952) tactgaaacattctgcagaa T/C gttatactctgagaagaaat 6560 CHST3 1 (5′untranslated region − 2 tccagcgtgccgaccggccc C/G gcagcgcctccatccctccg 6561 CHST3 2 (intron 1 96) gcgtccaggcgcgcgcgcca G/A actttggagggagaaggggg 6562 CHST3 3 (intron 1 4467) agagaagaatggggcagagc C/G ggagcagccaggggaggtga 6563 CHST3 4 (intron 1 4853) ggatgagcactgcccagctg A/G cccctgcccaccctccacag 6564 CHST3 5 (intron 1 4965) cccacggcagaggggacaca G/C tgaccaggacggaagttggg 6565 CHST3 6 (intron 1 5046) gggcggtccatctttgtacc C/T cgggttccatcccagtgcct 6566 CHST3 7 (intron 1 5300) ccttttctcctctaaggcct A/G aagagatgacagaatgctgc 6567 CHST3 8 (intron 1 5354) agcgcgtggactccacagcg G/A ggcgtggggtggcccctggc 6568 CHST3 9 (intron 1 5428) gacacgcttcagccctctgt C/G cccaccgccccaaatctggc 6569 CHST3 10 (intron 1 6555) gagtggggcactgctggaag G/C ctctggcccctgcggcgccc 6570 CHST3 11 (intron 1 6990) aaacacactgggcccccccc G/A tccccgcactgtgactacac 6571 CHST3 12 (intron 1 7133) ctgagggcctgtcctgcagg T/G ttgatgtgtctgaagaggcc 6572 CHST3 13 (intron 1 7161) gtctgaagaggccccgagaa T/C agaaatctagaacctgccag 6573 CHST3 14 (intron 1 7199) cagtcacgaagcagtgtcac C/T caccagaggatgaagaactg 6574 CHST3 15 (intron 1 7316) cttgcatctggtgtaggtgc C/T cgggggtagcgtgcccagga 6575 CHST3 16 (intron 1 7967) gacaggaaccccaccccgag T/G gatgtctggccctgtgacct 6576 CHST3 17 (intron 1 11412) gcttgcacttctgattcatt C/T tgcagtcactggctctttgt 6577 CHST3 18 (intron 1 11591) ccctggaagggcctcagtgc G/A gtgactcattacccagcatg 6578 CHST3 19 (intron 1 12541) acccacacagcatgaatggg G/C ccagccccagcctgcgggct 6579 CHST3 20 (intron 1 12672) gtagccaaagctggggctgt G/C gggtcagggcatggcaaggg 6580 CHST3 21 (intron 1 14809) ggatgtgtagggtttgggct C/T ggccttaagggatgggtgga 6581 CHST3 22 (intron 1 16161) gatgctggtcaggcattgtc G/A gtgggatctttaacaccacc 6582 CHST3 23 (intron 1 16385) tatttagcatgtgggtttca A/C ctttctgttttttcaaaggg 6583 CHST3 24 (intron 1 33638) gacttgggccacgtccttgg G/C catgaatcttggtctatgtc 6584 CHST3 25 (intron 1 35145) agggaagccgaagcctcact T/C gctggggcttgcctggccta 6585 CHST3 26 (intron 1 35340) tgtgaagttttgcccacagt T/C ggtggccatggttcgcaccg 6586 CHST3 27 (intron 1 35436) gccactcatgtatggagcaa T/C tgcctttttttcttcctctt 6587 CHST3 28 (intron 1 36150) acatagaagaggctgggcct G/T aggaagccagggaagcagga 6588 CHST3 29 (intron 1 36194) ggtgtggggaggccagcagg G/A gcgcgggcctcagcggcgag 6589 CHST3 30 (intron 1 37602) ctggaacagcaacttaaaaa A/T agaaatagtccctggaaggg 6590 CHST3 31 (intron 1 37725) gggtagcaagggcagctccc C/T gaccggca c/g ccgccttccca 6591 CHST3 32 (intron 1 37734) gggcagccccc c/t gacccgga C/G cggccttttcacccctctcc 6592 CHST3 33 (intron 1 38208) gccattctagatgcgagtcc C/T gactttgggg t/c gctcgcatt 6593 CHST3 34 (intron 2 255) ctacagctgtgaaaggctag A/G caagatacttaacatttctg 6594 CHST3 35 (3′untranslated region 2 acacctcagaggagcgtgtg C/A ccaacatttgtaggattatt 6595 CHST3 36 (3′untranslated region 2 aggcctcatctggggtaggg C/G caagaggaaagtacagagtg 6596 CHST3 37 (3′untranslated region 2 ctggaactcccccgtagggc C/T cggggaagagtattgcttaa 6597 CHST3 38 (3′untranslated region 2 cttaacgcaggatgtgctgg G/A tgttttgtttcgggctttta 6598 CHST3 39 (3′untranslated region 2 gcttggtgtctttcttgttt C/T atggctgtgtttttgctttt 6599 CHST3 40 (3′untranslated region 3 ccgagggctgcccagctgtg C/T ttctggtttccggggcaatt 6600 CHST3 41 (3′untranslated region 3 ctgtcagatacggcccatcg T/C aaacccagagggctgcattt 6601 CHST3 42 (3′untranslated region 3 gttccccatgtggaggtcgg A/G ggggctgggactggggaggg 6602 CHST3 43 (3′untranslated region 3 ggccctgctaatgtggacag T/C agaccccaggcccccctctt 6603 CHST3 44 (3′untranslated region 4 ccagatgtgcatagaagcca G/A ccccggccacatacacggca 6604 CHST3 45 (3′untranslated region 4 caaagcaaatttaggctttt G/A cccggcggcaatacacgcac 6605 CHST3 46 (3′untranslated region 6 accccaggccggcagggtac G/A agacaccccttcac g/a gcaca 6606 CHST3 47 (3′flanking region 281) agacaggagtgttgggccag C/T ggccagggggcctggggatg 6607 CHST3 48 (3′flanking region 997) acctcttaaagtatttgagc C/T ggtgcctgtcatcccaacct 6608 CHST3 49 (intron 1 22595) cgggagcaggaaaaaaaaaa A/&Dgr; gaataagaagaaaagaggct 6609 CHST3 50 (intron 1 35423-35424) gctcatgctcacagccactc AT/&Dgr; gtatggagcaa t/c tgcctttt 6610 CHST4 1 (5′flanking region − 1092) atgaagccttgtgccatctc G/A ctgtgtcgtgccagcacctg 6611 CHST4 2 (5′flanking region − 941) ctgccagagagaaacaggaa G/A ggaggaagagccacacaatt 6612 CHST4 3 (intron 1 − 150) caggaaatgatttggagaag G/T actggtgccattgttggcac 6613 CHST5 1 (intron 1 − 144) ggcctcttaggtttcagcca A/C gacaggtgactcttagcacc 6614 CHST5 2 (intron 2 17) caacgtcagagcgcttctca T/A tgtccagctcctttgtttct 6615 CHST5 3 (intron 2 139) aatcccagcactttgggagg C/A ggagatgtgcggatggatca 6616 CHST5 4 (intron 3 1829) gactgtctgtctgctattca T/C ataggaacaaataattcatg 6617 CHST5 5 (intron 3 2037) aaatgaaaccaacaccaaca C/G tgcagagaagcaaacaaaag 6618 CHST5 6 (intron 3 2134) aagcagctaaattgtgttcc G/A tacaggtgcaattaggcagg 6619 CHST5 7 (intron 3 2528) atggtaaagttcgcctgggt G/A cagtatgtcagcatcctgct 6620 CHST5 8 (intron 3 2674) gcacttatcctagaaaggcc A/G cccctgaagactcagcagga 6621 CHST5 9 (intron 3 7039) cgggcccccgccggccaccg T/C gggaccgcagccacgtctga 6622 CHST5 10 (intron 3 7211) gtagccccaggacaccccca T/G cctcaacatcccattctggg 6623 CHST5 11 (intron 3 7294) ggagcttccagtggcttggt T/C acccccgactcttcgtccat 6624 CHST5 12 (intron 4 108) gcagggtcctgcactctgca G/A ggggcaatcacaggtgggag 6625 CHST5 13 (intron 4 402) agcactggaaaaagtacagt T/C gcacttgtagcggaggtggg 6626 CHST5 14 (intron 4 547) ctcctgtccccgcattgagg C/G gaaggagcagaggtgagatc 6627 CHST5 15 (intron 4 1142) gccccaggtctcatagctcc C/G cattggcagtgctgggattt 6628 CHST5 16 (intron 5 1187) cactgggcagtaattggggc A/G tgggatgggcatgagggccc 6629 HNK-1ST 1 (intron 1 139) gtgttttggcgacttganga C/T ccccctagtccgcaggagta 6630 HNK-1ST 2 (intron 1 1020) acctgagcagaaaattctct T/C cttcgcggaaatgaaaattg 6631 HNK-1ST 3 (intron 1 1091) aagaatttgtaaacatgaca G/A gcaacgggcagctctaggcg 6632 HNK-1ST 4 (intron 1 1971) ctataactatttcaaacata C/T gaaacaggcataattggatt 6633 HNK-1ST 5 (intron 1 2096) acttagaatattcatttacc A/C agaaatccaaatataacctg 6634 HNK-1ST 6 (5′untranslated region − 9 ctacccagtgacaagaggaa C/A caagaacatcagctcagggg 6635 HNK-1ST 7 (intron 2 − 530) agtgggcggaggcgagaagc G/A tcagtgcccaggcctcggct 6636 HNK-1ST 8 (intron 2 − 466) gctacatcttgtcagccagt C/T agaattttaaacacagccag 6637 HNK-1ST 9 (intron 2 − 92) acggaaatatttgtgctgat A/T cctactgactgaaatcacct 6638 HNK-1ST 10 (intron 3 152) cagggcccccgccccggcac G/A ccacagaggcgcgaggggag 6639 HNK-1ST 11 (intron 3 312) cacagtggccccatgccttg C/T agcagggcgcctcccaggct 6640 HNK-1ST 12 (intron 3 1948) tcctttgatgtatcaagttt T/C gcgctgaaggttcccagtgt 6641 HNK-1ST 13 (intron 3 2140) ctacacctggagaggagcac C/T gcagcggtccttaatactgc 6642 HNK-1ST 14 (coding region 187 agaagcacattccggaggaa C/T tgaaggtgggcacagccagg 6643 (Leu 63 Leu)) HNK-1ST 15 (intron 4 581) ccggatcattccctagctgg G/A aggaggggtgcactctggaa 6644 HNK-1ST 16 (intron 4 615) tcgggaaggccgctcacttc G/C taacccccattcgggaccca 6645 HNK-1ST 17 (intron 5 7) gattgttctaaatggtgtgt G/A cgggtctactgaatgtccac 6646 HNK-1ST 18 (intron 5 123) acctgcagggacgggtggcc G/T cccagacaggccggtcggtg 6647 HNK-1ST 19 (intron 5 721) acaaccaggggcccggccca T/C gaaatttagcttcagacagg 6648 HNK-1ST 20 (intron 5 867) cgctgcccacagagtcggtg G/A ccacccctggccactgtttg 6649 HNK-1ST 21 (coding region 444 ccaggagcattttcttccat T/C gaggagatccccgaaaacgt 6650 (Ile 148 Ile)) HNK-1ST 22 (intron 6 94) ctgagttctgtacttggcag A/G ccgatcggaggaccacagag 6651 HNK-1ST 23 (intron 6 247) caggaaggcgacaccacccc G/A ccaacagaaattagcaggca 6652 HNK-1ST 24 (coding region 696 aggaggcaccggacagagac C/G cgggggatccagccggaaga 6653 (Thr 232 Thr)) HNK-1ST 25 (coding region 870 gagaccctggaggacgatgc C/T ccacacaccccaaaagaggc 6654 (Ala 298 Ala)) HNK-1ST 26 (3′untranslated region 11 tcaaacatccctaccagacc T/C ggggctaaccaggtgaagat 6655 HNK-1ST 27 (3′untranslated region 11 ccacacccctcctttgagga C/T gcccggggtctcccacaggc 6656 HNK-1ST 28 (3′untranslated region 13 ggaagcatcacacagcgcta G/A gagccgcctccctcaggcgt 6657 HNK-1ST 29 (3′untranslated region 14 cgaggccccccgggccagcc A/G gggcggcggcacccatcact 6658 HNK-1ST 30 (3′untranslated region 15 gcaagggggctgctgaaatc G/C cagagacttttgcagcatca 6659 HNK-1ST 31 (3′untranslated region 16 gggcggtgcggcgtccaggg G/A cccatctttccagaatccat 6660 HNK-1ST 32 (3′untranslated region 18 aggggaggctttttctacct G/A agaaggggagtgtctttgag 6661 HNK-1ST 33 (3′untranslated region 22 tccagcagtgcggcttcctg G/T c/t aacaaggtaggccctggtg 6662 HNK-1ST 34 (3′untranslated region 22 ccagcagtgcggcttcctg g/t C/T aacaaggtaggccctggtgc 6663 HNK-1ST 35 (3′flanking region 1016) cacacgaaggtgtgcactca C/T ggccggcagggcacccaggt 6664 HNK-1ST 36 (3′flanking region 1102) gcaggcggtgcccaccggga A/C cccccagaagcagggaacag 6665 HNK-1ST 37 (3′flanking region 1291) gccgagaccctcagcaggat A/G gcgcagctacagggcggagc 6666 STE 1 (5′flanking region − 605) caggtttctaaaataataat C/T gaaaggcgagtgatgtttac 6667 STE 2 (5′flanking region − 536) caaaacccccaggccggccg A/G agagttaaaggcaaagagtt 6668 STE 3 (5′flanking region ″231) ccttcttccccaacccctga C/T ggcagacttgggaatttgaa 6669 STE 4 (5′untranslated region − 6 cgcagcttaagatctgcctt G/A gtatttgaagagatataaac 6670 STE 5 (intron 1 69) aaatatagaatgaaaattat G/A caccacaaagctcttaaaaa 6671 STE 6 (intron 1 311) caaggagaaaataaagcaag C/G agggcagaaggaggcagaat 6672 STE 7 (intron 1 655) cctaagaaagtagggactat G/A agaacccctatgtatctata 6673 STE 8 (intron 1 672) ctatgagaacccctatgtat C/T tatatccaccatagtattct 6674 STE 9 (intron 1 772) aaaaggcaggttggaagatg C/A aggaggggagtatgcagaaa 6675 STE 10 (intron 1 1715) taaccatcttgcttaacctt A/G tcatttttagccaagtcatt 6676 STE 11 (intron 1 1928) aaatgatacatattcaggaa A/G tcaaaaatctctgacttaga 6677 STE 12 (intron 1 1953) aaatctctgacttagatacc C/T ggcaataataatcaaatgta 6678 STE 13 (intron 1 2087) aattttgaaagaaattgaag T/G tctgtggtttttatttatca 6679 STE 14 (intron 1 2323) taggtatgtaggagggtccc G/C ttatatacatagttgttaat 6680 STE 15 (intron 2 165) tctattccatgaccacaatt T/G ttacctgtaacttgaatagt 6681 STE 16 (intron 2 1707) cctaggacccaacatgagac A/G taatataccatcagtaaaat 6682 STE 17 (intron 3 850) ggtgtccattccctcaagaa T/G ttatactttgtgttacaccc 6683 STE 18 (intron 4 1653) agtaacaggctagtagataa T/C ataaataactgaggccaacg 6684 STE 19 (intron 4 1899) tacatgaacttagagaatca A/G gtagatcacacacaccaaca 6685 STE 20 (intron 4 1930) cacaccaacaataaaAttac A/G cagaatgataaaagaatttg 6686 STE 21 (intron 5 666) ttctgatcatgtaggaacaa T/C tataaagaaaataataatgt 6687 STE 22 (intron 5 982) aggcaaagcggcAcctcgtg A/C ctcacacaacattatattat 6688 STE 23 (intron 7 369) agattttattcctctctctt T/C ttgagttgaagaaataagtt 6689 STE 24 (intron 7 447) cacctttcaagggtaagtgg C/A aaaaaatagaaattcaaata 6690 STE 25 (intron 7 672) aatcttgctctttgaaccac A/T ctgtcagtgagagtcaggga 6691 STE 26 (intron 7 856) cgttacagaggacttaaaac A/G gttgtcttgcttgcaaacgg 6692 STE 27 (3′flanking region 218) cagcctcccaagtagctagg A/G ctacagacatgtgcaaccat 6693 NQ01 1 (intron 1 80) aggaggttgtaggggcttgg C/A ctgaattttgttccttgact 6694 NQ02 1 (5′flanking region − 434) tttctgttgcaccacggacc C/G ccaggctgtaaccgggatac 6695 NQ02 2 (5′flanking region − 406) gtaaccgggataccagccag A/G gatggggagcgggaggcgca 6696 NQ02 3 (5′intranslated region − 1 tcctgcggctcctactgggg A/C gtgcgctggtcggaaggtga 6697 NQ02 4 (intron 1 1919) tcactcaaatagagctgagt T/C agtcactcagctcttagaca 6698 NQ02 5 (intron 1 2004) acaaactcacatgccaccag C/G catatgatgtaaacatgtaa 6699 NQ02 6 (intron 1 3391) aaagcagagggctgtgcagg C/T gcccctgcccctagctgagg 6700 NQ02 7 (intron 1 3456) caaaggcctcatccgcaggg C/A ggccaactctictgttttag 6701 NQ02 8 (intron 1 3595) actgcccagctttaggttca T/C ccgtgtaagtgttgctggtg 6702 NQ02 9 (intron 1 3596) ctgcccagctttaggttcat T/C cgggtaagtgttgctggtgt 6703 NQ02 10 (intron 1 3598) gcccagctccaggcccaccc T/C tgcaagtgctgctggtgtca 6704 NQ02 11 (intron 1 3651) cccggcctgttgaagggatg A/G atgtgacctctcccacattc 6705 NQ02 12 (intron 1 6036) tggtgtggcggttcactgat C/T ccccagccttctgctcgatc 6706 NQ02 13 (intron 2 14) agggcaggtaaggattcact A/G ttgtggagtaagaccctttt 6707 NQ02 14 (intron 2 192) gccacgtggaagtgtataaa C/T tatcgggaactaccgtgcgg 6708 NQ02 15 (intron 2 635) cacactgtttagcacctagc A/C ccatcccgggccgcggccca 6709 NQ02 16 (intron 2 685) agcagcaccccccccccAcc G/A gcggtgacaaaccaaaatgt 6710 NQ02 17 (coding region 139 ctgatgtgtatgccatgaac T/C ttgagccgagggccacagac 6711 (Phe 47 Leu)) NQ02 18 (intron 3 36) aatgctctatttataaaaac T/C acccccaggttttccacccc 6712 NQ02 19 (intron 3 728) aacgtgggcataaaccacca T/C ctagtgccaaaaagcaggtg 6713 NQ02 20 (intron 4 1577) cgccgctgcacaccccggcc C/T gacaccagccctttctttac 6714 NQ02 21 (intron 4 1832) ccggccggccacgtggagcc C/T gccttcctccgggcacccac 6715 NQ02 22 (intron 4 2583) cggtgttacgcacagctcct C/T gtcccctccctgcctgccca 6716 NQ02 23 (coding region 330 ctgtactggttcagcgtgcc A/G gccatcctgaagggctggat 6717 (Pro 110 Pro)) NQ02 24 (coding region 405 atcccaggattccacgattc C/T ggcttgccccaggcctgtgc 6718 (Ser 135 Ser)) NQ02 25 (intron 5 21) gtatgtgctcttggacaagg A/T ccactatggatagttggagg 6719 NQ02 26 (intron 5 253) atggcaaacaagggagtggg T/C caggtgtcaggtgacggggg 6720 NQ02 27 (intron 6 2435) ecccccccaaataatctaac T/C gaagggtatgtaacaggtgt 6721 PIG3 1 (5′flanking region − 47) gggaaggaggaaaggaaaga G/A ggggagggcggttcggctta 6722 PIG3 2 (intron 2 243) caacaccggacgcccagcag A/C agccccagctccgtagaatc 6723 PIG3 3 (3′flanking region 282) agcaggccccagccgggccc G/A ccacccaccggggccccacc 6724 PIG3 4 (5′untranslated region − 9 cccgcgaggatacagcggcc (CCTGY)16 cagacaatatgttagccgtg 6725 PIG3 5 (3′flanking region 625-62 ctcctcaggccccgcccctt (T) ccattactcacttgggtccc 6726 PIG3 5 (3′flanking region 625-62 ccccgcaggccccgcccctt ccattactcacttgggtccc 6727 PIG3 6 (3′flanking region 770) ccacctgggtcccgccccac C/&Dgr; cgccacaaccctgctcaagc 6728 NDUFA1 1 (5′flanking region − 1437) agggctaaaaatcctgatta T/A acctaccttgaagcttcgaa 6729 NDUFA1 2 (intron 2 3071) aataaaagtacatggcatat C/A cccgatgggaacagacttgt 6730 NDUFA1 3 (3′flanking region 1218) aactccatgtgtataaagca A/G caccacagatgacacttcca 6731 NDUFA1 4 (3′flanking region 1411) ggattgcgccaccccttgac C/T ggcaatgaccttttactttt 6732 NDUFA1 5 (3′flanking region 1411) ggatcgtgccaccccttgat C/G ggcaatgaccgtttactttt 6733 NDUFA2 1 (intron 2 1087) aacatacaaaaattagccgg A/G t a/g cggtggcgggcacctgta 6734 NDUFA2 2 (intron 2 1089) catacaaaaattagccgg a/g t A/G cggcggcgggcacctgtaat 6735 NDUFA2 3 (intron 2 1356) ttccctgaaacaacccattg T/C ggccatccagaatcagccaa 6736 NDUFA2 4 (3′flanking region 467) cacagcctcatgggtcagcc C/T actccagagggtgcattccc 6737 NDUFA2 5 (3′flanking region 744) ggaagcaggggccctggcca C/T agccgctggcagtaagcagg 6738 NDUFA2 6 (3′flanking region 838-83) catagtctacaaagaatgaa (ACAC) aaagatcataacaatagcta 6739 NDUFA2 6 (3′flanking region 838-83) catagtctacaaagaaggaa aaagatcataacaata 6740 NDUFA3 1 (intron 2 2656) tccctgctgccctcccctgc G/A cactttatcttccctttgcc 6741 NDUFA3 2 (coding region 241 (Lec 81 agggccccagcctggagtgg C/G tgaagaaactgtgagcacct 6742 NDUFA3 3 (3′flanking region 1019) tccttacctgcactggcacc A/G gctctggagccccagtccct 6743 NDUFA5 1 (intron 3 2155) agactctagcatggtacctg G/C aacataaggttccttagaaa 6744 NDUFA5 2 (intron 3 2493) ggcatattgctagttttctc G/T gtctcaatttcatcatctat 6745 NDUFA5 3 (intron 3 2712) acaaattttgaactgttcac C/T taacacaggctttttctgaa 6746 NDUFA5 4 (3′flanking region 1296) aggtatctaaaaggtattgc A/C atttggtcattggttctttc 6747 NDUFA5 5 (intron 3 30-31) aagtcagttttgttgtcttg (GATTTGTGGTATCCAG) 6748 tgtaacatttaaccaaaaaa NDUFA5 5 (intron 3 30-31) aagtcagttttgttgtcttg 6749 tgtaacatttaaccaaaaaa NDUFA5 6 (intron 3 427-428) attaagtagcagttaataaa AG/&Dgr; tctagactgctgattcatac 6750 NDUFA5 7 (intron 3 4733-4734) tataggaattttaaaatata TA/&Dgr; ggatattgaaacattcagtt 6751 NDUFA6 1 (5′flanking region − 1148) tttataatttatatatgtta C/T gtgctttcttttgtatagct 6752 NDUFA6 2 (5′flanking region − 363) actacccaggagcgcggcgg G/A cagccggatagcaggacgct 6753 NDUFA6 3 (coding region 26 (Ala 9 V ggggagcggcgtccgccaag C/T tacttctaccgccagcacct 6754 NDUFA6 4 (intron 1 1318) attcagcagtttgaaaacat A/G atgtttgcctggcagaatac 6755 NDUFA6 5 (intron 2 562) agttaaagaatctgaaaagt G/C tcagaaatgatttaccctga 6756 NDUFA6 6 (5′flanking region − 861) ctgtaaaatggggatgctga (T) ggtacctacctgacctatga 6757 NDUFA6 6 (5′flanking region − 861) ctgtaaaatggggatgctga ggtacctacctgacctatga 6758 NDUFA6 7 (intron 1 1251-1278) tgtggggagtgcctgtagca (GT)12-14 ttcggggtggtgcattcaaa 6759 NDUFA7 1 (5′flanking region − 731) accaaccaaaggtctatcaa A/G ggggtgtcctctttgcaccc 6760 NDUFA7 2 (5′flanking region − 434) aaagggaaccatcagaeccc C/T gtgatgaaatgagaatcggc 6761 NDUFA7 3 (5′flanking region − 395) gctcccggattccggctggc A/G ggggttagggcagggtagag 6762 NDUFA7 4 (5′flanking region − 100) agaggagtcacgtgcttcgg G/A gagagcctttataggacgtt 6763 NDUFA7 5 (intron 1 92) tcacctccctcctaagccgg G/A acccttcgctctccccgaat 6764 NDUFA7 6 (intron 1 133) ctccctgggaacccccagct A/G gt c/g accccttcagcccggga 6765 NDUFA7 7 (intron 1 136) cctgggaacccccagct a/c gt C/G accccttcagcccgggaccc 6766 NDUFA7 8 (intron 2 89) tcctttagacccctgaaacg G/C agggctgacatcctgccacc 6767 NDUFA7 9 (coding region 196 gcagccgggaatctgtgccc C/G cttccatcatcatgtagtcg 6768 (Pro 66 Ala)) NDUFA7 10 (intron 3 4203) gcctccacccctggggcgcc T/G cctccatcaccccaccctcc 6769 NDUFA7 11 (intron 3 4604) gggccttgtgtacgctggag A/G ccaaaagtgggaagggagga 6770 NDUFA7 12 (5′flanking region agggtccagggtcccctgct CAGAGGCT/&Dgr; aacactggccgaagagaa 6771 (−1353)-(−1360)) NDUFA7 13 (5′flanking region agccctgatccacccactct CT/&Dgr; gaaacttctctgctaataaa 6772 (−1233)-(−1234)) NDUFA7 14 (intron 2 4142-4143) cattttgtgactgaggtgac AG/&Dgr; gggcccacagcggggccatg 6773 NDUFA8 1 (intron 1 − 75) tttgtgttctctattctgac C/T cgcatgaggtaaagctgaga 6774 NDUFA8 2 (intron 2 790) caaacctagacaaagtgtgc C/T ctttatccagaagtgagcag 6775 NDUFA8 3 (intron 2 900) ttcaggagataaaaagctct G/A attgctcaggcctgagatgg 6776 NDUFA8 4 (intron 2 3837) gaagttgtcttgtaagtgag A/G taagaatatgtactcacata 6777 NDUFA8 5 (intron 2 3942) tcattgttttgcaaagagat G/T cccctaacccagctttcttt 6778 NDUFA8 6 (intron 3 − 66) gaggagacaccaggaggcgc A/G ttgatggttacagattcctc 6779 NDUFA8 7 (3′untranslated region 52 tttatttctggaccaagtaa A/G gatgggtccgtggcccacac 6780 NDUFA8 8 (3′flanking region 367) gtcatacaaggggagcctcc A/G ggatagaagtgcagaeactt 6781 NDUFA8 9 (3′flanking region 777) attcttttttcactactagg C/T tgtttcctccacatctgact 6782 NDUFA8 10 (3′flanking region 1053) aaagaaaaagcaetgtgtga T/A ctgccatggccgcttctgca 6783 NDUFA8 11 (3′flanking region 1190) gattctctaatgaaaaataa G/T acttttttttgcattttttt 6784 NDUFA8 12 (intron 2 449-453) tcattgtgcatgatacttaa GTAAA/&Dgr; aaaaaactaagctgtgtaat 6785 NDUFA8 13 (intron 2 455-459) tgcatgatacttaagtaaaa AAAAA/&Dgr; ctaagctgtgtaattgtagg 6786 NDUFA8 14 (intron 2 707-708) tcattttggaaagactctca (A) ccttgctgtaccaaaaatgg 6787 NDUFA8 14 (intron 2 707-708) tcattttggaaagactctca ccttgctgtaccaaaaatgg 6788 NDUFA9 1 (5′flanking region − 807) gatggctctttgtagaacaa T/C gcagattctcaaaggtgacc 6789 NDUFA9 2 (5′flanking region − 769) accacagttaaagaaaaaat T/C anaagccattgcgctagaga 6790 NDUFA9 3 (5′flanking region − 353) cacaccctattttggtttct C/G ttctccacttttcccctcgt 6791 NDUFA9 4 (5′flanking region − 322) ttcccctcgttcttgtcccc C/T ctcctccccctcctgggccc 6792 NDUFA9 5 (intron 1 447) attcatatgagcacaatgga A/G atgataatattacaatacca 6793 NDUFA9 6 (intron 1 1039) ggcttgatgttcagcctgag G/A caagaattaggagtgtttag 6794 NDUFA9 7 (intron 1 4010) aatgtatccaaaagagactc T/G cattcctgccatatgaagaa 6795 NDUFA9 8 (intron 3 49) gacaaatataaattactaag G/A tcatttctaggagtgatagg 6796 NDUFA9 9 (intron3 107) aatttcttcccagaatggac C/T aaaggcaccctccgttccca 6797 NDUFA9 10 (intron 3 1183) atctctggtaatattcatac A/G gattatttgtaatcccttta 6798 NDUFA9 11 (intron 3 1395) attcctagttctttgtccct C/T aagtttgttggtcaccttgt 6799 NDUFA9 12 (intron 3 2363) agaaaatagtcatgaatggc C/T ccaactaacaccagtcttta 6800 NDUFA9 13 (intron 3 2608) gtcatttgattacctgagta A/C agtgtactgttacctgtttg 6801 NDUFA9 14 (intron 4 561) attttataaattctttgatg A/C cttgggggtcttattcaact 6802 NDUFA9 15 (intron 4 860) attgtgtagagtaatgacag C/T agagctgtcaacttttttaa 6803 NDUFA9 16 (intron 4 879) gcagagctgtcaactttttt A/T aaaaaataattttagcttaa 6804 NDUFA9 17 (intron 4 893) ttttttaaaaaaataatttt A/G gcttaaaaaaattaaaaatt 6805 NDUFA9 18 (intron 4 1090) atcattgctgtttaaaagtt T/C aagtagtgtgaatttcagta 6806 NDUFA9 19 (intron 4 1188) aaccaatccttttatttttt A/T tcttccagaaactttgattt 6807 NDUFA9 20 (intron 5 161) gggtgtgtgtgatgttttga C/T gttttgattgattgccttct 6808 NDUFA9 21 (intron 5 373) ctttctcaccgcttgcactg C/T agtggttttgtgccactctt 6809 NDUFA9 22 (intron 5 457) gccagggaagatgcctattc A/C cacagtgcttatgctccttt 6810 NDUFA9 23 (intron 5 3113) gatttttctccttcttcaat G/A taagcttcccttaaaataaa 6811 NDUFA9 24 (intron 5 3339) tctaaactcaaaacaggttt G/A tttggttattgtttaggctg 6812 NDUFA9 25 (intron 6 414) tatagttttgccttttccag G/C atattacatatatggttaga 6813 NDUFA9 26 (intron 6 518) ctttcatttcttttcatagc T/C tgatagctcatttctttata 6814 NDUFA9 27 (intron 7 974) ggattatgcgtacttggaaa A/G tacttggatagcggtgatta 6815 NDUFA9 28 (intron 8 368) acattaattttgatggagta T/G cacaatgcctccagaggctg 6816 NDUFA9 29 (intron 8 954) gcatgccatgagttatatag T/C ctagataagaattacaattc 6817 NDUFA9 30 (intron 8 1253) tcctcttgaaattgtagata G/T gtatctacacatttctcatc 6818 NDUFA9 31 (intron 8 11608) gaaaagatagatgtataaat G/A accaaaaattcgtgaagaaa 6819 NDUFA9 32 (intron 8 11930) ctacaaatatattctaaatg C/T gtaatcatggataagtacaa 6820 NDUFA9 33 (intron 9 1998) tgtttttcaagcctttaaac G/A gctgtggaaccctgtgctca 6821 NDUFA9 34 (intron 9 2239) ccagctacttgggaggctga A/G gtgggaggatcacttgagcc 6822 NDUFA9 35 (intron 9 2885) acagcggtctgtcttcctgc A/G gttctcataggctagcttac 6823 NDUFA9 36 (intron 10 801) tacactaaagtgtctcttac G/A tttatacttgagaaagtgtt 6824 NDUFA9 37 (intron 10 910) tgcagactttcaggtgggta G/C gatgagggattgctgctgct 6825 NDUFA9 38 (intron 10 1180) aaaactgagtcagaacgccg G/A tgctcagaaaacaggggcgt 6826 NDUFA9 39 (3′flanking region 554) gtgccagcacttaggaatta T/G gaccttctaatgaagttctt 6827 NDUFA9 40 (5′flanking region taaacagtaggggcaagata (TC) gagtggaaacagccaagatt 6828 (−1129)-(−1128)) NDUFA9 40 (5′flanking region taaacagtaggggcaagata gagtggaaacagccaagatt 6829 −1129)-(−1128)) NDUFA9 41 (5′flanking region − 341) tggtttct c/g ttctccacttt T/&Dgr; cccctcattcttatcccc c/ 6830 NDUFA9 42 (intron 4 594) attcaactttttatcccccc T/&Dgr; aatgattaacatagtgtatt 6831 NDUFA9 43 (intron 10 356-375) taacttcctcctaacgtcct GAAGAAACTGTTGACAGTTT/&Dgr; 6832 cttccttctttctttaacct NDUFA9 44 (intron 10 379-381) gaaactgttgacagtttctt CCT/&Dgr; tctttctttaacctactcca 6833 NDUFA9 45 (intron 10 384-387) tgttgacagtttcttccttc TTTC/&Dgr; tttaacctactccagtcagg 6834 NDUFA9 46 (intron 10 436-437) ccatttctcccctaaacttg (TTCTTTTAAAATTG) ctcttttcaaaat 6835 NDUFA9 46 (intron 10 436-437) ccatttctcccctaaaattg ctcttttcaaggt 6836 NDUFA9 47 (intron 10 495-496) gccacatccaatggtcagtt (TTCAGGCCTTT) ctcagacctcatgtca 6837 NDUFA9 47 (intron 10 495-496) accacatccaatagtcagtt ctcaaacctcatgtcc 6838 NDUFA9 48 (intron 10 519-520) gacctcatgtcatgtgcctg (GGCCTG) tgcatttgcttctagggagg 6839 NDUFA9 48 (intron 10 519-520) gacctcatgtcatgtgcctg tgcatttctgtctagggagg 6840 NDUFA9 49 (intron 10 558-559) gatgcaaaataaaataaaaa (A) tactataccaataccacatc 6841 NDUFA9 49 (intron 10 558-559) gatgcaaaataaaataaaaa tactataccaataccacatc 6842 NDUFA10 1 (5′flanking region − 1734 tgcaccttgaactgtttact T/C tcctgtaaccatttaccctt 6843 NDUFA10 2 (5′flanking region − 1492 aaaacatccacgcaaacagg T/C tgtgagaagttacgtctgcg 6844 NDUFA10 3 (intron 3 370) aagactgtgcatgtgccatg C/A agacagagatgtggatgcca 6845 NDUFA10 4 (intron 3 2485) ttgttattttcttttctctg G/A aatgcagtgatcagttgaca 6846 NDUFA10 5 (intron 4 236) ctgtgaaagcagattggagc C/T ctggacctcaaacacacgca 6847 NDUFA10 6 (intron 4 1742) tgtcggcatctgctgagtgt C/T tgctgaagtctgaggactgg 6848 NDUFA10 7 (intron 4 2090) ggctgggggaaagcagatca T/C gttggctaaaggacaggtgg 6849 NDUFA10 8 (intron 4 3054) cagctgattatactactgaa A/C cgggataaatg c/t agcttgat 6850 NDUFA10 9 (intron 4 3066) ctactgaa a/c cgggataaatg C/T agcttgatgattttcagctg 6851 NDUFA10 10 (intron 4 3377) gtcacagtttaaatgctgct G/A ttttactctgtgtaagtagc 6852 NDUFA10 11 (intron 5 46) aagcatctctattttgaatg T/C agatcagcactaaaagccct 6853 NDUFA10 12 (intron 8 1465) gcaacacccagttcctggta C/T aggcctcatatccagcgtgc 6854 NDUFA10 13 (intron 8 1809) cctggaggcacaaggatggc C/A ggggcactcaacttccctct 6855 NDUFA10 14 (intron 8 11226) gttgtgtgactgtgtggggc A/G tctcacctctcgggctgcag 6856 NDUFA10 15 (intron 8 11319) atcttgccttccctcctgcc G/A tctgttcaggcttgaatcct 6857 NDUFA10 16 (intron 8 11386) ccataatcctagcttgaacc C/T tcctttttccctgctgaccc 6858 NDUFA10 17 (intron 8 13361) ccaggccactgattgctttc G/A cattttctagcattttctta 6859 NDUFA10 18 (intron 9 183) tttctgtgtggaaagctgat G/A aagtcctcagatgacagccc 6860 NDUFA10 19 (intron 9 8028) gaggacattccacagaacgt G/A tgactattagagcagaaggt 6861 NDUFA10 20 (intron 9 10742) ctggaggagaggggtggagc C/G agttcagccagcactggggt 6862 NDUFA10 21 (intron 9 13908) cacattgttatgtaaccaag C/T ct g/t gaattgcagtgtgaaga 6863 NDUFA10 22 (intron 9 13911) attgttatgtaaccaag c/t ct G/T gaattgcagtgtgaagaact 6864 NDUFA10 23 (intron 9 14064) tcttgactattagaaaccct A/G tcagataaattttaaaacag 6865 NDUFA10 24 (intron 9 14184) tggctttggttgggaacagc G/A agagatacagaaccgacggt 6866 NDUFA10 25 (intron 9 16487) cttgaagctgatcgttccct C/A cttgaagctgatcgttccct 6867 NDUFA10 26 (intron 9 16779) gccagacgtgactgctttag G/A ttcctcatgacattcagacc 6868 NDUFA10 27 (intron 9 17663) ttccaaatcaccccagaact T/G tgcagtattttgaagctcct 6869 NDUFA10 28 (5′flanking region gtaaaattgttttaactaga (C)9-11 ttcctaaaccaaggtataaa 6870 (−1668)-(−1609) NDUFA10 29 (5′flanking region ctgtatccattggaaggcac (A)15-21 tgcaaaggaaacaaggcaaa 6871 (−1355)-(−1334) NDUFA10 30 (intron 1 46-61) tggcggggtggcagggtggc GGGGTGGCGGGGTGGG/&Dgr; gagcagttcc 6872 NDUFA10 31 (intron 4 2486) ctcactggaacttttttttt T/&Dgr; aatttaatttttaaaatttt 6873 NDUFA10 32 (intron 7 1600-1601) cacttccattctgactgtta (A) cggtgtgattcttcctgcca 6874 NDUFA10 32 (intron 7 1600-1601) cacttccattctgactgtta cggtgtgattcttcctgcca 6875 NDUFA10 33 (intron 9 1054) gcgcgtgctgtttctccctt A/&Dgr; tctgtccttgtacacgtgtg 6876 NDUFA10 34 (intron 9 8161-8172) tttctcgctttctgggagac (T)10-12 aatgttgaaaatatgtgttt 6877 NDUFA10 35 (intron 9 8646-8647) aattcccccattgcttctct (TT) ctgtagacattttaaaccta 6878 NDUFA10 35 (intron 9 8646-8647) aattcccccattgcttctct ctgtagacattttaaaccta 6879 NDUFA10 36 (intron 9 16503-16523) ccct c/a cttgaagctgatcgt TCCCTCCTTGAAGCTGATCGT/&Dgr; 6880 gtccaagatagttgctagga NDUFA10 37 (intron 9 17905-17936) caaatatatgtatacatgta (CA)12-18 tccttcatgaaaactctttc 6881 NDUFAB1 1 (intron 1 8451) cagcaccctgtagaggcctc G/A ggatgctgaagatgccatga 6882 NDUFAB1 2 (intron 1 8495) gacacaggcattctgcagac G/A ccagacaattttagtggcag 6883 NDUFB3 1 (5′flanking region − 1439) ttaaaagttgacttttttct G/A cc g/a ggcacggtggctcacgc 6884 NDUFB3 2 (5′flanking region − 1436) aaagttgacttttttct g/a cc G/A ggcacggtggctcacgcctg 6885 NDUFB5 1 (5′flanking region − 213) ggcggatgaaactctcctac A/C aagaagggccaaaccggccg 6886 NDUFB5 2 (intron 1 6288) ggggatgttgattacctagg T/C cagtaaagtaaagaaggcat 6887 NDUFB5 3 (intron 1 − 1581) ctcctgggccacggtatcct A/G tcccttcccctcgttaccct 6888 NDUFB5 4 (intron 1 − 1487) ccctcttagaccgtatatag T/G cctagcataggatctgcaca 6889 NDUFB5 5 (intron 2 556) gtgtctggaccatctgccac G/A gtagataaagctctgcatca 6890 NDUFB5 6 (intron 3 467) ggcgccatcgcactccagcc C/T gggcaacagagtgagactct 6891 NDUFB5 7 (intron 3 497) agcgaggctctgcccccccc C/G caaaaaaaaactataatcct 6892 NDUFB5 8 (coding region 397 acaacagccctgaaaagata T/C aggaaagaacaatggccgtc 6893 (Tyr 133 His)) NDUFB5 9 (intron 1 213-215) attagcatttctaaaacgtt GTT/&Dgr; attcaccatcccaattaatg 6894 NDUFB7 1 (intron 1 68) cctgaacacctggcacccca G/A ggctggcaccccagggctgg 6895 NDUFB7 2 (intron 2 266) gggctctctaggggcctgtt T/C gatggggacagggcaggtgg 6896 NDUFB7 3 (intron 1 4480-4481) agttctgaggctgagagaga (GA) ggccacgccgccggccagtg 6897 NDUFB7 3 (intron 1 4480-4481) agttctgaggctgagagaga ggccacgccgccggccagtg 6898 NDUFS1 1 (5′flanking region − 3) tcctagggggtcgtcgtggt C/G cagacagtttagcagaacag 6899 NDUFS1 2 (intron 1 445) gtgttagcaatggctcacgc T/C cctgtttgttgtccttgttt 6900 NDUFS1 3 (intron 1 470) cttgttgtccttgtttgttt G/T gcccaccgaccacgctggac 6901 NDUFS1 4 (intron 1 502) acgttggacagcattttttt A/G ttcctttaactaacgggaaa 6902 NDUFS1 5 (intron 1 557) ttttgaaaagttagcccagg A/G ttgcattgcaaataacaaaa 6903 NDUFS1 6 (intron 1 5218) tatctcagaatatctcagga A/G catttagtagacagctatgc 6904 NDUFS1 7 (intron 3 1371) aagccctaaaatagatagtg T/G caatgggaatgaaaacaaga 6805 NDUFS1 8 (intron 5 414) ttttgaaacgaggtctcacc A/G tgttgtccaggctgggcttg 6906 NDUFS1 9 (intron 10 812) gagtgcggtggcgcgatctc G/A acctcgggtcactgcagcct 6907 NDUFS1 10 (intron 11 233) ggaggccaaggcaggcagat C/T gcccaagcgcaggagtttga 6908 NDUFS1 11 (intron 11 263) ggccaacatggcgaaacccc G/A cctctactaaaaatacaaaa 6909 NDUFS1 12 (intron 11 585) ctgtatgtcttaattttaaa G/T taaatttgcatttcatatat 6910 NDUFS1 13 (coding region 1251 gcaccactgtttaatgctag A/G actcgaaagaggttggcaac 6911 (Arg 417 Arg)) NDUFS1 14 (intron 13 5159) atgacctttagaaaacgcgc T/C ccagcggatacccaggcata 6912 NDUFS1 15 (intron 14 250) aaaaagtgttatattagtta C/T accttggtccaaaaattgca 6913 NDUFS1 16 (intron 14 550) gataaagtctcactatgttg C/T ccaggccgatcccaaactcc 6914 NDUFS1 17 (intron 14 2429) ctgaaaatacaaaaactagc C/T gggcgcggtggcatgtgcct 6915 NDUFS1 18 (intron 14 2530) ttacagtgagccgagatcac G/T ccactgcgctccagcctggg 6916 NDUFS1 19 (intron 14 2659) acacacttaattttttacat T/C gaaaacactgcagctagggt 6917 NDUFS1 20 (intron 16 150) agaaaacatgcaggcagaaa C/T aggaaggcaaggttacagtg 6918 NDUFS1 21 (intron 18 279) cactgtgtagcaatttatgg T/C gaatcttccaaagtggcaaa 6919 NDUFS1 22 (3′flanking region 182) cccaggacaactacaactaa T/A aacaaccacagtaacaaggg 6920 NDUFS1 23 (intron 12 3226) aaatgtattgtctgtgcttt T/&Dgr; aacatttttgtaatagtaaat 6921 NDUFS3 1 (5′flanking region − 194) tctgccacaaggagctagga C/T cacgctcaccgcacgattcc 6922 NDUFS3 2 (intron 1 46) cggggtcaggcgcagcggcg T/C gcccagcgcagagagccccg 6923 NDUFS3 3 (intron 6 − 439) aaagctgtgtcaaaggtacc G/A ctttagatctggactgtgaa 6924 NDUFS3 4 (intron 6 − 280) ggcgggcgagcagccagccc G/A gagccccggatgcgggagcg 6925 NDUFS4 1 (5′flanking region − 439) aactgaacacagccctgccc T/A gagggcttgcaaagtgaatc 6926 NDUFS4 2 (intron 1 1829) gaaaaaaaaccctaaggcca G/T ggaagacgtcccctaaatac 6927 NDUFS4 3 (intron 1 2057) attaatgggaaaatctacat C/G caaaactcactttattgtaa 6928 NDUFS4 4 (intron 1 − 521) ctcatttcaaccaacttcat T/G tcccccactttgcgaagggg 6929 NDUFS4 5 (intron 3 − 1259) ataaaattatgatattatta G/A cactaacacagccagccaca 6930 NDUFS4 6 (intron 3 − 1174) aatatatataattataggaa T/C ctcagagtagcaaccatggt 6931 NDUFS4 7 (intron 4 10682) cacaatataggcacaaactt A/C ctaccaaagccctaacaagc 6932 NDUFS4 8 (intron 4 12299) cttactatatagatataggg A/T atagactatagagtatctct 6933 NDUFS4 9 (intron 4 12560) accaaataaggtattatgca G/A gctcacctccccacataaga 6934 NDUFS4 10 (intron 4 18801) ggaaagacttgccgggccag T/C gcacccgaaaccgcggccat 6935 NDUFS4 11 (intron 4 19888) ccgcacagctgagaagagca A/G ggggcgggtttccagtaccc 6936 NDUFS4 12 (intron 4 20178) agaaaagatgagtataattc G/A tctaacttacccattcttaa 6937 NDUFS4 13 (intron 4 23016) ctactctgtgaaagtaaggt T/A atgttgaacaagtaaattaa 6938 NDUFS4 14 (intron 4 23124) sctttctttcgagatggagt T/A ccagcagttgggaatgtaat 6939 NDUFS4 15 (intron 1 766) tgtgatgatttttttttttt T/&Dgr; ggctgtattaaccttccatt 6940 NDUFS4 16 (intron 1 1261) tttctttctctttttttttt T/&Dgr; gagatacattctcactctga 6941 NDUFS4 17 (intron 4 1974+ 19745) ctcatcatttaggtgctggt (T) agttgggtttgtcgcaaatc 6942 NDUFS4 17 (intron 4 1974+ 19745) ctcatcatttaggtgctggt agttgggtttgtggcaaatc 6943 NDUFS5 1 (intron 1 388) ccaaacatacccagcacttc C/T ggctgtaactccggcctgtt 6944 NDUFS5 2 (intron 1 − 13082) agtgagccgagattgcacca G/A tgcattccaccctgggcaac 6945 NDUFS5 3 (intron 1 − 12905) gttttcaacaaaggactcca G/T agtagtagagaactttctgt 6946 NDUFS5 4 (intron 1 − 12564) attttcatcacacctcaact T/G aaggtataacagccttaaga 6947 NDUFS5 5 (intron 1 − 12561) ttcatcacacctcaacttaa G/A gtataacagccttaacaatc 6948 NDUFS5 6 (intron 1 − 10561) aacaatgtggtatagtgggg C/G gggtggtgagcaggtgtcat 6949 NDUFS5 7 (intron 1 − 9065) cctgatgctcctggctccag G/A gtagaccttttccctttaga 6950 NDUFS5 8 (intron 1 − 8871) tcaccacgtctctgtagata T/C aggaccgcagaccttcgctt 6951 NDUFS5 9 (intron 1 − 7312) aaatccttggcttctagaat G/T ggtcactgatggtatataat 6952 NDUFS5 10 (intron 1 − 6827) aacctctgcctccccgattc A/G ccccattctcctgcctcacc 6953 NDUFS5 11 (intron 1 − 6725) agtagagacggggtttcacc G/A tgttagccagcatggtctcg 6954 NDUFS5 12 (intron 1 − 6631) aggcgtcagccactccgccc G/A gcctagaccttcttcttata 6955 NDUFS5 13 (intron 1 − 6531) cccaacagctcccaatgtaa A/G acagatctcttaatattctg 6956 NDUFS5 14 (intron 1 − 6346) gcaacagatcttgacctata T/C cccatagggtacacctgagg 6957 NDUFS5 15 (intron 1 − 6327) atcccatagggtacagctga G/C gactttaatcagaaaaggag 6958 NDUFS5 16 (intron 1 − 6122) tagccttgcttttactctac T/C gttcctcccaaatcacaccc 6959 NDUFS5 17 (intron 1 − 2512) acaaactcttaatgcgaatt T/C tgcagatcaaagtgggctta 6960 NDUFS5 18 (intron 1 − 1945) tttaatctcctttaaatttc G/A caatttcacaacctagggta 6961 NDUFS5 19 (intron 2 75) tttttttttttttttgagac G/A aagtctcactcttgtcccct 6962 NDUFS5 20 (intron2 148) ctgtagcctctgcctcccag G/A ttcaggcgattcgcgtacct 6963 NDUFS5 21 (3′flanking region 150) cagattcaagtggttctcct G/C cctcagcctcccaagtagct 6964 NDUFS5 22 (intron 1 (− 10682)-(− 10681) attataaacactaaacaaac AT/&Dgr; gtgtggtctctttacagggg 6965 NDUFS5 23 (intron 1 − 10267) caagtgactaccctgaaaaa A/&Dgr; gaagagatgaaacaaatcac 6966 NDUFS5 24 (intron 1 − 2069) accagacagagttcccttta C/&Dgr; ttgttttcctgtggcaaaga 6967 NDUFS6 1 (intron 1 26) ggccgctgggtacaggatgc A/C ccttcctccagccgcccctc 6968 NDUFS6 2 (intron 2 1076) ggatcatggtggtggagagg G/A ctgtgtgtctggtgggtttg 6969 NDUFS6 3 (intron 2 1260) cagttgtcgagtaagtggtg T/C atagggtaagtgctctttct 6970 NDUFS6 4 (intron 2 1413) caaaggagctcatggcattg C/T gaatgggacatttcttccgt 6971 NDUFS6 5 (intron 2 1568) tggagaaggggaggtttctc T/C tagtgtggatgcggtatgct 6972 NDUFS6 6 (intron 2 1692) gaccgtggtgacggaggttt C/T ctgggcatcgatgggtggtt 6973 NDUFS6 7 (intron 2 6488) tagcttaaataattattggc A/G ttcatgttcagaatgcctga 6974 NDUFS6 8 (intron 2 6563) tttaaacttttattttaaat G/A tccatgaatggggtcggtat 6975 NDUFS6 9 (intron 2 6740) aaagatttaaacctacatat C/T tttatgcccaatcatttgat 6976 NDUFS6 10 (intron 2 6832) gcgagggactcattttacag A/T ggttggacacttcactgtgt 6977 NDUFS6 11 (intron 2 7054) ttcactgccggagcttggcc G/A tgtgaacccggagccgggct 6978 NDUFS6 12 (intron 2 7186) ggtcagggtcacccttgagc T/C gcgcacactaaatgacggga 6979 NDUFS6 13 (intron 2 7225) gagggcatcccgcgtcagtc G/A ccagtgtcgaggcgtcagca 6980 NDUFS6 14 (intron 2 7810) cttccactctggggcgggga C/T gctgtagaaggagcacaaag 6981 NDUFS6 15 (intron 2 11080) gtaactgttcagtgctttct C/T ctttggatttcatgtaaatc 6982 NDUFS6 16 (intron 2 11657) gggacagaacgatgtggtgg G/A gagaagagggcgtggcagag 6983 NDUFS6 17 (intron 3 208) cgaaaaccccctttcaactg T/C gaagtggtgggcggcatgtt 6984 NDUFS6 18 (intron 3 1031) ctagagtgggactgggcacc C/T ggcatgtcccctcctgggct 6985 NDUFS6 19 (3′flanking region 270) gcttcagagagccaaggtgg G/C tcttgaggtgcatagtgaag 6986 NDUFS8 1 (5′untranslated region − 4 agtgtagcctccgcctcccg A/C ttgactggcctgcttggcaa 6987 NDUFS8 2 (intron 1 163) aggtgcagcggggagccggc T/C ctcagggcgcatgcgccgcc 6988 NDUFS8 3 (intron 3 123) tctctgagcctgtttccact T/C ttaaaatgattatggtgatg 6989 NDUFS8 4 (intron 5 − 505) aggcaaggcaggccgggcac G/A gtggctcacgcttgtaatcc 6990 NDUFS8 5 (3′flanking region 491) ggccctgagctggcctgcgt C/A cagccacatcctctttcctg 6991 NDUFS8 6 (3′flanking region 693) ttcacttcatttgcagtgag G/A aaaccagctccgagaggtga 6992 NDUFS8 7 (3′flanking region 1267) ttttcccagacgtaaccgcc G/A tcagagcgtggcatggagcc 6993 NDUFS8 8 (3′flanking region 1362) cgctgggttctttcccttac C/T gtggtctcccaggcacttac 6994 NDUFS8 9 (3′flanking region 1449) tgtcagaacaggcctatggc G/A cccaaccacaagtcccccaa 6995 NDUFS8 10 (3′flanking region 1572) cagccccacaggcctgtgct C/A gctgtgtggggcttagggat 6996 NDUFS8 11 (3′flanking region 783-78 cagagaccttgacccccccc (C) atctaccatcatttccaaaa 6997 NDUFS8 11 (3′flanking region 783-78 cagagaccttgacccccccc atctaccatcatttccaaaa 6998 NDUFV1 1 (intron 3 670) ctgggtggagtggggtggca T/C ggagttgaagacccagtcct 6999 NDUFV1 2 (intron 6 160) tgtgccggccccagccctga C/G catgcatccctttggggacc 7000 NDUFV1 3 (intron 9 27) accacccttctgcgtagcac G/A gagggtgggtggcatcaagg 7001 NDUFV1 4 (3′flanking region 1111) tgtaggctgaggtcagcccc A/C atccagtccaaagcccaccc 7002 NDUFV1 5 (3′flanking region 1658) gaatgcggaagtgctctgtg G/A gcacccaccatgctccgggc 7003 NDUFV1 6 (3′flanking region 1713) gatctggggcggagggtaca C/T ggggctggcgctgggtgaag 7004 NDUFV1 7 (intron 4 214) tggtgtaaattttttttttt T/&Dgr; gcttcaaaaatatagtattt 7005 NDUFV1 8 (3′flanking region 772-7 tgaactcggggttcagggtc TTC/&Dgr; ctgtgaacactggttttcaa 7006 NDUFV2 1 (intron 1 526) ggaaatgctggctaaataaa C/T ggtatcaaactaactctgaa 7007 NDUFV2 2 (intron 1 6689) tcgttggatggtagtattgt T/G tgaacaacagaagaaattca 7008 NDUFV2 3 (intron 1 14767) ccaaatgcatgccagcagag C/T gtggcaggaaggtacacaag 7009 NDUFV2 4 (coding region (Ala29Val)) aaggaatttgcataagacag T/C tatgcaaaatggagctggag 7010 NDUFV2 5 (intron 2 − 289) cagaagatcttactctctaa T/G gaagctggataacacttttt 7011 NDUFV2 6 (intron 2 − 168) tttactttggtaatcatact T/C atcaaatgtgtgtttagaca 7012 NDUFV2 7 (intron 4 677) aeaccacatactatttgatt C/A tgatgagaatcacataacca 7013 NDUFV2 8 (intron 4 2295) tatgattcaactttcaaaag A/T gtattgtgatatgaaataga 7014 NDUFV2 9 (intron 5 102) caacttctgccatcttattg G/A atctgtacttacctagtaat 7015 NDUFV2 10 (intron 7 5466) tggtaagaggctttaagata A/C caaatgctcagctttcagga 7016 NDUFV2 11 (intron 1 13562-13563) tactcttaaaattaatcctt (CTT) ttattataagtatacagtct 7017 NDUFV2 11 (intron 1 13562-13563) tactcttaaaattaatcctt ttattataagtatacagtc 7018 NDUFV3 1 (5′flanking region − 222) cgccgcgcccccgccacagc G/A cccaggcgcccgcagggcac 7019 NDUFV3 2 (5′flanking region − 111) tggccccaagggaggcactt A/G gccctactggggatgcgcgc 7020 NDUFV3 3 (intron 1 137) ttgggccgctgaccccgctc C/T ctgggcccaggactgaccgc 7021 NDUFV3 4 (intron 2 152) tatacaagacacaagatcta T/C aacagattttagaccaaaca 7022 NDUFV3 5 (intron 2 6304) ttcacacatgaaggggttcc G/A aaatttttgtcaagaaagac 7023 NDUFV3 6 (intron 2 6433) tcgccttcgtcttcatcctc T/G tccagctcctctgattctga 7024 NDUFV3 7 (intron 2 6563) cctttgaaaacagagccccc C/T gagttacagtatcagcaaaa 7025 NDUFV3 8 (intron 2 9619) actatcttctgtgcgcatgc G/A cagagcccaccttgcagagc 7026 NDUFV3 9 (intron 2 9858) aggatgccagctctttaaat G/A agacatcgtttttgcttaac 7027 NDUFV3 10 (intron 2 11673) cttggtaggtaagcgcctgt A/G tgtgagccaagtcattcata 7028 GGT1 1 intron 1 + 85 ttatccagtaaggtggctcc G/A tcacctcttttcctggtggg 7029 GGT1 2 exon 3 + 68 gacggccaggtccggatggt G/T gtgggagctgctgggggcac 7030 TGM1 1 exon 2 + 179 tgccgaaatgcggcagatga C/T gactggggacctgaaccctc 7031 TGM1 2 intron 9 + 1594 acttaccactctgtcctctc C/T tgccaggcctcttcctgtca 7032 TGM1 3 intron 9 + 1933 ccgcacctctgtaccctgcc C/G ccatcctccagcagagcagc 7033 TGM1 4 intron 10 + 54 tcagtcatgggttctctggt C/T ccaacttcaccgctgactga 7034 TGM1 5 intron 10 + 420 aggaggccgggagtcaggcc A/G ccctcagaccctctggctca 7035 TGM1 6 intron 12 + 101 gggagtccctgggggaagcc T/G catgtagggaagcaggcctc 7036 TGM1 7 intron 13 + 72 ggataaggacatcagaggtg G/A gcgctaagccagcagcaggc 7037 TGM1 8 intron 14 + 1671 atctcttacccacaccccca C/G catggtggggaggttcctca 7038 TGM1 9 intron 14 + 1691 ccatggtggggaggttcctc G/A tcctaagggatccgcagagc 7039 TGM1 10 intron 14 + 2983 tccctgcctccctccttcag G/A gagctcagaaacaccttcaa 7040 TGM1 11 intron 14 + 3158 ggaaacccctcagaaccagg T/C tccaagccaaatgctttgcc 7041 TGM1 12 intron 14 + 3816 cagaatacaaaagtgggatg G/C gaggcaaggagtcccgttag 7042 TGM1 13 exon 15 + 233 ctcgaggtggagcttagccc T/C gtgccaggagcaatgggact 7043 TGM1 14 exon 10 + 369 ggagtcagtcttcacttgca C/A tgggggaacagatgctaata 7044 CYP1A1 1 5′flanking − 1061 ccgccccgactccctccccc C/G tcgcgtgactgcgagccccc 7045 CYP1A1 2 5′flanking − 1035 tgactgcgagcccccgcgcc G/A ggccggggaatgggtcggct 7046 CYP1A1 3 5′flanking − 1020 gcgccgggccggggaatggg T/G cggctgggtggctgcgcggg 7047 CYP1A1 4 5′flanking − 947 cgcgcctccgggccaggtgg G/A gcggggacgggccgcctgac 7048 CYP1A1 5 intron 1 + (1326-1334) cattcattgagaattgagcc (A)8-9 ccctggcctggatttctctg 7049 CYP1A1 6 intron 1 − 1357 ctggcctggatttctctgac T/C aaagagctcaatctagctgg 7050 CYP1A1 7 intron 1 − 1590 ccactcttcaaaaggaggta C/T atgtgacagcagctggaaat 7051 CYP1A1 8 exon 2 + 160 gaatccaccagggccatggg G/A ctggcctctgattgggcaca 7052 CYP1A1 9 3′flanking + (710-720) caccgcgagatttccaggtc (T)10-12 gagacggagtctcactgtgt 7053 CYP1A1 10 3′flanking + 834 gcctcagcctcccaagtagc C/T gggactacaggcgcctgcca 7054 CYP1A2 1 intron 1 + 103 gcctgggctaggtgtagggg T/G cctgagttccgggctttgct 7055 CYP1A2 2 intron 2 + 371 cttccctgtgttcacactaa C/T cttttccttctttgaaattg 7056 CYP1A2 3 intron 4 + 44 atagccaggagaagccttga G/A acccaggttgtttgttcagt 7057 CYP1A2 4 intron 4 + 206 aagagtgacatggggtataa G/C aggggataattcatggggca 7058 CYP1A2 5 intron 5 + (623-648) tgccccaggctgcctgctgc (T)22-25 catagaaaatagaaaaacat 7059 CYP1A2 6 intron 6 + 81 tccctgctaggaactgttta T/C ataatgaaaggaggggacct 7060 CYP1A2 7 exon 7 + 101 ctggccatcctgctacagca A/T ctggagttcagcgtgccgcc 7061 CYP1A2 8 exon 7 + 295 cggctgcctgtctccatcaa C/T tgaagaagacaccaccattc 7062 CYP1B1 1 5′flanking − 3669 tgtatcctgtgaagcatcac G/A gttatccttctctgcacatg 7063 CYP1B1 2 flanking − 3149 tgacagcacttaccaaccta G/C ttcctctgatttttgagtca 7064 CYP1B1 3 flanking − 1222 gggggaagccacccccgccc G/A agcgcctccggcttccctta 7065 CYP1B1 4 flanking − 376 ttccgggaagcaagctcaag T/C cgcggagagggaagggaggt 7066 CYP1B1 5 flanking − 265 ctggggacaccgtgcggcct C/T gattggaggtggctgtgatg 7067 CYP1B1 6 intron 1 + 129 tgcccgcagcgttgtcccca G/A attgcaggaaccgttacgcg 7068 CYP1B1 7 intron 1 + 379 tgagtgtcacgccttctcct C/T tctgtccccagcatgggcac 7069 CYP1B1 8 exon 3 + (799-800) agcttctgggagattttttt (T) gagtcaaagacttaaagggc 7070 CYP1B1 8 exon 3 + (799-800) agcttctgggagattttttt gagtcaaagacttaaagggc 7071 CYP1B1 9 exon 3 + 1284 agtatagtggggttccatga G/T ttatcatgaattttaaagta 7072 CYP1B1 10 exon 3 + 1398 tcagcaaagaaaaaaaaaaa A/&Dgr; gccagccaagctttaaatta 7073 CYP1B1 11 exon 3 + 1468 tctcataggttaaaaaaaaa A/&Dgr; gtcaccaaatagtgtgaaat 7074 CYP1B1 12 exon 3 + 1564 ttgaataatatatgccttgt G/A taatattgaaaattgaaaag 7075 CYP1B1 13 exon 3 + 1762 ttgaaattctatttataata C/&Dgr; agaatcttgttttgaaaata 7076 CYP1B1 14 3′flanking + (2216-2226) agccagcctctttctttttc (T)10-12 aaaatttattcctatttcct 7077 CYP1B1 15 3′flanking + 2230 tttttctttttttttttaaa A/&Dgr; tttattcctatttccttaca 7078 CYP3A4 1 intron 2 + (754-763) cacaaaatgaggttgtgggg (T)9-11 acacaaaggcggaatcacat 7079 CYP3A4 2 intron 7 + 258 accactaataaactttctgc C/T tctatggatttgcctattct 7080 CYP3A4 3 intron 7 + 894 tgctgatctcactgctgtag C/T ggtgctccttatgcatagac 7081 CYP3A4 4 exon 9 + (32-33) ttccttcagctgatgattga (A) ctctcagaattcaaaagaaa 7082 CYP3A4 4 exon 9 + (32-33) ttccttcagctgatgattga ctctcagaattcaaaagaaa 7083 CYP3A4 5 intron 10 + 12 cccaataaggtgagtggatg G/A tacatggagaaggagggagg 7084 CYP3A4 6 intron 10 + 459 agacatctgacttttttttt T/&Dgr; gaaaggtaacaatcactttc 7085 CYP3A4 7 intron 10 + 608 agccgtctcgaatgtctccc C/T acttcataactcctccacac 7086 CYP3A4 8 intron 12 + 2467 ttttttgcccattactccat A/G gagatcagaatatcactctg 7087 CYP3A5 1 exon 1 + 69 ggaagactcacagaacacag T/C tgaagaaggaaagtggcgat 7088 CYP3A5 2 intron 1 + (955-956) tgtgggtagtggaggctcca (A) cctgtcccattaacttctac 7089 CYP3A5 2 intron 1 + (955-956) tgtgggtagtggaggctcca cctgtcccattaacttctac 7090 CYP3A5 3 intron 1 + 1126 acatttttaaatgaattgat A/G tggtttaaattcattcattt 7091 CYP3A5 4 intron 1 + 1145 tatggtttaaattcattcat T/G tttaaaccacaattttttgg 7092 CYP3A5 5 intron 1 + 1543 ttcatgcgtcctggccccac C/A gtggaggtcactcaaagggc 7093 CYP3A5 6 intron 1 + 2366 cttatcttatatgccatact G/A caccatttgctatcaacagg 7094 CYP3A5 7 intron 4 + 1813 tggttctaattttactcttc G/A tgttcttcatccttgaaaat 7095 CYP3A5 8 intron 4 + 1887 aatgacatgaacaaggtgtg A/T ttgtgaagcaagggatattt 7096 CYP3A5 9 intron 4 + 3384 gagtgcttcgctatttgcct C/T aacaagaaaaagtcatttgt 7097 CYP3A5 10 intron 4 + 3415 agtcatttgtccacttttca T/C tgaacaatcttccttcatcc 7098 CYP3A5 11 intron 4 + 3760 aagataacacactggaagtc G/A cacaccaccataaaactgaa 7099 CYP3A5 12 intron 4 + 3885 acaattcacttcacgtggca C/T tgcaatagcgtcctctcgct 7100 CYP3A5 13 intron 4 + 5061 tacctacttttcaaaaaaaa A/&Dgr; tcaccacatcatggcatccc 7101 CYP3A5 14 intron 4 + 5316 ccagatggctgggtctcccc A/T ctcccacccccgccccacat 7102 CYP3A5 15 intron 9 + 77 gttctgaaaatgtgcacgaa G/T tattccaggaagatgagaat 7103 CYP3A5 16 intron 9 + 1791 aaatttttattgggaaaaag C/T ctaccccatatttacttaca 7104 CYP3A5 17 intron 12 + 1408 atttaaataaaaaaaaaaaa A/&Dgr; cacgagtccacaagaatttg 7105 CYP3A5 18 3′flanking + 542 tggagaaaatattcatagtt T/C cattctgccttctttgaaga 7106 CYP3A5 19 3′flanking + 737 atgaacactgaataaaaaat T/G gtcaattcgtcagttgattg 7107 CYP3A5 20 3′flanking + 804 ttttccttttttattctttc A/C ttttcactccttttctgaat 7108 CYP3A7 1 5′flanking − 1680 cccaaggaacatgtggctcc C/A ggcacatacctggcacaaca 7109 CYP3A7 2 5′flanking − 1191 tagaaaatcctccacttgtc A/C aaaaggaagccatttgcttt 7110 CYP3A7 3 intron 1 + 1173 cccccatttcaaatacacct G/A cttagcaggttatcctaaac 7111 CYP3A7 4 intron 1 + 1597 tttttctgttagcctcttca T/C tgtaaccaaaagcagcatta 7112 CYP3A7 5 intron 3 + 762 tccagtgtctgcctattccc T/C tcttctttttttcttccctt 7113 CYP3A7 6 intron 7 + (1060-1069) atggtttcgttttctgttgg (T)9-10 ctacagaagtctttccattc 7114 CYP3A7 7 intron 11 + (592-594) taagacaaggtagggaggag AAG/&Dgr; gaggagaattagaaaaacaa 7115 CYP3A7 8 intron 12 + 911 ccccctccattaacaatatc C/T tctcattttattccatttaa 7116 CYP3A7 9 intron 12 + 1137 gtctgtctgcagggaaaata T/&Dgr; attcatgccttttgaaaatt 7117 CYP3A7 10 intron 12 + 2147 tattgtcagtaatttttttt T/&Dgr; actttgatgctatactttct 7118 CYP3A7 11 exon 13 + 218 ttcatccaatgtgctgcata A/C ataatcaggcattctgtacg 7119 CYP3A43 1 intron 1 + 3579 tcatgctcactttttttttt T/&Dgr; ctcaaaatgatcagtcacac 7120 CYP3A43 2 intron 2 + 2427 tagagggaatcttttttttt T/&Dgr; cctttttttctctgccccag 7121 CYP3A43 3 intron 3 + 3034 tttttatatagctagggaga T/C tgtaaattaacaagtttcct 7122 CYP3A43 4 intron 3 + 3433 agtcaagataactttttttt T/&Dgr; cataaaggaccacagtatgt 7123 CYP3A43 5 intron 3 + 3504 catgactcagtttccaacca T/C aacttttcattttggcatag 7124 CYP3A43 6 intron 4 + 2767 tagtgacttttgaaaaaaaa A/&Dgr; ttagtaataagcaaaagcct 7125 CYP3A43 7 exon 5 + 22 aaaacttaaggcacttttca G/A aaatcccattggacctaaag 7126 CYP3A43 8 intron 12 + (1585-1584) tactttgagccctcattctc (A) ccaagtcacttcagtgtcag 7127 CYP3A43 8 intron 12 + (1585-1584) tactttgagccctcattctc ccaagtcacttcagtgtcag 7128 CYP4B1 1 5′flanking − 333 gaaacattcacagtgcttgt A/T tgagaagacagtggttatta 7129 CYP4B1 2 5′flanking − 18 gagcagctgaaggcaggtca G/T atgaaggctaggtggctgga 7130 CYP4B1 3 intron 1 + 341 tccaaaacctctggatagta C/T atagaagtaggcaatccatt 7131 CYP4B1 4 intron 1 + 542 cctatgcgtggctcaggagc C/T gtgacaccttcccaggttca 7132 CYP4B1 5 intron 1 + 2856 gaggactttgcacatagtag G/A tgctcagctatattgttagc 7133 CYP4B1 6 intron 1 + (2923-2938) caacaaattggtgtgtgtgg (GT)7-8 agaatgccagctcccagatc 7134 CYP4B1 7 intron 1 + 6086 tttggaatctaaagactggg G/T cacgatgctagttgtgtgac 7135 CYP4B1 8 intron 1 + 6598 ttttggggtgtggggagagg G/A cccatagtagggagacagct 7136 CYP4B1 9 intron 1 + 6660 acctaagggtgtccatcctg A/G aggagagcagtcctaggggg 7137 CYP4B1 10 intron 1 + 7242 ccctggtctcccttaactca T/C gctggactgttccctttgct 7138 CYP4B1 11 intron 2 + 107 gcctgtgtactaagtctgcg C/G agctgaggttcccaccctac 7139 CYP4B1 12 intron 3 + 361 atggtgtggtggtaggacca C/T ggctggtcaccagaggctgt 7140 CYP4B1 13 intron 4 − 492 aaaggctttcacatctaaaa C/A gtgtctcctcattttctgtc 7141 CYP4B1 14 intron 4 − 315 ggattacttacatatacacc A/G tgcgggggagctcaccacct 7142 CYP4B1 15 intron 4 − 157 ctacccaccctatcctgata T/C tccagcaggatggagggcag 7143 CYP4B1 16 exon 5 + 22 acaagtgggaagagaaagct C/T gggagggtaagtcctttgac 7144 CYP4B1 17 intron 5 + 125 cccagggagccttagcttgc G/A gggagacaggacctgctcat 7145 CYP4B1 18 intron 5 + (267-289) tgtctaagccaatccctcct CCT/&Dgr; accctctgcttaacagggac 7146 CYP4B1 19 intron 6 + 54 gcctgggttcctcctcctgg C/T ccctctatgccccctcccat 7147 CYP4B1 20 intron 7 + (99-100) agctcttaagcatttccccc (TC) tttcctcagcaaatataacc 7148 CYP4B1 20 intron 7 + (99-100) agctcttaagcatttccccc tttcctcagcaaatataacc 7149 CYP4B1 21 intron 8 + 114 tcctggtttctctactgcat G/A gccctgtaccctgagcacca 7250 CYP4B1 22 exon 8 + 139 tgtaccctgagcaccagcat C/T gttgtagagaggaggtccgc 7151 CYP4B1 23 intron 8 + 247 agaaagttgtcaacaagagg C/T tgatattttgtgtgctaact 7152 CYP4B1 24 intron 8 + 366 tgtgggggtgaacagagctg A/G gacagctgggagagccagtt 7153 CYP4B1 25 intron 8 + 650 cctttgcttgtggtcagaca C/A cctgcctttctctctgggct 7154 CYP4B1 26 intron 8 + 844 tcatatgtgagaatcccccc C/A ccacggggtatccagacaca 7155 CYP4B1 27 intron 8 + 1767 tcccattccaagaatgttct G/T gttgtgttgctggcagggat 7156 CYP4B1 28 exon 9 + 53 tgtgcatcaaggagagcttc C/T gcctctacccacctgtgccc 7157 CYP4B1 29 intron 9 + 652 agtcggatgtggtcatgaac G/T ctctgtcactggcagtggtc 7158 CYP4B1 30 intron 9 + 774 cctggtcaccaacctctgtt C/T tgcccacaggaagcctgatc 7159 CYP4B1 31 intron 10 + 33 tgggctgggagatcagacag G/T gtgggggantgggacggtca 7160 CYP4B1 32 exon 12 + 224 ccagatggctcaggctgtga C/A ctccctgggcaccaccctcc 7161 CYP4B1 33 exon 12 + 270 ctgggtgtggaggagttggg G/A ccccctgccttcaggagctg 7162 CYP4B1 34 3′flanking + 129 tctgtgtctcacagtcacgt G/A gtgctccaggcattcagggt 7163 CYP4B1 1 intron 1 + (145-146) ccaagcccctggcaacctca CA/&Dgr; gtgattcaggctgcgccttt 7164 CYP4B1 2 intron 1 + 193 tttaatcagtctctctctct C/T tttcccattctaagtgctta 7165 CYP4B1 3 intron 1 + 324 ccctgctctacctccggcac T/C gcccgtccctgcctctccac 7166 CYP4B1 4 intron 1 + 367 tccctgcaggtccctgggcc G/C ttctctgggcctcaggatct 7167 CYP4B1 5 intron 1 + 402 ggatctcaccgtccatcccg T/C ctgccctgcaggatctccca 7168 CYP4B1 6 exon 2 + 35 ccctgtcctgcctgggcctc T/G ggccagtggcagcatcccct 7169 CYP4B1 7 exon 2 + 166 cggtgtttcccacaaccccc A/G agacggaactggttttgggg 7170 CYP4B1 8 intron 2 + 125 ggcagagaagcagaggaggc A/G tcttactcattcctctgctt 7171 CYP4B1 9 intron 2 + 440 gggccgtctcccacttccac T/C acacccgaaggcacctttct 7172 CYP4B1 10 exon 3 + 48 gttctgactcagctggtggc C/T acctacccccagggctttaa 7173 CYP4B1 11 intron 3 + 701 agactccaccccagcttggg T/A ccctttccttgacccctgtg 7174 CYP4B1 12 intron 3 + 742 cttcccatcgttggacgggc G/A aggctgagcagggggaatgg 7175 CYP4B1 13 intron 3 + 1020 gctttagctttctccatgtc G/A cttttcctatcaaggtggcc 7176 CYP4B1 14 intron 3 + 1039 cgcttttcctatcaagctgg C/A cttttcctcatgatgtcaac 7177 CYP4B1 15 intron 3 + 1040 gcttttcctatcaaggtggc C/G ttttcctcatgatgtcaacg 7178 CYP4B1 16 intron 3 + 1920 ccacctgtctaacctctgtt G/C ctgtttgctcatgtctgggg 7179 CYP4B1 17 intron 3 + 1945 ttgctcatgtctggggcgtg T/A ctctacaatggctgttatat 7180 CYP4B1 18 intron 3 + 2621 agcattctgtagaatgctga G/A ctgtgctcaggggttgcgga 7181 CYP4B1 19 intron 3 + 2665 tgttggatcgtgtaggaggc A/G tgtcaaggcatgctggaacc 7182 CYP4B1 20 intron 6 + 194 gggtttgaactggtgggtgt G/T ctcagagctctgtaggggac 7183 CYP4B1 21 intron 7 + 67 tgtgaaatgtcagatgaaag G/A acttgaacttgattaagagg 7184 CYP4B1 22 intron 7 + 2811 ttccaagggaaattgccatt T/G aattctcctgtaactcaggt 7185 CYP4B1 23 intron 7 + (3096-3097) ggggtgcgggttgggggggg (G) ttactgccttctctccagga 7186 CYP4B1 23 intron 7 + (3056-3057) ggcgtgggggttgggggggg ttactgccttctctccagga 7187 CYP4B1 24 intron 8 + 145 ggtgctgtctaccttcgggt G/A ctgaagcagcccagagaccc 7188 CYP4B1 25 exon 9 + 44 ctctcctgggtcctgtacca C/T cttgcaaagcacccagaata 7189 CYP4B1 26 exon 11 + 48 gaacccatcacaacccagct G/A tgtggccggaccctgaggtg 7190 CYP4B1 27 intron 12 '108 tggtccaagttccagctctc C/T ttccctcacctcctctggag 7191 CYP4B1 28 intron 12 + 285 gcatggggatccaggcacgg A/T tacccccttctctattcctc 7192 CYP4B1 29 exon 13 + 238 aagtgaagcctagaattacc C/A taagaccctgttccacagtc 7193 CYP4B1 30 exon 13 + 342 tgtgcgtgaatgttcatggc G/A gccctattcacagtagccaa 7194 CYP4B1 31 exon 13 + 863 tagtgtactgtccttttata T/C gaaatttccagaacaggcca 7195 CYP4B1 32 exon 13 + 707 aaatgttccggacctagata G/C tgacgaaggtagcacgacac 7196 CYP4F3 1 intron 2 + 258 cattaatgcacctctgcggg G/T ctcttgggcagggggttggg 7197 CYP4F3 2 intron 2 + 916 ttagggacatgtcctgagtc C/T acactgctccccacaaacct 7196 CYP4F3 3 intron 2 + 3417 atccaggtctcacacagtgt C/T acttcctctcttggctttag 7198 CYP4F3 4 intron 2 + 4090 gagagcatgaattgggtcct G/A tgtctttctctccagattca 7200 CYP4F3 5 intron 3 + 89 tctgctgcctccagcgggtc G/A cgtgcccatgtgcagacagg 7201 CYP4F3 6 intron 3 + 243 tcaagtctgctgtacggcta C/T gtcttgtcacctgtatattt 7202 CYP4F3 7 intron 3 + 502 aggtctgggacccagggtcc G/C taagtgaactgtctgagaca 7203 CYP4F3 8 intron 3 + 755 ttttgtggccatgtcaggac A/T tgtgaacacatgtcagtgtc 7204 CYP4F3 9 intron 3 + 855 gggacagacagggtgtccta G/A gcccttgtgaaggcattctg 7205 CYP4F3 10 intron 3 + 970 cctgacatagctcctacgtg C/T catgttaggcagtgtcattg 7206 CYP4F3 11 intron 6 + 122 gaggagttgttatacctgat C/T gttgaaggactggtatgaat 7207 CYP4F3 12 exon 7 + 159 ggtgcacgacttcacagatg C/A cgtcatccaggagcggcgcc 7208 CYP4F3 13 intron 7 + 2107 caggttgccagtgatttttt T/&Dgr; ctcagaaagttttcatcaag 7209 CYP4F3 14 intron 7 + 2285 gaccaagaagggtctaggag T/A gcaagatgggcttgggtttc 7210 CYP4F3 15 intron 8 + 132 cctcaatgcaaggttgctgt A/C caccctcgggtgctgaagca 7211 CYP4F3 16 exon 9 + 59 taccaccttgcaaagcaccc G/A gaataccaggagcgctgtcg 7212 CYP4F3 17 intron 9 + 13 attgaatggtgagtgcaggt G/A ctggtgccctgttcctgagc 7213 CYP4F3 18 intron 9 + 36 ggtgccctgttcctgagcct G/C tctcattggctctgttcccc 7214 CYP4F3 19 intron 9 + 167 acccatcctgactgtctggg C/G aaaggttataggcccttagg 7215 CYP4F3 20 intron 9 + 369 tccctaattcctacccttcc G/A tccagtccagggatttataa 7216 CYP4F3 21 intron 9 + 458 tcattcatccatccagtcat T/C gttcagcaaatactctcata 7217 CYP4F3 22 intron 10 + 46 ctcctgggtaggaagagggg A/C ccctcaggcagggagcattg 7218 CYP4F3 23 intron 10 + 63 gggcccctcaggcagggagc C/A ttgtcctgactgcccccttc 7219 CYP4F3 24 intron 11 + 14 ccctgaggtgcgggcccccc C/G tctctgtttttgtccattcc 7220 CYP4F3 25 intron 11 + 84 gatcaggagaatccaacatc G/A cctccctccaagacacacac 7221 CYP4F3 26 intron 11 + 113 caagacacacaccactgtct T/C tccaaggctgccggactggg 7222 CYP4F3 27 intron 11 + 164 cggcaacccttcttggtctc T/G cctccaggtctatgacccct 7223 CYP4F3 28 intron 11 + 168 ggcaacccttcttggtctcg T/C ctccaggtctatgacccctt 7224 CYP4F3 29 intron 12 + 156 gaaaaggcccacagagtagg G/A ttgggttggtcctagaagga 7225 CYP4F3 30 intron 12 + 253 gagctcggctaggctcgcag T/G atatgcaagcccacatgggg 7226 CYP4F3 31 intron 12 + 346 tggcggccccaggccaggcc A/C ccggcgggatggggccagga 7227 CYP4F8 1 5′flanking − 61 accatgtttacccatcattg G/T tcctggagctccccagcccc 7228 CYP4F8 2 exon 1 + 67 gtggcagcatccccgtggct G/T ctcctgctggtggtcggggc 7229 CYP4F8 3 intron 1 + 707 tacgcagcaggtattcacca T/G tatttccacattatccactg 7230 CYP4F8 4 intron 1 + 857 acaccccctaccctcacatc G/A tgacacagctgggccagaag 7231 CYP4F8 5 intron 1 + 907 tgccatctccaccctccccc G/A tgcaggggcatcttctttat 7232 CYP4F8 6 intron 2 + 668 tgtggcacttccaccatatg T/C tcattgccctcttgctccag 7233 CYP4F8 7 intron 2 + 818 gccacagagaccatggctca G/A gccccaaaatgctgagtgac 7234 CYP4F8 8 intron 2 + 1079 tatgcttgggtgttgcagaa C/T atgttggaccatgtaggagc 7235 CYP4F8 9 intron 2 + 1194 ccggtcccctttatgccccc C/A accctcctttcttcttctgc 7236 CYP4F8 10 intron 5 + 45 aacatgggatggagtggggg G/T gtgggtgtggggagagcaaa 7237 CYP4F8 11 exon 8 + (19-20) ggccatgacaccacggccag (GCCAG) tggccgctccggggccttgt 7238 CYP4F8 11 exon 8 + (19-20) ggccatgacaccacggccag tggcctctcctgggtcttgt 7239 CYP4F8 12 intron 8 + 222 tttatttccccactaacttg C/G tatgcaagcttagtaaaatc 7240 CYP4F8 13 intron 8 + 334 cttggagaattaacggcaaa A/T accgcaatgacttttggacc 7241 CYP4F8 14 intron 8 + 1999 ttctaagcacatttactctc T/C cgctcttagctatgatctag 7242 CYP4F8 15 intron 8 + 4184 caggagggccgcgtatgctc C/T cgggacaattgttgggtgtt 7243 CYP4F8 16 exon 9 + 119 acgtggtgctcccagacagc C/T gagtcatccccaaaggtgcc 7244 CYP4F8 17 intron 11 + 282 gggttgggggttccgggcct G/C gttcctggcgcagtggggcc 7245 CYP4F8 18 intron 11 + 340 tgcagtcagaccttccacct C/T ggcccccaggaactgcatcg 7246 CYP4F8 19 3′flanking + 35 atcacctacctttgcaccaa T/C taccttttcagacccccggt 7247 CYP4F8 20 3′flanking + 83 ctgtgttggcccctgtgcct G/C agtcccgcggatggccagta 7248 CYP4F8 21 3′flanking + 90 ggcccctgtgcctcagtccc A/G cggatggccagcagggggcg 7249 CYP27A1 1 intron 1 + 295 aggagggagctgtcttggga A/G gagagtggcagaggcaaatg 7250 CYP27A1 2 intron 1 + 17503 cagtgcataaagcctctgat C/T ctccttagagaaggagggac 7251 CYP27B1 1 intron 6 + 173 cagcccctagcctcatcttg C/T tgtctccattttgtgctttg 7252 CYP27B1 2 intron 8 + 113 atataagacctggtagaatg A/C atcttctgaaatatgataag 7253 CYP27B1 3 3′flanking + 1081 taccctggaatcagtgatga G/C aattctgcccatccgtactc 7254 AADAC 1 exon 1 + 29 attaaagtacactattcagg C/T atatcatgtaggtttactct 7255 AADAC 2 intron 1 + 138 gcggtggcctttgacaatgt G/A ttacttagaaatgttgtttg 7256 AADAC 3 intron 1 + 142 tggcctttgacaatgtgtta C/T ttagaaatgttgtttgtttt 7257 AADAC 4 intron 1 + 1033 ttccagcagagacaccaaca A/G gtaaaaacaccccagctaca 7258 AADAC 5 intron 1 + 1253 tttttttccctcatatttgc T/C gtctgtgctacaatatgtga 7259 AADAC 6 intron 1 + 1366 ctctggtagccttttaatta A/G ttaattcattcatttactta 7260 AADAC 7 intron 1 + 1369 cggtagccttttaattaatt A/C attcattcatttacttacat 7261 AADAC 8 intron 1 + 2501 ggttacagaaagaatggtgg C/A ttggccaaaaaatgataggg 7262 AADAC 9 intron 2 + 46 tgtcactgaggtagttcgca A/G acattttactaagtcttcag 7263 AADAC 10 intron 2 + 1971 aaatgagagttaagtaggag A/C attttcttttatttttgtgc 7264 AADAC 11 intron 2 + 1988 gagaattttctttcatcttt A/G tgcaggagaaatacaaacaa 7265 AADAC 12 intron 2 + 2341 aggtgccttctctattgtcc C/T acgcagacttaggtgatcct 7266 AADAC 13 intron 2 + 2546 gtctgacacagaaggatcaa T/A ggcaaaatgtgcaagacaaa 7267 AADAC 14 intron 2 + 2609 taggaggttcactgggaaac T/C tgaattccactgagtcatga 7268 AADAC 15 intron 2 + 2663 tataaatacagtgttaaatt T/C gtctctcgtatcttaaggta 7269 AADAC 16 intron 4 + 605 tgtgtcagtaaaatattata T/C taagtaggtgaatgagatca 7270 AADAC 17 intron 4 + 621 tatattaagtaggtgaatga G/T atcatgtaattgtgagacta 7271 AADAC 18 intron 4 + 679 ttagagattcagacgaattc A/G tctaatcttcgatggtgtat 7272 AADAC 19 intron 4 + 1680 gttaaaatgtggataaatac C/T acaatttgcaaaatatttgg 7273 AADAC 20 intron 4 + 1748 atttagaagttctatacatc T/C tttatagtatattacacact 7274 AADAC 21 intron 4 + 1771 tatagtatattacacacttc G/A aaaacacaaaattatttttt 7275 AADAC 22 exon 5 + 238 caagtcatctcttcaaattt A/G tcactgtggtactttgggga 7276 AADAC 23 exon 5 + 678 ttagaaattggtctttctta A/G aatggtctagttaagttcca 7277 AADAC 24 3′flanking + 208 aatgctaaaaaaaaaaaaaa A/&Dgr; cacagtgtgtttagtgaatt 7278 CES1 1 5′flanking − 983 tatttccttagccagcggta T/C cacagtgtgtttagtgaatt 7279 CES1 2 5′flanking − 814 tcacattgccttgacatcac A/C cctactgctcctccacccta 7280 CES1 3 5′flanking − 248 agtcctgcaagggtgacacc G/&Dgr; ttatgccacaagcagttggg 7281 CES1 4 intron 1 + 22 tgagtccttctgaagtcaaa T/&Dgr; atgcggggcactttttgaaa 7282 CES1 5 intron 1 + 30 tctgaagtcaaatatgcggg G/T cactttttgaaatccttgtt 7283 CES1 6 intron 1 + 1662 aagggaatccctgacctgag C/A atgaccagcccagtggtttc 7284 CES1 7 intron 1 + 1726 cctccctgaagtcctcagca A/C tcttagctggttcctcgccc 7285 CES1 8 intron 1 + 2716 tgcttccaaggaagttcatc T/G cagtattatttgtaattagc 7286 CES1 9 intron 1 + (2747-2749) tgtaattagcaacaacaaca AAA/&Dgr; gaaaagaagctaaatattga 7287 CES1 10 intron 1 + 3288 ttatttgtccattaaagaaa A/&Dgr; ctcaagcgcttagcctggca 7288 CES1 11 intron 1 + 3681 gagaatatgggacacccctt T/C ttcatcctctcatccagcat 7289 CES1 12 intron 1 + 3818 tccttcttgcatttattttt A/G gctggatgtttttatgcctc 7290 CES1 13 intron 1 + 3880 aaccagctcaatgggttagg C/A aggacattgatcgtcatccc 7291 CES1 14 intron 2 + 74 gagtcaaggcagtcccctga T/C gggctgatcctttgctctgg 7292 CES1 15 intron 2 + 552 atggaaggtgtgtccattca C/A cctggccaagctgggaagaa 7293 CES1 16 intron 2 + 885 cagtattttagatggtaaag T/C attatgatgtaatatattgt 7294 CES1 17 intron 2 + 2001 ttggcatgtcagggctgcaa C/A actcatgtagaaatcactcc 7295 CES1 18 intron 3 + 2119 cgctgagtgcatgaatagtc T/C aggcttgagggtgatgggag 7296 CES1 19 intron 4 + 127 taaggcatccaagccccttc C/A taattggacactacctaccg 7297 CES1 20 intron 4 + 347 tctgtcatgacacttagcag T/C cagcccagcaggtgaaggtt 7298 CES1 21 intron4 + (1984-1985) gtggtcctgaaggtcctgca (C) tgacatctctgctccccacc 7299 CES1 21 intron 4 + (1984-1985) gtggtcctgaaggtcctgca tgacatctctgctccccacc 7300 CES1 22 intron 5 + 766 gaggtgggcagagggtcagc T/C cactactggattcctcagtc 7301 CES1 23 intron 5 + 828 ggagtagatctagcctggaa T/C agcgagtgagtcactgaccc 7302 CES1 24 intron 5 + 828 gtagatctagcctggaatag C/T gagtgagtcactgaccccac 7303 CES1 25 intron 8 + 868 ctcctgagcatgaactctcc T/A cccctccactctgctgtcag 7304 CES1 26 intron 7 + 68 acttcttcatttcagctgtc C/G tcttgcccagcgacggtttc 7305 CES1 27 intron 7 + 681 cctccaaaatcaacaatcca A/G ttatcgcctgtctgctagtt 7306 CES1 28 intron 7 + 885 aggaactatccaaagagaaa T/C acattcatatacttcgcagg 7307 CES1 29 intron 7 + 2101 gtcgtgtaaactgaaaatct C/G aggagttgatggcttcaggc 7308 CES1 30 intron 7 + 2470 atatagatatacgaattcac C/A gagtgatgcgggaacaacct 7309 CES1 31 intron 8 + 128 cgtgtttgtttctgaggccc A/G gagaggggtagtgactcacc 7310 CES1 32 intron 0 + 2618 cctgatggcaacacatgagt T/C gggctctctctaatctgtga 7311 CES1 33 intron 0 + 2665 aaaaattattcatcaaaggt C/A aaacctaaaattaagacatg 7312 CES1 34 intron 8 + 3780 ccatggcgcacggccatgcc C/A gtctatggtactggtctcac 7313 CES1 35 intron 8 + 3791 cgcatggccatgccggtcta T/C ggtactggtctcaccctcag 7314 CES1 36 intron 10 + 222 gtgggctggagaagctgcat C/T gctcaccaggggctggtggt 7315 CES1 37 intron 10 + 230 gagaagctgcatcgctcacc A/G ggggctggtggtcacttttt 7316 CES1 38 intron 11 + 1177 ctagcaggtgccctgacaca C/G ctttgcacaggaaggggcag 7317 CES1 39 intron 11 + 1311 gccctatgctctgcgtctga A/G ctatatatagacttcccatc 7318 CES1 40 intron 11 + 2029 ttctcatttgggatgctaag A/G ttaaaaattagcataacact 7319 CES1 41 intron 11 + 2029 catttgggatgctaagatta A/G aaattagcataacacttcca 7320 CES1 42 intron 11 + 2317 cattcacaaaagctctttct T/C ctatggttggctctgagttt 7321 CES1 43 intron 11 + 3887 caaatatttggctctaattc C/T gcttccacctcagacagctg 7322 CES1 44 intron 12 + 2311 gcgcctctgggcatctcact C/A tgcatgcttaggcgccttgc 7323 CES1 45 intron 12 + 2331 gtacatgcttaggcgccttg C/G ggctctgttgtttttcagaa 7324 CES1 46 3+ flanking + 71 aacggtgatgaaagaggcga T/C gtgagaaggaaggtggcttt 7325 CES1 47 3′flanking + 362 ttgcatggcacttactgacc C/A ttgcacaggcctgcaacacc 7326 CES1 48 3′flanking + 581 atttctggattctgttagta C/T gtagaaagctctaaagcatg 7327 CES1 49 3′flanking + 1348 aaatctgctgctgggagaga G/C agcaaagcatgcagatcaac 7328 CES2 1 intron 1 + (1303-1321) caacagtgacttgtctctacc (A)17-19 gtcaagcatggtggcagaca 7329 CES2 2 exon 5 + 60 ggacccagtggctccactac C/A ctgggtccagcagaatatcg 7330 CES2 3 exon 12 + 256 agcctgctgtgcccacacac A/G cccactaaggagaaagaagt 7331 CES2 4 3′flanking + (155-172) acacagtgagaccccttctc (A)16-18 gagagagtgtgtgattagaa 7332 CES2 5 3′flanking + (173-178) tcaaaaaaaaaaaaaaaaaa (GA)4-6 gtgtgtgattagaagctaaa 7333 CES2 6 3′flanking + 377 ggtcaaggtgagcagaacac C/G tgaggacaggagtttgagac 7334 GZMA 1 5′flanking − 424 cctcagcttgcacttggcct A/G ctaattcttatataacccaa 7335 GZMA 2 5′flanking − 134 agcctgcctgctggcagtga C/G ccatcatccaccattctgac 7336 GZMA 3 intron 1 + 1947 gacataaggttctctctatc A/T gcatgtatggtttgccttgt 7337 GZMA 4 intron 2 + 958 gactgcgtgaccaggtagaa C/T tagcctcagcatggaagggt 7338 GZMA 5 intron 2 + 1025 gttggtgtagtttatactag C/A ttatgaatgatagccttaat 7339 GZMA 6 intron 4 + 105 tgccaagttgcagggtgggg C/G aggactcacaatagtgcatc 7340 GZMA 7 intron 4 + 696 atagagccttacctgaagaa A/G ggtgtgcagtatgcatggtt 7341 GZMA 8 intron 4 + 1141 ctgttcagggaggatcccgg C/A ttccaacatggttctttatt 7342 GZMB 1 5′flanking − 961 tgtttcgcaaatgtttactg T/C gagcctgttatgtgctgagc 7343 GZMB 2 5′flanking − 263 ggctgataccacatcctaca A/G ttcacttcataggcttgggt 7344 GZMB 3 exon 2 + 109 gtgcggtggcttcctgatac A/G agacgacttcgtgctgacag 7345 GZMB 4 intron 2 + (242-243) cgcgggcatactttggcata (A) gaatacaaactgaagcaatt 7346 GZMB 4 intron 2 + (242-243) cgcgggcatactttggcata gaatacaaactgaagcaatt 7347 GZMB 5 intron 4 + 131 atttctctctggaaagagaa G/A aggggactagactgagctgg 7348 GZMB 6 intron 4 + 102 gggcctctgcaaacttacca C/A gaggcttatggtggatggtg 7349 GZMB 7 3′flanking + 54 attctcaggcaccacatctg C/T gctatgcaggccaatgacac 7350 GZMB 8 3′flanking + 184 tccacaccagtttctccagg C/T cctgcccttctgccaaggct 7351 GZMB 9 3′flanking + 286 ccactttggtcctggggctt T/A gggtaaacttcttacctcct 7352 GZMB 10 3′flanking + 406 ctgagctcaaggctcagctc C/A tcctccagccctttggctgc 7353 ESD 1 5′flanking − 333 gtcttgggacagaggagttg C/A gggagttgaaattaggccct 7354 ESD 2 intron 1 + 603 gtcatttctgatggggtcat C/T agggaaatgggattgagcgc 7355 ESD 3 intron 1 + 698 tgtgtggtagaagaagcatt C/T taagcactacgtgaattaac 7356 ESD 4 intron 1 + 1864 gctttcatgcaggattgatc C/G tagtgggatgtattaggaag 7357 ESD 5 intron 1 + 2389 ttttgggaacacctgtctag G/A ttgttaagagccagtggaat 7358 ESD 6 intron 2 + 22 taaacttgttttattgttta T/C atgttactctgaacattgaa 7359 ESD 7 intron 2 + 589 taaaattagtatctctctct G/A taagttcattatttaagata 7360 ESD 8 intron 2 + 1499 tagaaaaatgtgtatcacac C/T gtaagtgttcagtaatgtta 7361 ESD 9 intron 3 + 92 ctttatctagatattatagt C/A cctcattttacttttaaact 7362 ESD 10 intron 3 + 422 gtaaagagattaaacacaca C/T gcacacatacatatacctat 7363 END 11 intron 3 + 581 agaaaacctgagaaatgaea C/T aatttatttaaagccatagt 7364 ESD 12 intron 3 + 2270 gccagtaattacatgtagcc C/A tttacatcaaattagctaat 7365 ESD 13 intron 3 + 2951 taatgaaagtaaatgtttca A/G cttccctaacaaaagttgaa 7366 ESD 14 intron 3 + 3503 aaatgtcagaaattttttgt C/A ccgtcagtcatcaacaagaa 7367 ESD 15 intron 3 + 3097 aaggagcatacagaaaactt C/G ccatgatggggcctttgtgg 7368 ESD 16 intron 4 + 2616 tctaatagtccccagtatta A/G tttacatcaaattagctaat 7369 ESD 17 intron 5 + 392 tcttttttcatctctgttaa C/T atcaaccatacagttaaaca 7370 ESD 18 intron 7 + 107 ttagtattggaactaaactt T/C tctagtgttgagaactttgg 7371 ESD 19 intron 8 + 1091 aaattctaactaattaaagg G/T ttcatcctttagtaactaga 7372 ESD 20 intron 8 + 1652 tataaacttgtggttaatga A/G tatatatgaataagaatatt 7373 ESD 21 intron 8 + 2048 agaaggaaaaaggccatttt G/C ttaagaatccctgagatatg 7374 ESD 22 intron 9 + (1523-1526) ctgccaacaaagtctgaaaa (TC)2-3 aagtttgttataaaaacagc 7375 ESD 23 intron 9 + 3468 atagaaggagaggctatact A/G cctccttaagtctcaggacc 7376 ESD 24 intron 9 + 3362 actaaggataaaaatatggc A/G tactcagtcacattggaact 7377 ESD 25 intron 9 + 5292 aggccttaatgacatatttc T/C cctcacataaagatacaaca 7378 ESD 26 intron 9 + 5298 taatgacatatttcccctca A/G ataaagatacaacatgcttt 7379 ESD 27 3′flanking + 798 tatggtaactgaagaaaatg A/G cattaagttcctaaagttat 7380 CEL 1 5′flanking − (611-617) tggatcaaggcaaataattt (A)6-7 ggaaattatttgaagaaaaa 7381 CEL 2 intron 1 + 20098 atctctaccaaggtaccaat T/C ccttaaggaagatgttaatt 7382 CEL 3 intron 1 + (20911-20924) taatgacattaatacttagc (A)13-15 ctgaatatgactaaaactga 7383 CEL 4 intron 1 + 22374 ttaagttaaatgtaaacagc A/G cctttgcacactattcagtg 7384 CEL 5 intron 1 + (22460-22469) ttaattttttagttaggttg (T)9-10 ctcttttattttatcacatg 7385 CEL 6 intron 1 + 24205 agaatttgagtctattcttg T/C gtgccttctgactacatcct 7386 CEL 7 intron 1 + (24404-24417) gcaagttttaactgaattac (A)11-14 gcagatgataatcattctat 7387 CEL 8 intron 1 + 26983 tagattttgatgagtttgag T/G ttttttttttttttttccaa 7388 CEL 9 intron 1 + (26983-26999) tagattttgatgagtttgag (T)14-17 ccaaaagggtgggggttgtt 7389 CEL 10 intron 1 + (32166-32174) tcaactttgctggtaaccag (A)8-9 gaaaagccactattaatatc 7390 CEL 11 intron 1 + 37217 aaatttgtaagtgaatgtta T/C ataaaaatctgtaacaatta 7391 CEL 12 intron 1 + 37685 taattcaaatggattaatca T/A tgataatttctatttttaaa 7392 CEL 13 intron 1 + 38032 caggcctaataaatgaaatg T/C tcactactgttgccaacacc 7393 CEL 14 intron 1 + 38133 attcgggagtcctgtctgcc A/G tttgtagaaaccatccagct 7394 CEL 15 intron 1 + 38169 cagctcatcttcctactctt A/T gtgttggggatttttgcccc 7395 CEL 16 intron 1 + 38544 gtttctgtcaactctccaga T/C ataaaatcaaatgctcttcc 7396 CEL 17 intron 1 + (38642-38643) caatttcttcacaatacctg (G) attgctgccaggcagcaata 7397 CEL 17 intron 1 + (38642-38643) caatttcttcacaatacctg attgctgccaggcagcaata 7398 CEL 18 intron 1 + 49429 gaaagagaaacttgtgtccc A/G gaaacttgtgtaagtatgcc 7399 CEL 19 intron 1 + 49038 ttgaaactgcactgacacta A/G tttaaattttacaagtaatt 7400 CEL 20 intron 1 + 49040 gaaactgcactgacactaat T/C taaattttacaagtaatttt 7401 CEL 21 intron 1 + 49256 acatgagaaaagaaatggag C/A taagtttaaaaacagaatga 7402 CEL 22 intron 1 + 49386 aatagttctcagtagatatt C/A ttttacctatatttagtata 7403 CEL 23 intron 1 + 50786 tactttgtcctcaccaatgc C/A tattcttcccctaaacagat 7404 CEL 24 intron 1 + 50977 ctccagccagagaggacaga T/C agctgagtttctgtttgcct 7405 CEL 25 intron 1 + 51150 agcacnatggactgtttttg C/G agtcctcctctttattatgc 7406 CEL 26 intron 1 + 52333 tcagtcaaacttaaaggctc A/G gagatctattaatgcttatg 7407 CEL 27 intron 1 + 52589 gtgtcagcatctgtagagta C/A gggagggtgttgaaagaaaa 7408 CEL 28 intron 1 + 55838 tctcgcaggtaaatgaggat C/A gaatactttaaatacaaatc 7409 CEL 29 intron 1 + 56828 ataagtttggaaaatttgtg C/G taaaatacactaaatatttc 7410 CEL 30 intron 1 + 58738 tggtggagaaatagcttata C/A tgctggtcaaactgtcccat 7411 CEL 31 intron 1 + 59358 cagaaattgtactttaaaat A/G cgaactgcaagcactgcagt 7412 CEL 32 intron 1 + 59359 agaaattgtactttaaaata C/T gaactgcaagcagtgcagtc 7413 CEL 33 intron 1 + 59464 acccagaaaggagcatgtcc C/G tttgtcatttgtggtgaaac 7414 CEL 34 intron 1 + 61340 aaaaaaaacttcaaaatact C/G caatatccaaagttggtaca 7415 CEL 35 intron 1 + 62739 cagtctttaggcacaaagag A/G caaagagtcttctcatctct 7416 CEL 36 intron 1 + (64764-64779) ctgggttgtttctcataaag (T)14-17 aatgtgggatagtggtataa 7417 CEL 37 intron 1 + 65243 tttcaggcttctggacagaa T/C agtattatgataaaagctat 7418 CEL 36 intron 1 + 65269 tatgataaaagctattaata T/A ttaggaagattcctctgact 7419 CEL 39 intron 1 + 65325 aattagaaaagcaagttttg C/G gggggggggtccaaaacaaa 7420 CEL 40 intron 1 + (65326-65334) attagaaaagcaagttttgg (G)7-9 gggggggggtgcaaaacaaa 7421 CEL 41 intron 1 + 65524 cacacccataaccaccagtt A/G gttgcctctcctgagccatg 7422 CEL 42 intron 1 + 65869 cagagtaacattcgggctcc A/T actgtcctttcttatacaga 7423 CEL 43 intron 1 + 65910 aaggctgtctcctgctgttt C/G tggatccaaggcctgctgaa 7424 CEL 44 intron 1 + 66800 cctctctttccatccctgac C/A gagcatattcactgtcctat 7425 CEL 45 intron 1 + (66226-66235) tctgtttttgaaaaaacaag (A)9-10 tctctccctgcctttggaaa 7426 CEL 46 intron 1 + 81816 aatgttgccttactttccac A/G tatttccagaagccctgatc 7427 CEL 47 intron 1 + 83480 tatgactgtcaggaagaaaa T/C tagaattatctttgtatcct 7428 CEL 48 intron 1 + 83732 ggggtttgaaatctatggag T/C catttacttctttttaaaaa 7429 CEL 49 intron 1 + 85507 ctggaaagaaattttgtgta A/T ctgcattatttaaatgttag 7430 CEL 50 intron 1 + 87299 caatggtcattatatcttcc G/A tgtgtgaagaaagtcgacaa 7431 CEL 51 intron 1 + 87426 caacaggataatcccagaat G/C ctctgtctgcacttggctct 7432 CEL 52 intron 1 + 87670 tattttgttcctaatattca T/C gacatgacacaccaacataa 7433 CEL 53 intron 1 − (77484-77503) ttggttactgttttttattt (A)9-10 aaactctgataaaaggggcc 7434 CEL 54 intron 1 + 77368 agctcacgggacagaacact G/C gggggaggcaagaaagcggg 7435 CEL 55 intron I − (75135-70129) tgcccggctggcacaagccct (G)6-7 tgggactactctgacgcctc 7436 CEL 58 intron 1 − 74785 gctgcccacggaagctgggg G/C ctgttcgcctcttctcctgt 7437 CEL 57 intron 1 − 74755 tcttctcctgtgtacatgaa A/G cctcaggcctccaggtgcag 7438 CEL 58 intron 1 − 73099 ccccgcggtctactcctggc C/T tcttcttgccgccgcctgct 7439 CEL 59 intron 1 − 72559 agcagcagctgggccggtcc G/A tgcagggagtgaggtcggca 7440 CEL 60 intron 1 − 70098 acagggaggaaacagcaaaa T/C ctcaacactgttgatctaat 7441 CEL 61 intron 1 − 69440 gttggccatgagagaaaaca C/T aggaaggtattggaaaatga 7442 CEL 62 intron 1 − 65270 attctgcactggctgggaag G/&Dgr; cttggcttgggcttcatggc 7443 CEL 63 intron 1 − 64434 ccaaattagggagtggaatg C/T aaaatctgaattaattttca 7444 CEL 64 intron 1 − 63966 agatcacacatcccccaccc C/T atcgcctagagaactgagcc 7445 CEL 65 intron 1 − 63916 gctgctcaccatgacctagc C/T ttcagggctgaccccagtcc 7446 CEL 66 intron 1 − 60392 tcatggggctccaggatgca C/T gtggaaatccctgggagaag 7447 CEL 67 intron 1 − 60321 aattacttgaaccccattcc A/T tcccacccaaacccttttcc 7448 CEL 68 intron 1 − 60318 tacttgaacaaaattcaatc C/T cacacaaacaattttcctcc 7449 CEL 69 intron 1 − 56852 tgctccaagccctccccctg C/A gcccagcacgaccccatctc 7450 CEL 70 intron 1 − 56133 gctggctcgtgggatgtcta C/T ggggattgactggcaccccc 7451 CEL 71 intron 1 − 55964 ccccagcgcccatcagaccg a/A cctgagacttatcactgccc 7452 CEL 72 intron 1 − 52016 tactggaactaggggtgggg G/A ggcactgccagtggaaaggg 7453 CEL 73 intron 1 − 51998 gggggcactgccagtgccca G/A gggaggggactgcggggcac 7454 CEL 74 intron 1 − 51578 gtgggatcgacttgcatttt T/C gggggagaagaataactggt 7455 CEL 75 intron 1 − 39557 ggaccagcacatggattcaa T/C gaggctctaagctacccaag 7456 CEL 76 intron 1 − 39490 gccctttcttccaggttgta A/G tgggcaatgatggtcaccag 7457 CEL 77 intron 1 − (31332-31340) tccggacttctaattggctc (A)8-9 ctcgctcggccctcggattc 7458 CEL 78 intron 1 − 19634 ttatttaagggctggaaata C/T tagctgcctgcaggagatgt 7459 CEL 79 intron 1 − 6589 gacgggtgatgcgagggact T/C gctgtccccaagtgtatggg 7460 CEL 80 intron 1 − (3340-3348) gctggcagtgctggcctgtc (C)4-6 tcacatgtggtcgggttggg 7461 CEL 81 intron 3 + 35 tgcaggaatggccatgagga G/A gggcgggtgagggcggctga 7462 CEL 82 intron 6 + 157 gtggggagcggccttggtga C/T gggatttctgggtcaagtag 7463 CEL 83 exon 9 + 137 aacatggacggacacatctt C/T gcaagcatcgacatgcctcc 7464 CEL 84 intron 9 + 41 tcaggggcgacacgtgcggg A/G gggcagccgggaaagcactg 7465 CEL 85 intron 9 + 181 ggggtgagtatgcacacaca T/C tcctgttggaaaaggatgag 7466 CEL 86 exon 10 + 82 acgacctttgatgtctacac C/T gagtcatgggaccaggaccc 7467 CEL 87 exon 12 + 583 cccacgggtgaatacggggc C/A cacccagtgaacaacaaggg 7468 CEL 88 exon 12 + 759 gttttagagtaacatgagca T/C tggtatcaagaggccacaag 7469 TL17 1 5′flanking + 832 cctgagaaggaactattctc A/G aggaaatgagtaaaacttaa 7470 TL17 2 5′flanking + 692 tgccccccttttatcaatct C/T cataacctttctccagtctc 7471 TL17 3 5′flanking + 76 ccctgaacccactgcgacac G/A ccacgtaagtgaccacagaa 7472 TL17 4 intron 1 + 18 gtggtgagtcctgcactaac G/A tgcgatcctcttgatgattt 7473 TL17 5 intron 1 + 126 ctgtatatgtaggataggaa A/G tgaaagctttggtaggtatt 7474 TL17 6 intron 1 + 762 ctgagaacaatggtgcagga G/A gatatttataaatagaaaat 7475 TL17 7 intron 2 + 594 tattttgatcatttgacttc A/T tacaaataagtctctgttct 7476 TL17 8 exon 3 + 1487 agctgatggggaagaacgaa C/T tttaagtatgagaaaactta 7477 TL17 9 3′flanking + 657 ccctgaatctttttaattat G/T catctaactaattcctaaca 7478 UCHL3 1 5′flanking − 1034 ataatgtgaagaagaaaaaa A/G agaaactgctactgggctac 7479 UCHL3 2 5′flanking − 490 aactactgcacaccgacaaa G/C gaacaacagcaacgtgctga 7480 UCHL3 3 5′flanking − 400 aaaagaaaaacgaaaaacag T/C accgtgatgaacggcgtcct 7481 UCHL3 4 5′flanking − 295 atgcgtagaacgcgagcgct T/C ggaaaggctaagctcggaag 7482 UCHL3 5 5′flanking − (25-11) tgggcggaagcggcggcggc GGCGAAGGCGGCGGC/&Dgr; tgtcagagctg 7483 UCHL3 6 intron 2 + 28 aggtgtctgtcgctcgggac T/C tcggagtcttttctgtctgc 7484 UCHL3 7 intron 2 + (5639-9640) aattttttattataataata (ATA) tataagtagaagaattatat 7485 UCHL3 7 intron 2 + (5639-5840) aattttttattataataata tataagtagaagaattatat 7486 UCHL3 8 intron 2 + 7062 aggtggattcaaaccaaaca G/A gctaactgctaacattttag 7487 UCHL3 9 intron 2 + (7936-7947) tgatcatttcaaacacaggg (T)11-12 aattgtaaaagtaggacatt 7488 UCHL3 10 intron 2 + (7975-7988) aaagtaggacattttaatga (T)12-14 gaagaagtgagtggtaaaag 7489 UCHL3 11 intron 2 + 8117 cctgactcatggcaatatgg A/G gtaaggatctaacaatatat 7490 UCHL3 12 intron 2 + 8361 ttcttacctttacctgacat G/A gagtagatttgcagtgaact 7491 UCHL3 13 intron 2 + 9800 taagatatagtgatgcattt C/T taatatgatttttgtttcct 7492 UCHL3 14 intron 2 + (10735-10747) taccaactaatgttccattg (T)9-10 ctttctttcttttaccagtt 7493 UCHL3 15 intron 3 + 11 tacagaaaaggtaattgtta A/T gtaaaatagaaagtttctgg 7494 UCHL3 16 intron 3 + (662-675) cttaaatacaattttttcaa (TA)6-7 aggaatattctttgattatt 7495 UCHL3 17 intron 3+ 866 tcaagtctacatattttagt T/C tttttttctagaatgatata 7496 tacatacgtatacgtatata UCHL3 18 intron 3 + (94 + 945) (TGTATACGTATACATACGTATACATATATACATACGTATATA) 7497 cgtacgtatatacgtatacg UCHL3 18 intron 3 + (94 + 945) tacatacgtatacgtatata 7498 cgtacgtatatacgtatacg UCHL3 19 intron 3 + 5052 aggcagtcagctatagagcc T/C acatttttgatgcttattat 7499 UCHL3 20 intron 3 + 5282 acctctgttaagtttttgca T/C accctttcagactttccaat 7500 UCHL3 21 intron 6 + 2191 tttctaggggtttcctagtg C/T gtagagcagtgattctcaag 7501 UCHL3 22 intron 6 + 8284 tctgcaagtcaaatgtgaag C/G caagagagaaaaatccaaaa 7502 UCHL3 23 intron 6 + (8741-8744) atgtgagtaaaccacaattt ATTT/&Dgr; ttcatttccttaacttttga 7503 UCHL3 24 intron 6 + 9411 tcctctgtttagaatctact T/G ggcttttttggcccagccag 7504 UCHL3 25 intron 6 + 9459 tgtcagtggcagtaaatagt T/A taaagtttcatcttcattac 7505 UCHL3 26 intron 6 + 9772 gaaacaatacatgtatcatg T/C ggttcaagatgtagagtcca 7506 UCHL3 27 intron 6 + 10158 ttattttaaaggaaaattct C/T agaccgaacttaccagttca 7507 UCHL3 28 intron 6 + 10829 tttactaaaaaatctacaga A/C atccatttagaattaattta 7508 UCHL3 29 intron 6 + 12493 agtcaaattagttgacagtt A/G atgggcgagtgaccttgcaa 7509 UCHL3 30 intron 6 + (20435-20437) ttttttaattatgtagtcct CCT/&Dgr; cgccatcctcatcacagcct 7510 UCHL3 31 intron 6 + 21202 ttgatctgatctttcctgcc C/T attcagtttctaaagatctt 7511 UCHL3 32 intron 6 + 21295 caaatttatgatttctcttt T/C ataggctaatgatatctgca 7512 UCHL3 33 intron 6 + 21639 taagaacaattaaaagtcaa C/T ggcaagcattctttccttcc 7513 UCHL3 34 intron 6 + 21778 tccatttctgctgagtatca A/G caaactcacatctctttcta 7514 UCHL3 35 intron 6 + 23299 cttttagattaaaggtgcaa T/C gatgcacaattttgagtcac 7515 UCHL3 36 intron 6 + 23498 tattcagttctctgactcca A/G ttgtactacttttacctcta 7516 UCHL3 37 intron 6 + 23790 ctagccttaaaaaattggac A/T ctcttctgattattgataaa 7517 UCHL3 38 intron 6 + 23894 actcattatcactgtcttca A/G atatttaaagaaatatgttc 7518 UCHL3 39 intron 6 + (24729-24732) agtcttaatttcaaattgtt TGTT/&Dgr; aagcatcaaagcaagagaaa 7519 UCHL3 40 intron 6 + (29083-25084) catgtattcatttcattcag (A) taagtatgcaatgtccatat 7520 UCHL3 40 intron 6 + (25083-25064) catgtattcatttcattcag taagtatgcaatgtgcatat 7521 UCHL3 41 intron 6 + 25884 catgtattcatttcattcag C/T aagtatgcaatgtgcatata 7522 UCHL3 42 intron 7 + 1342 gaagaagtcattattttggt C/A gcatataatggacctccagg 7523 UCHL3 43 intron 7 + 1387 ttttgaagatgtgccttgct G/A attgagtctacaaaatctgc 7524 UCHL3 44 intron 7 + 1760 actcggttttactagttaga T/C agctgtcttggctcagaggc 7525 UCHL3 45 intron 7 + 2096 taggtacattacaaagatgg C/A cagttgctgattcgttgcaa 7526 UCHL3 46 intron 7 + 2873 ttaatgtattaattccctac T/C ctaataaattgtaaggttaa 7527 UCHL3 47 intron 7 + 7594 tctctgagcctcatggattc T/A tctgcagcgtatgcatttac 7528 UCHL3 48 intron 8 + 287 ctctatgaacaaatgtaaaa T/A ttgaaaaggcaagaatagta 7529 UCHL3 49 intron 8 + 252 aagacttgctcattatatcc C/G agatttcatnaaatccagga 7530 UCHL3 50 intron 9 + (553-592) tttacactgaaaaatcatac (T)9-10 ccggcatagcatgccataca 7531 DDOST 1 intron 2 629 attctgttaagaagttctta T/C atgaacaaatattgtctcct 7532 DDOST 2 intron 2 3125 gagaatataggagcttctgc C/A tatgcctgaaagtcagtcag 7533 DDOST 3 intron 2 3920 attactcatttgatgaataa A/G tggattactgagcactgtct 7534 DDOST 4 intron 3 189 actgctgtccaggggtccat C/T tggggctgagcccacctgga 7535 DDOST 5 intron 6 185 ctgtcctcttgttcgggagg C/T gtggcagcttttcccctact 7536 DDOST 6 exon8 37 aactatgaactagctctggc C/T ctctcccgctgggtgttcaa 7537 DDOST 7 intron9 37 tcctgcccaagaatgctgcc A/&Dgr; aaaaacggccccacgcctca 7538 DDOST 8 intron2 + 1299 atcttctgatggctgggctt C/T ggtgcagtaactggtgtttg 7539 DDOST 9 intron2 + 1581 gatactgtgggtgggagaaa T/C gacagagagtgtaaaacagt 7540 DDOST 10 intron2 + 2822 gtttctcaacaggtgcattc T/C tgacgtttcagactggatac 7541 DDOST 11 intron2 + 3392 cagaaggcgtggaggcctgc C/T gcgcctccctctgttgctgc 7542 DDOST 12 intron5 + 495 attgcttgaacccaggacgc C/A gaggttgcagtgagccaagg 7543 DDOST 13 intron6 + 226 ggaactgcttgggtcacagc C/T ccgccttgcccccagtaccc 7544 DDOST 14 intron6 + 303 aagagagataggtcattagg A/T tgaatttgttaggcaagaga 7545 DDOST 15 3′flanking + 40 cacagcgtggagacggggca C/A ggaggggggttattaggatt 7546 NTE 1 5′flanking − 535 cacgatctgtcctccgattc C/T tgttaactctagactttctg 7547 NTE 2 5′flanking − 15 gtaaatccccggcaaaaacc A/G gcagcgccttgcaagcccac 7548 NTE 3 5′flanking − 748 agcatggcgcggggaggagg C/T gtgggagggtcgggagggac 7549 NTE 4 5′flanking − 690 tgaataatttaaaggggccg T/C gccggcggagccgggcggaa 7550 NTE 5 intron6 + 605 ccttgccatatacttagtgg A/G ggggtctacatcaggggttt 7551 NTE 6 intron6 + 749 agcctccagcctctcttctc C/T gggggttatctcaggcatct 7552 NTE 7 intron6 + 957 ggtctgggctctgggatccc C/T gtgcgtcatgtagtctacct 7553 NTE 8 intron6 + 1882 tggcctcaagcaatcctccc C/A cctcggcctcccaaagcgcc 7554 NTE 9 intron6 + 2222 gaatgtttatgtagaacaga C/A agactgtatctgcggtcttc 7555 NTE 10 intron12 + 166 tatctggtaccgaggaagct C/G cggcctcgtccccaagggcc 7556 NTE 11 intron13 + 69 atccaggtccaccgcctgcc C/T gtcttgattgttttaatctg 7557 NTE 12 intron14 + 8 agcccccgctcgggtaaggc C/T tgggaccctgcccgctggtg 7558 NTE 13 intron16 − 113 cccaccccgcccggcgccgt T/C atatttttcttaacccttcc 7559 NTE 14 intron21 + 34 agagcccgccggcccagagc A/G tgctgggagatgtagtccgg 7560 NTE 15 intron21 + 128 gaagaaatcgtgccgctgag C/A gtttcaaaccctaagtagga 7561 NTE 16 intron21 + 151 ctcaaaccctaagtaggacc C/G aggtgcagagcattctgggc 7562 NTE 17 intron21 + 601 ccactgtactcaagccggga C/T gacagagctagaacctcttt 7563 NTE 18 intron21 + 737 tggaaaatagtctgtggatt G/T ttgtttaggactctgggcac 7564 NTE 19 intron21 + 1752 acagctggtctaggctgtta G/C tggagaaactgggaagcaac 7565 NTE 25 intron31 + 1785 gaagcaacagctgggtcaaa A/&Dgr; gtagcttttcttttcttggc 7566 NTE 21 intron21 + 1907 cactgcaacctctgcctccc A/G ggttcaagtgattctcctgc 7567 NTE 22 intron21 + 2065 ctgcctcgttttatgttcag G/T tcccccattagacagaggaa 7568 NTE 23 intron21 + 2336 agtctgggagcacaggagca G/A gaatttcagataaggaggaa 7569 NTE 24 intron23 + 41 tggggagggtggtgggtggg G/C ctggagcctcaaattctttc 7570 NTE 25 intron23 + 71 caaattctttcagacctgag T/C tcaagttctcggcttccaac 7571 NTE 26 intron23 + 81 cagacctgagttcaagttct C/T ggcttccaaccacggagcct 7572 NTE 27 intron24 + 150 gtggggcggctggtgacctc A/G gccgtccgtattccgcagct 7573 NTE 28 intron29 + 37 gcctgcagcaaccgctgacg T/C cacgtggggttggggggatg 7574 NTE 29 intron29 + 370 cgtcccaggtcagcgagccc G/A tcgggccggctgggcctccg 7575 NTE 30 intron30 + 56 acctcccgcaccacacacac G/A cacacgcgtgggcacacaca 7576 NTE 31 intron30 + 358 aaaaatacaaaaaattaacc A/G ggctggtggggtgtgcctgt 7577 NTE 32 intron30 + 372 ttaaccaggctggtggggtg T/C ctggagcctcaaattctttc 7578 NTE 33 intron30 + 430 aaatcacttgaacctgagag G/T tggaggttgcagtgagctga 7579 NTE 34 intron30 + 655 gtgtgcacaccagctatata T/C gcaaatgctttctctcaggg 7580 NTE 35 intron30 + 655 gcacaccagctatatataca A/G atgctttctctcaggggcag 7581 NTE 36 intron30 + 760 tgaaatagggcatttgccaa C/T gcatgccagtctgtcccgtt 7582 NTE 37 intron30 + 835 gcacacacgtagataggatg T/C ggcacctctgaccgagttaa 7583 NTE 38 intron31 + 40 tggtgcctgcataggtggtc T/C ggctaagctttgctacttaa 7584 NTE 30 intron31 + 41 ggtgcctgcataggtggtct G/A gctaagctttgctacttaaa 7585 NTE 40 intron31 + 1329 gtctgtcaagggcaggacag G/A aaatatgtaaacgaatgtac 7586 NTE 41 intron35 + 31 aatggcttcctgtcgttttc G/A gactggggacccaccttctg 7587 L1CAM 1 intron 1 + 767 tttgacttccttacatgggt G/A actgtgtgagtcactctgtt 7588 L1CAM 2 intron 1 + 862 gcattgagtcatgtgtatgt G/C tgagtggggctgaatgtaag 7589 L1CAM 3 intron 1 + 1332 cagggatgaaggagcagagc C/T actgaaaggccacacagatg 7590 L1CAM 4 intron 4 + 552 tttccctggggttttccctt T/C gcattccatcctccctgagc 7591 L1CAM 5 intron 18 + 147 agcgacgttatgaaattccc C/A acacttcacatttctataat 7592 L1CAM 6 intron 24 + 221 ctccttagccccccagaggg C/T cccaactttaagagcatact 7593 AANAT 1 5′flanking − 542 aggggtgcaggatgaggtgt G/T agctggagggcagggggtag 7594 AANAT 2 5′flanking − 263 ccccccacataagaggtggg C/G ttgtccaagactccgaggga 7595 AANAT 3 intron3 39 cgcccagctccagggaggcc T/A ctgaaaacagaggtcagcca 7596 AANAT 4 exon4 150 cagccagccatacgccaggc C/T gcgctcatgtgcgaggacgc 7597 ARD1 1 intron1 + 317 ccgtcggtctgctcggcccc C/G etccctcggggctaggcagg 7598 ARD1 2 intron6 + 322 gctcctcagcatctgctcac G/A ccagggacccacacctctct 7599 ARD1 3 intron6 + 1095 aaggctccatcctgagacaa A/G aaatccaatataacctgccc 7600 ARD1 4 intron6 + 1179 aggaggaagacctgtatccc A/G gggacaccctcctccactcc 7601 ARD1 5 intron7 + 159 cctccaggctgctaggcaga C/T ggcctcctctaaagcccagc 7602 ARD1 6 intron7 + 295 tgaccagccctgccacccga G/T gagccttggacagaaccctg 7603 ARD1 7 intron7 + 416 actaccatggaggcccacac G/A acagagcgctgccccttgac 7604 NAT1 1 3′UTR 215 aataataataataataataa A/T aaatgtattttaaagatggc 7605 NAT2 1 exon2 867 cgtgcccaaacctggtaata G/A atcccttactatttagaata 7606 NAT2 2 3′flank 521 ccatccatactttgccacaa G/A agaaagaacatgagctttat 7607 NAT2 3 3′flank 573 gatttcaaatcctgtagaca C/T ggggtgaattacttttaaaa 7608 NAT2 4 3′flank 918 attttctatttgtaaattcc A/G gtatcaaggctatagtttaa 7609 NAT2 5 3′flank 979 actattctccctcttcgact C/T gtgatgactataataatctt 7610 NAT2 6 3′flank 1955 tacctattgaagtaaaccta C/T gtcatatccacctatttgtt 7611 NAT2 7 3′flank 2034 ccactgattcccaaagctag T/G tcattaagaaaacaatgcct 7612 NAT2 0 3′flank 2201 cagattactggagggctact G/A tttgctcaccaatacaaatg 7613 NAT2 9 3′flank 2818 gggatatttgtctcctttct C/G cccaatgcatattggaaacc 7614 NAT2 10 3′flank 3237 atatatattccaattaaaaa A/&Dgr; caaaataaatttccaaaact 7615 NAT2 11 3′flank 3386 caacaaagagattttttaaa G/A ctttttaaaacaccagacag 7616 NAT2 12 3′flank 3660 cagcactattcacaatagca A/G agatgtgaaatcaatctaaa 7617 NAT2 13 3′flank 3973 agcagaaaaaataaataata C/T gtactagacttactacctac 7618 NAT2 14 3′flank 4029 caaaacaaacccccataaca T/C gagtttatctatataacaaa 7619 NAT2 15 3′flank 4118 ataagattaatatctgcata C/A aaatctttgtttacaactta 7620 NAT2 16 3′flank 4146 tgtttacagcttgttatata C/T tgaattatgtctgctccccc 7621 NAT2 17 3′flank 4279 ttaatctgataaaattggtg G/C ctttataagaaaaagaaaag 7622 NAT2 18 3′flank 4323 ttgctctctccccagtgcag T/G taccaaggaaagaccatgta 7623 NAT2 19 3′flank 4446 tcaattaactttatctgcaa T/C tctagaatcaggcaatactc 7624 NAT2 20 3′flank 4462 gcgattctggaatcaggcaa T/C actccatttcataaaacaga 7625 NAT2 21 exon2 + 255 atgttaggagggtattttta C/T atccctccaattaacaaata 7626 NAT2 22 5′flank − 2053 ctaaattaaaacattttaat T/C ccaggtgtcaggtttccaac 7627 NAT2 23 5′flank − 1299 gaatcaccaatgcaagagat A/G taacaatgaacccaagacac 7628 NAT2 24 5′flank − 1145 ctgtagaacacaaggatatt C/T aaagacagtttgtacatacc 7629 NAT2 25 5′flank − 1036 ccttcccacagagtcccgag T/A tcatgtgacagcatgccaga 7630 NAT2 26 5′flank − 94 aaaaatttgctaagaaattc G/A cagaagcaacctaaggccct 7631 NAT2 27 5′flank − 643 atgtttatattttatattaa T/C attaatgtaaataaaaattt 7632 ABCB2 1 5′flanking − 673 agctaagagtcaaagcaccc G/C ctttttccaccagcctcgcg 7633 ABCB2 2 5′flanking − 646 ccaccagcctcgcgtgcctg T/C tcccttcacggacactctag 7634 ABCB2 3 5′flanking − 563 ttgcaagcgctggctgctac A/G ggcgacctccctgcgctccc 7635 ABCB2 4 5′flanking − 236 gctttgcgcgcggcgctaac C/T tgtgtagggcagatctgccc 7636 ABCB2 5 Intron3 + 408 aaggaaactgaggccaagac C/T ctaaatgctgaaactgcaca 7637 ABCB2 6 Exon4 + 153 ccctcaccatggtcaccctg A/G tcaccctgcctctgcttttc 7638 ABCB2 7 Intron4 + 289 gtatttctttagcatccaag G/T ggcatagctgtgtctctttc 7639 ABCB2 8 Intron4 + 291 atttctttagcatccagggg C/G catagctgtgtctctttctc 7640 ABCB2 9 Intrpn5 − 63 ttccttcaggttaatgactg C/T ggttctttgtgtcccctcca 7641 ABCB2 10 Intron7 − 185 gtctctgcccttgtctttgc C/T gcttcttctatctctactcc 7642 ABCB2 11 3′flanking + 71 agcgcacttttcagctgcgg C/A tgtctcctcttttatcatcc 7643 ABCB2 12 3′flanking + 129 aactgcatcaccttttccct T/C aagctttttaattcctatga 7644 ABCB2 13 3′flanking + 455 cattcagggaggcccaggtc C/A tgtgacgtcgacagttgctg 7645 ABCB3 1 intron3 + 8 tctcctttggcaggtaggtg C/A tgggcagctgggtccatttg 7646 ABCB3 2 intron4 + 104 cttcacccgtatgccaggac C/T tggggatgcttttctcttgt 7647 ABCB3 3 intron10 + 219 gcagcactggtgctccctcc A/G tgggcagccccgtcaggtcc 7648 ABCB3 4 intron11 + (317-319) atggtgcccaggtggatgtg GTG/&Dgr; tccatctcattcctgtcttt 7649 ABCB3 5 exon12 + 19 agctgcaggactggaattcc T/C gtggggatcgcacagtgctg 7650 ABCB3 6 exon12 + (356-357) aggtggggtggcgtggggtc GG/TGGTGGGGTGGA ggctgtctgtgtcc 7651 GSTM3 1 5′flanking − 144 ccaacgccggcattagtcgc C/G cctgcgcacggccctgtgga 7652 GSTM3 2 intron 7 + 165 agcctaacttctataccttg A/G aggcactgtctacaaaaaaa 7653 GSTM3 3 intron 7 + 257 ctgttgcactgggtggggtc C/G ttataagattggtgtatttt 7654 GSTM3 4 exon 5 + 51 cccagtggggcaacaagcct A/G tatgctgagcaggaggcaga 7655 GSTM4 1 intron 4 + 67 ttggctggattggggtgcta C/G gctcacagtgagtctgtgtt 7656 GSTM4 2 intron 7 + 77 gatgctttcccagtcctgga T/C ctgcataaagaataacttgc 7657 GSTM4 3 intron 7 + 80 gctttcccagtcctggatct C/A cataaagaataacttgcatt 7658 ALDH7 1 intron1 + 464 catgaatgactctgggaaag A/G atcattcttagcaatggact 7659 ALDH7 2 intron1 + 2269 aaatggaatccaaacagcaa C/G agacatcccctcaccggtca 7660 ALDH7 3 intron2 + 1349 actgagcttctgccaccggc C/G gcctgccggccttcatgaga 7661 ALDH7 4 intron2 + 1820 tccgtgtgggaggcaccttc C/G cccagcctcagtggctagga 7662 ALDH7 5 intron2 + 2046 aacctcaggcgctgcctcag C/G cagggagccagcctggcccc 7663 ALDH7 6 intron2 + 2939 aagcacgcactgaacatgga C/A tgagtgagtgaaccaatgaa 7664 ALDH7 7 intron3 + 7 tgcccaggaacctggtgagc C/T ggccgggctgaggcgggcag 7665 ALDH7 8 intron4 + 36 gccccttccggtcacccttc T/C ccgctcgaggcctcagggcc 7666 ALDH7 9 intron6 + (116-117) attctcctctctctctctct CT/&Dgr; ggacaaggctgggagcagtc 7667 ALDH7 10 intron6 + 263 cagaccctcatacgtgaccc C/G gctgccccccaggctcttag 7668 HMG17L1 1 3′untranslated + 864 ctttctgatttttgatagtc C/G gttgaagaagggagtttgaa 7669
[0561] In some embodiments, a drug-metabolizing enzyme is at least one of the following: epoxide hydrolase, methyltransferase, N-acetyltransferase, sulfotransferase, quinone oxidereductase, glutathione S-transferase, UDP-glycosyltransferase, aldehyde dehydrogenase, alcohol dehydrogenase, esterase, NDUF, cytochrome P450 (CYP) and ATP-binding cassette.
[0562] The present invention relates to a method for detecting a genetic polymorphism in a test subject using the genetic polymorphism data related to a drug metabolizing enzyme. The present invention analyzes the effectiveness, safety and strength of drugs metabolized by a drug metabolizing enzyme. The relationship between a disease and the drug to be evaluated is based on the results of the analysis. The genetic polymorphism data for the drug metabolizing enzyme is different for each patient with a given disease. Therefore, the effectiveness and safety of a specific drug depends on drug metabolism in the presence of certain genetic polymorphism data and the side effects in the presence of certain genetic polymorphism data. As a result, a physician can determine whether a certain drug should be used by a certain patient and can tailor drugs for use by a certain patient based on the genetic polymorphism data (so-called “made-to-order” treatments).
[0563] “Drug metabolizing enzymes” refer to a group of enzymes that catalyze in vivo structural changes in exogenous materials including drugs. When used for clinical purposes, the group of metabolizing enzymes includes some endogenous materials. Because drug-metabolizing enzymes absorb, metabolize and secrete drugs, the polymorphism of an enzyme depends on the amount of enzyme expressed (transcription and translation) and the amount of activity. As a result, there are blood serum concentrations of both unchanged materials and metabolites.
[0564] Drug metabolizing enzymes expressed by the genes that are targeted for genetic polymorphism analysis in the present invention include, but are not limited to the following classes of enzymes:
[0565] Epoxide hydrolases
[0566] Methyltransferases
[0567] N-acetyltransferases
[0568] Sulfotransferases
[0569] Quinone oxidereductases
[0570] Glutathione S-transferases
[0571] UDP-glycosyltransferases
[0572] Aldehyde dehydrogenases
[0573] Alcohol dehydrogenases
[0574] Esterases
[0575] Ubiquinone dehydrogenases: NDUF
[0576] Cytochrome P450s (CYPs)
[0577] ATP-binding cassettes
[0578] ATP-binding cassettes/Transporters
[0579] Examples and descriptions of these enzymes are provided below.
[0580] (1) Epoxide hydrolases are enzymes that hydrolyze epoxide using a trans-cleavage mechanism to produce 1,2-glycol. Examples include microsomal epoxide hydrolase 1 and cytoplasmic epoxide hydrolase 2.
[0581] (2) Methyltransferases are enzymes that catalyze transmethylation in amino groups, hydroxyl groups and thiol groups. Examples include the following.
[0582] Catechol-O-methyltransferase
[0583] Vitamin-N-methyltransferase
[0584] Phenylethanolamine-N-methyltransferase
[0585] Phosphatidylethanolamine-N-methyltransferase
[0586] Nicotinamide-N-methyltransferase
[0587] Acetylserotonin-O-methyltransferase
[0588] Thiopurine S-methyltransferase
[0589] (3) N-acetyltransferases are enzymes that catalyze transacetylation in amino groups, sulfonamide groups and hydrazine groups. Examples include the following.
[0590] Arylamine-N-acetyltransferase 1, 2
[0591] Arylalkylamine-N-acetyltransferase
[0592] N-acetyltransferase homologues of saccharomyces cerevisiae
[0593] LI intracellular adhesion molecules
[0594] (4) Sulfotransferases are enzymes that contribute to sulfate conjugation and catalyzes trans-sulfonylation in phenols, steroids, arylamines and biliary acid. Examples include the following.
[0595] Sulfotransferase 1A1, 1A2, 1A3, 1C1, 1C2, 2A1, 2B1
[0596] Thyroid hormone sulfotransferase
[0597] Tyrosyl protein sulfotransferase 1, 2
[0598] Sulfotransferase-opening protein 3
[0599] Estrogen sulfotransferase
[0600] Cerebroside sulfotransferase
[0601] HNK-sulfotransferase 1
[0602] Carbohydrate sulfotransferase 2, 4, 5
[0603] Carbohydrate sulfotransferase 1, 3
[0604] (5) Quinone oxidereductases are enzymes that catalyze the reduction of quinones such as o-quinone and p-quinone. Examples include the following.
[0605] NAD(P)H: Quinone oxidereductase 1
[0606] NRH: Quinone oxidereductase 2
[0607] Quinone oxidereductase homologues
[0608] p53-induced gene 3 (PIG3) of a quinone oxide transferase homologue
[0609] (6) Glutathione S-transferases are enzymes that catalyze the conjugation of glutathione. Examples include the following.
[0610] Glutathione S-transferase Mu1, Mu2, Mu3, Mu4, Mu5
[0611] Glutathione S-transferase Z (zeta)
[0612] Glutathione S-transferase P (pi)
[0613] Glutathione S-transferase 1 T1 (zeta)
[0614] Glutathione S-transferase 1 Theta 1, Theta 2
[0615] Microsomal Glutathione S-transferase 1
[0616] Microsomal Glutathione S-transferase 1-1
[0617] Microsomal Glutathione S-transferase 2, 3
[0618] Microsomal Glutathione S-transferase Ha Subunit 1, 2
[0619] Microsomal Glutathione S-transferase A3, A4
[0620] Glutathione S-transferase A1, A4
[0621] Glutathione S-transferase M1, M2, M3, M4
[0622] (7) UDP-glycosyltransferases are enzymes that catalyze the contribution of glucuronic acid to functional groups such as hydroxyl groups, carboxyl groups, amino groups and thiol groups after their introduction in the 1 st drug metabolism route. Examples include the following.
[0623] UDP-glycosyltransferase 1
[0624] UDP-glycosyltransferase 1 Family Polypeptide A1
[0625] UDP-glycosyltransferase 2 Family Polypeptide A1, B7, B10, B4, B11, B15, B17
[0626] UDP-glycosyltransferase 8
[0627] Dolichyl-diP-oligosaccharide protein glycosyl transferase
[0628] (8) Aldehyde dehydrogenases are enzyme that converts aldehydes into carboxylic acids. Examples include Aldehyde dehydrogenase 1 through 10.
[0629] Aldehyde dehydrogenase 1 family member A1, A2, A3
[0630] Aldehyde dehydrogenase 1 family member B1
[0631] Formyltetrahydroforate dehydrogenase
[0632] Aldehyde dehydrogenase 2
[0633] Aldehyde dehydrogenase 3 family member A1, A2
[0634] Aldehyde dehydrogenase 3 family member B1, B2
[0635] Aldehyde dehydrogenase 5 family member A1
[0636] Aldehyde dehydrogenase 6 family member A1
[0637] Aldehyde dehydrogenase 8 family member A1
[0638] Aldehyde dehydrogenase 9 family member A1
[0639] (9) Alcohol dehydrogenases are enzymes that convert alcohols into aldehydes or ketones. Examples include the following.
[0640] Alcohol dehydrogenase 1 through 7
[0641] Hydroxy-CoA-dehydrogenase
[0642] Short-chain alcohol dehydrogenase family genes
[0643] (10) Esterases are enzymes that hydrolyze some esters. Examples include the following.
[0644] Arylacetoamide deacetylase
[0645] Granzyme A
[0646] Granzyme B
[0647] Interleukin 17
[0648] Ubiquitin carboxyl-terminal esterase L1, 3
[0649] Carboxyl esterase 1
[0650] Lipase A
[0651] Esterase D-formylglutathione hydrolase
[0652] Carboxylester lipase
[0653] Dolichyl-diphosphooligosaccharide-protein glycosyltransferase (DDOST)
[0654] Neuropathy target esterase
[0655] (11) Ubiquinone dehydrogenases (NDUF) are enzymes that support energy metabolism, e.g., as in the mitochondrial respiratory chain. Examples include NADH ubiquinone dehydrogenase 1a Subunit 1 through 10.
[0656] NADH-dehydrogenase (ubiquinone) 1&agr;-subcomplex 1 through 3 and 5 through 10
[0657] NADH-dehydrogenase (ubiquinone) 1&agr;/&bgr;-subcomplex 1
[0658] NADH-dehydrogenase (ubiquinone) 1&bgr;-subcomplex 3, 5, 7
[0659] NADH-dehydrogenase (ubiquinone) Fe—S protein 1, 3, 4, 5, 6, 8
[0660] NADH-dehydrogenase (ubiquinone) flavoprotein 1 through 3
[0661] (12) Cytochrome P450s (CYPs) are enzymes that regulate 1st drug metabolism and introduce oxygen atoms to the drug. Examples include Cytochrome P450 (CYP) 1A1, CYP 1A2, CYP1B1, CYP 2A6, CYP 2B6, CYP 2C8, CYP 2C18, CYP 2C9, CYP 2C19, CYP 2E1, CYP 2D6, CYP 2E1, CYP 2F1, CYP 3A3, CYP 3A4, CYP 3A5, CYP 3A7, CYP 3A43, CYP 4A1, CYP 4B1, CYP 4F2, CYP 4F3, CYP 4F8, CYP 11B1, CYP 11B2, CYP 17, CYP 19, CYP 21A2, CYP 21A1, CYP 27B1 and CYP 27.
[0662] (13) ATP-binding cassettes absorb the drug and adjust the interstitial concentration with a transporter. Examples include the following.
[0663] ATP-Binding Cassette Subfamily A Members 1 through 6, 8
[0664] ATP-Binding Cassette Subfamily A Members 1, 4, 7, 8
[0665] ATP-Binding Cassette Subfamily B Members 1 through 11
[0666] ATP-Binding Cassette Subfamily B Members 1, 4, 7, 8, 9, 10, 11
[0667] ATP-Binding Cassette Subfamily C Members 1 through 6, 8 through 10
[0668] ATP-Binding Cassette Subfamily C Members 1, 2, 3, 4, 5, 7, 8, 9
[0669] ATP-Binding Cassette Subfamily D Members 1 through 4
[0670] ATP-Binding Cassette Subfamily D Members 1, 3, 4
[0671] ATP-Binding Cassette Subfamily E Members 1
[0672] ATP-Binding Cassette Subfamily F Members 1 through 3
[0673] ATP-Binding Cassette Subfamily F Member 1
[0674] ATP-Binding Cassette Subfamily G Members 1
[0675] ATP-Binding Cassette Subfamily G Members 1, 2, 4, 8
[0676] Organic anion transporters 1, 2, 3
[0677] Organic anion transporter polypeptides 1, 2, 8
[0678] Transporter 1 ATP-binding cassette subfamily B
[0679] Transporter 2 ATP-binding cassette subfamily B
[0680] SLC22A4 solute carrier family 22 (organic cation transporter) member 4
[0681] SLC22A5 solute carrier family 22 (organic cation transporter) member 5
[0682] SLC22A1 solute carrier family 22 (organic cation transporter) member 1
[0683] SLC22A2 solute carrier family 22 (organic cation transporter) member 2
[0684] SLC10A2 solute carrier family 10 (sodium/bile acid cotransporter family) member 2
[0685] SLC15A 1 solute carrier family 15 (oligopeptide transporter) member 1
[0686] (14) Other enzymes include gamma glutamyl transferase 1, transglutaminase 1 and dihydropyrimidine dihydrogenase.
[0687] Genetic polymorphism data relating to DMEs can be obtained using any general genetic polymorphism detection method. Examples include, but are not limited to, PCR or other amplification methods, hybridization methods using an allele-specific oligonucleotide matrix (e.g., TAQMAN PCR method, INVADER assay method), primer extension reaction methods, sequencing methods, MALDI-TOF/MS methods and the DNA chip methods (e.g., microarrays). Examples of detection methods that are applicable to analysis of the DME associated polymorphisms of the present invention include but are not limited to those listed below.
[0688] 1. Direct Sequencing Assays
[0689] In some embodiments of the present invention, variant sequences are detected using a direct sequencing technique. In these assays, DNA samples are first isolated from a subject using any suitable method. In some embodiments, the region of interest is cloned into a suitable vector and amplified by growth in a host cell (e.g., a bacteria). In other embodiments, DNA in the region of interest is amplified using PCR.
[0690] Following amplification, DNA in the region of interest (e.g., the region containing the SNP or mutation of interest) is sequenced using any suitable method, including but not limited to manual sequencing using radioactive marker nucleotides, or automated sequencing. The results of the sequencing are displayed using any suitable method. The sequence is examined and the presence or absence of a given SNP or mutation is determined.
[0691] 2. PCR Assay
[0692] In some embodiments of the present invention, variant sequences are detected using a PCR-based assay. In some embodiments, the PCR assay comprises the use of oligonucleotide primers that hybridize only to the variant or wild type allele (e.g., to the region of polymorphism or mutation). Both sets of primers are used to amplify a sample of DNA. If only the mutant primers result in a PCR product, then the patient has the mutant allele. If only the wild-type primers result in a PCR product, then the patient has the wild type allele.
[0693] 3. Fragment Length Polymorphism Assays
[0694] In some embodiments of the present invention, variant sequences are detected using a fragment length polymorphism assay. In a fragment length polymorphism assay, a unique DNA banding pattern based on cleaving the DNA at a series of positions is generated using an enzyme (e.g., a restriction enzyme or a CLEAVASE I [Third Wave Technologies, Madison, Wis.] enzyme). DNA fragments from a sample containing a SNP or a mutation will have a different banding pattern than wild type.
[0695] a. RFLP Assay
[0696] In some embodiments of the present invention, variant sequences are detected using a restriction fragment length polymorphism assay (RFLP). The region of interest is first isolated using PCR. The PCR products are then cleaved with restriction enzymes known to give a unique length fragment for a given polymorphism. The restriction-enzyme digested PCR products are generally separated by gel electrophoresis and may be visualized by ethidium bromide staining. The length of the fragments is compared to molecular weight markers and fragments generated from wild-type and mutant controls.
[0697] b. CFLP Assay
[0698] In other embodiments, variant sequences are detected using a CLEAVASE fragment length polymorphism assay (CFLP; Third Wave Technologies, Madison, Wis.; See e.g., U.S. Pat. Nos. 5,843,654; 5,843,669; 5,719,208; and 5,888,780; each of which (Northern) is isolated from a subject. The DNA or RNA is then cleaved with a series of restriction enzymes that cleave infrequently in the genome and not near any of the markers being assayed. The DNA or RNA is then separated (e.g., on an agarose gel) and transferred to a membrane. A labeled (e.g., by incorporating a radionucleotide) probe or probes specific for the SNP or mutation being detected is allowed to contact the membrane under a condition or low, medium, or high stringency conditions. Unbound probe is removed and the presence of binding is detected by visualizing the labeled probe.
[0699] b. Detection of Hybridization Using “DNA Chip” Assays
[0700] In some embodiments of the present invention, variant sequences are detected using a DNA chip hybridization assay. In this assay, a series of oligonucleotide probes are affixed to a solid support. The oligonucleotide probes are designed to be unique to a given SNP or mutation. The DNA sample of interest is contacted with the DNA “chip” and hybridization is detected.
[0701] In some embodiments, the DNA chip assay is a GeneChip (Affymetrix, Santa Clara, Calif.; See e.g., U.S. Pat. Nos. 6,045,996; 5,925,525; and 5,858,659; each of which is herein incorporated by reference) assay. The GeneChip technology uses miniaturized, high-density arrays of oligonucleotide probes affixed to a “chip.” Probe arrays are manufactured by Affymetrix's light-directed chemical synthesis process, which combines solid-phase chemical synthesis with photolithographic fabrication techniques employed in the semiconductor industry. Using a series of photolithographic masks to define chip exposure sites, followed by specific chemical synthesis steps, the process constructs high-density arrays of oligonucleotides, with each probe in a predefined position in the array. Multiple probe arrays are synthesized simultaneously on a large glass wafer. The wafers are then diced, and individual probe arrays are packaged in injection-molded plastic cartridges, which protect them from the environment and serve as chambers for hybridization.
[0702] The nucleic acid to be analyzed is isolated, amplified by PCR, and labeled with a fluorescent reporter group. The labeled DNA is then incubated with the array using a fluidics station. The array is then inserted into the scanner, where patterns of hybridization are detected. The hybridization data are collected as light emitted from the fluorescent reporter groups already incorporated into the target, which is bound to the probe array. Probes that perfectly match the target generally produce stronger signals than those that have mismatches. Since the sequence and position of each probe on the array are known, by complementarity, the identity of the target nucleic acid applied to the probe array can be determined.
[0703] In other embodiments, a DNA microchip containing electronically captured probes (Nanogen, San Diego, Calif.) is utilized (See e.g., U.S. Pat. Nos. 6,017,696; 6,068,818; and 6,051,380; each of which are herein incorporated by reference). Through the use of microelectronics, Nanogen's technology enables the active movement and concentration of charged molecules to and from designated test sites on its semiconductor microchip. DNA capture probes unique to a given SNP or mutation are electronically placed at, or “addressed” to, specific sites on the microchip. Since DNA has a strong negative charge, it can be electronically moved to an area of positive charge.
[0704] First, a test site or a row of test sites on the microchip is electronically activated with a positive charge. Next, a solution containing the DNA probes is introduced onto the microchip. The negatively charged probes rapidly move to the positively charged sites, where they concentrate and are chemically bound to a site on the microchip. The microchip is then washed and another solution of distinct DNA probes is added until the array of specifically bound DNA probes is complete.
[0705] A test sample is then analyzed for the presence of target DNA molecules by determining which of the DNA capture probes hybridize, with complementary DNA in the test sample (e.g., a PCR amplified gene of interest). An electronic charge is also used to move and concentrate target molecules to one or more test sites on the microchip. The electronic concentration of sample DNA at each test site promotes rapid hybridization of sample DNA with complementary capture probes (hybridization may occur in minutes). To remove any unbound or nonspecifically bound DNA from each site, the polarity or charge of the site is reversed to negative, thereby forcing any unbound or nonspecifically bound DNA back into solution away from the capture probes. A laser-based fluorescence scanner is used to detect binding,
[0706] In still further embodiments, an array technology based upon the segregation of fluids on a flat surface (chip) by differences in surface tension (ProtoGene, Palo Alto, Calif.) is utilized (See e.g., U.S. Pat. Nos. 6,001,311; 5,985,551; and 5,474,796; each of which is herein incorporated by reference). Protogene's technology is based on the fact that fluids can be segregated on a flat surface by differences in surface tension that have been imparted by chemical coatings. Once so segregated, oligonucleotide probes are synthesized directly on the chip by ink-jet printing of reagents. The array with its reaction sites defined by surface tension is mounted on a X/Y translation stage under a set of four piezoelectric nozzles, one for each of the four standard DNA bases. The translation stage moves along each of the rows of the array and the appropriate reagent is delivered to each of the reaction site. For example, the A amidite is delivered only to the sites where amidite A is to be coupled during that synthesis step and so on. Common reagents and washes are delivered by flooding the entire surface and then removing them by spinning.
[0707] DNA probes unique for the SNP or mutation of interest are affixed to the chip using Protogene's technology. The chip is then contacted with the PCR-amplified genes of interest. Following hybridization, unbound DNA is removed and hybridization is detected using any suitable method (e.g., by fluorescence de-quenching of an incorporated fluorescent group).
[0708] In yet other embodiments, a “bead array” is used for the detection of polymorphisms (Illumina, San Diego, Calif.; See e.g., PCT Publications WO 99/67641 and WO 00/39587, each of which is herein incorporated by reference). Illumina uses a BEAD ARRAY technology that combines fiber optic bundles and beads that self-assemble into an array. Each fiber optic bundle contains thousands to millions of individual fibers depending on the diameter of the bundle. The beads are coated with an oligonucleotide specific for the detection of a given SNP or mutation. Batches of beads are combined to form a pool specific to the array. To perform an assay, the BEAD ARRAY is contacted with a prepared subject sample (e.g., DNA). Hybridization is detected using any suitable method.
[0709] C. Enzymatic Detection of Hybridization
[0710] In some embodiments of the present invention, hybridization is detected by enzymatic cleavage of specific structures (INVADER assay, Third Wave Technologies; See e.g., U.S. Pat. Nos. 5,846,717, 6,090,543; 6,001,567; 5,985,557; and 5,994,069; each of which is herein incorporated by reference). The INVADER assay detects specific DNA and RNA sequences by using structure-specific enzymes to cleave a complex formed by the hybridization of overlapping oligonucleotide probes. Elevated temperature and an excess of one of the probes enable multiple probes to be cleaved for each target sequence present without temperature cycling. These cleaved probes then direct cleavage of a second labeled probe. The secondary probe oligonucleotide can be 5′-end labeled with a fluorescent dye that is quenched by a second dye or other quenching moiety. Upon cleavage, the de-quenched dye-labeled product may be detected using a standard fluorescence plate reader, or an instrument configured to collect fluorescence data during the course of the reaction (i.e., a “real-time” fluorescence detector, such as an ABI 7700 Sequence Detection System, Applied Biosystems, Foster City, Calif.).
[0711] The INVADER assay detects specific mutations and SNPs in unamplified genomic DNA. In an embodiment of the INVADER assay used for detecting SNPs in genomic DNA, two oligonucleotides (a primary probe specific either for a SNP/mutation or wild type sequence, and an INVADER oligonucleotide) hybridize in tandem to the genomic DNA to form an overlapping structure. A structure-specific nuclease enzyme recognizes this overlapping structure and cleaves the primary probe. In a secondary reaction, cleaved primary probe combines with a fluorescence-labeled secondary probe to create another overlapping structure that is cleaved by the enzyme. The initial and secondary reactions can run concurrently in the same vessel. Cleavage of the secondary probe is detected by using a fluorescence detector, as described above. The signal of the test sample may be compared to known positive and negative controls.
[0712] In some embodiments, hybridization of a bound probe is detected using a TAQMAN assay (PE Biosystems, Foster City, Calif.; See e.g., U.S. Pat. Nos. 5,962,233 and 5,538,848, each of which is herein incorporated by reference). The assay is performed during a PCR reaction. The TAQMAN assay exploits the 5′-3′ exonuclease activity of DNA polymerases such as AMPLITAQ DNA polymerase. A probe, specific for a given allele or mutation, is included in the PCR reaction. The probe consists of an oligonucleotide with a 5′-reporter dye (e.g., a fluorescent dye) and a 3′-quencher dye. During PCR, if the probe is bound to its target, the 5′-3′ nucleolytic activity of the AMPLITAQ polymerase cleaves the probe between the reporter and the quencher dye. The separation of the reporter dye from the quencher dye results in an increase of fluorescence. The signal accumulates with each cycle of PCR and can be monitored with a fluorimeter.
[0713] In still further embodiments, polymorphisms are detected using the SNP-IT primer extension assay (Orchid Biosciences, Princeton, N.J.; See e.g., U.S. Pat. Nos. 5,952,174 and 5,919,626, each of which is herein incorporated by reference). In this assay, SNPs are identified by using a specially synthesized DNA primer and a DNA polymerase to selectively extend the DNA chain by one base at the suspected SNP location. DNA in the region of interest is amplified and denatured. Polymerase reactions are then performed using miniaturized systems called microfluidics. Detection is accomplished by adding a label to the nucleotide suspected of being at the SNP or mutation location. Incorporation of the label into the DNA can be detected by any suitable method (e.g., if the nucleotide contains a biotin label, detection is via a fluorescently labeled antibody specific for biotin).
[0714] 5. Other Detection Assays
[0715] Additional detection assays that are produced and utilized using the systems and methods of the present invention include, but are not limited to, enzyme mismatch cleavage methods (e.g., Variagenics, U.S. Pat. Nos. 6,110,684, 5,958,692, 5,851,770, herein incorporated by reference in their entireties); polymerase chain reaction; branched hybridization methods (e.g., Chiron, U.S. Pat. Nos. 5,849,481, 5,710,264, 5,124,246, and 5,624,802, herein incorporated by reference in their entireties); rolling circle replication (e.g., U.S. Pat. Nos. 6,210,884 and 6,183,960, herein incorporated by reference in their entireties); NASBA (e.g., U.S. Pat. No. 5,409,818, herein incorporated by reference in its entirety); molecular beacon technology (e.g., U.S. Pat. No. 6,150,097, herein incorporated by reference in its entirety); E-sensor technology (Motorola, U.S. Pat. Nos. 6,248,229, 6,221,583, 6,013,170, and 6,063,573, herein incorporated by reference in their entireties); cycling probe technology (e.g., U.S. Pat. Nos. 5,403,711, 5,011,769, and 5,660,988, herein incorporated by reference in their entireties); Dade Behring signal amplification methods (e.g., U.S. Pat. Nos. 6,121,001, 6,110,677, 5,914,230, 5,882,867, and 5,792,614, herein incorporated by reference in their entireties); ligase chain reaction (Bamay Proc. Natl. Acad. Sci USA 88, 189-93 (1991)); and sandwich hybridization methods (e.g., U.S. Pat. No. 5,288,609, herein incorporated by reference in its entirety).
[0716] 6. Mass Spectroscopy Assay
[0717] In some embodiments, a MassARRAY system (Sequenom, San Diego, Calif.) is used to detect variant sequences (See e.g., U.S. Pat. Nos. 6,043,031; 5,777,324; and 5,605,798; each of which is herein incorporated by reference). DNA is isolated from blood samples using standard procedures. Next, specific DNA regions containing the mutation or SNP of interest, about 200 base pairs in length, are amplified by PCR. The amplified fragments are then attached by one strand to a solid surface and the non-immobilized strands are removed by standard denaturation and washing. The remaining immobilized single strand then serves as a template for automated enzymatic reactions that produce genotype specific diagnostic products.
[0718] Very small quantities of the enzymatic products, typically five to ten nanoliters, are then transferred to a SpectroCHIP array for subsequent automated analysis with the SpectroREADER mass spectrometer. Each spot is preloaded with light absorbing crystals that form a matrix with the dispensed diagnostic product. The MassARRAY system uses MALDI-TOF (Matrix Assisted Laser Desorption Ionization—Time of Flight) mass spectrometry. In a process known as desorption, the matrix is hit with a pulse from a laser beam. Energy from the laser beam is transferred to the matrix and it is vaporized resulting in a small amount of the diagnostic product being expelled into a flight tube. As the diagnostic product is charged when an electrical field pulse is subsequently applied to the tube they are launched down the flight tube towards a detector. The time between application of the electrical field pulse and collision of the diagnostic product with the detector is referred to as the time of flight. This is a very precise measure of the product's molecular weight, as a molecule's mass correlates directly with time of flight with smaller molecules flying faster than larger molecules. The entire assay is completed in less than one thousandth of a second, enabling samples to be analyzed in a total of 3-5 second including repetitive data collection. The Spec troTYPER software then calculates, records, compares and reports the genotypes at the rate of three seconds per sample.
[0719] In some embodiments, the present invention provides an oligonucleotide comprising a DME related sequence, or a complement of a DME-related sequence. In preferred embodiments, an oligonucleotide of the present invention comprises a sequence or a complement of a sequence selected from the group consisting SEQ ID NOs. 1-3360 and 3361-7669, or a substantially similar sequence.
[0720] In some embodiments, an oligonucleotide probe or oligonucleotide primer is created so the 5′ terminus, 3′ terminus or central base contains the genetic polymorphism site. In some preferred embodiments, an oligonucleotide is created comprising at least 13 contiguous bases of a sequence selected from SEQ ID NOs 1 through 3360 and 3361-7669, or the complement thereto, and further comprising the 21st nucleotide of the sequence selected from SEQ ID NOs 1 through 3360 and 3661-7669, or the complement thereto.
[0721] In some embodiments, an oligonucleotide of the present invention flanks or is adjacent to a polymorphic site, such that the presence of the polymorphism can be detected by modification of the oligonucleotide in a manner dependent on the presence or absence of the polymorphism.
[0722] In some embodiments, the present invention provides kits comprising one or more of the components necessary for practicing the present invention. For example, the present invention provides kits for storing or delivering the enzymes of the present invention and/or the reaction components necessary to practice a cleavage assay (e.g., the INVADER assay). The kit may include any and all components necessary or desired for the enzymes or assays including, but not limited to, the reagents themselves, buffers, control reagents (e.g., tissue samples, positive and negative control target oligonucleotides, etc.), solid supports, labels, written and/or pictorial instructions and product information, inhibitors, labeling and/or detection reagents, package environmental controls (e.g., ice, desiccants, etc.), and the like. In some embodiments, the kits provide a sub-set of the required components, wherein it is expected that the user will supply the remaining components. In some embodiments, the kits comprise two or more separate containers wherein each container houses a subset of the components to be delivered. For example, a first container (e.g., box) may contain an enzyme (e.g., structure specific cleavage enzyme in a suitable storage buffer and container), while a second box may contain oligonucleotides (e.g., INVADER oligonucleotides, probe oligonucleotides, control target oligonucleotides, etc.). In some embodiments one or more the reaction components may be provided in a predispensed format (i.e., pre-measured for use in a step of the procedure without re-measurement or re-dispensing). In some embodiments, selected reaction components are mixed and predispensed together. In preferred embodiments, predispensed reaction components are predispensed and are provided in a reaction vessel (including but not limited to a reaction tube or a well, as in, e.g., a microtiter plate). In particularly preferred embodiments, predispensed reaction components are dried down (e.g., desiccated or lyophilized) in a reaction vessel.
[0723] Examples of genetic polymorphism data (especially the SNP data) that can be used in the method of the present invention are shown in Table 1.
[0724] In Table 1, the name of the gene encoding the drug metabolizing enzyme is recorded in the gene name column. The base in capital letters is the SNP data in the sequence column. Two bases separated by a forward slash indicate the SNP of homo and hetero bases. For example, A/G indicates a homo allele A/A and G/G as well as a hetero allele A/G. The sequences in this table have 20 bases before and after the SNP. Here, the base in parentheses, for example the 26th (T) in ABCB4, indicates a polymorphism with an inserted base, and D, such as the 10th spot in NAT2, indicates a polymorphism with a deleted base. In Sequence No. 674, n is VNTR and (cctgy)x, where x is an integer between 1 and 50, indicates a repeated sequence. The bases with numbers in parentheses indicate the number of times they are repeated. For example, “(T) 9-12” in Sequence No. 1552 (ABCB11 No. 55 in Table 1) indicates T is repeated 9 to 12 times.
[0725] Here, “position” indicates the position of the SNP genome. The position of SNPs in the 5′ flanking region, intron region and 3′ flanking region are intron base sequences counted as a single number starting at the exon-intron junction. The position of SNPs in the exon region are exon base sequences counted as a single number starting at the exon-intron junction. Also, (+) or no symbol indicates a number counted in the 3′ upstream direction and (−) indicates a number counted in the 5′ downstream direction. The number in the “number” column indicates the position of the SNP in the gene maps of the various genes (FIG. 9 through FIG. 141 and FIG. 144 through 312).
[0726] The sequence represented by the SEQ ID Nos. 1-3360 and 3361-7669 can readily be associated with the corresponding gene, chromosome, and chromosomal position. Each of the genes shown in Table 1 correlates to a corresponding Figure in the present application. The Figures show a map of the gene with positional identifiers for each of the polymorphisms. The Figures also provide an accession number that correlates to public genome databases, allowing the genetic context of the polymorphism and the gene to be understood. Using the information in Table 1, the Figures, and public genome databases, one skilled in the art is able to identify flanking sequences. This allows, for example, the development of PCR primers that flank the polymorphism. Considerations for PCR primer design are known in the art for both single PCR reactions and multiplex reactions (See e.g., Henegariu et al., BioTechniques 23:504-511 [1997] and PCR Applications, edited by Innis, Gelfand, and Sninsky, Academic Press, San Diego, Calif. 1999), each of which is herein incorporated by references in its entirety). Examples of primers that find use in the amplification of sequences containing polymorphisms, as well as amplification conditions, are found at the IMS-JST JSNP database website (See, submissions from Laboratory for Genotyping, The SNP Research Center, The Institute of Physical and Chemical Research (RIKEN)).
[0727] One example of information generated using SEQ ID Nos. 1-3360 and 3361-7669 and information in publicly available databases is provided in FIG. 143. The first column in this figure shows that 3360 entries are made, corresponding to the first 3360 entries found in Table 1. The second column, entitled “GENE” provides a gene name abbreviation, while the next column provides a long gene name. The next columns show the chromosome (CHROM), a reference mRNA accession number (REF.MRNA), a locus link database accession number (L-LINK), an OMIM database accession number (OMIM_ID) which allows disease association information to be readily obtained, the exon count for the gene (EXONS), and the number of polymorphisms in the gene (NO GENE).
[0728] Creating an Oligonucleotide Probe or Oligonucleotide Primer
[0729] In some embodiments, an oligonucleotide used as a primer and/or probe in the detection method of the present invention serves as the template of the base sequences (Sequence No. 1 through 3360 and 3361 through 7669) shown in Table 1 if, for example, a SNP is to be detected. The primer/probe can be designed so it is synthesized as the base sequence itself or as a portion of the base sequence. In preferred embodiments, the SNP is included in the base sequence of the primer/probe (and denoted in capital letters in the base sequence column of Table 1). The primers/probes may also be complementary to the non-mutant sequence.
[0730] The SNP in the following example is designed so it is on the 3′ or 5′ end of the base sequence. It is designed to be within four bases of the 3′ or 5′ end, and ideally within two bases of the end. The SNP can also be in the center of the oligonucleotide base sequence. Here, “center” means the number of the bases from the SNP base to the 5′ end is substantially equal to the number of bases from the SNP base to the 3′ end. If there is an odd number of bases in the oligonucleotide, the central region should be essentially five bases in length, preferably three bases in length, and ideally one base in length. In a base sequence with 41 bases, for example, the central region should be bases 19 through 23, preferably bases 20 through 22, and ideally base 21. If there is an even number of bases, the central region should be four bases and ideally two bases. In a base sequence of 40 bases, for example, the central region should be bases 19 through 22 and ideally base 20.
[0731] If the polymorphism consists of a plurality of bases, in some embodiments, the probe/primer is designed so the full polymorphism sequence is contained in the probe/primer. In some preferred embodiments, it is designed so one of the bases 1 through 4 on the 5′ end or 3′ end complementing the primer DNA corresponds to the base at the very end of the polymorphism bases. (This is called the “corresponding base”; ideally, it is the base at the 5′ or 3′ end). For example, in the INVADER assay, if a probe and INVADER oligonucleotide are prepared to detect a genetic polymorphism (CAGAGGCT) in No. 12 of NDUFA7 in Table 1 (Sequence No. 828), the position of the corresponding base in the probe in FIG. 4a (a “T” base in the figure) is designed to become “C” at the far left of sequence CAGAGGCT, and the N base in the INVADER oligonucleotide shown in FIG. 4b is designed to replace the “C” at the far left of CAGAGGCT with A, T, C or G). Conversely, if designed so the position of the corresponding base in the INVADER oligonucleotide is the far right “T” in CAGAGGCT, the “N” base is such that the corresponding base in the probe is “T.” Further, the corresponding base of the INVADER oligonucleotide and the allele probe can be set anywhere in the CAGAGGCT sequence.
[0732] In preferred embodiments, the length of the base sequence is at least 13 bases, preferably between 13 and 60 bases, more preferably between 15 and 40 bases, and ideally between 18 and 30 bases. These oligonucleotide base sequences can be used as probes, as forward (sense) primers or as reverse (anti-sense) primers to detect target genes.
[0733] These oligonucleotides can link regions hybridized with genome DNA in tandem to unhybridized regions. The linking order can be upstream or downstream. The hybridized regions in these oligonucleotides can be designed from base sequence data containing the SNP described in Table 1, and created so the sequence containing the region hybridized with genome DNA closest to the 5′ or 3′ end is the SNP. These oligonucleotides can be used as probes to detect SNP using the INVADER assay.
[0734] The primer used in some embodiments of the present invention is designed to determine the functional change caused by the SNPs in the base sequences in Table 1, to determine whether the change is effective or ineffective, and to determine the existence of side effects. It is designed to include the SNP in the PCR-amplified base sequence. In some preferred embodiments, the primer should have at least 15 base sequences, preferably between 15 and 30 base sequences, and ideally between 18 and 24 base sequences. The template DNA regions in the primer base sequence should contain 500 bp or less amplified fragments, preferably between 100 and 300 bp fragments, and ideally between 100 and 150 bp fragments.
[0735] The oligonucleotide probes and primers designed in this manner can be synthesized chemically using any method commonly known in the art. For example, the oligonucleotides can be synthesized using a commercially available chemical synthesis device. The production of probes can be conducted automatically by adding fluorescent tags (e.g., FAM, VIC, Cy3) or other labels.
[0736] These oligonucleotides can be included in genetic polymorphism detection kits along with polymerase (e.g., Taq polymerase), a buffering solution (e.g., a Tris buffering solution), dNTP, fluorescent dyes (e.g., VIC, FAM), or other desired kit components.
[0737] Detection
[0738] In some embodiments, the oligonucleotides prepared in the examples above are used as primers/probes, and the genes or a portion thereof (template DNA) encoding the drug metabolizing enzyme is amplified using DNA polymerase. A primer/probe prepared in this manner can be hybridized with template DNA and used to detect DNA with the target genetic polymorphism. The DNA used as the template can be prepared using any method commonly known in the art. Examples include cesium chloride density gradient ultra centrifugation method, the SDS solvency method or the phenol chloroform extraction method.
[0739] 1 Detection Using PCR
[0740] The amplification can be performed using a polymerase chain reaction (PCR). The DNA polymerase can be LA Taq DNA polymerase (Takara), Ex Taq polymerase (Takara), AMPLITAQ Gold polymerase (Applied Biosystems), AMPLITAQ (Applied Biosystems) or Pfu DNA polymerase (Stratagene), as well as other polymerases.
[0741] An illustrative example of amplification conditions is provided below. The present invention is not limited to the conditions provided in this example. In preferred embodiments, each cycle in the transforming phase should last between 10 and 40 seconds at 85° C. to 105° C. and preferably 20 and 30 seconds at 94° C., each cycle in the annealing phase should last 30 seconds to 1 minute at 50° C. to 72° C. and preferably 20 seconds to 1 minute at 60° C., and each cycle in the elongation phase should last 1 minute to 4 minutes between 65° C. and 75° C. and preferably 2 minutes to 3 minutes at 72° C. There should be 30 to 40 cycles, although fewer or more cycles are contemplated. In order to completely transform the template DNA and the primer, each cycle in the transforming phase should last 1 minute to 5 minutes at 95° C. before the amplifying cycle. If AMPLITAQ GOLD polymerase manufactured by Applied Biosystems is used, it should last from 8 minutes to 15 minutes and ideally from 10 minutes to 12 minutes. In order to completely elongate the amplified DNA, the elongation phase should last between 1 minute and 10 minutes at 72° C. after the amplification cycle. If the amplified product is not immediately detected, it should be processed again at 4° C. to make sure the amplification was not irregular. In this way, the gene encoding the drug metabolizing enzyme is amplified.
[0742] After amplification, gel electrophoresis is performed on the amplified product, the amplified product is stained using ethidium bromide or SYBR Green, and one, two or three bands are detected in the amplified product (DNA fragments) to determine the portion (DNA fragment) of the drug metabolizing enzyme containing the genetic polymorphism in the gene encoding the drug metabolizing enzyme. Polyacrylamide gel electrophoresis or capillary electrophoresis can be performed instead of aerogel electrophoresis. PCR can be performed using a primer tagged with a fluorescent dye to detect the amplified product. A detection method that does not require electrophoresis can also be used, such as bonding the amplified product in solid phase to a microplate and detecting the amplified product using a fluorescent or enzymatic reaction.
[0743] 2. Detection Using the TAQMAN PCR Method
[0744] In the TAQMAN PCR method, the PCR reaction is performed using a fluorescent dye-tagged allele-specific oligo and Taq DNA polymerase. The allele-specific oligo used in the TAQMAN PCR method (TAQMAN probe) can be designed based on the SNP data. The 5′ end of the TAQMAN probe is tagged using a fluorescent reporter dye R such as FAM or VIC, and the 3′ end is tagged using a quencher Q (light-quenching substance). (See FIG. 1.). Here, the fluorescent light energy absorbed by the quencher is not detected. Because the 3′ end of the TAQMAN probe is phosphorylated, there is no elongation reaction from the TAQMAN probe in the PCR reaction (FIG. 1). However, a PCR reaction is performed on the TAQMAN probe with TaqDNA polymerase and a primer designed to amplify the region containing the SNP. The following reaction occurs.
[0745] First, the TAQMAN probe is hybridized in a specific sequence of template DNA (FIG. 2a) and an elongation reaction is simultaneously performed from the PCR primer (FIG. 2b). Because the Taq DNA polymerase has 5′ nuclease activity, the hybridized TAQMAN probe is severed as the PCR primer elongation reaction continues. When the TAQMAN probe is severed, the quencher has no effect on the fluorescent dye, and the fluorescent light is detected (FIG. 2c).
[0746] For example, suppose there is an A allele (Allele 1) and a G allele (Allele 2) at the SNP position as shown in FIG. 3. Allele 1 is tagged by a specific TAQMAN probe with FAM and Allele 2 is tagged by a specific TAQMAN probe with VIC (see FIG. 3). Two different allele-specific oligos are added to the PCR drug, and TAQMAN PCR is performed on the detected template. The fluorescence detector then detects the fluorescent intensity of the FAM and VIC. When the SNP position in the allele and the position corresponding to the SNP in the TAQMAN probe are complementary, the probe is hybridized with the allele, the fluorescent dye in the probe is severed by the Taq polymerase, the effect of the quencher is eliminated, and the intensity of the fluorescence is detected.
[0747] If the template is homozygous for Allele 1, strong FAM fluorescence is detected and hardly any VIC fluorescence is detected. If the template is heterozygous for Allele 1 and Allele 2, both FAM and VIC fluorescence are detected.
[0748] 3. SNP Detection Using the INVADER Assay
[0749] In the INVADER assay, an allele-specific oligo and the template are hydridized to detect the SNP. In the INVADER assay, two different non-tagged oligos and one fluorescent dye-tagged oligo are used. One of the two non-tagged oligos is known as the probe. In some embodiments, the probe has a. region hybridized to the genome DNA (template DNA) and a region (called a flap) that is not hydridized with the genome DNA, and that has a sequence unrelated to the sequence of the genomic DNA. The hybridized region has base sequences corresponding to the SNP (FIG. 4a). The flap sequence is complementary to a FRET probe (described below). The other of the two non-tagged oligos is called the INVADER oligonucleotide. This oligonucleotide is designed so that it is hybridized in complementary fashion from the SNP position towards the 3′ end of the genome DNA (FIG. 4b). In some preferred embodiments, the sequence corresponding to the SNP position can be any base (denoted by N in FIG. 4b). When the template DNA genome is hybridized with the two probes, the base (N) from the INVADER oligonucleotide is inserted in the SNP position (FIG. 4c) forming a cleavage structure at the SNP position.
[0750] In some embodiments, the fluorescent dye-tagged oligonucleotide is a sequence completely unrelated to the alleles. This probe is a FRET (fluorescence resonance energy transfer) probe (FIG. 5). The fluorescent dye R tags the base (reporter) at the 5′ end of the FRET prove. A quencher Q absorbs the fluorescence. Here, the quencher absorbs the fluorescent light and the light is not detected. A specific region (Region 1) is designed on the 5′ end of the FRET probe (reporter base) to face the 3′ end from Region 1 (This region is Region 2). As a result, Region 1 and Region 2 form a complementary duplex (FIG. 5). The 3′-region from the regions forming the complementary duplex can be hybridized with the flap of the allele probe to form a complementary chain (FIG. 5).
[0751] In the INVADER assay, a cleavage agent (e.g., CLEAVASE enzyme, Third Wave Technologies, Madison, Wis.) is used, which is an enzyme (5′ nuclease) with specific endonuclease activity for identifying and cleaving a specific DNA structure. When the genome DNA, the probe and the INVADER oligonucleotide form a cleavage structure at the SNP position, the cleavage agent severs 3′ of the SNP position on the allele probe. The section with three bases forming a flap with the 5′ end is identified as shown in FIG. 4c, and the flap is severed. The structure with the SNP position is identified by the cleavage agent (FIG. 6a), the probe is severed at the flap position, and the flap is separated (FIG. 6b). Next, the released flap from the probe bonds with the FRET probe in complementary fashion to form a duplex (FIG. 6c). The cleavage agent identifies this structure and cleaves the section with the fluorescent dye. The cleaved fluorescent dye is no longer affected by the quencher and fluorescent light becomes detectable (FIG. 6d). If the SNP position does not match the sequence corresponding to the SNP in the allele probe as shown in FIG. 7, the specific DNA structure is not identified by the cleavage agent, the probe is not severed, and fluorescent light is not detected.
[0752] When the SNP is T/C, for example, a T INVADER oligonucleotide, a T probe, a FRET probe with FAM bonded to the reporter for the T SNP, a C INVADER oligonucleotide, a C probe and a FRET probe with VIC bonded to the reporter for the C SNP are prepared. These are combined and SNP detection is performed. If there is a T/T homo, FAM fluorescence is generated. If there is a C/C homo, VIC fluorescence is detected. If there is a T/C hetero, both FAM and VIC fluorescence are detected. Because the FAM and VIC fluorescence wavelengths are different, both can be readily identified.
[0753] Detection Using the SniPer Method
[0754] In order to detect SNP using the SniPer method, an allele identifier is amplified using RCA. The genome DNA template is a straight chain, and a probe is hybridized with the genome DNA. When there is a complementary match between the probe sequence and the genome DNA template sequence and a complementary chain forms, a ligation reaction on the genome DNA forms a ring. As a result, RCA continues on cyclic DNA. If the end of the probe does not match the genome DNA, the RCA reaction does not occur because there is no ligation and no ring. In the SniPer method, therefore, a single chain probe is designed to anneal the genome DNA and create a ring. This single chain probe is called a padlock probe. The severed end of the padlock probe is the sequence corresponding to the target SNP. The padlock probe and the genome DNA mix and a ligation reaction occurs. If the severed end of the padlock probe and the SNP section of the genome DNA are complementary, the severed end of the padlock probe connects and forms a ring during the ligation reaction. If they are not complementary, a ring does not form. Therefore, only a padlock probe corresponding to the target SNP forms a ring and is amplified by the DNA polymerase. The presence of amplification is used to detect the SNP. A synthetic oligonucleotide with a hairpin structure and a fluorescent dye and quencher on both ends can be used in the detection process.
[0755] Detection Using the MALDI-TOF/MS Method
[0756] In the matrix assisted laser desorption-time of flight/mass spectroscopy (MALDI-TOF/MS) method, SNP typing is performed using a mass spectrometer. A preferred embodiments of this method has the following steps.
[0757] (i) PCR Amplification and Refinement of DNA Fragments Containing SNP
[0758] After making sure the base at the SNP location and the PCR primer do not overlap, the DNA fragment is amplified, exonuclease or alkali phosphatase processing is performed on the amplified product, the dNTP is removed, and the amplified fragment is refined.
[0759] (ii) Primer Extension Reaction (Thermal Cycle) and Refinement
[0760] A primer ten or more times the template in the region identified as the PCR product is added, a thermal cycle reaction is performed, and a primer elongation reaction is performed. The primer used here is designed so the 3′ end is next to the base corresponding to the SNP position. The primer length should be 15 to 30 bases, ideally 20 to 25 bases. If there is a multiplex reaction, a sequence that is not complementary to the template is added to the 5′ end. There should be 20 to 30 (ideally 25) thermal cycles at two different temperatures. These should be 85 to 105° C. (ideally 94° C.) and 35 to 40° C. (ideally 37° C.).
[0761] The reaction product is then refined using a refining kit so it can be used in the mass spectrometer.
[0762] (iii) Mass Spectroscopy Using a Mass Spectrometer
[0763] The elongated and refined reaction product is applied to the mass spectrometer, and a quality of the target product is measured. In other words, the refined product is mixed with the matrix and 0.5 to 1.0 mL spots are formed on the MALDI plate. After drying the plate, the substance is irradiated by a laser beam and a spectrogram is produced.
[0764] Detection Using the Base Sequence Determining Method
[0765] In the present invention, a polymorphism can be detected using an elongation reaction on a single base. In other words, four different types of dideoxynucleotides identified by different fluorescent compounds are added to reaction systems including the gene to be detected and a single base elongation reaction is performed. Here, the base to be elongated is the polymorphism. Two reactions are performed; one to stop the DNA synthesis and another to identify the 3′ end of the DNA molecule with fluorescence. Electrophoresis is performed on four different reaction solutions with the same lanes and capillaries for the sequencing gel. The sequence is determined by detecting the differences in the fluorescent dyes identifying the DNA bands using a fluorescence detector. The oligonucleotides with one base elongated have the elongation confirmed using different types of fluorescent dyes in a fluorescence detector and mass spectrometer. Instead of fluorescent-tagged dideoxynucleotides, the primer can be identified using fluorescence used with non-tagged dideoxynucleotides.
[0766] Drug Evaluation
[0767] Using information obtained by the methods of the present invention, the efficacy and stability of the drug metabolized by the drug metabolizing enzyme can be evaluated.
[0768] For example, in some embodiments, the drug can be evaluated using a typing system. In other words, the frequency of expressed and unexpressed alleles (e.g., toxic alleles that cause undesired side effects) can be compared using any one of the detection methods mentioned above. Once they have been compared, markers can be selected to indicate, for example, a toxic expression where the allele frequency differs. In statistical analysis, this is usually set as ×2. However, this is different in other methods such as the Fisher method. The active components (altered and metabolized drug components) in the drug will be reflected in blood and tissue concentrations. All of the genetic polymorphisms can be checked against the causes of the toxic effects to isolate specific correlating genetic polymorphisms. The substances corresponding to the probes or primers used to analyze all of the genetic polymorphisms are prepared beforehand on reaction plates, cards or glass plates, and unprepared human genome DNA is added and reacted to determine the allele pattern. If there are genetic polymorphisms correlating with toxicity or other phenotypes, then human side-effects can be expected or predicted. The same is true of drug effectiveness. Because the genetic polymorphisms correlating to effectiveness and side-effects differ depending on the drug, typing performed using genetic polymorphisms can be performed to anticipate effectiveness and side-effects.
[0769] Differences in allele frequency can be determined in certain instances by comparing the frequency of genetic polymorphisms to effectiveness/ineffectiveness or the presence/absence of side-effects. If, for example, an SNP analysis is performed on persons with a toxic reaction (side-effect) to Drug A, the results may show a 90% of the people have T/T (e.g., detected based on the intensity of fluorescent FAM light). The same results may show 10% of people with no toxic reaction have a T/T and 90% have a C/C. As a result of the SNP analysis, the evaluation may be not to administer Drug A to persons with T/T.
[0770] Drug Screening
[0771] In the present invention, the genetic polymorphism data obtained as described above is compared to genetic polymorphism data from genes encoding certain drug metabolizing enzymes to indicate the safety and effectiveness of drugs metabolized by these drug metabolizing enzymes. Therefore, the genetic polymorphism data obtained using the method of the present invention can be used to determine the likely effectiveness of certain drug therapies and to select the appropriate drug.
[0772] The evaluation methods described above can be used. Genetic polymorphisms with correlations to side-effects and effectiveness are said to be influenced by the activation, transfer and translation of certain enzymes. The cause and effect relationship with the side-effect or effectiveness expression mechanism may be indirect. The metabolization of drugs is being studied by pharmaceutical companies in laboratory and clinical testing. If there are genetic polymorphisms in enzyme genes correlating with severe side-effects, they can be removed and used under different conditions. The same is true of effectiveness. Drugs can be screened, therefore, using side-effects and effectiveness data. A wide variety of conditions and diseases (See e.g., Physician's Desk Reference) benefit from analysis using the systems and methods of the present invention.
[0773] In some embodiments of the present invention, a sample is taken from a subject (e.g., by a drug company) and sent to a laboratory for analysis using a detection assay. The laboratory results (e.g., detection assay test result data) is returned to the party providing the sample such that an appropriate decision can be made, including, but not limited to, development or administration of a drug to a subject.
[0774] In clinical testing (Tests I through III), the frequency of the expression of genetic polymorphisms can be studied in volunteers exhibiting certain side-effects and volunteers not exhibiting the same side-effects to a drug. In this way, novel genetic polymorphisms correlating with side-effects and effectiveness can be detected. This information can be used to screen drugs. Exemplary drugs and drug-related data and other information that find use in or with the present invention, including but are not limited to the methods and databases described herein, are described in the PHYSICIANS' DESK REFERENCE (PDR). (e.g., 2002 Edition, Medical Economics Company, Inc., Montvale, N.J.). The PDR is expressly incorporated by reference herein as if fully set forth.
EXPERIMENTAL EXAMPLES[0775] The following examples are provided in order to demonstrate and further illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.
Example 1 Obtaining SNP Data[0776] (1) DNA Extraction
[0777] Blood was extracted from 48 unrelated people in the presence of EDTA. The DNA was extracted in the following way based on the method in the Genome Analysis Manual (Yusuke Nakamura ed., Springer-Verlag Tokyo).
[0778] Ten milliliters of blood was transferred to a 50 ml test tube and centrifuged for five minutes at room temperature and 3000 rpm. After the supernatant (blood serum) had been removed using a pipette, 30 ml of RBC-dissolving buffer (10 mM NH4 HCO3, 144 mM NH3C1) was added. After mixing until there was no sediment, it was allowed to stand for 20 minutes at room temperature. After being centrifuged for five minutes at room temperature and 3000 rpm, the supernatant (blood serum) was again removed using a pipette to obtain white blood cells. Another 30 ml of RBC-dissolving buffer was added and the process was repeated twice. Then, 4 ml of proteinase K buffer [50 mM Tris-HCl (pH 7.4), 100 mM NaCl, 1 mM EDTA (pH 8.0)] was added to the white blood cells, 200 ml of SDS was added, 200 ml of 10 mg/ml proteinase K was added, and the solution was tumble-mixed. The solution was then allowed to stand overnight at 37° C. The next day, 4 ml of phenol was added, and the solution was slowly tumble-mixed for four hours using a Taitec T-50 Rotator. After being centrifuged for 10 minutes at room temperature and 3000 rpm, the supernatant was removed using a new tube. Then, 4 ml of phenol-chloroform-isoamylalcohol (volume ratio 25:24:1) was added, the solution was tumble-mixed for two hours in the manner described above, and the solution was centrifuged. The supernatant was removed using a new tube, 4 ml of chloroform-isoamylalcohol (volume ratio 24:1) was added, and the solution was tumble-mixed. Fibrous white precipitate (DNA) was removed using a 2 ml tube, 1 ml of 70% ethanol was added, and the solution was tumble-mixed. The DNA was transferred to a new tube, dried and dissolved in 500 ml of TE solution [10 mM Tris-HCl (pH 4.7), 1 mM EDTA (pH 7.4)] to obtain a genome DNA sample.
[0779] (2) PCR
[0780] A genome sequence was obtained from the GenBank DNA Database. After removing the repeating sequences using the RepMask computer program, the PCR primer was set so there would be approximately 1 kb of PCR product. The genome DNA from 48 unrelated people was prepared at the same concentration. After mixing the same amount of DNA from three people in a single tube, 60 ng was used in the PCR. The PCR was Ex-Taq (Takara 2.5 U) and performed using the GeneAmp PCR System 9700 (PE Applied Biosystems). After reacting for two hours at 94° C., denaturing was performed for 30 seconds at 96° C., annealing was performed for 30 seconds at 55° C. or 60° C., and elongation was performed for one minute at 72° C. in each cycle. There were 35 cycles.
[0781] (3) Sequence
[0782] After refining the PCR product using Arraylt (Telechem), the sequence reaction was performed using the BigDye Terminator RR Mix (PE Applied Biosystems). After reacting for two hours at 96° C., denaturing was performed for 20 seconds at 96° C., annealing was performed for 30 seconds at 50° C., and elongation was performed for 4 minutes at 60° C. in each cycle using the GeneAmp PCR System 9700 (PE Applied Biosysytems). There were 25 cycles. After the sequencing reaction, the sequencing was analyzed using the ABI Prism 3700 DNA Analyzer.
[0783] (4) SNP Detection
[0784] An analysis was performed on the SNP detection using the PolyPhred computer program (Nickerson et al., 1997, Nucleic Acid Res., 25, 2745-2751).
[0785] (5) Results
[0786] The SNP results shown in Table 1 were obtained. The analyzed drug metabolizing enzyme, the abbreviation of the enzyme, the databank (GenBank) accession number, the structure of the gene for the drug metabolizing enzyme, and the position of the SNPs are shown in FIG. 9 through FIG. 141 and FIG. 144 through 312. In FIG. 9 through FIG. 141 and FIG. 144 through 312, the exons are blank boxes or black lines in the genes denoted by the horizontal lines. The position of the SNPs is denoted above the genes with solid lines and numbers.
Example 2 Typing[0787] Typing was performed on two different groups of patients using the INVADER assay. In FIG. 142, the x-axis (Allele 1) indicates the intensity of the FAM fluorescent light corresponding to T, and the x-axis (Allele 2) indicates the intensity of the VIC fluorescent light corresponding to C. The slanted line indicates the SNP pattern for T/T, the black circles denote the pattern for C/C, and the white circles denote the pattern for T/C. The black squares indicate the background values. The x marks indicate where the detection failed. The group of patients in the graph for panel A (top) had many C/C SNP patterns and the group of patients in the graph for panel B (bottom) had many T/T SNP patterns.
Example 3 SNP Detection[0788] Genome DNA was extracted from five unrelated people using the method described in Example 1, and the SNPs in three different drug metabolizing enzyme genes (EPHX1, ABCB2, AANAT) were detected using the INVADER assay method. The INVADER oligonucleotides and probes were designed using base sequence No. 3 (Sequence No. 49) and No. 17 (Sequence No. 63) in the case of EPHX1, base sequence No. 4 (Sequence No. 4) and No. 11 (Sequence No. 11) in the case of ABCB2, and base sequence No. 3 (Sequence No. 561) in the case of AANAT. The positions of the SNPs are shown in Table 1.
[0789] The results are shown in Table 2. 2 TABLE 2 EPHX1 ABCB2 AANAT Drug No. 3 No. 17 No. 4 No. 11 No. 3 Metabolizing Seq. Seq. Seq. Seq. Seq. Enzyme Gene No. 49 No. 63 No. 4 No. 11 No. 561 SNP (T/G) (A/G) (G/T) (G/A) (T/A) Subject I T/T A/G T/T G/A T/T Subject II T/T A/A G/G G/G T/A Subject III T/G A/A G/G A/A T/T Subject IV G/G A/G G/T G/G T/T Subject V T/G A/G G/T G/A T/A
[0790] As shown in Table 2, the SNPs in the drug metabolizing genes of patients can be detected and the patterns determined using the method of the present invention.
Example 4 Correlation Between SNP Genotypes and Optimal Amounts of a Medicament for Treatment Validity and Safety[0791] In this example, validity and safety of medicaments were investigated using SNP analysis.
[0792] Thiopurine S-methyltransferase (TPMT) is an enzyme that transfers a methyl group to a sulfur atom attached to a purine ring, and is one of the major enzymes for metabolizing drugs such as the anti-cancer agents 6-mercaptopurine and 6-thioguanine, and thiopurine derivatives such as the immunosuppressive agent azathioprine. This example shows a correlation between optimal amounts of azathioprine and various combinations of the alleles at the 868th SNP of intron 3 of TPMT (Seki, et al., J Hum Genet 45(5):299 [2000], incorporated by reference herein in its entirety; Accession No. AB045146.1) (G or T alleles) and the 2682nd SNP of intron 3 (C or A alleles) (Table 3 and Table 4). 3 TABLE 3 868 2682 High Low TT AA 2 0 TT AT 3 0 TT TT 1 0 GT AA 0 2 GT AT 1 7 GT TT 4 1 GG AA 1 0 GG AT 0 1 GG TT 1 0
[0793] Optimal amounts of azathioprine were determined by adopting suppression of rejection after renal transplantation as an index. A group of patients in which the validity of treatment with 100 mg/day of azathioprine was confirmed was designated as a high dose group, and a group of patients in which side effects developed with treatment of 100 mg/day, but in which validity was confirmed with a treatment of 50 mg/day was designated as a low dose group. Table 3 indicates the number of patients having each combination of alleles, with the columns labeled “High” and “Low” representing the numbers of patients of each genotype in the high dose and the low dose groups, respectively. Side effects include leukopenia, anthema, angiitis, nausea/vomiting, anorexia, diarrhea, malaise, myalgia, arthralgia, fever, chill, and dizziness. More serious side effects include, for example, blood disorders, shock-like symptoms, infectious diseases, and hepatic disorders, and renal disorders.
[0794] Investigation of a correlation between the high dose and low dose groups and the two types of SNPs indicated above revealed that when G is present in at least one allele at the 868th SNP of intron 3 (G/G homozygous or G/T heterozygous) and A is present in at least one allele at the 2682nd SNP of intron 3 (A/A homozygous or A/T heterozygous), side effects were developed with 100 mg/day and 50 mg/day was an optimal amount for 10 out of 12 patients (low dose group), while 100 mg/day was an optimal amount for 11 out of 12 patients with other allele combinations (high dose group) (Table 4). Investigation of this combination of two SNP loci in patients enables prediction of optimal amounts of azathioprine for treatment prior to the administration of the drug, for improved validity and safety. These results indicate that the validity and safety of medicaments can be predicted using analysis of SNPs associated with medicament metabolic enzymes, e.g., as described in this specification and including but not limited to the DME-associated SNPs listed in Table 1. As used in this example only, the term “optimal amount” refers to the best dosage selected from the tested amounts of 50 mg/day or 100/mg per day. It will be appreciated by those skilled in the art that a study testing additional amounts of a medicament (e.g., a study in which amounts are varied in smaller increments, such as 40, 50, 60, 70, 80, 90, etc. mg/day) would provide additional information regarding ranges of amounts giving optimal performance for patients having a particular genotype, and that optimal amounts of this or any other medicament are not limited to the particular amounts of 50 or 100 mg/day tested in this example. 4 TABLE 4 Optimal amount Genotype 100 mg/day 50 mg/day G as the 868th SNP and A 2 10 as the 2682nd Other combinations 11 1 (Fisher exact test: p = 0.0003)
Sequence Listing Free Text[0795] SEQ ID NO:39: n indicates t (Position 21).
[0796] SEQ ID NO:64: n indicates c (Position 21).
[0797] SEQ ID NO:580: n indicates a or deletion (Position 21).
[0798] SEQ ID NO:634: n indicates a or deletion (Position 21).
[0799] SEQ ID NO:656: n indicates a or deletion (Position 21).
[0800] SEQ ID NO:658: n indicates c or deletion (Position 21).
[0801] SEQ ID NO:671: n indicates a or deletion (Position 21).
[0802] SEQ ID NO:672: n indicates g or deletion (Position 21).
[0803] SEQ ID NO:673: n indicates c or deletion (Position 21).
[0804] SEQ ID NO:674: n indicates (cctgy)x or deletion (Position 21).
[0805] SEQ ID NO:676: n indicates gaa or deletion (Position 21).
[0806] SEQ ID NO:677: n indicates ag or deletion (Position 21).
[0807] SEQ ID NO:785: n indicates ta. (Position 21).
[0808] SEQ ID NO:797: n indicates acac. (Position 21).
[0809] SEQ ID NO:806: n indicates gatttgtggtatccag. (Position 21).
[0810] SEQ ID NO:808: n indicates ag or deletion (Position 21).
[0811] SEQ ID NO:809: n indicates ta or deletion (Position 21).
[0812] SEQ ID NO:815: n indicates t (Position 21).
[0813] SEQ ID NO:828: n indicates cagaggct (Position 21).
[0814] SEQ ID NO:830: n indicates ca or deletion (Position 21).
[0815] SEQ ID NO:831: n indicates ag or deletion (Position 21).
[0816] SEQ ID NO:843: n indicates gtaaa (Position 21).
[0817] SEQ ID NO:845: n indicates a (Position 21).
[0818] SEQ ID NO:888: n indicates tc (Position 21).
[0819] SEQ ID NO:890: n indicates t or deletion (Position 21).
[0820] SEQ ID NO:913: n indicates t or deletion (Position 21).
[0821] SEQ ID NO:932: n indicates t or deletion (Position 21).
[0822] SEQ ID NO:933: n indicates t or deletion (Position 21).
[0823] SEQ ID NO:955: n indicates at or deletion (Position 21).
[0824] SEQ ID NO:956: n indicates a or deletion (Position 21).
[0825] SEQ ID NO:957: n indicates c or deletion (Position 21).
[0826] SEQ ID NO:987: n indicates c (Position 21).
[0827] SEQ ID NO:999: n indicates gtt or deletion (Position 21).
[0828] SEQ ID NO:1164: n indicates at (Position 21).
[0829] SEQ ID NO:1166: n indicates c or deletion (Position 21).
[0830] SEQ ID NO:1167: n indicates t or deletion (Position 21).
[0831] SEQ ID NO:1168: n indicates t or deletion (Position 21).
[0832] SEQ ID NO:1169: n indicates g (Position 21).
[0833] SEQ ID NO:1171 n indicates c (Position 21).
[0834] SEQ ID NO:1173: n indicates t (Position 21).
[0835] SEQ ID NO:1175: n indicates c or deletion (Position 21).
[0836] SEQ ID NO:1200: n indicates a or deletion (Position 21).
[0837] SEQ ID NO:1204: n indicates a (Position 21).
[0838] SEQ ID NO:1207: n indicates tt (Position 21).
[0839] SEQ ID NO:1210: n indicates at (Position 21).
[0840] SEQ ID NO:1245: n indicates t (Position 21).
[0841] SEQ ID NO:1248: n indicates t or deletion (Position 21).
[0842] SEQ ID NO:1249: n indicates t (Position 21).
[0843] SEQ ID NO:1251: n indicates a or deletion (Position 21).
[0844] SEQ ID NO:1252: n indicates tgt or deletion (Position 21).
[0845] SEQ ID NO:1260: n indicates t or deletion (Position 21).
[0846] SEQ ID NO:1309: n indicates a or deletion (Position 21).
[0847] SEQ ID NO:1389: n indicates g or deletion (Position 21).
[0848] SEQ ID NO:1411: n indicates a or deletion (Position 21).
[0849] SEQ ID NO:1417: n indicates aaag (Position 21).
[0850] SEQ ID NO:1424: n indicates gtg or deletion (Position 21).
[0851] SEQ ID NO:1426: n indicates gg or tggtggggtgga (Position 21).
[0852] SEQ ID NO:1429: n indicates at or deletion (Position 21).
[0853] SEQ ID NO:1436: n indicates a (Position 21).
[0854] SEQ ID NO:1453: n indicates c or deletion (Position 21).
[0855] SEQ ID NO:1456: n indicates gg (Position 21).
[0856] SEQ ID NO:1465: n indicates gtc or deletion (Position 21).
[0857] SEQ ID NO:1487: n indicates t or deletion (Position 21).
[0858] SEQ ID NO:1494: n indicates tt (Position 21).
[0859] SEQ ID NO:1497: n indicates t repeated 9 to 12 times (Position 21).
[0860] SEQ ID NO:1499: n indicates a or deletion (Position 21).
[0861] SEQ ID NO:1501: n indicates a repeated 10 to 13 times (Position 21).
[0862] SEQ ID NO:1504: n indicates ct or deletion (Position 21).
[0863] SEQ ID NO:1507: n indicates cagatcttcttcagctaatttagaaatgt (Position 21).
[0864] SEQ ID NO:1533: n indicates a or deletion (Position 21).
[0865] SEQ ID NO:1540: n indicates c (Position 21).
[0866] SEQ ID NO:1545: n indicates t (Position 21).
[0867] SEQ ID NO:1552: n indicates t repeated 9 to 12 times (Position 21).
[0868] SEQ ID NO:1555: n indicates t (Position 21).
[0869] SEQ ID NO:1557: n indicates aaaaaaagaaaa (Position 21).
[0870] SEQ ID NO:1558: n indicates aaaaaaaaaaaa (Position 21).
[0871] SEQ ID NO:1559: n indicates aaaaaaaaaa (Position 21).
[0872] SEQ ID NO:1563: n indicates t or deletion (Position 21).
[0873] SEQ ID NO:1572: n indicates c (Position 21).
[0874] SEQ ID NO:1574: n indicates a or deletion (Position 21).
[0875] SEQ ID NO:1575: n indicates c or deletion (Position 21).
[0876] SEQ ID NO:1596: n indicates cct or deletion (Position 21).
[0877] SEQ ID NO:1598: n indicates tc (Position 21).
[0878] SEQ ID NO:1616: n indicates ca or deletion (Position 21).
[0879] SEQ ID NO:1638: n indicates g (Position 21).
[0880] SEQ ID NO:1661: n indicates t or deletion (Position 21).
[0881] SEQ ID NO:1690: n indicates gccag (Position 21).
[0882] SEQ ID NO:1718: n indicates t (Position 21).
[0883] SEQ ID NO:1723: n indicates c or deletion (Position 21).
[0884] SEQ ID NO:1729: n indicates tc or deletion (Position 21).
[0885] SEQ ID NO:1740: n indicates ct or deletion (Position 21).
[0886] SEQ ID NO:1771: n indicates a (Position 21).
[0887] SEQ ID NO:1781: n indicates a or deletion (Position 21).
[0888] SEQ ID NO:1787: n indicates t or deletion (Position 21).
[0889] SEQ ID NO:1791: n indicates t or deletion (Position 21).
[0890] SEQ ID NO:1792: n indicates g or deletion (Position 21).
[0891] SEQ ID NO:1800: n indicates t or deletion (Position 21).
[0892] SEQ ID NO:1801: n indicates t or deletion (Position 21).
[0893] SEQ ID NO:1802: n indicates a or deletion (Position 21).
[0894] SEQ ID NO:1815: n indicates a or deletion (Position 21).
[0895] SEQ ID NO:1819: n indicates ca or deletion (Position 21).
[0896] SEQ ID NO:1820: n indicates t or deletion (Position 21).
[0897] SEQ ID NO:1824: n indicates t or deletion (Position 21).
[0898] SEQ ID NO:1829: n indicates t or deletion (Position 21).
[0899] SEQ ID NO:1830: n indicates c or deletion (Position 21).
[0900] SEQ ID NO:1838: n indicates a or deletion (Position 21).
[0901] SEQ ID NO:1840: n indicates t or deletion (Position 21).
[0902] SEQ ID NO:1847: n indicates gatt or deletion (Position 21).
[0903] SEQ ID NO:1848: n indicates t (Position 21).
[0904] SEQ ID NO:1853: n indicates t or deletion (Position 21).
[0905] SEQ ID NO:1854: n indicates gt (Position 21).
[0906] SEQ ID NO:1857: n indicates a or deletion (Position 21).
[0907] SEQ ID NO:1858: n indicates a or deletion (Position 21).
[0908] SEQ ID NO:1862: n indicates t or deletion (Position 21).
[0909] SEQ ID NO:1865: n indicates at or deletion (Position 21).
[0910] SEQ ID NO:1871: n indicates a or deletion (Position 21).
[0911] SEQ ID NO:1874: n indicates t or deletion (Position 21).
[0912] SEQ ID NO:1877: n indicates at or deletion (Position 21).
[0913] SEQ ID NO:1878: n indicates a or deletion (Position 21).
[0914] SEQ ID NO:1879: n indicates t repeated 12 to 14 times (Position 21).
[0915] SEQ ID NO:1882: n indicates t or deletion (Position 21).
[0916] SEQ ID NO:1884: n indicates cac or deletion (Position 21).
[0917] SEQ ID NO:1891: n indicates cca (Position 21).
[0918] SEQ ID NO:1919: n indicates t or deletion (Position 21).
[0919] SEQ ID NO:1949: n indicates c or deletion (Position 21).
[0920] SEQ ID NO:1957: n indicates aaaa or deletion (Position 21).
[0921] SEQ ID NO:1970: n indicates c or deletion (Position 21).
[0922] SEQ ID NO:1980: n indicates t repeated 7 to 9 times (Position 21).
[0923] SEQ ID NO:1981: n indicates a or deletion (Position 21).
[0924] SEQ ID NO:1993: n indicates taac or deletion (Position 21).
[0925] SEQ ID NO:1994: n indicates ctcttt (Position 21).
[0926] SEQ ID NO:1995: n indicates ct (Position 21).
[0927] SEQ ID NO:2002: n indicates a or deletion (Position 21).
[0928] SEQ ID NO:2005: n indicates t or deletion (Position 21).
[0929] SEQ ID NO:2008: n indicates g or deletion (Position 21).
[0930] SEQ ID NO:2011: n indicates aattagaa or deletion (Position 21).
[0931] SEQ ID NO:2012: n indicates tttaaaa or ttttaa (Position 21).
[0932] SEQ ID NO:2015: n indicates t or deletion (Position 21).
[0933] SEQ ID NO:2020: n indicates t or deletion (Position 21).
[0934] SEQ ID NO:2024: n indicates g or deletion (Position 21).
[0935] SEQ ID NO:2025: n indicates t or deletion (Position 21).
[0936] SEQ ID NO:2030: n indicates aaa or deletion (Position 21).
[0937] SEQ ID NO:2031: n indicates a or deletion (Position 21).
[0938] SEQ ID NO:2042: n indicates c (Position 21).
[0939] SEQ ID NO:2072: n indicates a or deletion (Position 21).
[0940] SEQ ID NO:2074: n indicates a or deletion (Position 21).
[0941] SEQ ID NO:2243: n indicates tca repeated 14 to 16 times (Position 21).
[0942] SEQ ID NO:2244: n indicates a repeated 8 to 10 times (Position 21).
[0943] SEQ ID NO:2245: n indicates cacagtcat or deletion (Position 21).
[0944] SEQ ID NO:2246: n indicates tt or deletion (Position 21).
[0945] SEQ ID NO:2247: n indicates a repeated 10 to 12 times (Position 21).
[0946] SEQ ID NO:2248: n indicates c or deletion (Position 21).
[0947] SEQ ID NO:2249: n indicates a repeated 16 to 18 times (Position 21).
[0948] SEQ ID NO:2250: n indicates g (Position 21).
[0949] SEQ ID NO:2252: n indicates c or deletion (Position 21).
[0950] SEQ ID NO:2253: n indicates t or deletion (Position 21).
[0951] SEQ ID NO:2254: n indicates a or deletion (Position 21).
[0952] SEQ ID NO:2255: n indicates tg (Position 21).
[0953] SEQ ID NO:2257: n indicates t repeated 10 to 13 (Position 21).
[0954] SEQ ID NO:2258: n indicates gt repeated 11 to 13 times (Position 21).
[0955] SEQ ID NO:2259: n indicates a or deletion (Position 21).
[0956] SEQ ID NO:2260: n indicates g or deletion (Position 21).
[0957] SEQ ID NO:2261: n indicates g or deletion (Position 21).
[0958] SEQ ID NO:2262: n indicates t repeated 9 to 11 times (Position 21).
[0959] SEQ ID NO:2263: n indicates g (Position 21).
[0960] SEQ ID NO:2265: n indicates tt or deletion (Position 21).
[0961] SEQ ID NO:2266: n indicates a repeated 7 to 9 times (Position 21).
[0962] SEQ ID NO:2267: n indicates t repeated 9 to 11 times (Position 21).
[0963] SEQ ID NO:2268: n indicates a repeated 9 to 10 times (Position 21).
[0964] SEQ ID NO:2269: n indicates gt or deletion (Position 21).
[0965] SEQ ID NO:2270: n indicates a or deletion (Position 21).
[0966] SEQ ID NO:2271: n indicates t (Position 21).
[0967] SEQ ID NO:2273: n indicates a or deletion (Position 21).
[0968] SEQ ID NO:2274: n indicates ct or deletion (Position 21).
[0969] SEQ ID NO:2275: n indicates g or deletion (Position 21).
[0970] SEQ ID NO:2276: n indicates a or deletion (Position 21).
[0971] SEQ ID NO:2277: n indicates a or deletion (Position 21).
[0972] SEQ ID NO:2278: n indicates a or deletion (Position 21).
[0973] SEQ ID NO:2279: n indicates c or deletion (Position 21).
[0974] SEQ ID NO:2280: n indicates aaag or deletion (Position 21).
[0975] SEQ ID NO:2348: n indicates t repeated 22 to 26 times (Position 21).
[0976] SEQ ID NO:2349: n indicates g repeated 8 to 10 times (Position 21).
[0977] SEQ ID NO:2350: n indicates c repeated 6 to 7 times (Position 21).
[0978] SEQ ID NO:2351: n indicates a repeated 12 to 14 times (Position 21).
[0979] SEQ ID NO:2427: n indicates caccaggcagcagactctgatgaggaggggagggg (Position 21).
[0980] SEQ ID NO:2429: n indicates g (Position 21).
[0981] SEQ ID NO:2474: n indicates tcac or deletion (Position 21).
[0982] SEQ ID NO:2475: n indicates t or deletion (Position 21).
[0983] SEQ ID NO:2476: n indicates t repeated 9 to 11 times (Position 21).
[0984] SEQ ID NO:2477: n indicates a repeated 7 to 8 times (Position 21).
[0985] SEQ ID NO:2495: n indicates t repeated 13 to 16 times (Position 21).
[0986] SEQ ID NO:2496: n indicates t repeated 9 to 10 times (Position 21).
[0987] SEQ ID NO:2497: n indicates t repeated 14 to 16 times (Position 21).
[0988] SEQ ID NO:2498: n indicates t repeated 13 to 17 times (Position 21).
[0989] SEQ ID NO:2499: n indicates t (Position 21).
[0990] SEQ ID NO:2501: n indicates a repeated 8 to 9 times (Position 21).
[0991] SEQ ID NO:2502: n indicates t repeated 8 to 9 times (Position 21).
[0992] SEQ ID NO:2503: n indicates gcagtattactgtagt or deletion (Position 21).
[0993] SEQ ID NO:2504: n indicates t repeated 13 to 14 times (Position 21).
[0994] SEQ ID NO:2505: n indicates t repeated 9 to 10 times (Position 21).
[0995] SEQ ID NO:2506: n indicates t repeated 10 to 11 times (Position 21).
[0996] SEQ ID NO:2524: n indicates t or deletion (Position 21).
[0997] SEQ ID NO:2525: n indicates t repeated 12 to 15 times (Position 21).
[0998] SEQ ID NO:2586: n indicates a or deletion (Position 21).
[0999] SEQ ID NO:2587: n indicates at or deletion (Position 21).
[1000] SEQ ID NO:2594: n indicates t or deletion (Position 21).
[1001] SEQ ID NO:2595: n indicates ttc or deletion (Position 21).
[1002] SEQ ID NO:2606: n indicates ctt (Position 21).
[1003] SEQ ID NO:2651: n indicates c repeated 9 to 11 times (Position 21).
[1004] SEQ ID NO:2652: n indicates a repeated 15 to 21 times (Position 21).
[1005] SEQ ID NO:2653: n indicates ggggtggcggggtggg or deletion (Position 21).
[1006] SEQ ID NO:2654: n indicates t or deletion (Position 21).
[1007] SEQ ID NO:2655: n indicates a (Position 21).
[1008] SEQ ID NO:2657: n indicates a or deletion (Position 21).
[1009] SEQ ID NO:2658: n indicates t repeated 10 to 12 times (Position 21).
[1010] SEQ ID NO:2659: n indicates tt (Position 21).
[1011] SEQ ID NO:2661: n indicates tccctccttgaagctgatcgt or deletion (Position 21).
[1012] SEQ ID NO:2662: n indicates ca repeated 12 to 18 times (Position 21).
[1013] SEQ ID NO:2685: n indicates a repeated 18 to 20 times (Position 21).
[1014] SEQ ID NO:2686: n indicates aa (Position 21).
[1015] SEQ ID NO:2688: n indicates t or deletion (Position 21).
[1016] SEQ ID NO:2689: n indicates t repeated 9 to 13 times (Position 21).
[1017] SEQ ID NO:2690: n indicates aa or deletion (Position 21).
[1018] SEQ ID NO:2691: n indicates ttgaca or gtccaatat (Position 21).
[1019] SEQ ID NO:2692: n indicates cta or deletion (Position 21).
[1020] SEQ ID NO:2693: n indicates t repeated 9 to 10 times (Position 21).
[1021] SEQ ID NO:2694: n indicates gagatgttgtggctcacat (Position 21).
[1022] SEQ ID NO:2696: n indicates cc or deletion (Position 21).
[1023] SEQ ID NO:2697: n indicates act or deletion (Position 21).
[1024] SEQ ID NO:2755: n indicates tat or deletion (Position 21).
[1025] SEQ ID NO:2756: n indicates ac repeated 14 to 17 times (Position 21).
[1026] SEQ ID NO:2757: n indicates a repeated 16 to 27 times (Position 21).
[1027] SEQ ID NO:2758: n indicates t or deletion (Position 21).
[1028] SEQ ID NO:2759: n indicates a repeated 8 to 10 times (Position 21).
[1029] SEQ ID NO:2760: n indicates gt repeated 9 to 11 times (Position 21).
[1030] SEQ ID NO:2761: n indicates aa or deletion (Position 21).
[1031] SEQ ID NO:2762: n indicates t or deletion (Position 21).
[1032] SEQ ID NO:2763: n indicates ac repeated 8 to 12 times (Position 21).
[1033] SEQ ID NO:2764: n indicates a or deletion (Position 21).
[1034] SEQ ID NO:2810: n indicates a (Position 21).
[1035] SEQ ID NO:2812: n indicates aa or deletion (Position 21).
[1036] SEQ ID NO:2813: n indicates ca or deletion (Position 21).
[1037] SEQ ID NO:2814: n indicates t or deletion (Position 21).
[1038] SEQ ID NO:2815: n indicates tgtgtg or deletion (Position 21).
[1039] SEQ ID NO:2912: n indicates a (Position 21).
[1040] SEQ ID NO:2914: n indicates g (Position 21).
[1041] SEQ ID NO:2916: n indicates actt or deletion (Position 21).
[1042] SEQ ID NO:2917: n indicates ttta or deletion (Position 21).
[1043] SEQ ID NO:2918: n indicates a repeated 11 to 13 times (Position 21).
[1044] SEQ ID NO:2919: n indicates t repeated 8 to 10 times (Position 21).
[1045] SEQ ID NO:2920: n indicates a repeated 12 to 14 times (Position 21).
[1046] SEQ ID NO:2921: n indicates cttgta or deletion (Position 21).
[1047] SEQ ID NO:2922: n indicates a repeated 9 to 10 times (Position 21).
[1048] SEQ ID NO:2923: n indicates c or deletion (Position 21).
[1049] SEQ ID NO:2924: n indicates ctt (Position 21).
[1050] SEQ ID NO:2926: n indicates a or deletion (Position 21).
[1051] SEQ ID NO:2927: n indicates a repeated 9 to 10 times (Position 21).
[1052] SEQ ID NO:2928: n indicates tgt or deletion (Position 21).
[1053] SEQ ID NO:2929: n indicates a repeated 24 to 27 times (Position 21).
[1054] SEQ ID NO:2930: n indicates ta repeated 10 to 21 times (Position 21).
[1055] SEQ ID NO:2931: n indicates a repeated 8 to 10 times (Position 21).
[1056] SEQ ID NO:2932: n indicates a repeated 11 to 13 times (Position 21).
[1057] SEQ ID NO:2933: n indicates a repeated 8 to 10 times (Position 21).
[1058] SEQ ID NO:2999: n indicates tatc or deletion (Position 21).
[1059] SEQ ID NO:3000: n indicates atattcacttggtatctg or deletion (Position 21).
[1060] SEQ ID NO:3001: n indicates tt ta or deletion (Position 21).
[1061] SEQ ID NO:3002: n indicates t (Position 21).
[1062] SEQ ID NO:3004: n indicates g or deletion (Position 21).
[1063] SEQ ID NO:3005: n indicates a or deletion (Position 21).
[1064] SEQ ID NO:3006: n indicates a repeated 9 to 11 times (Position 21).
[1065] SEQ ID NO:3007: n indicates g or deletion (Position 21).
[1066] SEQ ID NO:3008: n indicates at repeated 4 to 5 times (Position 21).
[1067] SEQ ID NO:3009: n indicates t repeated 7 to 8 times (Position 21).
[1068] SEQ ID NO:3010: n indicates t repeated 19 to 23 times (Position 21).
[1069] SEQ ID NO:3011: n indicates t or deletion (Position 21).
[1070] SEQ ID NO:3012: n indicates tgat or deletion (Position 21).
[1071] SEQ ID NO:3013: n indicates t repeated 8 to 10 times (Position 21).
[1072] SEQ ID NO:3014: n indicates a or deletion (Position 21).
[1073] SEQ ID NO:3021: n indicates a repeated 13 to 15 times (Position 21).
[1074] SEQ ID NO:3022: n indicates t repeated 12 to 15 times (Position 21).
[1075] SEQ ID NO:3042: n indicates g (Position 21).
[1076] SEQ ID NO:3044: n indicates a or deletion (Position 21).
[1077] SEQ ID NO:3046: n indicates g or deletion (Position 21).
[1078] SEQ ID NO:3047: n indicates t repeated 11 to 13 times (Position 21).
[1079] SEQ ID NO:3049: n indicates a or deletion (Position 21).
[1080] SEQ ID NO:3051: n indicates t repeated 9 to 11 times (Position 21).
[1081] SEQ ID NO:3054: n indicates t or deletion (Position 21).
[1082] SEQ ID NO:3056: n indicates t or deletion (Position 21).
[1083] SEQ ID NO:3060: n indicates t or deletion (Position 21).
[1084] SEQ ID NO:3065: n indicates aaga (Position 21).
[1085] SEQ ID NO:3069: n indicates aaaa or deletion (Position 21).
[1086] SEQ ID NO:3073: n indicates t repeated 9 to 13 times (Position 21).
[1087] SEQ ID NO:3081: n indicates a or deletion (Position 21).
[1088] SEQ ID NO:3103: n indicates t repeated 11 to 13 times (Position 21).
[1089] SEQ ID NO:3119: n indicates acta (Position 21).
[1090] SEQ ID NO:3125: n indicates gtg or deletion (Position 21).
[1091] SEQ ID NO:3130: n indicates t repeated 11 to 12 times (Position 21).
[1092] SEQ ID NO:3140: n indicates tta or deletion (Position 21).
[1093] SEQ ID NO:3154: n indicates g (Position 21).
[1094] SEQ ID NO:3156: n indicates a (Position 21).
[1095] SEQ ID NO:3158: n indicates cct or deletion (Position 21).
[1096] SEQ ID NO:3169: n indicates gga or deletion (Position 21).
[1097] SEQ ID NO:3179: n indicates t repeated 12 to 14 times (Position 21).
[1098] SEQ ID NO:3184: n indicates t repeated 16 to 17 times (Position 21).
[1099] SEQ ID NO:3196: n indicates g (Position 21).
[1100] SEQ ID NO:3273: n indicates ag (Position 21).
[1101] SEQ ID NO:3306: n indicates g (Position 21).
[1102] SEQ ID NO:3310: n indicates c (Position 21).
[1103] SEQ ID NO:3315: n indicates ct or deletion (Position 21).
[1104] SEQ ID NO:3317: n indicates gc or deletion (Position 21).
[1105] SEQ ID NO:3352: n indicates t repeated 9 to 11 times (Position 21).
[1106] SEQ ID NO:3355: n indicates a (Position 21).
[1107] SEQ ID NO:3358: n indicates t or deletion (Position 21).
[1108] SEQ ID NO:3510 n represents at or deletion (Location 21).
[1109] SEQ ID NO:3512 n represents c or deletion (Location 21).
[1110] SEQ ID NO:3513 n represents t or deletion (Location 21).
[1111] SEQ ID NO:3514 n represents t or deletion (Location 21).
[1112] SEQ ID NO:3515 n represents g or deletion (Location 21).
[1113] SEQ ID NO:3517 n represents c or deletion (Location 21).
[1114] SEQ ID NO:3519 n represents t or deletion (Location 21).
[1115] SEQ ID NO:3521 n represents c or deletion (Location 21).
[1116] SEQ ID NO:3649 n represents 14 to 16 repeats of tca (from Location 21).
[1117] SEQ ID NO:3650 n represents 8 to 10 repeats of a (from Location 21).
[1118] SEQ ID NO:3651 n represents cacagtcat or deletion (Location 21).
[1119] SEQ ID NO3652 n represents tt or deletion (Location 21).
[1120] SEQ ID NO:3653 n represents 10 to 12 repeats of a (from Location 21).
[1121] SEQ ID NO:3654 n represents c or deletion (Location 21).
[1122] SEQ ID NO:3655 n represents 16 to 18 repeats of a (from Location 21).
[1123] SEQ ID NO:3656 n represents g or deletion (Location 21).
[1124] SEQ ID NO:3658 n represents c or deletion (Location 21).
[1125] SEQ ID NO:3659 n represents t or deletion (Location 21).
[1126] SEQ ID NO:3660 n represents a or deletion (Location 21).
[1127] SEQ ID NO:3661 n represents tg or deletion (Location 21).
[1128] SEQ ID NO:3663 n represents 10 to 13 repeats of t (from Location 21).
[1129] SEQ ID NO:3664 n represents 11 to 13 repeats of gt (from Location 21).
[1130] SEQ ID NO:3665 n represents a or deletion (Location 21).
[1131] SEQ ID NO:3666 n represents g or deletion (Location 21).
[1132] SEQ ID NO:3667 n represents g or deletion (Location 21).
[1133] SEQ ID NO:3668 n represents 9 to 11 repeats of t (from Location 21).
[1134] SEQ ID NO:3669 n represents g or deletion (Location 21).
[1135] SEQ ID NO:3671 n represents tt or deletion (Location 21).
[1136] SEQ ID NO:3672 n represents 7 to 9 repeats of a (from Location 21).
[1137] SEQ ID NO:3673 n represents 9 to 11 repeats of t (from Location 21).
[1138] SEQ ID NO:3674 n represents 9 to 10 repeats of a (from Location 21).
[1139] SEQ ID NO:3675 n represents gt or deletion (Location 21).
[1140] SEQ ID NO:3676 n represents a or deletion (Location 21).
[1141] SEQ ID NO:3677 n represents t or deletion (Location 21).
[1142] SEQ ID NO:3679 n represents a or deletion (Location 21).
[1143] SEQ ID NO:3680 n represents ct or deletion (Location 21).
[1144] SEQ ID NO:3681 n represents g or deletion (Location 21).
[1145] SEQ ID NO:3682 n represents a or deletion (Location 21).
[1146] SEQ ID NO:3683 n represents a or deletion (Location 21).
[1147] SEQ ID NO:3684 n represents a or deletion (Location 21).
[1148] SEQ ID NO:3685 n represents c or deletion (Location 21).
[1149] SEQ ID NO:3686 n represents aaag or deletion (Location 21).
[1150] SEQ ID NO:3751 n represents 22 to 26 repeats of t (from Location 21).
[1151] SEQ ID NO:3752 n represents 8 to 10 repeats of g (from Location 21).
[1152] SEQ ID NO:3753 n represents 6 to 7 repeats of c (from Location 21).
[1153] SEQ ID NO:3754 n represents 12 to 14 repeats of a (from Location 21).
[1154] SEQ ID NO:3833 n represents tt or deletion (Location 21).
[1155] SEQ ID NO:3834 n represents 9 to 11 repeats of a (from Location 21).
[1156] SEQ ID NO:3835 n represents 8 to 12 repeats of a (from Location 21).
[1157] SEQ ID NO:3836 n represents t or deletion (Location 21).
[1158] SEQ ID NO:3837 n represents t or deletion (Location 21).
[1159] SEQ ID NO:3838 n represents t or deletion (Location 21).
[1160] SEQ ID NO:3839 n represents a or deletion (Location 21).
[1161] SEQ ID NO:3840 n represents t or deletion (Location 21).
[1162] SEQ ID NO:3841 n represents t or deletion (Location 21).
[1163] SEQ ID NO:3842 n represents 11 to 15 repeats of t (from Location 21).
[1164] SEQ ID NO:3843 n represents cat or deletion (Location 21).
[1165] SEQ ID NO:3844 n represents t or deletion (Location 21).
[1166] SEQ ID NO:3845 n represents a or deletion (Location 21).
[1167] SEQ ID NO:3846 n represents a or deletion (Location 21).
[1168] SEQ ID NO:3847 n represents t or deletion (Location 21).
[1169] SEQ ID NO:3848 n represents a or deletion (Location 21).
[1170] SEQ ID NO:3857 n represents g or deletion (Location 21).
[1171] SEQ ID NO:3879 n represents a or deletion (Location 21).
[1172] SEQ ID NO:3885 n represents aaag or deletion (Location 21).
[1173] SEQ ID NO:3915 n represents t or deletion (Location 21).
[1174] SEQ ID NO:3918 n represents a or deletion (Location 21).
[1175] SEQ ID NO:3926 n represents at or deletion (Location 21).
[1176] SEQ ID NO:3933 n represents a or deletion (Location 21).
[1177] SEQ ID NO:3950 n represents c or deletion (Location 21).
[1178] SEQ ID NO:3953 n represents gg or deletion (Location 21).
[1179] SEQ ID NO:3962 n represents gtc or deletion (Location 21).
[1180] SEQ ID NO:3984 n represents t or deletion (Location 21).
[1181] SEQ ID NO:3991 n represents tt or deletion (Location 21).
[1182] SEQ ID NO:3994 n represents 9 to 12 repeats of t (from Location 21).
[1183] SEQ ID NO:3996 n represents a or deletion (Location 21).
[1184] SEQ ID NO:3998 n represents 10 to 13 repeats of a (from Location 21).
[1185] SEQ ID NO:4001 n represents ct or deletion (Location 21).
[1186] SEQ ID NO:4004 n represents cagatcttcttcagctaatttagaaatgt or deletion (Location 21).
[1187] SEQ ID NO:4030 n represents a or deletion (Location 21).
[1188] SEQ ID NO:4037 n represents c or deletion (Location 21).
[1189] SEQ ID NO:4042 n represents t or deletion (Location 21).
[1190] SEQ ID NO:4049 n represents 9 to 12 repeats of t (from Location 21).
[1191] SEQ ID NO:4052 n represents t or deletion (Location 21).
[1192] SEQ ID NO:4054 n represents g (a)4, a (a)4 or a (Location 21).
[1193] SEQ ID NO:4058 n represents t or deletion (Location 21).
[1194] SEQ ID NO:4067 n represents c or deletion (Location 21).
[1195] SEQ ID NO:4069 n represents a or deletion (Location 21).
[1196] SEQ ID NO:4070 n represents c or deletion (Location 21).
[1197] SEQ ID NO:4077 n represents g or deletion (Location 21).
[1198] SEQ ID NO:4079 n represents 18 to 20 repeats of t (from Location 21).
[1199] SEQ ID NO:4084 n represents 11 to 13 repeats of a (from Location 21).
[1200] SEQ ID NO:4085 n represents gaaa or deletion (Location 21).
[1201] SEQ ID NO:4089 n represents 10 to 12 repeats of a (from Location 21).
[1202] SEQ ID NO:4092 n represents c or deletion (Location 21).
[1203] SEQ ID NO:4102 n represents ca or deletion (Location 21).
[1204] SEQ ID NO:4109 n represents at or deletion (Location 21).
[1205] SEQ ID NO:4113 n represents ctt or deletion (Location 21).
[1206] SEQ ID NO:4115 n represents g or deletion (Location 21).
[1207] SEQ ID NO:4117 n represents ggggct or deletion (Location 21).
[1208] SEQ ID NO:4121 n represents 19 to 22 repeats of t (from Location 21).
[1209] SEQ ID NO:4126 n represents 6 to 7 repeats of t (from Location 21).
[1210] SEQ ID NO:4129 n represents 11 to 13 repeats of t (from Location 21).
[1211] SEQ ID NO:4173 n represents 7 to 8 repeats of c (from Location 21).
[1212] SEQ ID NO:4175 n represents 10 to 12 repeats of a (from Location 21).
[1213] SEQ ID NO:4183 n represents c or deletion (Location 21).
[1214] SEQ ID NO:4188 n represents aaga or deletion (Location 21).
[1215] SEQ ID NO:4190 n represents 9 to 11 repeats of a (from Location 21).
[1216] SEQ ID NO:4193 n represents ct or deletion (Location 21).
[1217] SEQ ID NO:4198 n represents 8 to 9 repeats of t (from Location 21).
[1218] SEQ ID NO:4218 n represents g or deletion (Location 21).
[1219] SEQ ID NO:4224 n represents cttt or deletion (Location 21).
[1220] SEQ ID NO:4229 n represents t or deletion (Location 21).
[1221] SEQ ID NO:4234 n represents c or deletion (Location 21).
[1222] SEQ ID NO:4235 n represents a or deletion (Location 21).
[1223] SEQ ID NO:4238 n represents gtt or deletion (Location 21).
[1224] SEQ ID NO:4239 n represents t or deletion (Location 21).
[1225] SEQ ID NO:4259 n represents at or deletion (Location 21).
[1226] SEQ ID NO:4273 n represents g or deletion (Location 21).
[1227] SEQ ID NO:4280 n represents 15 to 17 repeats of a (from Location 21).
[1228] SEQ ID NO:4294 n represents t or deletion (Location 21).
[1229] SEQ ID NO:4298 n represents t or deletion (Location 21).
[1230] SEQ ID NO:4310 n represents t or deletion (Location 21).
[1231] SEQ ID NO:4314 n represents a or deletion (Location 21).
[1232] SEQ ID NO:4315 n represents 13 to 15 repeats of t (from Location 21).
[1233] SEQ ID NO:4316 n represents 12 to 13 repeats of a (from Location 21).
[1234] SEQ ID NO:4317 n represents t or deletion (Location 21).
[1235] SEQ ID NO:4319 n represents t or deletion (Location 21).
[1236] SEQ ID NO:4320 n represents 13 to 15 repeats of a (from Location 21).
[1237] SEQ ID NO:4325 n represents a or deletion (Location 21).
[1238] SEQ ID NO:4331 n represents 5 to 11 repeats of t (from Location 21).
[1239] SEQ ID NO:4333 n represents 8 to 9 repeats of t (from Location 21).
[1240] SEQ ID NO:4334 n represents t or deletion (Location 21).
[1241] SEQ ID NO:4345 n represents 9 to 10 repeats of t (from Location 21).
[1242] SEQ ID NO:4348 n represents 10 to 11 repeats of a (from Location 21).
[1243] SEQ ID NO:4354 n represents a or deletion (Location 21).
[1244] SEQ ID NO:4361 n represents a or deletion (Location 21).
[1245] SEQ ID NO:4372 n represents ct or deletion (Location 21).
[1246] SEQ ID NO:4391 n represents t or deletion (Location 21).
[1247] SEQ ID NO:4397 n represents a or deletion (Location 21).
[1248] SEQ ID NO:4398 n represents at or deletion (Location 21).
[1249] SEQ ID NO:4408 n represents tgtccaaaggaaggacacg or deletion (Location 21).
[1250] SEQ ID NO:4414 n represents 6 to 8 repeats of tc (from Location 21).
[1251] SEQ ID NO:4416 n represents c or deletion (Location 21).
[1252] SEQ ID NO:4419 n represents t or deletion (Location 21).
[1253] SEQ ID NO:4424 n represents t or deletion (Location 21).
[1254] SEQ ID NO:4425 n represents c or deletion (Location 21).
[1255] SEQ ID NO:4433 n represents a or deletion (Location 21).
[1256] SEQ ID NO:4435 n represents t or deletion (Location 21).
[1257] SEQ ID NO:4442 n represents 6 to 7 repeats of gatt (from Location 21).
[1258] SEQ ID NO:4443 n represents t or deletion (Location 21).
[1259] SEQ ID NO:4448 n represents t or deletion (Location 21).
[1260] SEQ ID NO:4449 n represents gt or deletion (Location 21).
[1261] SEQ ID NO:4452 n represents a or deletion (Location 21).
[1262] SEQ ID NO:4453 n represents a or deletion (Location 21).
[1263] SEQ ID NO:4457 n represents t or deletion (Location 21).
[1264] SEQ ID NO:4460 n represents at or deletion (Location 21).
[1265] SEQ ID NO:4466 n represents a or deletion (Location 21).
[1266] SEQ ID NO:4469 n represents t or deletion (Location 21).
[1267] SEQ ID NO:4472 n represents at or deletion (Location 21).
[1268] SEQ ID NO:4473 n represents a or deletion (Location 21).
[1269] SEQ ID NO:4474 n represents 12 to 14 repeats of t (from Location 21).
[1270] SEQ ID NO:4477 n represents t or deletion (Location 21).
[1271] SEQ ID NO:4479 n represents cac or deletion (Location 21).
[1272] SEQ ID NO:4486 n represents cca or deletion (Location 21).
[1273] SEQ ID NO:4514 n represents t or deletion (Location 21).
[1274] SEQ ID NO:4544 n represents c or deletion (Location 21).
[1275] SEQ ID NO:4552 n represents aaaa or deletion (Location 21).
[1276] SEQ ID NO:4565 n represents c or deletion (Location 21).
[1277] SEQ ID NO:4575 n represents 8 to 9 repeats of t (from Location 21).
[1278] SEQ ID NO:4576 n represents a or deletion (Location 21).
[1279] SEQ ID NO:4588 n represents taac or deletion (Location 21).
[1280] SEQ ID NO:4589 n represents ctcttt or deletion (Location 21).
[1281] SEQ ID NO:4590 n represents ct or deletion (Location 21).
[1282] SEQ ID NO:4597 n represents a or deletion (Location 21).
[1283] SEQ ID NO:4600 n represents t or deletion (Location 21).
[1284] SEQ ID NO:4603 n represents g or deletion (Location 21).
[1285] SEQ ID NO:4606 n represents aattagaa or deletion (Location 21).
[1286] SEQ ID NO:4607 n represents tttaaaa or ttttaa (Location 21).
[1287] SEQ ID NO:4610 n represents t or deletion (Location 21).
[1288] SEQ ID NO:4615 n represents t or deletion (Location 21).
[1289] SEQ ID NO:4627 n represents c or deletion (Location 21).
[1290] SEQ ID NO:4652 n represents 11 to 14 repeats of t (from Location 21).
[1291] SEQ ID NO:4653 n represents t or deletion (Location 21).
[1292] SEQ ID NO:4654 n represents 10 to 13 repeats of t (from Location 21).
[1293] SEQ ID NO:4655 n represents t or deletion (Location 21).
[1294] SEQ ID NO:4657 n represents t or deletion (Location 21).
[1295] SEQ ID NO:4658 n represents ta or deletion (Location 21).
[1296] SEQ ID NO:4660 n represents 13 to 15 repeats of t (from Location 21).
[1297] SEQ ID NO:4661 n represents c or deletion (Location 21).
[1298] SEQ ID NO:4662 n represents 17 to 20 repeats of a (from Location 21).
[1299] SEQ ID NO:4663 n represents 13 to 13 repeats of t (from Location 21).
[1300] SEQ ID NO:4664 n represents 8 to 9 repeats of t (from Location 21).
[1301] SEQ ID NO:4665 n represents 10 to 11 repeats of a (from Location 21).
[1302] SEQ ID NO:4666 n represents 16 to 19 repeats of a (from Location 21).
[1303] SEQ ID NO:4758 n represents g or deletion (Location 21).
[1304] SEQ ID NO:4760 n represents 6 to 7 repeats of a (from Location 21).
[1305] SEQ ID NO:4761 n represents c or deletion (Location 21).
[1306] SEQ ID NO:4763 n represents tcctcaggg or deletion (Location 21).
[1307] SEQ ID NO:4764 n represents 8 to 10 repeats of cgc (from Location 21).
[1308] SEQ ID NO:4765 n represents 10 to 12 repeats of a (from Location 21).
[1309] SEQ ID NO:4766 n represents caccaggcagcagactctgatgaggaggggaggggg or deletion (Location 21).
[1310] SEQ ID NO:4768 n represents g or deletion (Location 21).
[1311] SEQ ID NO:4808 n represents tcac or deletion (Location 21).
[1312] SEQ ID NO:4809 n represents t or deletion (Location 21).
[1313] SEQ ID NO:4810 n represents 9 to 11 repeats of t (from Location 21).
[1314] SEQ ID NO:4811 n represents 7 to 8 repeats of a (from Location 21).
[1315] SEQ ID NO:4847 n represents agg or deletion (Location 21).
[1316] SEQ ID NO:4848 n represents taacatt or deletion (Location 21).
[1317] SEQ ID NO:4849 n represents 10 to 12 repeats of a (from Location 21).
[1318] SEQ ID NO:4850 n represents 15 to 17 repeats of t (from Location 21).
[1319] SEQ ID NO:4851 n represents 11 to 13 repeats of a (from Location 21).
[1320] SEQ ID NO:4877 n represents 11 to 13 repeats of t (from Location 21).
[1321] SEQ ID NO:4878 n represents t or deletion (Location 21).
[1322] SEQ ID NO:4879 n represents t or deletion (Location 21).
[1323] SEQ ID NO:4880 n represents 10 to 12 repeats of a (from Location 21).
[1324] SEQ ID NO:4881 n represents t or deletion (Location 21)
[1325] SEQ ID NO:4883 n represents 7 to 9 repeats of c (from Location 21).
[1326] SEQ ID NO:4884 n represents a or deletion (Location 21)
[1327] SEQ ID NO:4891 n represents 13 to 16 repeats of t (from Location 21).
[1328] SEQ ID NO:4892 n represents 9 to 10 repeats of t (from Location 21).
[1329] SEQ ID NO:4893 n represents 14 to 16 repeats of t (from Location 21).
[1330] SEQ ID NO:4894 n represents 13 to 17 repeats of t (from Location 21).
[1331] SEQ ID NO:4895 n represents t or deletion (Location 21).
[1332] SEQ ID NO:4897 n represents 8 to 9 repeats of a (from Location 21).
[1333] SEQ ID NO:4898 n represents 8 to 9 repeats of t (from Location 21).
[1334] SEQ ID NO:4899 n represents gcagtattactgtagt or deletion (Location 21).
[1335] SEQ ID NO:4900 n represents 13 to 14 repeats of t (from Location 21).
[1336] SEQ ID NO:4901 n represents 9 to 10 repeats of t (from Location 21).
[1337] SEQ ID NO:4902 n represents 10 to 11 repeats of t (from Location 21).
[1338] SEQ ID NO:4907 n represents 10 to 14 repeats of a (from Location 21).
[1339] SEQ ID NO:4908 n represents 13 to 15 repeats of a (from Location 21).
[1340] SEQ ID NO:4909 n represents a or deletion (Location 21).
[1341] SEQ ID NO:4910 n represents t or deletion (Location 21).
[1342] SEQ ID NO:4918 n represents 13 to 15 repeats of a (from Location 21).
[1343] SEQ ID NO:4919 n represents 12 to 15 repeats of a (from Location 21).
[1344] SEQ ID NO:4936 n represents g or deletion (Location 21).
[1345] SEQ ID NO:4938 n represents aa or deletion (Location 21).
[1346] SEQ ID NO:4983 n represents a or deletion (Location 21).
[1347] SEQ ID NO:4985 n represents aa or deletion (Location 21).
[1348] SEQ ID NO:4986 n represents ca or deletion (Location 21).
[1349] SEQ ID NO:4987 n represents t or deletion (Location 21).
[1350] SEQ ID NO:4988 n represents tgtgtg or deletion (Location 21).
[1351] SEQ ID NO:5076 n represents a or deletion (Location 21).
[1352] SEQ ID NO:5078 n represents g or deletion (Location 21).
[1353] SEQ ID NO:5080 n represents actt or deletion (Location 21).
[1354] SEQ ID NO:5081 n represents ttta or deletion (Location 21).
[1355] SEQ ID NO:5082 n represents 11 to 13 repeats of a (from Location 21).
[1356] SEQ ID NO:5083 n represents 8 to 10 repeats of t (from Location 21).
[1357] SEQ ID NO:5084 n represents 12 to 14 repeats of a (from Location 21).
[1358] SEQ ID NO:5085 n represents cttgta or deletion (Location 21).
[1359] SEQ ID NO:5086 n represents 9 to 10 repeats of a (from Location 21).
[1360] SEQ ID NO:5087 n represents ctt or deletion (Location 21).
[1361] SEQ ID NO:5088 n represents ctt or deletion (Location 21).
[1362] SEQ ID NO:5090 n represents a or deletion (Location 21).
[1363] SEQ ID NO:5091 n represents 9 to 11 repeats of a (from Location 21)
[1364] SEQ ID NO:5092 n represents tgt or deletion (Location 21).
[1365] SEQ ID NO:5093 n represents 24 to 27 repeats of a (from Location 21)
[1366] SEQ ID NO:5094 n represents 10 to 21 repeats of ta (from Location 21)
[1367] SEQ ID NO:5095 n represents 8 to 10 repeats of a (from Location 21)
[1368] SEQ ID NO:5096 n represents 11 to 13 repeats of a (from Location 21)
[1369] SEQ ID NO:5097 n represents 8 to 10 repeats of a (from Location 21)
[1370] SEQ ID NO:5155 n represents ctat or deletion (Location 21).
[1371] SEQ ID NO:5156 n represents atattcacttggtatctg or deletion (Location 21).
[1372] SEQ ID NO:5157 n represents ttta or deletion (Location 21).
[1373] SEQ ID NO:5158 n represents t or deletion (Location 21).
[1374] SEQ ID NO:5160 n represents g or deletion (Location 21).
[1375] SEQ ID NO:5161 n represents a or deletion (Location 21).
[1376] SEQ ID NO:5162 n represents 9 to 11 repeats of a (from Location 21).
[1377] SEQ ID NO:5163 n represents g or deletion (Location 21).
[1378] SEQ ID NO:5164 n represents 4 to 5 repeats of at (from Location 21).
[1379] SEQ ID NO:5165 n represents 7 to 8 repeats of t (from Location 21).
[1380] SEQ ID NO:5166 n represents 19 to 23 repeats of t (from Location 21).
[1381] SEQ ID NO:5167 n represents t or deletion (Location 21).
[1382] SEQ ID NO:5168 n represents tgat or deletion (Location 21).
[1383] SEQ ID NO:5169 n represents 8 to 10 repeats of t (from Location 21).
[1384] SEQ ID NO:5170 n represents a or deletion (Location 21).
[1385] SEQ ID NO:5187 n represents gtg or deletion (Location 21).
[1386] SEQ ID NO:5189 n represents gg or tggtggggtgga (Location 21).
[1387] SEQ ID NO:5209 n represents acaaca or deletion (Location 21).
[1388] SEQ ID NO:5210 n represents 11 to 13 repeats of t (from Location 21).
[1389] SEQ ID NO:5212 n represents 15 to 18 repeats of ac (from Location 21).
[1390] SEQ ID NO:5218 n represents 18 to 26 repeats of t (from Location 21).
[1391] SEQ ID NO:5227 n represents tc or deletion (Location 21).
[1392] SEQ ID NO:5231 n represents 16 to 18 repeats of t (from Location 21).
[1393] SEQ ID NO:5246 n represents 18 to 20 repeats of t (from Location 21).
[1394] SEQ ID NO:5247 n represents tggtaagt or deletion (Location 21).
[1395] SEQ ID NO:5249 n represents t or deletion (Location 21).
[1396] SEQ ID NO:5255 n represents g or deletion (Location 21).
[1397] SEQ ID NO:5256 n represents g or deletion (Location 21).
[1398] SEQ ID NO:5257 n represents c or deletion (Location 21).
[1399] SEQ ID NO:5258 n represents ctct or deletion (Location 21).
[1400] SEQ ID NO:5261 n represents a or deletion (Location 21).
[1401] SEQ ID NO:5264 n represents t or deletion (Location 21).
[1402] SEQ ID NO:5271 n represents 14 to 17 repeats of t (from Location 21).
[1403] SEQ ID NO:5276 n represents 12 to 15 repeats of t (from Location 21).
[1404] SEQ ID NO:5277 n represents 10 to 13 repeats of a (from Location 21).
[1405] SEQ ID NO:5278 n represents 25 to 27 repeats of a (from Location 21).
[1406] SEQ ID NO:5299 n represents c or deletion (Location 21).
[1407] SEQ ID NO:5308 n represents 20 to 24 repeats of t (from Location 21).
[1408] SEQ ID NO:5311 n represents t or deletion (Location 21).
[1409] SEQ ID NO:5312 n represents t or deletion (Location 21).
[1410] SEQ ID NO:5314 n represents g or deletion (Location 21).
[1411] SEQ ID NO:5320 n represents 18 to 23 repeats of t (from Location 21).
[1412] SEQ ID NO:5340 n represents c or deletion (Location 21).
[1413] SEQ ID NO:5400 n represents a or deletion (Location 21).
[1414] SEQ ID NO:5404 n represents a or deletion (Location 21).
[1415] SEQ ID NO:5407 n represents tt or deletion (Location 21).
[1416] SEQ ID NO:5410 n represents at or deletion (Location 21).
[1417] SEQ ID NO:5436 n represents tgt or deletion (Location 21).
[1418] SEQ ID NO:5445 n represents t or deletion (Location 21).
[1419] SEQ ID NO:5550 n represents t or deletion (Location 21).
[1420] SEQ ID NO:5556 n represents g or deletion (Location 21).
[1421] SEQ ID NO:5557 n represents 11 to 13 repeats of t (from Location 21).
[1422] SEQ ID NO:5559 n represents a or deletion (Location 21).
[1423] SEQ ID NO:5561 n represents 9 to 11 repeats of t (from Location 21).
[1424] SEQ ID NO:5564 n represents t or deletion (Location 21).
[1425] SEQ ID NO:5566 n represents t or deletion (Location 21).
[1426] SEQ ID NO:5570 n represents t or deletion (Location 21).
[1427] SEQ ID NO:5575 n represents aaga or deletion (Location 21).
[1428] SEQ ID NO:5579 n represents aaaa or deletion (Location 21).
[1429] SEQ ID NO:5583 n represents 9 to 11 repeats of t (from Location 21).
[1430] SEQ ID NO:5591 n represents a or deletion (Location 21).
[1431] SEQ ID NO:5614 n represents 11 to 13 repeats of t (from Location 21).
[1432] SEQ ID NO:5630 n represents acta or deletion (Location 21).
[1433] SEQ ID NO:5636 n represents gtg or deletion (Location 21).
[1434] SEQ ID NO:5641 n represents 11 to 12 repeats of t (from Location 21).
[1435] SEQ ID NO:5651 n represents tta or deletion (Location 21).
[1436] SEQ ID NO:5665 n represents g or deletion (Location 21).
[1437] SEQ ID NO:5667 n represents a or deletion (Location 21).
[1438] SEQ ID NO:5669 n represents cct or deletion (Location 21).
[1439] SEQ ID NO:5680 n represents gga or deletion (Location 21).
[1440] SEQ ID NO:5690 n represents 12 to 14 repeats of t (from Location 21).
[1441] SEQ ID NO:5695 n represents 16 to 17 repeats of t (from Location 21).
[1442] SEQ ID NO:5707 n represents g or deletion (Location 21).
[1443] SEQ ID NO:5740 n represents c or deletion (Location 21).
[1444] SEQ ID NO:5800 n represents ag or deletion (Location 21).
[1445] SEQ ID NO:5806 n represents g or deletion (Location 21).
[1446] SEQ ID NO:5807 n represents a or deletion (Location 21).
[1447] SEQ ID NO:5835 n represents g or deletion (Location 21).
[1448] SEQ ID NO:5839 n represents c or deletion (Location 21).
[1449] SEQ ID NO:5844 n represents ct or deletion (Location 21).
[1450] SEQ ID NO:5846 n represents gc or deletion (Location 21).
[1451] SEQ ID NO:5849 n represents c or deletion (Location 21).
[1452] SEQ ID NO:5884 n represents c or deletion (Location 21).
[1453] SEQ ID NO:5890 n represents tc or deletion (Location 21).
[1454] SEQ ID NO:5902 n represents c or deletion (Location 21).
[1455] SEQ ID NO:5904 n represents g or deletion (Location 21).
[1456] SEQ ID NO:5917 n represents a or deletion (Location 21).
[1457] SEQ ID NO:5921 n represents ca or deletion (Location 21).
[1458] SEQ ID NO:5922 n represents t or deletion (Location 21).
[1459] SEQ ID NO:5934 n represents ct or deletion (Location 21).
[1460] SEQ ID NO:5965 n represents a or deletion (Location 21).
[1461] SEQ ID NO:5980 n represents t or deletion (Location 21).
[1462] SEQ ID NO:5981 n represents t or deletion (Location 21).
[1463] SEQ ID NO:5981 n represents 11 to 13 repeats of t (from Location 21).
[1464] SEQ ID NO:5987 n represents t or deletion (Location 21).
[1465] SEQ ID NO:5989 n represents 16 to 8 repeats of t (from Location 21).
[1466] SEQ ID NO:5991 n represents ctta or deletion (Location 21).
[1467] SEQ ID NO:5992 n represents c or deletion (Location 21).
[1468] SEQ ID NO:5994 n represents 10 to 12 repeats of a (from Location 21).
[1469] SEQ ID NO:5995 n represents gt or deletion (Location 21).
[1470] SEQ ID NO:5996 n represents a or deletion (Location 21).
[1471] SEQ ID NO:6001 n represents aatt or deletion (Location 21).
[1472] SEQ ID NO:6003 n represents t or deletion (Location 21).
[1473] SEQ ID NO:6009 n represents g or deletion (Location 21).
[1474] SEQ ID NO:6021 n represents at or deletion (Location 21).
[1475] SEQ ID NO:6027 n represents 4 to 5 repeats of caaaa (from Location 21).
[1476] SEQ ID NO:6036 n represents 9 to 10 repeats of a (from Location 21).
[1477] SEQ ID NO:6041 n represents a or deletion (Location 21).
[1478] SEQ ID NO:6047 n represents t or deletion (Location 21).
[1479] SEQ ID NO:6051 n represents t or deletion (Location 21).
[1480] SEQ ID NO:6052 n represents g or deletion (Location 21).
[1481] SEQ ID NO:6060 n represents t or deletion (Location 21).
[1482] SEQ ID NO:6061 n represents t or deletion (Location 21).
[1483] SEQ ID NO:6062 n represents a or deletion (Location 21).
[1484] SEQ ID NO:6072 n represents gaa or deletion (Location 21).
[1485] SEQ ID NO:6073 n represents ag or deletion (Location 21).
[1486] SEQ ID NO:6089 n represents 9 to 11 repeats of t (from Location 21).
[1487] SEQ ID NO:6090 n represents a or deletion (Location 21).
[1488] SEQ ID NO:6091 n represents t or deletion (Location 21).
[1489] SEQ ID NO:6173 n represents tat or deletion (Location 21).
[1490] SEQ ID NO:6174 n represents 14 to 17 repeats of ac (from Location 21).
[1491] SEQ ID NO:6175 n represents 16 to 27 repeats of a (from Location 21).
[1492] SEQ ID NO:6176 n represents t or deletion (Location 21).
[1493] SEQ ID NO:6177 n represents 8 to 10 repeats of a (from Location 21).
[1494] SEQ ID NO:6178 n represents 9 to 11 repeats of gt (from Location 21).
[1495] SEQ ID NO:6179 n represents aa or deletion (Location 21).
[1496] SEQ ID NO:6180 n represents t or deletion (Location 21).
[1497] SEQ ID NO:6181 n represents 8 to 12 repeats of ac (from Location 21).
[1498] SEQ ID NO:6182 n represents a or deletion (Location 21).
[1499] SEQ ID NO:6202 n represents agg or deletion (Location 21).
[1500] SEQ ID NO:6204 n represents 11 to 15 repeats of a (from Location 21).
[1501] SEQ ID NO:6205 n represents 11 to 14 repeats of a (from Location 21).
[1502] SEQ ID NO:6208 n represents gt or deletion (Location 21).
[1503] SEQ ID NO:6224 n represents ta or deletion (Location 21).
[1504] SEQ ID NO:6307 n represents 16 to 19 repeats of a (from Location 21).
[1505] SEQ ID NO:6308 n represents aa or deletion (Location 21).
[1506] SEQ ID NO:6310 n represents t or deletion (Location 21).
[1507] SEQ ID NO:6311 n represents 10 to 12 repeats of t (from Location 21).
[1508] SEQ ID NO:6312 n represents aa or deletion (Location 21).
[1509] SEQ ID NO:6313 n represents ttgacagtccaatat, ttgaca, gtccaatat or deletion (Location 21).
[1510] SEQ ID NO:6314 n represents cta or deletion (Location 21).
[1511] SEQ ID NO:6315 n represents a or deletion (Location 21).
[1512] SEQ ID NO:6317 n represents 9 to 11 repeats of t (From Location 21).
[1513] SEQ ID NO:6318 n represents c or deletion (Location 21).
[1514] SEQ ID NO:6320 n represents gagatgttgtggctcacat or deletion (Location 21).
[1515] SEQ ID NO:6322 n represents cc or deletion (Location 21).
[1516] SEQ ID NO:6323 n represents act or deletion (Location 21).
[1517] SEQ ID NO:6405 n represents a or deletion (Location 21).
[1518] SEQ ID NO:6415 n represents 8 to 11 repeats of t (from Location 21).
[1519] SEQ ID NO:6416 n represents 10 to 13 repeats of t (from Location 21).
[1520] SEQ ID NO:6472 n represents g or deletion (Location 21).
[1521] SEQ ID NO:6473 n represents c or deletion (Location 21).
[1522] SEQ ID NO:6554 n represents t or deletion (Location 21).
[1523] SEQ ID NO:6555 n represents 12 to 15 repeats of t (from Location 21).
[1524] SEQ ID NO:6609 n represents a or deletion (Location 21).
[1525] SEQ ID NO:6610 n represents at or deletion (Location 21).
[1526] SEQ ID NO:6725 n represents 16 repeats of cctgc or 16 repeats of cctgt (from Location 21).
[1527] SEQ ID NO:6726 n represents t or deletion (Location 21).
[1528] SEQ ID NO:6728 n represents c or deletion (Location 21).
[1529] SEQ ID NO:6739 n represents acac or deletion (Location 21).
[1530] SEQ ID NO:6748 n represents gatttgtggtatccag or deletion (Location 21).
[1531] SEQ ID NO:6750 n represents ag or deletion (Location 21).
[1532] SEQ ID NO:6751 n represents ta or deletion (Location 21).
[1533] SEQ ID NO:6757 n represents t or deletion (Location 21).
[1534] SEQ ID NO:6759 n represents 12 to 14 repeats of gt from Location 21).
[1535] SEQ ID NO:6771 n represents cagaggct or deletion (Location 21).
[1536] SEQ ID NO:6772 n represents ct or deletion (Location 21).
[1537] SEQ ID NO:6773 n represents ag or deletion (Location 21).
[1538] SEQ ID NO:6785 n represents gtaaa or deletion (Location 21).
[1539] SEQ ID NO:6786 n represents aaaaa or deletion (Location 21).
[1540] SEQ ID NO:6787 n represents a or deletion (Location 21).
[1541] SEQ ID NO:6828 n represents tc or deletion (Location 21).
[1542] SEQ ID NO:6830 n represents t or deletion (Location 21).
[1543] SEQ ID NO:6831 n represents t or deletion (Location 21).
[1544] SEQ ID NO:6832 n represents gaagaaactgttgacagttt or deletion (Location 21).
[1545] SEQ ID NO:6833 n represents cct or deletion (Location 21).
[1546] SEQ ID NO:6834 n represents tttc or deletion (Location 21).
[1547] SEQ ID NO:6835 n represents ttcttttaaaattg or deletion (Location 21).
[1548] SEQ ID NO:6837 n represents ttcaggccttt or deletion (Location 21).
[1549] SEQ ID NO:6839 n represents ggcctg or deletion (Location 21).
[1550] SEQ ID NO:6841 n represents a or deletion (Location 21).
[1551] SEQ ID NO:6870 n represents 9 to 11 repeats of c (from Location 21).
[1552] SEQ ID NO:6871 n represents 15 to 21 repeats of a (from Location 21).
[1553] SEQ ID NO:6872 n represents ggggtggcggggtggg or deletion (Location 21).
[1554] SEQ ID NO:6873 n represents t or deletion (Location 21).
[1555] SEQ ID NO:6874 n represents a or deletion (Location 21).
[1556] SEQ ID NO:6876 n represents a or deletion (Location 21).
[1557] SEQ ID NO:6877 n represents 10 to 12 repeats of t (from Location 21).
[1558] SEQ ID NO:6878 n represents tt or deletion (Location 21).
[1559] SEQ ID NO:6880 n represents tccctccttgaagctgatcgt or deletion (Location 21).
[1560] SEQ ID NO:6881 n represents 12 to 18 repeats of ca (from Location 21).
[1561] SEQ ID NO:6894 n represents gtt or deletion (Location 21).
[1562] SEQ ID NO:6897 n represents ga or deletion (Location 21).
[1563] SEQ ID NO:6921 n represents t or deletion (Location 21).
[1564] SEQ ID NO:6940 n represents t or deletion (Location 21).
[1565] SEQ ID NO:6941 n represents t or deletion (Location 21).
[1566] SEQ ID NO:6942 n represents t or deletion (Location 21).
[1567] SEQ ID NO:6965 n represents at or deletion (Location 21).
[1568] SEQ ID NO:6966 n represents a or deletion (Location 21).
[1569] SEQ ID NO:6967 n represents c or deletion (Location 21).
[1570] SEQ ID NO:6997 n represents c or deletion (Location 21).
[1571] SEQ ID NO:7005 n represents t or deletion (Location 21).
[1572] SEQ ID NO:7006 n represents ttc or deletion (Location 21).
[1573] SEQ ID NO:7017 n represents ctt or deletion (Location 21).
[1574] SEQ ID NO:7049 n represents 8 to 9 repeats of a (from Location 21).
[1575] SEQ ID NO:7053 n represents 10 to 12 repeats of t (from Location 21).
[1576] SEQ ID NO:7059 n represents 22 to 25 repeats of t (from Location 21).
[1577] SEQ ID NO:7070 n represents t or deletion (Location 21).
[1578] SEQ ID NO:7073 n represents a or deletion (Location 21).
[1579] SEQ ID NO:7074 n represents a or deletion (Location 21).
[1580] SEQ ID NO:7076 n represents c or deletion (Location 21).
[1581] SEQ ID NO:7077 n represents 10 to 12 repeats of t (from Location 21).
[1582] SEQ ID NO:7078 n represents a or deletion (Location 21).
[1583] SEQ ID NO:7079 n represents 9 to 11 repeats of t (from Location 21).
[1584] SEQ ID NO:7082 n represents a or deletion (Location 21).
[1585] SEQ ID NO:7085 n represents t or deletion (Location 21).
[1586] SEQ ID NO:7089 n represents a or deletion (Location 21).
[1587] SEQ ID NO:7101 n represents a or deletion (Location 21).
[1588] SEQ ID NO:7105 n represents a or deletion (Location 21).
[1589] SEQ ID NO:7114 n represents 9 to 10 repeats of t (from Location 21).
[1590] SEQ ID NO:7115 n represents aag or deletion (Location 21).
[1591] SEQ ID NO:7117 n represents t or deletion (Location 21).
[1592] SEQ ID NO:7118 n represents t or deletion (Location 21).
[1593] SEQ ID NO:7120 n represents t or deletion (Location 21).
[1594] SEQ ID NO:7121 n represents t or deletion (Location 21).
[1595] SEQ ID NO:7123 n represents t or deletion (Location 21).
[1596] SEQ ID NO:7125 n represents a or deletion (Location 21).
[1597] SEQ ID NO:7127 n represents a or deletion (Location 21).
[1598] SEQ ID NO:7134 n represents 7 to 8 repeats of gt (from Location 21).
[1599] SEQ ID NO:7146 n represents cat or deletion (Location 21).
[1600] SEQ ID NO:7148 n represents tc or deletion (Location 21).
[1601] SEQ ID NO:7164 n represents ca or deletion (Location 21).
[1602] SEQ ID NO:7186 n represents g or deletion (Location 21).
[1603] SEQ ID NO:7209 n represents t or deletion (Location 21).
[1604] SEQ ID NO:7238 n represents gccag or deletion (Location 21).
[1605] SEQ ID NO:7278 n represents a or deletion (Location 21).
[1606] SEQ ID NO:7281 n represents g or deletion (Location 21).
[1607] SEQ ID NO:7282 n represents t or deletion (Location 21).
[1608] SEQ ID NO:7287 n represents aaa or deletion (Location 21).
[1609] SEQ ID NO:7288 n represents a or deletion (Location 21).
[1610] SEQ ID NO:7299 n represents c or deletion (Location 21).
[1611] SEQ ID NO:7329 n represents 17 to 19 repeats of a (from Location 21).
[1612] SEQ ID NO:7332 n represents 16 to 18 repeats of a (from Location 21).
[1613] SEQ ID NO:7333 n represents 4 to 6 repeats of ga (from Location 21).
[1614] SEQ ID NO:7346 n represents a or deletion (Location 21).
[1615] SEQ ID NO:7375 n represents 2 to 3 repeats of tc (from Location 21).
[1616] SEQ ID NO:7381 n represents 6 to 7 repeats of a (from Location 21).
[1617] SEQ ID NO:7383 n represents 13 to 15 repeats of a (from Location 21).
[1618] SEQ ID NO:7385 n represents 9 to 10 repeats of t (from Location 21).
[1619] SEQ ID NO:7387 n represents 12 to 14 repeats of a (from Location 21).
[1620] SEQ ID NO:7389 n represents 14 to 17 repeats of t (from Location 21).
[1621] SEQ ID NO:7390 n represents 8 to 9 repeats of a (from Location 21).
[1622] SEQ ID NO:7397 n represents g or deletion (Location 21).
[1623] SEQ ID NO:7417 n represents 14 to 17 repeats of t (from Location 21).
[1624] SEQ ID NO:7421 n represents 7 to 9 repeats of g (from Location 21).
[1625] SEQ ID NO:7426 n represents 9 to 10 repeats of a (from Location 21).
[1626] SEQ ID NO:7434 n represents 9 to 10 repeats of a (from Location 21).
[1627] SEQ ID NO:7436 n represents 6 to 7 repeats of g (from Location 21).
[1628] SEQ ID NO:7443 n represents g or dele t ion (Location 21).
[1629] SEQ ID NO:7458 n represents 8 to 9 repeats of a (from Location 21).
[1630] SEQ ID NO:7461 n represents 4 to 6 repeats of c (from Location 21).
[1631] SEQ ID NO:7483 n represents ggcgaaggcggcggc or deletion (Location 21).
[1632] SEQ ID NO:7485 n represents ata or deletion (Location 21).
[1633] SEQ ID NO:7488 n represents 11 to 12 repeats of t (from Location 21).
[1634] SEQ ID NO:7489 n represents 12 to 14 repeats of t (from Location 21).
[1635] SEQ ID NO:7493 n represents 9 to 10 repeats of t (from Location 21).
[1636] SEQ ID NO:7495 n represents 6 to 7 repeats of ta (from Location 21).
[1637] SEQ ID NO:7497 n represents tgtatacgtatacatacgtatacatatatacatacgtatata or deletion (Location 21).
[1638] SEQ ID NO:7503 n represents attt or deletion (Location 21).
[1639] SEQ ID NO:7510 n represents cct or deletion (Location 21).
[1640] SEQ ID NO:7519 n represents tgtt or deletion (Location 21).
[1641] SEQ ID NO:7520 n represents a or deletion (Location 21).
[1642] SEQ ID NO:7531 n represents 9 to 10 repeats of t (from Location 21).
[1643] SEQ ID NO:7538 n represents a or deletion (Location 21).
[1644] SEQ ID NO:7566 n represents a or deletion (Location 21).
[1645] SEQ ID NO:7615 n represents a or deletion (Location 21).
[1646] SEQ ID NO:7649 n represents gtg or deletion (Location 21).
[1647] SEQ ID NO:7651 n represents gg or tggtggggtgga (Location 21).
[1648] SEQ ID NO:7667 n represents ct or deletion (Location 21).
[1649] All publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the relevant fields are intended to be within the scope of the following claims.
Claims
1. A method of identifying individuals having a polymorphism, comprising;
- a. providing nucleic acid from a subject; and
- b. detecting the presence of at least one polymorphism in said nucleic acid, said at least one polymorphism selected from the group consisting of polymorphisms found in SEQ ID Nos:1-3360 and 3361-7669.
2. The method of claim 1, further comprising step c) providing a prognosis to said subject based on the presence or absence of said at least one polymorphism.
3. The method of claim 2, wherein said prognosis comprises a genotype relative risk.
4. The method of claim 2, wherein said prognosis comprises a population attributable risk.
5. The method of claim 1, wherein said detecting step comprises use of a hybridization assay.
6. The method of claim 1, wherein said detecting step comprises use of a TAQMAN assay.
7. The method of claim 1, wherein said detecting step comprises use of an invasive cleavage assay.
8. The method of claim 1, wherein said detecting step comprises use of mass spectroscopy.
9. The method of claim 1, wherein said detecting step comprises use of a microarray.
10. The method of claim 1, wherein said detecting step comprises use of a polymerase chain reaction.
11. The method of claim 1, wherein said detecting step comprises use of a rolling circle extension assay.
12. The method of claim 1, wherein said detecting step comprises use of a sequencing assay.
13. The method of claim 1, wherein said detecting step comprises use of a hybridization assay employing a probe complementary to a polymorphism.
14. The method of claim 1, wherein said detecting step comprises use of a bead array assay.
15. The method of claim 1, wherein said detecting step comprises use of a primer extension assay.
16. The method of claim 1, wherein said detecting step comprises use of an enzyme mismatch cleavage assay.
17. The method of claim 1, wherein said detecting step comprises use of a branched hybridization assay.
18. The method of claim 1, wherein said detecting step comprises use of a NASBA assay.
19. The method of claim 1, wherein said detecting step comprises use of a molecular beacon assay.
20. The method of claim 1, wherein said detecting step comprises use of a cycling probe assay.
21. The method of claim 1, wherein said detecting step comprises use of a ligase chain reaction assay.
22. The method of claim 1, wherein said detection step comprises use of a sandwich hybridization assay.
23. A composition comprising a nucleic acid, said nucleic acid comprising a sequence selected from the group consisting of SEQ ID NO: 1-3360 and 3361-7669 or complements thereof.
24. The composition of claim 23, wherein said nucleic acid is 200 or less nucleotides in length.
25. The composition of claim 23, wherein said nucleic acid molecule comprises a label.
26. The composition of claim 23, wherein said nucleic acid comprises a gene sequence.
27. The composition of claim 23, wherein said nucleic acid is attached to a solid support.
28. The vector comprising the nucleic acid of claim 23.
29. A host cell comprising the vector of claim 28.
30. A polypeptide encoded by the nucleic acid of claim 23.
31. A kit for detecting a polymorphism, comprising at least one reagent that specifically detects a polymorphism in a sequence selected from the group consisting of SEQ ID Nos:3360 and 3361-7669.
32. The kit of claim 31, further comprising instructions for determining whether the subject is at increased risk of having a drug metabolism disorder.
33. The kit of claim 31, wherein said at least one reagent comprises a nucleic acid probe.
34. The kit of claim 31, wherein said kit comprises an in vitro diagnostic detection assay.
35. The kit of claim 31, wherein said kit comprises an analyte specific reagent detection assay.
36. The kit of claim 31, wherein said kit comprises a research-use-only detection assay.
37. A method for screening subjects for genetic markers associated with drug metabolizing enzyme(s), comprising:
- a) providing a biological sample comprising a nucleic acid from a subject;
- b) testing said nucleic acid for a polymorphism in a genetic marker associated with a drug metabolizing enzyme, said genetic marker comprising one or more nucleotide polymorphisms designated by n, said n selected from a base substitution, an insertion, or a deletion found in a sequence selected from the group consisting of SEQ ID Nos:1-3360 and 3361-7669.
38. The method of claim 37, wherein said biological sample is selected from the group consisting of blood, saliva, amniotic fluid, and tissue.
39. The method of claim 37, wherein said subject is a human.
40. The method of claim 37, wherein said nucleic acid comprises DNA.
41. The method of claim 37, wherein said nucleic acid comprises RNA.
42. A composition comprising an array of detection assays, said array comprising a plurality of drug metabolizing enzyme nucleotide polymorphism detection assays, one or more of said detection assays being capable of detecting one or more nucleotide polymorphisms designated by n in SEQ ID Nos:1-3360 and 3361-7669, wherein n represents a base substitution, insertion, or deletion compared to a wild-type sequence.
43. The composition of claim 42, wherein said detection assay is selected from the group consisting of a sequencing assay, a polymerase chain reaction assay, a hybridization assay, a hybridization assay employing a probe complementary to a polymorphism, a microarray assay, a bead array assay, a primer extension assay, an enzyme mismatch cleavage assay, a branched hybridization assay, a rolling circle replication assay, a NASBA assay, a molecular beacon assay, a cycling probe assay, a ligase chain reaction assay, and a sandwich hybridization assay.
44. A composition comprising a detection probe for determining the presense or absence a single nucleotide polymorphism in a gene encoding a drug metabolizing enzyme, said gene comprising a sequence selected from the group consisting of SEQ ID Nos:1-3360 and 3361-7669.
45. A kit comprising the detection probe of claim 44, and at least one PCR primer for amplifying at least a portion of said gene.
46. A method of determining the effectiveness of or side-effect of a drug or treatment protocol, comprising;
- a. administering a drug or treatment protocol to one or more subjects;
- b. obtaining nucleic acid from said one or more subjects;
- c. using a detection assay to detect the presence of at least one polymorphism in said nucleic acid from said one or more of subjects, said at least one polymorphism selected from the group consisting of polymorphisms found in SEQ ID Nos:1-3360 and 3361-7669; and,
- d. assigning an effectiveness rating, side-effect rating, or score for said drug or treatment protocol based upon a result of one or more said detection assays.
47. The method of claim 46, wherein said detection assay comprises a hybridization assay.
48. The method of claim 46, wherein said detection assay comprises a TAQMAN assay.
49. The method of claim 46, wherein said detection assay comprises an invasive cleavage assay.
50. The method of claim 46, wherein said detection assay comprises mass spectroscopy.
51. The method of claim 46, wherein said detection assay comprises a micro array.
52. The method of claim 46, wherein said detection assay comprises a polymerase chain reaction.
53. The method of claim 46, wherein said detection assay comprises a rolling circle extension assay.
54. The method of claim 46, wherein said detection assay comprises a sequencing assay.
55. The method of claim 46, wherein said detection assay comprises a hybridization assay employing a probe complementary to a polymorphism.
56. The method of claim 46, wherein said detection assay comprises a bead array assay.
57. The method of claim 46, wherein said detection assay comprises a primer extension assay.
58. The method of claim 46, wherein said detection assay comprises an enzyme mismatch cleavage assay.
59. The method of claim 46, wherein said detection assay comprises a branched hybridization assay.
60. The method of claim 46, wherein said detection assay comprises a NASBA assay.
61. The method of claim 46, wherein said detection assay comprises a molecular beacon assay.
62. The method of claim 46, wherein said detection assay comprises a cycling probe assay.
63. The method of claim 46, wherein said detection assay comprises a ligase chain reaction assay.
64. The method of claim 46, wherein said detection step comprises a sandwich hybridization assay.
65. The method of claim 46, in which said detection assay comprises a kit for detecting a polymorphism, said kit comprising at least one reagent that specifically detects a polymorphism in a sequence selected from the group consisting of SEQ ID Nos:1-3360 and 3361-7669.
66. The method of claim 65, further comprising instructions for determining whether the subject is at increased risk of having a drug metabolism disorder.
67. The method of claim 65, wherein said at least one reagent comprises a nucleic acid probe.
68. The method of claim 65, wherein said kit comprises an analyte specific reagent detection assay.
69. The method of claim 65, wherein said kit comprises a research-use-only detection assay.
70. The method of claim 46, wherein said nucleic acid is obtained from a biological sample, said sample being selected from the group consisting of blood, saliva, amniotic fluid, and tissue.
71. The method of claim 70, wherein said subject is a mammal.
72. The method of claim 70, wherein said nucleic acid comprises DNA.
73. The method of claim 70, wherein said nucleic acid comprises RNA.
74. The method of claim 65, wherein said kit comprises PCR primers.
75. The method of claim 74, in which said kit comprises an array of detection assays, said array comprising a plurality of drug metabolizing enzyme nucleotide polymorphism detection assays, one or more of said detection assays being capable of detecting one or more nucleotide polymorphisms designated by n in SEQ ID Nos:1-3360 and 3361-7669, wherein n represents a base substitution, insertion, or deletion compared to a wild-type sequence.
76. A method of prescribing a drug to or treatment protocol for a subject, comprising;
- a. providing nucleic acid from said subject;
- b. using a detection assay to detect the presence of at least one polymorphism in said nucleic acid, said at least one polymorphism selected from the group consisting of polymorphisms found in SEQ ID Nos:1-3360 and 3361-7669; and,
- c. prescribing said drug or treatment protocol based upon the result of said detection assay.
77. The method of claim 76, further comprising step d) providing a prognosis to said subject based on the presence or absence of said at least one polymorphism.
78. The method of claim 77, wherein said prognosis comprises a genotype relative risk.
79. The method of claim 77, wherein said prognosis comprises a population attributable risk.
80. The method of claim 76, wherein said detection assay comprises a hybridization assay.
81. The method of claim 76, wherein said detection assay comprises a TAQMAN assay.
82. The method of claim 76, wherein said detection assay comprises an invasive cleavage assay.
83. The method of claim 76, wherein said detection assay comprises mass spectroscopy.
84. The method of claim 76, wherein said detection assay comprises a microarray.
85. The method of claim 76, wherein said detection assay comprises a polymerase chain reaction.
86. The method of claim 76, wherein said detection assay comprises a rolling circle extension assay.
87. The method of claim 76, wherein said detection assay comprises a sequencing assay.
88. The method of claim 76, wherein said detection assay comprises a hybridization assay employing a probe complementary to a polymorphism.
89. The method of claim 76, wherein said detection assay comprises a bead array assay.
90. The method of claim 76, wherein said detection assay comprises a primer extension assay.
91. The method of claim 76, wherein said detection assay comprises an enzyme mismatch cleavage assay.
92. The method of claim 76, wherein said detection assay comprises a branched hybridization assay.
93. The method of claim 76, wherein said detection assay comprises a NASBA assay.
94. The method of claim 76, wherein said detection assay comprises a molecular beacon assay.
95. The method of claim 76, wherein said detection assay comprises a cycling probe assay.
96. The method of claim 76, wherein said detection assay comprises a ligase chain reaction assay.
97. The method of claim 76, wherein said detection step comprises a sandwich hybridization assay.
98. The method of claim 76, in which said detection assay comprises a kit for detecting a polymorphism, said kit comprising at least one reagent that specifically detects a polymorphism in a sequence selected from the group consisting of SEQ ID Nos:1-3360 and 3361-7669.
99. The method of claim 98, further comprising instructions for determining whether the subject is at increased risk of having a drug metabolism disorder.
100. The method of claim 99, wherein said at least one reagent comprises a nucleic acid probe.
101. The method of claim 98, wherein said kit comprises an in vitro diagnostic detection assay.
102. The method of claim 98, wherein said kit comprises an analyte specific reagent detection assay.
103. The method of claim 98, wherein said kit comprises a research-use-only detection assay.
104. The method of claim 76, wherein said nucleic acid is obtained from a biological sample, said sample being selected from the group consisting of blood, saliva, amniotic fluid, and tissue.
105. The method of claim 104, wherein said subject is a human.
106. The method of claim 104, wherein said nucleic acid comprises DNA.
107. The method of claim 104, wherein said nucleic acid comprises RNA.
108. The method of claim 104, wherein said kit comprises PCR primers.
109. The method of claim 98, in which said kit comprises an array of detection assays, said array comprising a plurality of drug metabolizing enzyme nucleotide polymorphism detection assays, one or more of said detection assays being capable of detecting one or more nucleotide polymorphisms designated by n in SEQ ID Nos: 1-3360 and 3361-7669, wherein n represents a base substitution, insertion, or deletion compared to a wild-type sequence.
110. The method of claim 109, wherein said detection assay is selected from the group consisting of a sequencing assay, a polymerase chain reaction assay, a hybridization assay, a hybridization assay employing a probe complementary to a polymorphism, a microarray assay, a bead array assay, a primer extension assay, an enzyme mismatch cleavage assay, a branched hybridization assay, a rolling circle replication assay, a NASBA assay, a molecular beacon assay, a cycling probe assay, a ligase chain reaction assay, and a sandwich hybridization assay.
111. A method for generating assay data comprising:
- a. obtaining a sample from a subject containing nucleic acid;
- b. transferring said sample to a laboratory; and
- c. receiving data from said laboratory, wherein said data corresponds to the presence of at least one polymorphism in said nucleic acid, said at least one polymorphism selected from the group consisting of polymorphisms found in SEQ ID Nos:1-3360 and 3361-7669.
112. A data set generated by the method of claim 111.
113. A composition comprising a nucleic acid, said nucleic acid comprising a gene sequence, said gene sequence having at least one polymorphism, said at least one polymorphism selected from the group consisting of polymorphisms found in SEQ ID NOs:1-3360 and 3361-7669.
114. The composition of claim 113, wherein said at least one polymorphism is located in a non-coding portion of said gene.
115. The composition of claim 113, wherein said at least one polymorphism is located in an intron.
116. The composition of claim 113, wherein said at least one polymorphism is located in an exon.
117. The composition of claim 113, wherein said at least one polymorphism is located in a 5′ untranslated portion of said gene.
118. The composition of claim 113, wherein said at least one polymorphism is located in a 3′ untranslated portion of said gene.
119. The composition of claim 113, wherein said at least one polymorphism is located in an untranslated regulatory portion of said gene.
120. The composition of claim 113, wherein said at least one polymorphism is located in a region of said gene affecting splicing.
121. The composition of claim 113, wherein said at least one polymorphism is located in a region of said gene affecting level of transcription of said gene.
122. The composition of claim 113, wherein two or more of said polymorphisms are located in a gene sequence, said gene sequence comprising an intron, an exon, a 5′ untranslated portion of said gene, a 3′ untranslated portion of said gene, a regulatory portion of said gene, a portion of said gene affecting splicing, and a portion of said gene affecting level or transcription of said gene.
123. A composition comprising an oligonucleotide, said oligonucleotide comprising at least one polymorphism, said at least one polymorphism selected from the group consisting of polymorphisms found in SEQ ID Nos:1-3360 and 3361-7669, and said oligonucleotide comprising at least five bases upstream or five bases downstream of said polymorphism.
Type: Application
Filed: Dec 27, 2001
Publication Date: Apr 15, 2004
Applicant: Riken Institute of Physical and Chemical Research
Inventors: Yusuke Nakamura (Yokohama-shi), Akihiro Sekine (Tokyo), Aritoshi Ilda (Kawasaki-shi), Susumu Saito (Tokyo)
Application Number: 10035833
International Classification: C12Q001/68;