Fine metal structure, process for producing the same, fine metal mold and device
A fine metal structure having its surface furnished with microprojections of high strength, high precision and large aspect ratio; and a process for producing the fine metal structure free of defects. There is provided a fine metal structure having its surface furnished with microprojections, characterized in that the microprojections have a minimum thickness or minimum diameter ranging from 10 nanometers to 10 micrometers and that the ratio between minimum thickness or minimum diameter (D) of microprojections and height of microprojections (H), H/D, is greater than 1. There is further provided a process for producing a fine metal structure, characterized by comprising providing a substrate having a fine rugged pattern on its surface, applying a molecular electroless plating catalyst to the surface, thereafter carrying out electroless plating to thereby form a metal layer having the rugged pattern filled, and detaching the metal layer from the substrate to thereby obtain a fine metal structure furnished with a surface having undergone reversal transfer of the above rugged pattern.
Latest HITACHI LTD Patents:
The present invention relates to a fine structure having its surface furnished with microprojections and a process for producing such a structure. The present invention also pertains to the apparatuses and devices using the said fine structure, particularly fine metal molds and nanoimprinters used for nanoimprinting in which resins or inorganic materials are pressure molded, and electrodes, microchips and DNA chips for converting, producing or detecting the materials by making use of an electrochemical reaction.
BACKGROUND ARTThe conventional fine structures having microprojections on their surfaces and methods of producing such structures are reviewed below.
In a first instance of the conventional fine structures having microprojections on the surface and their production methods, an inorganic material such as silicon, a metal such as nickel or an organic material such as polystyrene or resist is directly worked by a fine working technique such as lithography or anisotropic etching using a mask, and the obtained work is directly used as a structural member of a metal mold or microdevice. (See Patent Document 1).
In a second instance of the conventional fine structures having microprojections on the surface and their production methods, a resin such as polystyrene is pressure molded by using as its mold a fine structure obtained in the same way as in the first instance described above, and the molded product is detached from the mold and utilized as a fine structure. (See Patent Document 2).
In a third instance of the conventional fine structures having microprojections on the surface and their production methods, a fine structure obtained in the same way as in the first instance described above is used as a casting mold, the inside thereof is filled up by electroplating, and the formed plating film is detached from the mold and utilized as a fine structure. (See Patent Document 3).
With reference to the third instance, it is disclosed that in case a high hardness is required for the stamper surface, the stamper is made by electroless plating with NiP alone and the obtained stamper is heat treated at around 400° C. for 4 hours, whereby it is possible to obtain a HV hardness of 1,000 or higher. (See Patent Document 4).
Patent Document 1: JP-A-2002-307398
Patent Document 2: U.S. Pat. No. 5,772,905
Patent Document 3: Japanese Patent No. 2633088
Patent Document 4: JP-A-2003-22585 (paragraph [0040])
DISCLOSURE OF INVENTION Problem to be Solved by the InventionThe fine structure obtained by the method described in Patent Document 1 is generally of high precision and may have sufficient strength when a metal or silicon is used for the structure. According to this method, however, since the structure is formed directly by fine working which requires a number of steps, the production cost is high and it is hard to apply this method to a process for mass producing the uncostly structure.
The method disclosed in Patent Document 2 is generally called nanoimprinting technology, with which it is possible to produce an object having fine structure by replicating, at low cost, the configuration of the fine structure formed by the first instance method. In this method, however, since the fine structure is produced by pressure molding, the materials usable for the fine structure are limited to those having relatively low strength, so that there is a fear of insufficiency of strength and reliability of the obtained fine structure. Further, when the molded product is released from the mold, the molded product may be deformed, posing the problem on precision of the obtained fine structure.
The method described in Patent Document 3 is a technique called electroforming, which is applied for producing the stamper used for producing digital videodiscs. According to this method, for forming the microprojections with a large aspect ratio, it is necessary to fill up the inside of the mold having a fine and deep hole or trench-like cavity by electroplating. It is, however, difficult to perfectly fill up the fine and deep hole or trench-like cavity without creating defects such as voids or seams in the central portion of the cavity. Further, since the metal articles obtained by electroplating are generally low in strength, this method not only involves a problem on reliability of the obtained fine structure but also has a possibility that when the plating film is detached from the mold after forming the microprojections with a large aspect ratio, the formed microprojections may be damaged.
Patent Document 4 describes a method with which it is possible to increase hardness of the structure, but it gives no concrete disclosure on the techniques for perfectly filling up the fine and deep cavity without forming defects such as voids or seams in the inside of the mold.
As viewed above, it is difficult with the prior art to provide a fine metal structure having on its surface microprojections of high strength, high precision and large aspect ratio, and a method of producing such a fine structure free of defects.
An object of the present invention is to provide a fine metal structure having its surface furnished with microprojections of high strength, high precision and large aspect ratio, and a process for producing such a fine structure free of defects.
Another object of the present invention is to provide the apparatuses and devices with high precision and high reliability, particularly fine metal molds and nanoimprinters used for nanoimprinting in which a resin or an inorganic material is pressure molded, and electrodes, microchips and DNA chips for converting, producing or defecting the materials by means of an electrochemical reaction.
MEANS FOR SOLVING THE PROBLEMThe present invention has been made for solving the above problem, and it provides a fine metal structure having its surface furnished with microprojections, characterized in that the microprojections have a thickness or an eqauivalent diameter ranging from 10 nanometers to 10 micrometers and an aspect ratio of greater than 1. The “aspect ratio” referred to herein is a value defined by the ratio (H/D) of the thickness or equivalent diameter (D) of the microprojections to their height (H). The term “equivalent diameter” is used here because the cross section of the microprojections is not always circular but may be oval, polygonal, asymmetric or of other shapes. In the present invention, this term is used for embracing all of these variety of sectional shape of microprojections. Also, in the present invention, “thickness of microprojections” means the length of the portion smaller in thickness in case the cross section of microprojections is of an elongated shape such as rectangular. It is also a feature of the present invention that the microprojections are made of an alloy having a nonmetallic element as an accessory constituent.
The fine metal structure of the present invention is also characterized by its production process in which a molecular electroless plating catalyst is applied to the surface of a substrate having a fine rugged pattern, then electroless plating is carried out to form a metal layer, and this metal layer is detached from the substrate to effect reversal transfer of the rugged pattern.
In an embodiment of the present invention, for suiting the intended purpose of use of the structure, at least part of the surface of microprojections may be coated with at least one layer of coating. Also, at least one kind of organic material selected from the surface modifiers such as antigens, antibodies, proteins, bases, sugar chains and release agents may be directly or indirectly fixed to the surface of microprojections.
Further, the process for producing a fine metal structure according to the present invention is characterized in that a molecular electroless plating catalyst is applied to the substrate surface having a fine rugged pattern, then electroless plating is carried out to form a metal layer having at least the said rugged pattern filled, and the metal layer is detached from the substrate to obtain a fine metal structure furnished with a surface having undergone reversal transfer of the said rugged pattern.
Other objects, features and advantages of the present invention will become apparent from perusing the following description of the embodiments of the invention given in conjunction with the accompanying drawings.
ADVANTAGES OF THE INVENTIONAccording to the present invention, it is possible to provide a fine metal structure having its surface furnished with microprojections of high strength, high precision and large aspect ratio, and a process for producing such a fine metal structure free of defects. It also becomes possible to provide high-precision and high-reliability apparatuses or devices using the said fine structure, particularly fine metal molds and nanoimprinters used for nanoimprinting in which a resin or an inorganic material is pressure molded, and electrodes, microchips and DNA chips for converting, producing or detecting the materials by an electrochemical reaction.
BEST MODE FOR CARRYING OUT THE INVENTIONAs a result of extensive studies for solving the above problem, the present inventors have succeeded in inventing a fine metal structure having its surface furnished with microprojections made of a metal alloy containing a nonmetallic element as an accessory constituent. The present inventors have also found that by a process comprising applying a molecular electroless plating catalyst to the surface of a substrate having a fine rugged pattern, then carrying out electroless plating to form a metal layer having the rugged pattern filled, and detaching the metal layer from the substrate to thereby produce, free of defects, a fine metal structure furnished with a surface having undergone reversal transfer of the said rugged pattern.
The present inventors have also realized a high-strength, high-durability and high-precision fine metal mold for nanoimprinting and a nanoimprinter by making use of the said fine metal structure and its production process described above. Moreover, the present inventors have completed a high-performance electrode, microchip and DNA chip by coating the surface of the said fine metal structure with a layer of an organic material, an inorganic material or a metal. Particularly, the present inventors have found that it is possible to fix a substance derived from an organism, especially an antigen, antibody, protein, base or sugar chain, on the surface of a metal coating formed on the surface of the said fine metal structure. The present inventors have also found that by applying this finding to microchips, it is possible to mass produce various kinds of devices with excellent durability at low cost. The present invention has been attained on the basis of the above disclosures.
We have found that a fine metal structure having microprojections of high strength and large aspect ratio on the surface can be obtained by using as its material a metal alloy containing a nonmetallic element, especially phosphorus or boron, as an accessary constituent. The metal alloys usable for the structure needn't be specific types although nickel-phosphorus alloy or nickel-boron alloy comprising nickel as its major component is preferable for high strength; it is possible to use alloys comprising cobalt or other metals as major component or those composed of two or more types of metal. These alloys are generally higher in strength than pure metals composed of only one metal. This is considered attributable to segregation of the nonmetallic element such as phosphorus or boron in the alloys. We have found that this segregation is particularly effective in a fine structure and this finding has contributed to the attainment of the present invention. The reason therefor is not clarified at this writing, but it is considered that one account is the fact that the makeup of segregation of the nonmetallic element in a fine structure is different from that in the bulk. The concentration of a nonmetallic element contained in a metal alloy is not specified, but generally it is preferable, in terms of strength of the obtained fine metal structure, that the concentration of the nonmetallic element is in the range of 2% by weight to 15% by weight in the case of phosphorus and 0.1% by weight to 8% by weight in the case of boron. When the concentration of the nonmetallic element is below the above-defined range, there is produced no satisfactory strength improving effect. On the other hand, when the concentration of the nonmetallic element exceeds the above range, the obtained fine metal structure proves to be so embrittled that it can hardly be offered to practical use.
As viewed above, a fine structure made of a metal alloy containing a nonmetallic element, especially phosphorus or boron, as an accessory constituent shows high strength, and particularly excellent properties are provided when the microprojections present on the surface of the fine metal structure are cylindrical or rectangular column shaped ones, and the ratio of diameter or length (D) of one side of such shaped microprojection to its height (H), H/D, is greater than 1, that is, when fine and high microprojections are built up on the substrate. Generally, when these fine and high microprojections were made of a resin or a metal, their strength was low, and when, for instance, the obtained fine metal structure was used as a fine metal mold for nanoimprinting, it would be broken in several times of use. Also, in use of the fine structure as a substrate for DNA chips, damage to the microprojections on the surface of the fine structure was observed during spotting of the DNA solution. However, when the present invention was applied for these structures, the frequency of occurrence of said troubles was drastically lessened.
Next, a process for flawlessly producing a fine metal structure furnished with microprojections on the surface is explained with reference to
By application of this process, it is possible to precipitate the nonmetallic element such as phosphorus or boron by properly selecting the reducing agent and/or additives used for electroless plating, which makes it possible to produce a high-strength fine metal structure. This is an outstanding feature of the present process, which greatly contributes to solving the problems in the conventional electroforming operations. As the major component of the electroless plating film, nickel, gold, silver, platinum, palladium, cobalt, tin and copper may be cited as examples. Although the major component is not specified, nickel is preferred in view of strength of the obtained fine structure.
Another feature of the process creditable to this invention is that it is capable of easily producing the microprojections of a shape with a large aspect ratio, which have been generally difficult to produce with the conventional electroforming method. For forming the microprojections with a shape of large aspect ratio, it needs to let a metal precipitate in the mold having a deep cavity to fill it up. In this operation, there exist the following two problems with the electroforming method, which makes it difficult to produce a fine structure of high quality. The first problem is that in the electroforming method, in order to fill the inside of the mold by electroplating, it is necessary to form an electrical feeder layer on the fine mold surface prior to electroplating. Generally, such technique as sputtering or vapor deposition is applied for forming the feeder layer, but it is difficult to form this feeder layer uniformly in a fine metal mold having a deep cavity. Another problem concerns the fact that when using an electroplating method, precipitation of the plating film takes place earlier in the vicinity of the surface portion of the cavity than in the area around the bottom portion of the cavity, and consequently, the cavity is closed by the plating film which precipitated in the vicinity of the surface portion of the cavity before the inside of the cavity is perfectly filled. As a result, voids and/or seams are formed in the inside of the produced microprojections, making it unable to obtain a fine metal structure with high quality.
In order to solve the above problems, we have pursued studies for filling the inside of the cavity by an electroless plating method which is considered to have an advantage of allowing uniform growth of the plating film. As a result, we have found that only when using a molecular electroless plating catalyst with its atoms dissolved in a solution in the state of a complex or a salt, instead of using a conventional colloidal catalyst, as the catalyst serving as a starting point of the electroless plating reaction, it is possible to fill the cavity free of defects and to produce a fine metal structure of large aspect ratio with high precision. The present invention is based on this finding.
The cause of the above phenomenon, as surmised from the viewpoint of the process of growth of plating with the catalyst applied to the cavity serving as cardinal point, is explained with reference to
On the other hand, when a molecular catalyst is used, there is formed a molecular catalyst layer 305 with the catalyst molecules being uniformly adsorbed in the cavity as shown in
The fine metal structure of large aspect ratio obtained according to the present invention can be applied, for its strength, precision and configuration, to a wide variety of industrial products, devices, parts, etc., for example, various kinds of devices such as electrodes, DNA chips and immunoanalytical chips used for converting, producing or detecting the materials by the electrochemical reactions, optical devices such as MEMS, optical or magnetic storages, waveguides and diffraction gratings, photonic crystals, electron emission sources used for FED displays, etc. The above-described fine metal structure and its production process can be applied directly in the form as they are, but more preferably, the structure is applied after coating its surface with an organic material, an inorganic material or a metal according to the purpose of use of the structure. The organic material, inorganic material or metal used for such coating is not specified, but it is expedient to properly select one suited for the purpose of use of the structure, for example, gold, silver or a platinum group metal may be selected when the structure is used as an electrode or the like, while a fluorine-based release agent is recommended when the structure is used as a fine metal mold.
In application of the fine structure of the present invention to microchips or sensors used for detection or separation of organic molecules or trace chemical substances, it is advised to make the coating with the organic molecules or organism-derived molecules, such as antigens, antibodies, proteins, bases or sugar chains, which interact with the object material of detection or separation. In this case, the organic molecules or organism-derived molecules may be coated directly on the structure surface by a suitable method such as physical adsorption, but preferably they are fixed by chemical bonding. Such chemical fixation of the organic molecules or organism-derived molecules on the structure surface can be effected by, for instance, silane coupling or gold-thiol bonding. The latter is preferred as it allows easier fixation of the organic molecules or organism-derived molecules. Thus, according to the present invention, it becomes possible to introduce, with stability, the organic molecules or organism-derived substances to the surface of a fine structure by coating the structure surface with gold and then reacting the gold coating with the organic molecules or organism-derived substances to which thiol groups have been introduced. For coating the structure surface with gold, immersion plating method is preferably used as it allows simple coating operation.
The detailed modes of practice of the present invention are described below with reference to the examples thereof.
EXAMPLE 1Fine Nickel-Phosphorus Alloy Structure
As an embodiment of the present invention, a fine metal structure mostly composed of nickel and containing phosphorus as an accessory constituent is explained.
The above fine metal structure was made by the following method.
Then a molecular electroless plating catalyst layer 505 was formed on the surface of the fine mold 504 by the following method. First, the fine mold 504 was cleaned by immersing it in a mixed solution of sulfuric acid and hydrogen peroxide solution (70%/30%) at 70° C. for 30 minutes. This mold was sufficiently washed with pure water and then further immersed in a cleaner solution (Securigant 902 produced by Atotec Japan) for expediting application of the catalyst, at 30° C. for 5 minutes to adjust the mold surface. The thus treated mold 502 was washed well with pure water and then dipped in a predipping solution (Neogant B produced by Atotec Japan) at room temperature for one minute for the purpose of preventing contamination of the catalyst solution. The mold was then dipped in a catalyst solution (Neogant 834 produced by Atotec Japan) at 50° C. for 5 minutes to afford palladium to the mold surface. The catalyst used here was the type prepared by dissolving the palladium complex molecules in a solution. After applying the catalyst, the mold was washed by dipping it in pure water, and the palladium applied by using a Neogant W solution (Atotec Japan) was activated as nucleus. Lastly, the thus worked mold 504 was washed with pure water to obtain a fine mold 504 having a molecular catalyst layer 505. Although a palladium type catalyst produced by Atotec Japan was applied in this example, the catalyst usable here is not limited to this type but all the other types of molecular catalysts can be used.
The catalyst-applied fine mold 504 was dipped in an electroless plating solution to deposit an alloy film 506 mostly composed of nickel on the inside of the fine cavity and on the mold surface. The composition of the electroless plating solution used here and the plating conditions are shown in Table 1. In this example, sodium phosphate was used as reducing agent for the purpose of coprecipitating phosphorus as an accessory constituent of the alloy.
The surface of the electroless plating film 506 was coated with a polystyrene solution (concentration: 5 wt %) by a bar coater and dried at 70° C. by a dryer to form a polystyrene support film 507.
Lastly, the electroless plating film 506 supported by the polystyrene film 507 was detached from the fine mold 504 to obtain a fine metal structure mostly composed of nickel and containing phosphorus as an accessory constituent. Fluorescent X-ray analysis of the constituents of the obtained fine metal structure showed that the content of the accessory constituent phosphorus was 4.5% by weight. Also, minute observation of the surface of the obtained fine nickel alloy structure by a scanning electron microscope confirmed that the cylindrical microprojections on the surface of the fine nickel alloy structure could be formed free of defects. Further, the cylindrical microprojections were cut at intervals of 100 nm from the top end by convergent ion beam machining and the cut cross sections were observed by a scanning electron microscope, which confirmed that there were no flaws such as seams or voids in the inside of the cylindrical microprojectioins.
Next, a fine metal structure was produced on an experimental basis according to the same process as described above except that a colloidal electroless plating catalyst HS202B (produced by Hitachi Chemical Industries Co., Ltd.) was used in place of the molecular electroless plating catalyst. Close observation of the surface of the produced fine nickel alloy structure by a scanning electron microscope revealed partial imperfections of the cylindrical microprojections on the surface of the fine nickel alloy structure. The cylindrical microprojections were cut at intervals of 100 nm from the top end by convergent ion beam machining, and the cut sections were observed by a scanning electron microscope, which revealed the presence of many defects such as seams and voids in the inside of the cylindrical microprojections. From the above, it was clarified that a flawless fine metal structure can be produced only when a molecular electroless plating catalyst is applied.
EXAMPLE 2Nickel-Boron Alloy Structure
A fine metal structure made of a nickel-boron alloy having the same makeup as the fine metal structure of Example 1 was made from the same process as in Example 1 except that the electroless plating solution and the plating conditions were changed as shown in Table 2.
Fluorescent X-ray analysis of the composition of the obtained fine metal structure showed that the content of the accessory constituent boron was 3.0% by weight. It was also confirmed that the cylindrical and tabular microprojections on the surface of the obtained fine nickel alloy structure could be formed free of defects. The cylindrical and tubular microprojections were cut at intervals of 100 nm from the top end by convergent ion beam machining and the cut sections were observed by a scanning electron microscope, which confirmed that there existed no defects such as seams or voids in the inside of both cylindrical and tabular microprojections.
A fine metal structure was made as a trial product according to the same process as in Example 1 except that a colloidal electroless plating catalyst HS202B (produced by Hitachi Chemical Industries Co., Ltd.) was used in place of the molecular electroless plating catalyst. Close observation of the surface of the obtained fine metal structure by a scanning electron microscope detected partial defects on the cylindrical microprojections on the surface of the fine nickel alloy structure. Also, the cylindrical microprojections were cut at intervals of 100 nm from the top end by convergent ion beam machining, and the cut sections were observed by a scanning electron microscope, which revealed the presence of defects such as lots of seams and voids in the inside of the cylindrical microprojections. From the above, it has become evident that a flawless fine metal structure can be produced only when a molecular electroless plating catalyst is applied.
EXAMPLE 3Cobalt-Phosphorus Alloy Structure
A fine metal structure comprising a cobalt-phosphorus alloy and having the same makeup as the structure of Example 1 was made according to the same process as in Example 1 except for use of the electroless plating solution and the plating conditions shown in Table 3.
Fluorescent X-ray analysis of the constituents of the obtained fine metal structure showed that the content of the accessory constituent phosphorus was 5.2% by weight. Also, close observation of the surface of the produced fine cobalt alloy structure confirmed that the cylindrical and tabular microprojections on the surface of said structure could be formed free of defects. The cylindrical and tabular microprojections were cut at intervals of 100 nm from the top end by convergent ion beam machining, and the cut sections were observed by a scanning electron microscope, which confirmed that there existed no defects such as seams or voids in the inside of both cylindrical and tabular microprojections.
A fine metal structure was made as a trial product according to the same process as in Example 1 except that a colloidal electroless plating catalyst HS202B (produced by Hitachi Chemical Industries Co., Ltd.) was used in place of the molecular electroless plating catalyst. Close observation of the surface of the obtained fine metal structure by a scanning electron microscope confirmed partial defects on the cylindrical microprojections on the surface of the fine cobalt alloy structure. Also, the cylindrical microprojections were cut at intervals of 100 nm from the top end by convergent ion beam machining, and the cut sections were observed by a scanning electron microscope, which revealed the presence of defects such as lots of seams and voids in the inside of the cylindrical microprojections. From the above, it has become evident that a flawless fine metal structure can be produced only when a molecular electroless plating catalyst is applied.
EXAMPLE 4Palladium-Phosphorus Alloy Structure
A fine metal structure comprising a cobalt-phosphorus alloy and having the same makeup as the structure of Example 1 was made according to the same process as Example 1 except for use of the electroless plating solution and the plating conditions shown in Table 4.
Fluorescent X-ray analysis of the constituents of the obtained fine metal structure showed that the content of the accessory constituent phosphorus was 4.1% by weight. Also, close observation of the surface of the produced fine palladium alloy structure confirmed that the cylindrical and tabular microprojections on the surface of said structure could be formed free of defects. The cylindrical and tabular microprojections were cut at intervals of 100 nm from the top end by convergent ion beam machining, and the cut sections were observed by a scanning electron microscope, which confirmed that there existed no defects such as seams or voids in the inside of both cylindrical and tabular microprojections.
A fine metal structure was made as a trial product according to the same process as in Example 1 except that a colloidal electroless plating catalyst HS202B (produced by Hitachi Chemical Industries Co., Ltd.) was used in place of the molecular electroless plating catalyst. Close observation of the surface of the obtained fine metal structure by a scanning electron microscope confirmed partial defects on the cylindrical microprojections on the surface of the fine palladium alloy structure. Also, the cylindrical microprojections were cut at intervals of 100 nm from the top end by convergent ion beam machining, and the cut sections were observed by a scanning electron microscope, which revealed the presence of defects such as lots of seams and voids in the inside of the cylindrical microprojections. From the above, it has become evident that a flawless fine metal structure can be produced only when a molecular electroless plating catalyst is applied.
EXAMPLE 5Gold-Plated Fine Nickel-Boron Alloy Structure
Disclosed in this example is a fine metal structure having a gold surface. First, a fine nickel-boron alloy structure and a fine nickel-phosphorus alloy structure having the same makeup as the fine nickel-phosphorus alloy structure shown in
Both of the obtained structures had gold luster, and in observation thereof by a scanning electron microscope, there was observed no definite difference in construction before and after replacement gold plating in both structures.
EXAMPLE 6Fine Electrode
This example concerns application of a fine metal structure having on its surface the nanopillars made of a gold-plated nickel-phosphorus alloy as a high-sensitivity electrode for anode stripping which is a technique for the analysis of trace metal ions.
The process used for producing a high-sensitivity gold electrode as a trial product in this example is schematically illustrated in
Using this high-sensitivity gold electrode, the trace copper ions contained in an aqueous solution were analyzed by anode stripping. Anode stripping is a method which comprises reduction concentrating the metal ions contained in a solution on the electrode, conducting anode polarization of the electrode to cause oxidative elution, and identifying the ions in the solution from electric potential or quantity of electricity flowing in the solution at that time. First, four kinds of copper sulfate solutions with copper ion concentrations of 1×10−8 mol/l, 1×10−9 mol/l, 1×10−10 mol/l and 1×10−11 mol/l, respectively, were prepared by using ultra-pure water. Then, each of the copper sulfate solutions was analyzed by anode stripping using the high-sensitivity gold electrode and a comparative electrode comprising a substrate having a flat gold surface made by depositing gold on the surface of a glass substrate. For the analysis, there were used a glass-made beaker, a platinum electrode for the opposite electrode, and a saturated calomel electrode for the reference electrode. 30 cc of each copper sulfate solution was supplied into the beaker and after dipping the gold electrode, opposite pole and reference electrode in the solution, the beaker was purged with argon gas. Then an electric potential of −0.4 V vs. SCE was applied to the electrode for 15 minutes to precipitate copper on the electrode surface, then the electrode potential was swept from −0.1 V vs. SCE to +1.0 V vs. SCE at a rate of 0.1 V/min to dissolve copper precipitated on the electrode surface, and the potential and electric current at that time were recorded. The obtained results are shown in Table 5. The ratio of the amount of copper dissolving charge observed with the electrode having microprojections to that observed with the electrode having no microjections was 10 to 15 regardless of the copper ion concentration, which indicates that it is possible to make determinations with higher precision and higher sensitivity by using the electrode having microprojections than capable when using the electrode having no microprojections. This is considered attributable to a drastic increase of the surface area of the electrode, resulting in an increase of the amount of copper precipitating on the electrode surface, due to formation of microprojections on the electrode surface, in comparison with the case where no microprojections are present on the electrode surface.
Nano-Mold
This example concerns application of a metal structure having microprojections made according to the present invention to a stamper for nano-imprinting.
The stamper 701 was made by the same method as used in Example 2. That is, a 6-inch silicon substrate was dry etched to make a mold having a reversed surface configuration of the nickel-boron alloy-made structure 702, and then a molecular electroless plating catalyst was applied to the mold surface, followed by electroless nickel-boron alloy plating to perfectly fill the surface ruggedness. Thereafter, nickel electroplating was applied to the backside of the nickel-boron alloy plating film to form a 90-micrometer thick nickel support layer 703. Lastly, the plating film was detached from the mold to obtain a stamper 701.
A nano-printer made on trial by using the above stamper is schematically shown in
Here, the procedure of operations is explained. First, a process for coating the stamper 701 surface with a release agent 713 for facilitating release from the mold in the resin molding operation is explained with reference to
Next, a process for molding a resin by using the stamper 701 coated with a release agent is explained. First, an Si substrate (6 inches φ and 0.5 mm thick) was coated with a resin 722 (Polystyrene 679 produced by A and M) to a coating thickness of 600 nm. After positioning a stamper 701 coated with a release agent, the assembly was set on a stage 718 (
The above resin molding process was repeated 100 times using the stampers 701 coated with a same release agent to obtain 100 pieces of moldings to which the stamper surface configuration has been transferred. Then the stamper surface after 100 times of execution of the above process was closely examined by SEM. There was admitted no damage to the fine structure on the surface, and it was confirmed that the fine metal structure made according to the present invention has sufficient strength for use as a nano-mold.
EXAMPLE 8Fluorine Molecule-Fixed Nano-Mold
This example describes a process for making a stamper which allows easy separation of the resin molding with no need of coating it with a release agent in nanoprinting by plating the surface of the fine metal structure with gold and covalent bonding the fluorine-containing molecules on its surface.
First, a nickel-boron alloy-made stamper having the same structure as that shown in
CF3—(CF2)7—(CH2)2—SH (Compound 1)
Using a stamper having a layer of Compound 1 on the surface, nanoimprinting of a polystyrene resin was repeated 100 times according to the same process as used in Example 7 except that the step of forming a peel ply was omitted. In all the nanoimprinting operations, the stamper could be easily detached from the resin molding surface and the stamper surface configuration was correctly transferred to the resin molding surface. In close SEM observation of the stamper after 100 times of repetition of the nanoimprinting operation, there was admitted no damage to the fine structure, which confirmed that the fine metal structure made according to the present invention has sufficient resin releasability and strength.
EXAMPLE 9DNA-Fixed Ni Nanopillars
Illustrated in this example is application of the fine metal structure as a high-sensitivity DNA chip by fixing DNA probes to the gold-plated surface of the metal structure.
The principle of DNA chip is as follows. First, the DNA target for analysis is labeled, and this labeled DNA target is hybridized with a DNA probe fixed on the substrate. The DNA target is specifically hybridized with a DNA probe having a base sequence complementary to the particular DNA target among a plurality of fixed DNA probes. Then the signal issued from the DNA target hybridized with the DNA probe is determined. By determining this signal, it is possible to identify the DNA probe with which the DNA target is hybridized and to determine the amount of the hybridized DNA target. For example, in case a fluorescein-labeled DNA target is used, the value given by deducting the background from the fluorescent signal value in the hybridized region is the amount of detection, so that it is possible to elevate the detection sensitivity by increasing the fluorescent signal value in the hybridized region while reducing the background. For enhancing the fluorescent signal value against the background, it is effective to increase the surface area of the substrate where the DNA probes are fixed. In this example, therefore, there is shown application of a fine nickel-boron alloy structure having its surface plated with gold as a substrate drastically increased in surface area in comparison with a flat plate.
A DNA-fixed substrate produced by way of trial in this example is schematically shown in
Then, a thiol group-introduced DNA probe 1005, represented by the following Sequence No. 1, was synthesized by an automatic DNA synthesizer (Model 394 mfd. by Applied Biosystem Inc.).
(Sequence No. 1)
HS— (CH2)6—O—PO2—O-5′-ccctttttgtcccccaacttgagatgtatgaaggcttttggtctccctgggagtg ggtggaggcagccagggcttacctgtacactgacttgagaccagttgaataaaag tgcacacctta-3′
The obtained DNA probes 1005 were refined by high speed liquid chromatography. Then, 1 μl of 2 μM DNA probe, 4 μl of HEPES buffer solution (N-2-hydroxyethylpiperazine-N-2-ethanesulfonic acid; 10 mM, pH 6.5) and 5 μl of an additive (ethylene glycol) were mixed to prepare a spotting solution. This spotting solution was spotted on an arbitrarily selected point of the gold layer 1001 on the DNA fixing substrate surface by a spotter (SPBIO 2000 mfd. by Hitachi Soft Co., Ltd.) and allowed to stand at room temperature for 2 hours to cause bonding of the gold layer 1001 with thiol groups of the DNA probe 1005 to fix the DNA probe 1005 on the DNA fixing substrate having cylindrical microprojections on the surface (
A DNA target having a base sequence complementary to the DNA probe 1005 and fluorescence labeled with Texas red at the 5′ terminal was synthesized by an automatic DNA synthesizer. Then 8 μl of 0.1 μM DNA target, 1.7 μl of 20×SSC (produced by Wako Pure Chemicals Co., Ltd.) and 0.3 μl of a 10% sodium dodecylsulfate solution (produced by Lifetec Oriental Co., Ltd.) were mixed to prepare a hybridization solution. This hybridization solution was dropped onto a DNA fixing substrate having the DNA probe-fixed cylindrical microprojections on the surface and, with a cover glass placed thereon, the substrate was left in a 40° C. thermostat for 12 hours to carry out a hybridization reaction. After the hybridization reaction, the slide glass was dipped in a mixture of a 10-fold diluted solution of 20×SSC and a 300-fold diluted 10% sodium dodecylsulfate solution to remove cover glass, and then the slide glass was washed with a 100-fold diluted 20×SSC solution. Lastly, after removing water on the substrate by a microtiter plate centrifuge, fluorescence intensity in the region where the DNA probe 1005 was fixed (hybridization signal) and fluorescence intensity in the region where the DNA probe 1005 was not fixed (background signal) were determined by a microarray scanner (Scan Array 5000 mfd. by GSI Lumonics Ltd.).
Then a similar experiment was carried out except that a slide glass substrate having a flat gold film on the surface was used in place of the DNA fixing substrate having cylindrical microprojections on the surface, and fluorescence intensity in the region where the DNA probe was fixed (hybridization signal) and fluorescence intensity in the region where the DNA probe was not fixed (background signal) were determined. The said slide glass substrate having a flat gold film on the surface was made by depositing gold on a slide glass to a buildup of 100 nanometers.
Hybridization was carried out using the DNA fixing substrate having cylindrical microprojections on the surface and the slide glass substrate having a flat gold-plated surface, and the ratio of fluorescence intensity in the region where the DNA probe 1005 was fixed to that in the region where the DNA probe 1005 was not fixed was determined, the results being shown in Table 6.
From the results of Table 6, it was found that high-sensitivity detection of DNA is made possible by applying the fine metal structure obtained according to the present invention as a DNA fixing substrate.
EXAMPLE 10DNA Chip
Using the method of Example 9, there was produced a DNA chip in which 200 types of single-stranded DNA probes per sheet of slide glass were fixed in a regular array. Used as DNA probes were single-stranded DNA probes of 25 base sequences having their terminals modified by a thiol group, which were synthesized according to the method of Example 9. As the base sequences possessed respectively by the 200 types of DNA probes, there were used the continuous 25 base sequences peculiar to the respective 200 types of gene fragments shown in Tables 7 to 14.
A hybridization solution was prepared by the following method. Approximately 2×106 pancreatic cancer cells (CFPAC1 produced by American Type Culture Collection Inc.) and 10 ml of a medium were supplied to a dish, and the cells were cultured at 37° C. for one week, changing the medium once every two days. A 9:1 mixed solution of D-MEM (produced by Lifetec Oriental Co., Ltd.) and Fetal Bovine Serum Qualified (produced by Lifetec Oriental Co., Ltd.) was used as the medium. After cultivation, the medium was removed from the dish and a GTC solution (comprising 4M guanidine thiocyanate, 0.1M tris(hydroxymethyl)aminomethane and 1% 2-mercaptoethanol; pH 7.5) was added, dissolving the cultured cells therein. Then, after adding sodium N-lauroylsarcosinate so that the final concentration of the solution would become 0.5%, the solution was centrifuged at 5,000 rpm for 10 minutes and the supernatant liquid was taken out. A 5.7M cesium chloride solution was added to the supernatant liquid so that the supernatant/cesium chloride solution ratio would become 7/3, to which a proper quantity of light liquid paraffin was added, and the solution was centrifuged at 35,000 rpm for 12 hours. After centrifuging, the RNA pellets deposited in the lower layer were taken out. The thus obtained RNA pellets were dissolved in a proper quantity of TES solution (comprising 10 mM tris(hydroxymethyl)aminomethane, 5 mM ethylenediamine tetracetate and 1% sodium dodecylsulfate, pH 7.4) and concentrated and purified by ethanol precipitation. The purified RNA pellets were dissolved in a DEPC solution (0.1% diethyl dioxide) and then mRNA was separated from the RNA pellets by using an m-RNA purification kit (Micro-Fast Track 2.0 Kit mfd. by Invitrogen Co., Ltd.). The thus obtained mRNA was diluted to 1 μg/μl, then 1 μl of a 0.5 μg/μ Oligo dT Primer (produced by Lifetec Oriental Co., Ltd.) and 5 μl of DEPC solution were added to 1 μl of the dilute solution, and the mixed solution was kept at 70° C. for 5 minutes. To 5 μl of the thus prepared solution were added 5 μl of Super Script II buffer (Super Script II Reverse Transcriptase produced by Lifetec Oriental Co., Ltd.), 2 μl of dNTP mixture (comprising 2 mM dUTP, 5 mM dATP, 5 mM dGTP and 5 mM dCTP), 2 μl of 100 mM DTT (dithiothreitol), 2.5 μl of 40U resin (Rnase Inhibitor produced by Toyobo Co., Ltd.), 2 μl of 1 mM FluoriLink dUTP (Fluoro Link Cy5-dUTP produced by Amacham Farmacia Co., Ltd.) and 1 μl of SSII (Super Script II Reverse Transscriptase produced by Lifetec Oriental Co., Ltd.), and the mixed solution was kept 42° C. for 30 minutes. Then 1 μl of SSII (Super Script II Reverse Transcriptase produced by Lifetec Oriental Co., Ltd.) was further added, and the solution was again kept at 42° C. for 30 minutes. Thereafter, 20 μl of DEPC solution, 5 μl of 0.5M ethylenediamine tetracetate and 10 μl of a 1N sodium hydroxide solution were added, the mixed solution was kept at 65° C. for 60 minutes, and then 25 μl of a 1M tris(hydroxymethyl)aminomethane buffer solution (pH 7.5) was added to neutralized the solution. The neutralized sample solution was put into Microcon-30 (produced by Amicon Co., Ltd.), centrifuged at 8,000 rpm for 4 minutes and concentrated to 10 to 20 μl, and the unreacted dNTP was removed. The obtained solution was mixed with proper quantities of 20× Denhardt's solution (produced by Sigma Co., Ltd.), 20×SSC and sodium dodecylsulfate to thereby prepare 24.5 μl of a hybridization solution with final concentrations of 100 pg/μl DNA target, 2× Denhardt's solution, 4×SSC and 0.2% sodium dodecylsulfate.
The following hybridization reaction was carried out using the thus obtained DNA chips and hybridization solution.
The hybridization solution, after one-minute thermal denaturation at 95° C., was dropped onto a slide glass and a cover glass was placed thereon. Then the slide glass was left in a 40° C. thermostat for 12 hours to conduct a hybridization reaction. After the hybridization reaction, the slide glass was dipped in a mixture of a 10-fold diluted solution of 20×SSC and a 300-fold diluted version of a 10% sodium dodecylsulfate solution, and after removing the cover glass, the slide glass was washed with a 100-fold diluted solution of 20×SSC. Then, after removing water on the slide glass by a microtiter plate centrifuge, the fluorescence intensity at 200 spots (hybridization signal) and the fluorescence intensity in the region where the DNA probes were not fixed (background signal) were measured by using a microarray scanner (Scan Array 5000 mfd. by GSI Lumonics Co., Ltd.). The fluorescent yield at each of the 200 spots was determined by deducting the background signal from the hybridization signal measured as described above. The above hybridization reaction was carried out twice, and by plotting the fluorescent yield in the initial hybridization at each point as abscissa and the fluorescent yield in the second hybridization as ordinate, there were obtained the scattered plots such as shown in
Then the DNA chips were made in the same way as described above except for use of a slide glass substrate having a flat gold film on the surface in place of the DNA fixing substrate having cylindrical microprojections on the surface, and the above hybridization was carried out, obtaining the scattered plots shown in
The DNA chip using a DNA fixing substrate having cylindrical microprojections on the surface is enlarged in surface area and improved in DNA target detection sensitivity, and as apparent from the comparison of
According to the present invention, it is possible to provide a fine metal structure having its surface furnished with microprojections of high strength, high precision and large aspect ratio, and a process for producing such a fine metal structure free of defects. It is also made possible to provide the high-precision and high-reliability apparatuses and devices using the said fine structure, particularly fine metal molds and nanoimprinters used for nanoimprinting in which resins or inorganic materials are pressure molded, and the electrodes and DNA chips for converting, producing or detecting the materials by an electrochemical reaction. While the present invention has been described in conjunction with the embodiments thereof, it will be apparent to those skilled in the art that various changes and modifications can be made within the sprit and the scope defined by the appended claims of the present invention.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 9(a) and 9(b) are the enlarged views of the portions near the stamper surface in the apparatuses of FIGS. 8(a) and 8(b), respectively.
Claims
1-27. (canceled)
28. A fine metal structure having its surface furnished with microprojections, characterized in that the thickness or equivalent diameter of the microprojections ranges from 10 nanometers to 10 micrometers, that the ratio of the equivalent diameter (D) to the height (H) of the microprojections, H/D, is greater than 1, and that the microprojections are made of an alloy containing a nonmetallic element as an accessory constituent.
29. The fine metal structure according to claim 28 wherein the nonmetallic element is boron.
30. The fine metal structure according to claim 28 wherein at least part of the surface of each microprojection is coated with at least one layer of coating.
31. The fine metal structure according to claim 28 wherein at least one type of organic material selected from the group consisting of antigens, antibodies, proteins, bases, sugar chains and surface modifiers is fixed directly or indirectly to the surface of each microprojection.
32. A fine metal structure having its surface furnished with microprojections, characterized in that at least part of the surface of each microprojection is coated with at least one layer of coating having a different composition from that of the microprojections.
33. The fine metal structure according to claim 32, said structure having a portion where the thickness or equivalent diameter of the microprojections is from 10 nanometers to 10 micrometers.
34. The fine metal structure according to claim 32 wherein the ratio of the equivalent diameter (D) of microprojections to their height (H), H/D, is greater than 1.
35. The fine metal structure according to claim 32 wherein the microprojections are made of an alloy containing a nonmetallic element as an accessory constituent.
36. The fine metal structure according to claim 32 wherein at least one organic material selected from the group consisting of antigens, antibodies, proteins, bases, sugar chains and surface modifiers is fixed to the surface of the coating layer.
37. The fine metal structure according to claim 32 wherein the material composing the coating layer is gold.
38. A process for producing a fine metal structure, which comprises providing a substrate having a fine rugged pattern on its surface, applying a molecular electroless plating catalyst to the substrate surface, thereafter carrying out electroless plating to thereby form a metal layer having the rugged pattern filled, and detaching the metal, layer from the substrate to thereby obtain a fine metal structure furnished with a surface having undergone reversal transfer of the rugged pattern.
39. A process for producing a fine metal structure characterized in that after producing a fine metal structure according to the method of claim 38, at least one coating layer composed of a different composition from that of said fine metal structure is formed on the surface of said fine metal structure.
40. A process for producing a fine metal structure characterized in that after producing a fine metal structure according to the process of claim 38, at least one organic material selected from the group consisting of antigens, antibodies, proteins, bases, sugar chains and surface modifiers is fixed at least at a part of said gold coating surface.
41. The process according to claim 38, wherein the rugged surface configuration of said fine structure is at least partly constituted by columnar microprojections, with the diameter or the length of one side thereof being 10 nanometers to 10 micrometers, and the ratio of their diameter or length of one side (D) to their height (H), H/D, is greater than 1.
42. A metal mold used for pressure molding of resins and inorganic materials, characterized in that the surface of the mold is constituted by the fine metal structure set forth in claim 28.
43. A nanoimprinter in which resins or inorganic materials are pressure molded by using a fine metal mold, characterized in that the surface of said fine metal mold is constituted by the fine metal structure set forth in claim 28.
44. An electrode for converting, producing or detecting the materials by an electrochemical reaction, characterized in that at least part of the surface of the electrode is constituted by the fine metal structure set forth in claim 28.
45. A microchip having a fine rugged configuration at the specimen detecting section, characterized in that the fine metal structure set forth in claim 28 is used for the detecting section.
46. A microchip in which a material interacting with the specimen is fixed to the surface of a substrate, characterized in that the fine metal structure set forth in claim 28 is used as said substrate.
47. A DNA chip having multiple types of DNA fixed to the substrate surface, characterized in that the fine metal structure set forth in claim 28 is used as the substrate.
Type: Application
Filed: Dec 21, 2004
Publication Date: Jun 28, 2007
Applicant: HITACHI LTD (CHIYODA-KU, TOKYO JAPAN)
Inventor: Hiroshi Yoshida (MITO JAPAN)
Application Number: 10/584,139
International Classification: C12Q 1/68 (20060101); B05D 3/04 (20060101); B32B 3/30 (20060101); G01N 33/53 (20060101); C12M 3/00 (20060101); B32B 15/02 (20060101);