Increased stress tolerance and enhanced yield in plants
The present invention provides methods and compositions for improving biomass, as well as, the drought resistance of plants. More specifically, the present invention utilizes expression of aspartate carboxylase in plants and plant cells.
This invention was made through support from the USDA-Agricultural Research Service, Grant No. NRICGP 2001-35318-10947. The government has certain rights in this invention.
BACKGROUNDThe non-protein amino acid β-alanine is a precursor of pantothenate (vitamin B5) in all plants; and the osmoprotectant β-alanine betaine in most members of Plumbaginaceae (Hanson et. al., 1991). β-Alanine betaine is a product of three sequential methylations of β-alanine (Rathinasabapathi et. al., 2001). While beta-alanine itself can be an osmoprotectant, in certain plants it is methylated to a more effective osmoprotectant called beta-alanine betaine.
Bacteria make beta-alanine by decarboxylating aspartic acid. In Escherichia coli, this reaction is catalyzed by the product of panD gene encoding L-aspartate-α-decarboxylase. Aspartate decarboxylation reaction is not known in plants. Plants appear to use a variety of other ways to synthesize beta-alanine. Thus, engineering strategies to increase β-alanine pool in plants has potential applications for improving nutritional quality, yield and abiotic stress tolerance of crops.
SUMMARYIt is an object of the present invention to provide methods and compositions for increasing stress tolerance in plants.
It is another object of the present invention to provide plants and plant cells which have increased stress resistance.
It is a further object of the present invention is to increase biomass yield in plants. Preferably, enhanced biomass yield is accomplished by increasing leaf carbon dioxide concentration. Preferably still, enhanced growth and biomass is achieved by transforming plants with a polynucleotide molecule that decarboxylates aspartic acid.
Another object of the present invention is to enhance production of pantothenate in select plants.
The objects of the present invention, and others, may be accomplished with a method of increasing stress resistance in a plant, comprising expressing an aspartate decarboxylase in the plant. More preferred, an embodiment of the invention pertains to transforming plants with the panD gene of E. coli. (SEQ. ID NO: 1)
The objects of the present invention may also be accomplished with a method of increasing stress resistance in a plant cell, comprising expressing an aspartate decarboxylase in the plant cell.
The objects of the present invention may also be accomplished with a plant or a plant cell transformed with a nucleic acid, which encodes an aspartate decarboxylase.
Thus, the present invention also provides a method of producing such a plant or plant cell, by transforming a plant or plant cell with the nucleic acid which encodes the aspartate decarboxylase.
The present invention also provides an isolated and purified aspartate decarboxylase having the amino acid sequence of SEQ ID NO: 2.
The present invention also provides a method of producing the aspartate decarboxylase described above, comprising culturing host cells which have been transformed with a nucleic acid encoding the aspartate decarboxylase under conditions in which the aspartate decarboxylase is expressed, and isolating the aspartate decarboxylase.
In another embodiment, the present invention provides an isolated and purified enzyme having aspartate decarboxylase activity, wherein the amino acid sequence of the enzyme has a homology of from 70% to less than 100% to SEQ ID NO: 2.
The present invention also provides a method of producing the enzyme described above, comprising culturing host cells, which have been transformed with a nucleic acid encoding the enzyme under conditions in which the enzyme is expressed, and isolating the enzyme.
BRIEF DESCRIPTION OF THE DRAWINGS
As described herein, transformation and expression of aspartate decarboxylase in plant cells and plants produces increased biomass yield. Such plants are also expected to be also more resistant to drought, heat stress, salt stress and freezing stress.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art of molecular biology. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described herein. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be limiting.
Reference is made to standard textbooks of molecular biology that contain definitions and methods and means for carrying out basic techniques, encompassed by the present invention. See, for example, Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York (1982) and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York (1989); Methods in Plant Molecular Biology, Maliga et al, Eds., Cold Spring Harbor Laboratory Press, New York (1995); Arabidopsis, Meyerowitz et al, Eds., Cold Spring Harbor Laboratory Press, New York (1994) and the various references cited therein.
The term “plant” includes whole plants, plant organs (e.g., leaves, stems, roots, etc.), seeds and plant cells and progeny of same. The class of plants which can be used in the methods of the invention is generally as broad as the class of higher plants amenable to transformation techniques, including both monocotyledonous and dicotyledonous plants. Preferred plants include rice, corn, wheat, cotton, peanut, and soybean. Thus, in one embodiment of the present invention, the stress tolerance of a plant can be enhanced or increased by increasing the amount of protein available in the plant, preferably by the enhancement of the aspartate decarboxylase gene in the plant.
Thus, one embodiment of the present invention are plant cells carrying a polynucleotide that encodes an aspartate decarboxylase, and preferably transgenic plants carrying such polynucleotide.
As used herein, the term “enhancement” means increasing the intracellular activity of one or more enzymes in a plant cell and/or plant which are encoded by the corresponding DNA. Enhancement can be achieved with the aid of various manipulations of the bacterial cell. In order to achieve enhancement, particularly over-expression, the number of copies of the corresponding gene can be increased, a strong promoter can be used, or the promoter- and regulation region or the ribosome binding site which is situated upstream of the structural gene can be mutated. Expression cassettes which are incorporated upstream of the structural gene act in the same manner. In addition, it is possible to increase expression by employing inducible promoters. A gene can also be used which encodes a corresponding enzyme with a high activity. Expression can also be improved by measures for extending the life of the mRNA. Furthermore, enzyme activity as a whole is increased by preventing the degradation of the enzyme. Moreover, these measures can optionally be combined in any desired manner. These and other methods for altering gene activity in a plant are known as described, for example, in Methods in Plant Molecular Biology, Maliga et al, Eds., Cold Spring Harbor Laboratory Press, New York (1995).
A gene can also be used which encodes a corresponding or variant enzyme with a high activity. Preferably the corresponding enzyme has a greater activity than the native form of the enzyme, more preferably at least in the range of 5, 10, 25% or 50% more activity, most preferably more than twice the activity of the native enzyme.
In the context of the present application, a polynucleotide sequence is “homologous” with the sequence according to the invention if at least 70%, preferably at least 80%, most preferably at least 90% of its base composition and base sequence corresponds to the sequence according to the invention. According to the invention, a “homologous protein” is to be understood to comprise proteins which contain an amino acid sequence at least 70% of which, preferably at least 80% of which, most preferably at least 90% of which, corresponds to the amino acid sequence disclosed in (Gish and States, 1993); wherein corresponds is to be understood to mean that the corresponding amino acids are either identical or are mutually homologous amino acids. The expression “homologous amino acids” denotes those which have corresponding properties, particularly with regard to their charge, hydrophobic character, steric properties, etc. Thus, the protein may be from 70% up to less than 100% homologous to SEQ ID NO: 2.
Homology, sequence similarity or sequence identity of nucleotide or amino acid sequences may be determined conventionally by using known software or computer programs such as the BestFit or Gap pairwise comparison programs (GCG Wisconsin Package, Genetics Computer Group, 575 Science Drive, Madison, Wis. 53711). BestFit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981), to find the best segment of identity or similarity between two sequences. Gap performs global alignments: all of one sequence with all of another similar sequence using the method of Needleman and Wunsch, J. Mol. Biol. 48:443453 (1970). When using a sequence alignment program such as BestFit, to determine the degree of sequence homology, similarity or identity, the default setting may be used, or an appropriate scoring matrix may be selected to optimize identity, similarity or homology scores. Similarly, when using a program such as BestFit to determine sequence identity, similarity or homology between two different amino acid sequences, the default settings may be used, or an appropriate scoring matrix, such as blosum45 or blosum80, may be selected to optimize identity, similarity or homology scores.
The present invention also relates to plant cells or plants transformed with polynucleotides which contain the complete gene with the polynucleotide sequence corresponding to the E. coli panD gene (Merkel and. Nichols, 1996 ) or fragments thereof, and which can be obtained by screening by means of the hybridization of a corresponding gene bank with a probe which contains the sequence of said polynucleotide molecule or a fragment thereof, and isolation of the DNA sequence.
Polynucleotide sequences according to the invention are suitable as hybridization probes for RNA, cDNA and DNA, in order to isolate those cDNAs or genes which exhibit a high degree of similarity to the sequence of the panD gene.
Polynucleotide sequences according to the invention are also suitable as primers for polymerase chain reaction (PCR) for the production of DNA which encodes an enzyme having aspartate decarboxylase activity.
Oligonucleotides such as these, which serve as probes or primers, can contain more than 30, preferably up to 30, more preferably up to 20, most preferably at least 15 successive nucleotides. Oligonucleotides with a length of at least 40 or 50 nucleotides are also suitable.
The term “isolated” means separated from its natural environment.
The term “polynucleotide” refers in general to polyribonucleotides and polydeoxyribonucleotides, and can denote an unmodified RNA or DNA or a modified RNA or DNA.
The term “polypeptides” is to be understood to mean peptides or proteins which contain two or more amino acids which are bound via peptide bonds.
The polypeptides for use in accord with the teachings herein include polypeptides corresponding to E. coli aspartate decarboxylase, and also includes those, at least 70% of which, preferably at least 80% of which, are homologous with the polypeptide corresponding to E. coli aspartate decarboxylase, and most preferably those which exhibit a homology of least 90% to 95% with the polypeptide corresponding to E. coli aspartate decarboxylase and which have aspartate decarboxylase activity. Thus, the polypeptides may have a homology of from 70% to up to 100% with respect to E. coli aspartate decarboxylase.
The invention also relates to transforming plant cells and plants with polynucleotide sequences which result from E. coli panD gene by degeneration of the genetic code. In the same manner, the invention further relates to DNA sequences which hybridize with E. coli panD gene or with parts of E. coli panD gene. Moreover, one skilled in the art is also aware of conservative amino acid replacements such as the replacement of glycine by alanine or of aspartic acid by glutamic acid in proteins as “sense mutations” which do not result in any fundamental change in the activity of the protein, i.e. which are functionally neutral. It is also known that changes at the N- and/or C-terminus of a protein do not substantially impair the function thereof, and may even stabilize the function.
In the same manner, the present invention also relates to employing DNA sequences which hybridize with E. coli panD gene or with parts of E. coli panD gene. Finally, the present invention relates to DNA sequences which are produced by polymerase chain reaction (PCR) using oligonucleotide primers which result from E. coli panD gene. Oligonucleotides of this type typically have a length of at least 15 nucleotides.
The terms “stringent conditions” or “stringent hybridization conditions” includes reference to conditions under which a polynucleotide will hybridize to its target sequence, to a detectably greater degree than other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing).
Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1M NaCl, 1% SDS (sodium dodecyl sulphate) at 37° C., and a wash in 1× to 2×SSC (20×SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55° C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1M NaCl, 1% SDS at 37° C., and a wash in 0.5x to lXSSC at 55 to 60° C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C.
Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl, Anal. Biochem., 138:267-284 (1984): Tm=81.5° C.+16.6 (log M)+0.41 (% GC)−0.61 (% form)−500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1° C. for each 1% of mismatching; thus, Tm, hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with approximately 90% identity are sought, the Tm can be decreased 10° C. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4° C. lower than the thermal melting point (Tm); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10° C. lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20° C. lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 45° C. (aqueous solution) or 32° C. (formamide solution) it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Current Protocols in Molecular Biology, Chapter 2, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (2000).
Thus, with the foregoing information, the skilled artisan can identify and isolate polynucleotides which are substantially similar to the present polynucleotides utilized in accord with the teachings herein. In so isolating such a polynucleotide, the polynucleotide can be used as the present polynucleotide in, for example, increasing the abiotic stress and/or biomass yield of a plant.
One embodiment of the present invention is methods of screening for polynucleotides which have substantial homology to the polynucleotides of the present invention, preferably those polynucleotides encode a protein having aspartate decarboxylase activity.
The polynucleotide sequences of the present invention can be carried on one or more suitable plasmid vectors, as known in the art for plants or the like.
In one embodiment, it may be advantageous for propagating the polynucleotide to carry it in a bacterial or fungal strain with the appropriate vector suitable for the cell type. Common methods of propagating polynucleotides and producing proteins in these cell types are known in the art and are described, for example, in Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York (1982) and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York (1989).
In another preferred embodiment the polynucleotide comprises E. coli panD gene, polynucleotides which are complementary to E. coli panD gene, polynucleotides which are at least 70%, 80% and 90% identical to E. coli panD gene; or those sequence which hybridize under stringent conditions to E. coli panD gene, the stringent conditions comprise washing in 5×SSC at a temperature from 50 to 68° C. Thus, the polynucleotide may be from 70% up to less than 100% identical to E. coli panD gene.
In another preferred embodiment the polynucleotides of the present invention are in a vector and/or a host cell. Preferably, the polynucleotides are in a plant cell or transgenic plant. Preferably, the plant is selected from the group consisting of wheat, corn, peanut cotton, oat, tobacco, and soybean plant. In a preferred embodiment, the polynucleotides are operably linked to a promoter, preferably an inducible promoter designed for expression in plants.
In another preferred embodiment, the present invention provides a method for making aspartate decarboxylase protein, comprising culturing the host cell carrying the polynucleotides of the invention for a time and under conditions suitable for expression of aspartate decarboxylase, and collecting the aspartate decarboxylase protein.
In another preferred embodiment, the present invention provides a method of making a transgenic plant comprising introducing the polynucleotides of the invention into the plant.
In another preferred embodiment, the present invention provides method of increasing the abiotic stress tolerance of a plant in need thereof, comprising introducing the polynucleotides of the invention into said plant.
In another preferred embodiment, the present invention provides method of increasing the biomass yield of a plant, comprising introducing the polynucleotides of the invention into said plant under conditions where said polynucleotides are expressed.
Methods, vectors, and compositions for transforming plants and plant cells in accordance with the invention are well-known to those skilled in the art, and are not particularly limited. For a descriptive example see Karimi et al., TRENDS in Plant Science, Vol. 7, No. 5, May 2002, pp. 193-195, incorporated herein by reference.
Examples of plant species suitable for transformation with the polynucleotides and methods of the present invention include but are not limited to tobacco (Nicotiana tabacum), potato (Solanum tuberosum), soybean (glycine max), tomato (Lycopersicon esculentum), cassava (Manihot esculenta), beets, peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), citrus trees (Citrus spp.), corn or maize (Zea mays), beans (e.g., green beans (Phaseolus vulgaris) and lima beans (Phaseolus limensis)), peas (Lathyrus spp.), sugarbeet, sunflower, carrot, celery, flax, cabbage and other cruciferous plants, pepper, strawberry, lettuce, alfalfa, oat, wheat, rye, rice, barley, sorghum and canola.
The ability to increase the biomass or size of a plant according to certain invention embodiments would have several important commercial applications. Crop species may be generated that produce higher yields on larger cultivars, particularly those in which the vegetative portion of the plant is edible. For example, increasing plant leaf biomass may increase the yield of leafy vegetables for human or animal consumption. Additionally, increasing leaf biomass can be used to increase production of plant-derived pharmaceutical or industrial products. By increasing plant biomass, increased production levels of the products may be obtained from the plants. Tobacco leaves, in particular, have been employed as plant factories to generate such products. Furthermore, it may be desirable to increase crop yields of plants by increasing total plant photosynthesis. An increase in total plant photosynthesis is typically achieved by increasing leaf area of the plant. Additional photosynthetic capacity may be used to increase the yield derived from particular plant tissue, including the leaves, roots, fruits or seed. In addition, the ability to modify the biomass of the leaves may be useful for permitting the growth of a plant under decreased light intensity or under high light intensity. Modification of the biomass of another tissue, such as roots, may be useful to improve a plant's ability to grow under harsh environmental conditions, including drought or nutrient deprivation, because the roots may grow deeper into the ground. Increased biomass can also be a consequence of some strategies for increased tolerance to stresses, such as drought stress. Early in a stress response plant growth (e.g., expansion of lateral organs, increase in stem girth, etc.) can be slowed to enable the plant to activate adaptive responses. Growth rate that is less sensitive to stress-induced control can result in enhanced plant size, particularly later in development. See U.S. Patent Publication No. 2004/0128712 which is incorporated herein by reference.
EXAMPLE 1 Aspartate α-decarboxylation Prokaryotes have a unique route of β-alanine synthesis through the a-decarboxylation of L-aspartic acid (
Bacterial aspartate decarboxylase is an unusual enzyme. It translates as an inactive precursor protein which goes through self-processing to give α and β subunits (102 and 24 amino acid residues, respectively;
A 429 bp fragment containing the aspartate decarboxylase open reading frame (ORF) was amplified using specific primers from E. coli DH5α genomic DNA as a template. The PCR product was cloned using TOPO-TA cloning kit panD DNA sequence was confirmed by sequencing. The pUC-panD vector complemented an E. coli mutant (strain AB543) defective in β-alanine biosynthesis, which confirmed that the cloned gene is coding for an active aspartate decarboxylase enzyme. This clone was used for further sub-cloning into plant expression vectors.
EXAMPLE 4 Tobacco Leaf Disks TransformationE. coli panD gene was sub-cloned under 35S promoter in pMON-R5 plant expression vector, which has the AAC (3)-III gene that gives the transgenic plant resistance for kanamycin. The generated vector was named pMON-D-A9. The tobacco leaf-disks were maintained under kanamycin selection starting from the third day after the co-cultivation with Agrobacterium and were sub-cultured every 2-3 weeks. No kanamycin-resistant shoots were obtained with the control treatments. A total of 10 and 29 independent putative transgenic plants were generated from the leaf disks infected with Agrobacterium harboring pMON-R5 and pMON-D-A9 vectors respectively. All these plants were maintained under kanamycin till the rooting stage and then moved to the soil.
Genomic DNA from putative panD and pMON-R5 transgenic tobacco plants were isolated for PCR screening with panD specific primers. All the panD putative transgenic plants were positive and amplified the expected 429 bp PCR product confirming the panD insertion, while there was no PCR product with two pMON-R5 transgenic plants (
Total RNA from 22 panD and 4 pMON-R5 putative transgenic plants were analyzed in RNA blots, probed with 32P-labeled DNA of either AAC (3) III (kanamycin resistance gene) or panD. As expected all the samples were positive for AAC (3) III expression. Some of the transgenics had detectable levels of panD expression. The expression levels for the two genes were variable between lines (
The panD gene was amplified with introducing BspH I site on the ATG start codon at the 5′ end and Pvu II site at the 3′ end primers. The PCR product was digested with the two restriction enzymes and cloned directly into Nco I, Pvu II digested pET Blue-2 vector. The panD sequence was placed between the ribosomal binding site right before the panD ATG without any extra amino acids residues and a fusion peptide at the 3′ end that had a His-tag. The resulting vector was named pETB-panD and sequenced. The vector was introduced to BL2 1 -DE3 strain for protein induction with IPTG.
For protein purification, DE3:pETB-panD strain was grown in LB media and when reached 0.8 OD600 the culture was induced with 100 μM IPTG for 3 hours. The harvested cells were extracted with Bug Buster Protein extraction Reagent (Novagen) and the soluble protein was loaded onto 5 ml Ni++ column (Pro Bond purification system, Invitrogen) and eluted with 250 mM Imidazole. The eluted protein was loaded onto 2 ml of DEAE-Sepharose column. The proteins were eluted with liner gradient (0-1M KCl), protein fractions separated on SDS-PAGE and blotted proteins were subject to western analysis (
Tobacco was transformed with Agrobacterium tumefaciens strain ABI carrying (pMON-R5) vector or pMON-R5-panD, which contained E. coli panD gene under the control of CaMV 35S promoter and NOS3′ terminator. A total of 10 and 29 independent putative transformants were obtained for pMON-R5 and pMON-R5-panD constructs respectively based on their kanamycin resistance. In a PCR screen using genomic DNA template and primers specific for the PanD gene, all the panD putative transgenic plants amplified the expected 429 bp band which was not present in vector controls (
Total RNA from 22 panD and 4 pMON-R5 transformants were analyzed in RNA blots, probed with 32P-labeled panD DNA. Fifteen panD transformants showed low, moderate or high levels of the expected ≅1 Kb transcript which was absent in the vector controls (pR1;
Some of the transformants with single panD gene per genome based on DNA blot analysis and positive for gene expression based on RNA blots were grown in a greenhouse and selfed. The progeny from these plants segregated 3:1 for kanamycin resistance: sensitivity in a seedling bioassay, consistent with the single gene insertion (data not shown). Further analyses were done on two lines homozygous for the panD transgene (pD2 and pD7) and a vector control line (pR5) homozygous for the kanamycin resistance gene.
EXAMPLE 6 E. coli ADC Protein Expressed in Transgenic Tobacco is Active Protein extracts from the leaves of pD2 and pD7 showed detectable activities for ADC (
Total free amino acids and β-ala levels in leaves were evaluated using HPLC separation of amino acid-PTC derivatives. Five week old plants were grown either at 24° C. or 35° C. for one week prior to analysis because of a thermotolerance phenotype of the panD lines (see below). At both the temperatures, pD2 and pD7 lines had higher levels of β-ala as a per cent of total amino acids compared to the pR5 and WT lines (Table 1). β-Ala was about 0.4% of the total free amino acids in the control lines and about 0.6% of the total free amino acids in the pD2 and pD7 lines. Compared to the control lines, pD2 and pD7 had about 1.2-1.3× and 2-4× more absolute β-ala levels at 24° C. and 35° C. respectively (Table 1). The total free amino acid level in the panD lines was also elevated about 1.8-3.7× at 35° C. but not at 24° C. (Table 1).
Table 1. Levels of β-ala and total free amino acids in transgenic tobacco expressing E. coli panD gene compared to vector control and wild-type. Fully expanded leaves were sampled from 6-week old seedlings either growing at 24° C. or after at 35° C. for one week right before sampling. Values are means and standard error for three independent analyses.
Temp Genotype ,-Ala Total Free amino acid mnol.g-lfiwt % of Tota. (nol.g- fwt) amino acids 240C WT 17.09 5.5 0.33 O.05 4687 965 pR5 16.78 1.7 0.37 0.07 5023 +1072 pD2 20.59 3.2 0.54 0.06 3699 +170 pD7 21.68 3.6 0.58 0.05 3672 502 35° C. WT 16.6 +0.1 0.41 +0.03 4047 +345 pR5 26.5 +8 0.39 0.03 6178 +1347 pD2 66.1 +0.4 0.62 0.05 10855 +816 pD7 79.4 +10.5 0.59 +0.1 14891 +4127
EXAMPLE 8 Transgenic Expression of ADC Improves Vegetative Biomass In general, young seedlings of pD2 and pD7 lines were larger than the pR5 and WT plants from visual inspection.
To study the high temperature stress effect on transgenic lines, seeds were germinated and seedlings maintained at 24° C. for five weeks and then transferred to environmental growth chambers set at 35° C. After one week of high temperature stress, WT and pR5 plant's height was reduced by 14.8 and 15.1% respectively compared to plants growing at 24° C. (
When seeds of panD lines pD, vector control pR and wild-type seeds were germinated at 30° C., all the lines germinated equally well (data not shown). However, when the imbibed seeds were incubated at 42° C., lines expressing the panD gene germinated better than the vector controls (
(a) Materials
Bacterial media, antibiotics, buffers, protease inhibitors and DEAE-Sepharose were from Sigma (St. Louis, Mo.). Plasmid purification and gel extraction kits were from Qiagen (Valencia, Calif.). U [14C]-L-aspartate (217 mCi.mmol−1) from ICN Biomedicals (Irvine, Calif.) and dGTP (α-32P, 800 Ci mmol−1) from Amersham Bioscience (Piscataway, N.J.) were used without further purification. Gradient SDS-PAGE protein gels, protein molecular weight markers, protein stains and PVDF membranes were from BioRad (Hercules, Calif.). Bacterial expression vector pET-Blue-2 and E. coli BL21 -DE3 were from Novagen (Madison, Wis.). DNA Mr marker, Taq polymerase, dNTPs, restriction enzymes, pCR 2.1-TOPO cloning kit, TRIzol reagent, Pro-Bond Ni-NTA resin, and secondary antibodies were from Invitrogen (Carlsbad, Calif.). Oligonucleotide primers were synthesized by the custom primer synthesis unit of Invitrogen (Carlsbad, Calif.).
(b) Construction of the Expression Vector
E. coli panD open reading frame (ORF) with the start and stop codon (429 bp) was amplified from DH5α genomic DNA using the primers 5′ to 3′CCGAGCTCGACAGGGTAGAAAGGTAGA and CCCCATGGGGGATAACAATCAAGCAACC. The PCR product, cloned in pCR 2.1-TOPO vector, was verified by sequencing. A single point mutation in the clone's ORF converted Cys26 to Tyr. This panD gene was sub-cloned in the right frame into pUC-18 vector under lac promoter. The pUC-panD vector successfully complemented an E. coli mutant defective in β-ala synthesis (ATCC Number AB354), confirming that the cloned gene coded for an active ADC.
The plant expression vector pMON979 contains a multiple cloning site (MCS) between an enhanced CaMV 35S promoter and NOS3′ terminator, a kanamycin resistance selectable marker for plant selection and a spectinomycin resistance gene for bacterial selection. A 34-bp synthetic dsDNA containing BamHI, SacI, HpaI, ApaI, KpnI and EcoRI sites was ligated into the Bg/II and EcoRI sites of the MCS to create pMON-R5. E. coli panD ORF in TOPO-panD vector was digested with EcoRI and sub-cloned into EcoRI digested pMON-R5 plant expression vector to derive pMON-R5-panD. Recombinants with the insert in the correct orientation were identified by restriction analyses.
(c) Agrobacterium-Mediated Transformation of Tobacco
The pMON-R5-panD and pMON-R5 were transferred into Agrobacterium tumefaciens ABI strain via triparental mating (An et al., 1988). Transformation of Nicotiana tabacum cv. Havana 38 (Wisconsin 38) was performed as described previously (An et al., 1988; Rathinasabapathi et al., 1994). Putative transformants were selected based on their resistance to kanamycin (50 mg.L−1) in the media and verified by PCR using panD specific primers.
(d) DNA and RNA Blot Analyses
Genomic DNA (20 μg), extracted using CTAB method (Wong and Taylor 1993), was digested with restriction enzymes, separated by 1.2% (wt/v) agarose gel, and transferred to nylon membranes (Sambrook et al., 1989). Total leaf RNA (20 μg), extracted using TRIzol reagent (Invitrogen, Carlsbad, Calif.), was separated in formaldehyde 1.2% (wt/v) agarose gel, and transferred to nylon membrane (Sambrook et al., 1989). Equal loading of RNA was verified by ethidium bromide staining. A 446 bp of PanD sequence was labeled with [32P]dGTP (800 Ci mmol−1, Amersham BioSciences) using a random primer method (Invitrogen) according to manufacturer's instructions. Hybridization, membrane washing and autoradiography were done as described (Raman and Rathinasabapathi, 2003).
(e) Genetic Analyses and Identification of Homozygous Lines
Primary transgenic lines and wild-type (WT) tobacco were grown in a greenhouse and selfed. Surface sterilized T2 seeds of each line were placed on Petri plates containing half-strength MS salts media supplemented with kanamycin (200mg.L−1). Seeds were germinated at 24° C. under continuous light (40-50 μmole.m2s−1) for 14 d. Seedlings were scored for their resistance to kanamycin and segregation was analyzed using a X2 test. Several T2 lines with single gene segregation for kanamycin resistance were grown in a greenhouse for flowering and their seeds were analyzed for the segregation of the marker. Those lines that did not segregate at T3 generation were considered homozygous.
(f) ADC Expression, Purification and Polyclonal Antibodies
The panD gene was amplified from E. coli DH5α genomic DNA using primers 5′ to 3′ TCATGATTCGCACGATGCTGCCAGG and CAGCTGAGCAACCTGTACCGGAATCGC primers. The BspHI site was introduced on the panD ATG start codon by the forward primer and the Pvu II site was introduced at the 3′end by the reverse primer. The PCR product, generated using Advantage-HF 2 PCR Kit (Clontech; Palo Alto, Calif.) was digested with BspHI and Pvu II and ligated directly into Nco I, Pvu II digested pET-Blue-2 vector generating pET-panD. Recombinant E. coli BL21-DE3 harboring pETB-panD vector or vector control, induced with IPTG, were suspended in BugBuster reagent (Novagen; Madison, Wis.) 5 ml.g−1 wet cells, for total soluble protein extraction. Benzonase (Novagen; Madison, Wis.) 1 μl.ml−1, β-mercaptoethanol 5 mM final concentration and a protease inhibitor cocktail as described (Rathinasabapathi et al., 2001) were added. Affinity purification of the recombinant protein was performed according to the manufacturer's instructions of ProBond resin (Invitrogen; Carlsbad, Calif.). The sample was further purified using a 5 mL DEAE-Sepharose ion-exchange column (Sigma; St. Louis, Mo.). Following protein elution using a 0 to 0.3 M linear NaCl gradient, the purified ADC-His was detected using SDS-PAGE gels. Total protein was estimated by the method of Peterson (1977), and bovine serum albumin was the standard. The purified native ADC was used for raising polyclonal antibodies in rabbit according to manufacturer's protocol (Cocalico Biological, Reamstown, Pa.).
(g) SDS-PAGE and Immunoblot Analyses
SDS-PAGE was performed in 10% to 20% Tris-Tricine gradient PAGE gel (Bio Rad; Hercules, Calif.) or 12% (wt/v) Tris-glycine polyacrylamide gels. Protein samples were diluted with 2× of SDS-PAGE sample buffer containing 0.1 M Tris-HCl, pH 6.8, 4% wt/v SDS, 20% (v/v) glycerol, 5 mM dithiotheritol, and 0.08% (wt/v) bromophenol blue and denatured at 95° C. for 10 min. The separated proteins were visualized with Coomassie Brilliant Blue or silver stain. The SDS-PAGE separated proteins were transferred by electroblotting onto a PVDF membrane. The membranes were incubated with different dilutions of antibodies after blocking with blocking buffer (20 mM Tris-HCl, pH 7.5, 140 mM NaCl, and 5% (wt/v) nonfat dry milk). The primary anti-ADC polyclonal antibodies were used at 1:5000 dilution. The secondary anti-rabbit IgG antibody conjugated to alkaline phosphatase (Sigma, St. Louis, Mo.) was used at a 1:30000 dilution. After washing, binding of the antibody was recorded using a colorimetric substrate. The alkaline phosphatase activity was detected in 10 ml alkaline phosphatase buffer containing 0.1 M Tris-HCl pH 9, 0.1 M NaCl, 5 mM MgCl2, 3.3 mg nitro blue tetrazolium and 1.7 mg bromochloroindolyl phosphate.
(h) ADC Activity Assays
Aspartate decarboxylase was assayed using a radiometric procedure employing 14C-aspartate. The assays contained in 50 mM potassium phosphate, pH 7.0, 1.2 mM of aspartate, 0.2 μCi of 14C aspartate (217 mCi.mmol−1), 5 mM DTT, and crude protein or PEG (25% wt./v)-precipitated fraction in a total volume of 50 μL. Following incubation at 37° C. for 1 h, the reaction was terminated by adding 5 μL of 72% (wt/v) trichloroacetic acid and the proteins were removed by centrifugation at 14000×g for 10 min. Radiolabeled 14C carbon dioxide generated by ADC was trapped during the reaction with Whatman 3 paper saturated with 20% (wt/v) KOH. At the end of the reaction period the reaction products in the reaction mixture were separated from the substrate using thin layer chromatography using cellulose plate (Selecto Scientific, Georgia, USA) developed with solvents butanol: acetic acid: water (60:15:20, v/v/v), followed by autoradiography. The product formed was quantified by isolating the zone corresponding to β-ala. In a variation of the assay, 14Co2 trapped from the assay was quantified in 50% (v/v) Ready Gel (Beckman Instruments, Fullerton, Calif.) in a Beckman liquid scintillation counter. The counting efficiency was 30%.
(i) Germination Tests
Seeds of panD homozygous transgenic lines, vector alone transgenic and wild-type control lines were surface sterilized. Around 100 seeds of each line were placed on 100×15 mm Petri plates containing half-strength MS salts. The plates were incubated in a growth chamber set at 24° C., 30° C., 36° C. or 42° C. under continuous light (20 μmole.m−2s−1). Percent germination was scored over a period of 12 d based on radical emergence.
(j) Growth Tests and High Temperature Stress
For growth analysis and temperature stress, five weeks old seedling of two homozygous transgenic lines, vector control (R5) and WT control lines growing in 350 mL pots at 24° C. were used. The growing medium was Metro-Mix 300 (Scotts-Sierra, Marysville, Ohio) supplemented with 1 g slow-release fertilizer Osmocote (N:P:K 24:6:10, 5.8% ammoniacal N, 5% nitrate N, and 13.2% urea N) per pot. The pots were irrigated to container capacity every day. Seedlings were germinated and maintained in a culture room at 24° C. under 50 μmole.m−2s−1 light intensity 16 h light/8 h dark period for five weeks, then they were transferred to growth chambers adjusted at 24° C., 30° C. or 36° C. with same light period and intensity. After one week, or four weeks, aboveground biomass, plant height, and number of leaves per plant were recorded.
(k) Quantification of Free β-ala and Total Free Amino Acids
Fully expanded leaf (1.0 g fresh wt.) was extracted using a methanol:chloroform:water mixture as described previously (Hanson and Gage 1991). The aqueous fraction was evaporated under a stream of N2, redissolved in water and purified using a Dowex 50-H+ ion exchange resin as described previously (Rhodes et al., 1989). Following pre-column derivatization of amino acids using phenylthiocyanate (PITC), the PTC-amino acid derivatives were separated and quantified by HPLC using Waters 515 HPLC Pump, Waters 717 plus Autosampler, Waters 2410 Refractive Index Detector, and YMC-Pack ODS-AM, S-5 μm, 12 nm 250×4.6 mm I.D. column, as described (Sherwood 2001). Nor-leucine was used as the internal standard. Amino acid derivatives were identified at 254 nm based on retention times for pure standards run under identical conditions.
(l) Statistical Treatment of Data
All experiments were done at least twice with 3-6 replicates per treatment. The data were processed using the analysis of variance in a completely randomized design model using the SAS software (SAS, 2002). The mean separations were done using Duncan's multiple range test at P≦0.05.
REFERENCESAlbert A, Dhanaraj V, Genschel U, Khan G, Ramjee M K, Pulido R, Sibanda B L, Von Delft F, Witty M, Blundell T L, Smith A G, and Abell C (1998). Crystal structure of aspartate decarboxylase at 2.2 Å resolution provides evidence for an ester in protein self-processing. Nat. Struct. Biol., 5: 289-293.
An, G., Ebert, P. R., Mitra, A., Ha, S. B. (1988) Binary vectors. In Plant molecular biology manual (Gelvin, S. B., Schilperoort, R. A. eds). Kluwer, Dordrecht, A3: pp. 1-19.
Chopra S, Pai H, and Ranganathan A (2002). Expression, purification, and biochemical characterization of Mycobacterium tuberculosis aspartate decarboxylase, PanD. Protein Expr. Purif., 25: 533-540.
Cronan, J. E., Jr. (1980). Beta-alanine synthesis in Escherichia coli. J. Bacteriol., 141: 1291-1297.
Gish W and States D J (1993) Identification of protein coding regions by database similarity search. Nature Genetics 3:266-272.
Hanson A D, Rathinasabapathi B, Chamberlin B, Gage D A (1991). Comparative physiological evidence that β-alanine betaine and choline-O-sulfate act as a compatible osmolytes in halophytic Limonium species. Plant Physiol., 97: 306-310.
Merkel W K, Nichols B P (1996) Characterization and sequence of the Escherichia coli panBCD gene cluster, FEMS Microbiol. Lett. 143: 247-252.
Naylor N W, Rabson R, and Tolbert N E (1958). Aspartic-14C acid metabolism in leaves, roots and stems. Physiol. Plant., 11: 537-547.
Raman, S. B., and Rathinasabapathi, B. (2003) β-Alanine N-methyltransferase of Limonium latifolium. cDNA cloning and functional expression of a novel N-methyltransferase implicated in the synthesis of the osmoprotectant β-alanine betaine. Plant Physiol. 132, 1642-1651.
Ramjee M K, Genschel U, Abell C, and Smith A G (1997). Escherichia coli L-aspartate-α-decarboxylase: preprotein processing and observation of reaction intermediates by electrospray mass spectrometry. Biochem. J., 323: 661-669.
Rathinasabapathi, B., McCue, K. F., Gage, D. A. and Hanson, A. D. (1994) Metabolic engineering of glycine betaine synthesis: plant betaine aldehyde dehydrogenases lacking typical transit peptides are targeted to tobacco chloroplasts where they confer betaine aldehyde resistance. Planta 193, 155-162.
Rathinasabapathi B, Fouad W M, and Sigua C A (2001). β-Alanine Betaine Synthesis in the Plumbaginaceae. Purification and Characterization of a Trifunctional, S-Adenosyl-L-Methionine-Dependent N-Methyltransferase from Limonium latifolium Leaves. Plant Physiol., 126: 1241-1249.
Rathinasabapathi B, Sigua C, Ho J, Gage D A (2000). Osmoprotectant β-alanine betaine synthesis in the Plumbaginaceae: S-adenosyl-1-methionine dependent N-methylation of β-alanine via N-methyl β-alanine and N,N-dimethyl β-alanines. Physiol. Plant., 109: 225-231.
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular cloning: A laboratory manual 2nd edn. Cold Spring Harbor Laboratory Press.
The teachings of the references cited throughout the specification are incorporated herein in their entirety by this reference to the extent they are not inconsistent with the teachings herein. It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application.
Claims
1. A method of increasing yield in a plant, comprising expressing aspartate carboxylase in said plant.
2. The method of claim 1, wherein said plant has increased drought tolerance.
3. The method of claim 1, wherein said plant has increased salt tolerance.
4. The method of claim 1, wherein said plant has increased freezing tolerance.
5. The method of claim 1, wherein said aspartate carboxylase has the amino acid sequence of SEQ ID NO: 2.
6. The method of claim 1, wherein said aspartate carboxylase is encoded by a nucleic acid having the sequence of SEQ ID NO: 1.
7. The method of claim 1, wherein said aspartate carboxylase is encoded by a nucleic acid which has a sequence which is at least 70% identical to SEQ ID NO: 1.
8. The method of claim 1, wherein said aspartate carboxylase is encoded by a nucleic acid which has a sequence which is at least 90% identical to SEQ ID NO: 1.
9. The method of claim 1, wherein said aspartate carboxylase is encoded by a nucleic acid which hybridizes under stringent conditions to the complement of SEQ ID NO: 1, wherein said stringent conditions comprise washing in 5.times.SSC at a temperature of form 50 to 68.degree. C.
10. The method of claim 1, wherein the amino acid sequence of said aspartate carboxylase has a homology of at least 80% with SEQ ID NO: 2.
11. The method of claim 1, wherein the amino acid sequence of said aspartate carboxylase has a homology of at least 90% with SEQ ID NO: 2.
12. The method of claim 1, wherein the plant is selected from the group consisting of soybean, rice, tomato, wheat, corn, potato, cotton, oilseed rape, sunflower, alfalfa, clover, sugarcane, turf, banana, blackberry, blueberry, strawberry, raspberry, cantaloupe, carrot, cauliflower, coffee, cucumber, eggplant, grapes, honeydew, lettuce, mango, melon, onion, papaya, peas, peppers, pineapple, pumpkin, spinach, squash, sweet corn, tobacco, watermelon, mint and other labiates, rosaceous fruits, and vegetable brassicas.
13. The method of claim 1, wherein the plant is selected from the group consisting of wheat, corn, peanut, cotton, oat, and soybean.
14. The method of claim 1, wherein the plant is transformed with a vector encoding the said aspartate carboxylase.
15. A plant transformed with a nucleic acid encoding an aspartate carboxylase.
16. The transformed plant of claim 15, having increased biomass.
17. The transformed plant of claim 15 having increased stress tolerance.
18. The transformed plant of claim 17, wherein the plants have increased drought tolerance.
19. The transformed plant of claim 17, wherein the plants have increased salt tolerance.
20. The transformed plant of claim 17, wherein the plants have increased freezing tolerance.
21. The transformed plant of claim 15, wherein said aspartate carboxylase has the amino acid sequence of SEQ ID NO: 2.
22. The transformed plant of claim 15, wherein said aspartate carboxylase is encoded by a nucleic acid having the sequence of SEQ ID NO: 1.
23. The transformed plant of claim 15, wherein said aspartate carboxylase is encoded by a nucleic acid which has a sequence which is at least 70% identical to SEQ ID NO: 1.
24. The transformed plant of claim 15, wherein said aspartate carboxylase is encoded by a nucleic acid which has a sequence which is at least 90% identical to SEQ ID NO: 1.
25. The transformed plant of claim 15, wherein said aspartate carboxylase is encoded by a nucleic acid which hybridizes under stringent conditions to the complement of SEQ ID NO: 1, wherein said stringent conditions comprise washing in 5.times.SSC at a temperature of form 50 to 68 C.
26. The transformed plant of claim 15, wherein the amino acid sequence of said aspartate carboxylase has a homology of at least 80% with SEQ ID NO: 2.
27. The transformed plant of claim 15, wherein the amino acid sequence of said aspartate carboxylase has a homology of at least 90% with SEQ iID NO: 2.
28. The transformed plant of claim 15, wherein the plant is selected from the group consisting of wheat, corn, peanut, cotton, oat, and soybean.
29. A plant cell, transformed with a nucleic acid encoding an aspartate carboxylase.
30. The transformed plant cell of claim 29, wherein said aspartate carboxylase has the amino acid sequence of SEQ ID NO: 2.
31. The transformed plant cell of claim 30 wherein said aspartate carboxylase is encoded by a nucleic acid having the sequence of SEQ ID NO: 1.
32. The transformed plant cell of claim 29, wherein said aspartate carboxylase is encoded by a nucleic acid which has a sequence which is at least 70% identical to SEQ ID NO: 1.
33. The transfonned plant cell of claim 29, wherein said aspartate carboxylase is encoded by a nucleic acid which has a sequence which is at least 90% identical to SEQ ID NO: 1.
34. The transformed plant cell of claim 29, wherein said aspartate carboxylase is encoded by a nucleic acid which hybridizes under stringent conditions to the complement of SEQ ID NO: 1, wherein said stringent conditions comprise washing in 5.times.SSC at a temperature of form 50 to 68.degree. C.
35. The transformed plant cell of claim 29, wherein the amino acid sequence of said aspartate carboxylase has a homology of at least 80% with SEQ ID NO: 2.
Type: Application
Filed: Mar 17, 2005
Publication Date: Aug 2, 2007
Inventors: Bala Rathinasabapathi (Gainesville, FL), Walid Fouad (Gainesville, FL)
Application Number: 10/588,043
International Classification: A01H 1/00 (20060101); C12N 15/82 (20060101); C12N 5/04 (20060101);