TRANSCRIPTION FACTOR ARNTL2 GENE AND EXPRESSION PRODUCTS THEREOF USED IN THE DIAGNOSIS, PREVENTION, AND TREATMENT OF TYPE 1 DIABETES
The present application identifies the involvement of the HIFβ-homologous Arntl2 gene in the control of type 1 (insulin-dependent) diabetes. Accordingly, the present invention provides a method of determining the susceptibility of a subject to developing insulin-dependent diabetes based on the expressing level of the Arntl2 gene. The present invention also provides a method for identifying compounds effective for treating or preventing insulin-dependent diabetes in a subject in need thereof and a method of treating or preventing insulin-dependent diabetes by administering an effective amount of compound identified by the identification method. The present invention also provides a method of enhancing protection against insulitis progression or autoimmune diabetes development in a subject in need thereof comprising, enhancing expression of the Arntl2 gene or modulating the expression of target genes thereof.
Latest INSTITUT PASTEUR Patents:
- Variants of terminal deoxynucleotidyl transferase and uses thereof
- Multi-channel extended depth-of-field method for automated digital cytology
- Methods of treatment of inflammation related conditions using pluripotent anti-inflammatory and metabolic modulators
- Broadly SARS-CoV-2 neutralizing monoclonal antibodies and uses thereof
- Ionic channel modulation as a method for treating tumors through inflammasome activation
1. Field of the Invention
The present application implicates the involvement of the HIFβ-homologous Arntl2 gene in the control of type 1 (insulin-dependent) diabetes. Accordingly, the present invention provides a method of determining the susceptibility of a subject to developing insulin-dependent diabetes based on the expressing level of the Arntl2 gene. The present invention also provides a method for identifying compounds effective for treating or preventing having insulin-dependent diabetes in a subject in need thereof and a method of treating or preventing insulin-dependent diabetes by administering an effective amount of compound identified by the identification method. The present invention also provides a method of enhancing protection against insulitis progression or autoimmune diabetes development in a subject in need thereof comprising, enhancing expression of the Arntl2 gene.
2. Discussion of the Background
Type I or insulin dependent diabetes (IDDM) is an autoimmune disease characterized by the progressive destruction of insulin-producing β-cells of the islets of Langerhans by infiltrating lymphocytes (1, 2). The disease, which affects about 0.3% of the Caucasian population, is both multifactorial and polygenic, with the MHC class II locus and the insulin locus being the two best studied genetic loci (3, 4).
The non-obese diabetes (NOD) mouse (5, 6) is a well-characterized animal model of IDDM. More than twenty murine insulin dependent diabetes susceptibility loci (Idd) have been genetically identified (7), but little information has been obtained about the nature of these non-MHC Idd genes. Construction of congenic strains, differing from the NOD receiver strain by only a selected genetic region derived from a non-diabetes prone parental donor strain (8, 9), is a widely used approach allowing the definition of disease-related candidate regions. A promising strategy for candidate gene identification is to combine a variety of phenotypic studies of congenic mice with expression profiling, haplotype and mutational analysis (10-13).
Several Idd loci have been identified on mouse chromosome 6. (14-16). Recently, the IDDM associated loci Idd6, Idd19, and Idd20 on distal chromosome 6 have been further defined by the analysis of a series of congenic strains, carrying C3H/HeJ genomic material for distal chromosome 6 introgressed onto the NOD/Lt genetic background, with their candidate regions being refined respectively to 4.5, 7 and 4 cM (17).
NOD/Lt alleles at the Idd6 locus on distal mouse chromosome 6 confer susceptibility to IDDM, whilst C57BL/6, C57BL/10 and C3H/HeJ alleles all confer resistance to diabetes (14, 17, 18). The NOD.C3H congenic strain described in this study carries NOD alleles at both the Natural Killer gene complex (18) and the candidate region for the islet-specific BDC-6.9 autoantigen gene (19), which excludes both these loci as responsible for the disease resistance. The Idd6 candidate region does however overlap with the candidate region for the resistance of immature T-cells to dexamethasone (20-22). Idd6 has also been suggested to control low rates of proliferation in immature NOD-thymocytes (23).
Recently we have undertaken a detailed phenotypic analysis of the Idd6 locus containing congenic strain NOD.C3H 6.VIII (17), which shows resistance to the spontaneous development of diabetes. We have shown that this resistance is not ascribable to the resistance of islet β-cells to immune destruction or to a default in pathogenic T cells. Protection of the congenic strain likely involves changes in the proportions of the various leukocyte subsets infiltrating the pancreatic islet, and in particular that of CD4+ T cells. Critical to our understanding of the reduced diabetes susceptibility of the Idd6 congenic mice has been our finding that their splenocytes conferred enhanced disease protection in diabetes transfer assays (24).
However, heretofore, there remained a critical need for the identification of specific genes that control and/or regulate type 1 or insulin dependent diabetes. Additionally, Heretofore, there Remained a Critical Need for the Identification and development of safe therapeutics for treating or preventing type 1 or insulin dependent diabetes.
SUMMARY OF THE INVENTIONTo address the aforementioned critical needs, in the present application the inventors describe the transcriptional profiling of all identified transcripts within the ldd6 interval of the murine model system. A total of six transcripts distributed throughout the interval were found to have strongly altered expression profiles when comparing splenic tissues of the disease protected congenic NOD.C3H 6.VIII and a NOD control strain. Analysis of newly created subcongenic strains showed the presence of at least three diabetes related sub-loci within the Idd6 locus. The recently identified control of disease protection mediated splenocytes was mapped to a 700 kb interval, which contains the Aryl hydrocarbon receptor nuclear translocator-like 2 (Arntl2, Bmal2) encoding gene. This candidate gene was strongly upregulated in the NOD.C3H 6.VIII congenic strain and exhibited a large number of sequence polymorphisms and alternative splice variants. Arntl2 upregulation correlated with the upregulation of the ARNT-binding site containing Pla2g4a gene that has recently been shown to be required for protection against insulitis progression and autoimmune diabetes development. Accordingly, the present invention targets Arntl2 and its downstream targets for controlling type 1 diabetes resistance.
It is an object of the present invention to provide a method of determining the susceptibility of a subject to developing insulin-dependent diabetes by:
a) acquiring a sample from the subject;
b) determining the expression level of the Arntl2 gene in the sample;
c) comparing the expression level of the Arntl2 gene determined in (b) with that of the average expression level of the Arntl2 gene in samples of the corresponding type obtained from the population to which the subject belongs, wherein an expression level of the Arntl2 gene in the subject that is lower than that of the average expression level of the Arntl2 gene is correlated with an increased susceptibility in developing insulin-dependent diabetes.
Another object of the present invention is to provide a method for identifying a compound effective for treating or preventing insulin-dependent diabetes in a subject in need thereof by:
a) acquiring a control sample from a diabetes-sensitive NOD mouse;
b) determining the expression level of the Arntl2 gene in the control sample;
c) administering at least one candidate compound to the diabetes-sensitive NOD mouse;
d) acquiring a test sample from the diabetes-sensitive NOD mouse;
e) determining the expression level of the Arntl2 gene in the test sample; and
e) comparing the expression level of the Arntl2 gene determined in (b) with that determined in (e), wherein an increase in the expression level of the Arntl2 gene in (e) as compared to (b) is correlated with an increase in insulin-dependent diabetes resistance.
It is yet another object of the present invention to provide a method of treating insulin-dependent diabetes in a subject in need thereof by administering an effective amount of a composition containing the compound identified by the method above.
Another object of the present invention to provide a method of preventing insulin-dependent diabetes in a subject in need thereof by administering an effective amount of a composition containing the compound identified by the method above.
It is still another object of the present invention to provide a method of enhancing protection against insulitis progression or autoimmune diabetes development in a subject in need thereof by enhancing expression of the Arntl2 gene in cells of the subject.
It is yet another object of the present invention to provide a method of enhancing protection against insulitis progression or autoimmune diabetes development in a subject in need thereof comprising modulating expression of a target gene of the Arntl2 gene in cells of the subject. Within this object, the target genes may be one or more of Pla2g4a, Gpx, Chi313, and Mpo.
The above objects highlight certain aspects of the invention. Additional objects, aspects and embodiments of the invention are found in the following detailed description of the invention.
A more complete appreciation of the invention and many of the attendant advantages thereof will be readily obtained as the same becomes better understood by reference to the following Figures in conjunction with the detailed description below.
Unless specifically defined, all technical and scientific terms used herein have the same meaning as commonly understood by a skilled artisan in enzymology, biochemistry, cellular biology, molecular biology, and the medical sciences.
All methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, with suitable methods and materials being described herein. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Further, the materials, methods, and examples are illustrative only and are not intended to be limiting, unless otherwise specified.
The Idd6 murine type 1 diabetes locus has been shown to control diabetes by regulating the protective activity of the peripheral immune system as demonstrated by diabetes transfer assays using splenocytes. The analysis of three novel subcongenic NOD.C3H strains has confirmed the presence of at least two diabetes related genes within the 5.4 Mb Idd6 interval with the disease protection conferred by splenocyte co-transfer being located to a 700 kb subregion. This sub-interval contains the circadian rhythm related transcription factor Arntl2 (Bmal2), a homologue of the type 2 diabetes associated ARNT (HIF1β) gene. As shown in the Examples herein, Arntl2 exhibited a six-fold upregulation in spleens of the NOD.C3H 6.VIII congenic strain compared to the NOD control strain, strain-specific splice variants and a large number of polymorphisms in both coding and non-coding regions. Arntl2 upregulation was not associated with changes in the expression levels of other circadian genes in the spleen, but did correlate with the upregulation of the ARNT-binding motif containing Pla2g4a gene, that has recently been described as being protective for the progression of insulitis and autoimmune diabetes in the NOD mouse. The present application provides that the HIF1β-homologous Arntl2 gene is involved in the control of type 1 diabetes.
Both others and we have previously shown that the immune system, notably spleen and thymus, are required for Idd6 mediated disease susceptibility in the NOD mouse. In the present application a systematic transcriptional profiling approach to genes located within the candidate region for the murine type 1 diabetes locus Idd6 is described. In a comparison of the disease protected NOD.C3H congenic strain 6.VIII to its NOD control strain, six genes were found to be differentially expressed in the spleen. We mapped the subphenotype of diabetes disease protection in splenocyte co-transfer assays to a restricted interval of 700 kb by analysis of three newly created NOD.C3H congenic strains. Whilst this region (Idd6.3) contains ten transcripts, only the bHLH-PAS transcription factor superfamily member Arntl2 (Bmal2), a component of the circadian clock pathway, was found to be differentially expressed in the disease protected 6.VIII strain.
Arntl2 contains a large number of NOD/C3H polymorphisms within the 5′UTR, exonic, and 3′UTR sequences of its transcript. Several polymophisms in Arnt2 will lead to changes in its functional domains, and could be expected to influence its dimerization, transcriptional activity and/or specificity. In addition, putative alternative strain-specific splice forms were identified. It has previously been suggested that such alternative splicing of ARNTL2 (BMAL2) might provide tissues with a rheostat capable of regulating CLOCK:BMAL2 heterodimer function across a broad continuum of potential transcriptional activities, and that this might be important in accommodating a variety of metabolic demands and physiological roles (36).
In the Examples of the present application, it is shown that changes in Arntl2 transcript levels are not associated with widespread generalized changes in the expression levels of other circadian and hypoxia-induced genes in spleen. The BMAL-CLOCK heterodimers are however known to activate E-box element-dependent transcription (27) and our microarray analysis and quantitative RT-PCR on spleen samples have revealed the Cytosolic phospholipase A (2)alpha (cPLA (2)alpha), which contains an ARNT binding motif, as a potential downstream target of Arntl2. The Cytosolic phospholipase A(2)alpha (cPLA(2)alpha, Pla2g4a) gene is known to play an important role in arachidonate pathway. Non-obese diabetic (NOD) mice deficient in cPLA(2)alpha show severe insulitis and an increased incidence of diabetes. In the macrophages of these knockout mice, prostaglandin E(2) (PGE(2)) production is decreased and tumour necrosis factor (TNF)-alpha production is increased. Overall the results suggest that cPLA(2)alpha plays a protective role in the progression of insulitis and the development of autoimmune diabetes via suppression of TNF-alpha production from macrophages (37). This observation correlates with our finding that peritoneal macrophages of pre-diabetic 6.VIII mice show a 2.8 fold decrease in Tnf-alpha expression (unpublished data), data that could suggest that Arntl2 may be involved in the control the Tnf-alpha pathway in macrophages of 6.VIII mice.
A more precise understanding of how the upregulation and polymorphisms of the widely expressed Arntl2 gene in the 6.VIII strain interact in the regulation of different aspects of the immune system will benefit from additional studies, in particular as it can be expected that the role of Arntl2 may vary from tissue to tissue and between cell types. For example, it is possible to identify and characterize tissue-specific splice variants that effectuate enhanced effects. In relation with previously described phenotypes for Idd6 whose alleles appear to be involved in the regulation of proliferation and apoptosis in the thymus (22, 23), it is important to note that Arntl2 downregulation was found to enhance cell proliferation (26). Another study has identified Arntl2 as being differentially expressed in various CD4+CD25+ regulatory T cell subpopulations (38). This finding is of interested because CD4+CD25+ T cell activity has been found to be modulated by Idd6 alleles (24).
Of particular interest is recent data showing that a homologue of Arntl2, ARNT (HIF1β) is associated with type 2 diabetes in both human and mouse and as being essential for normal pancreatic beta cell function and insulin production (39, 40). ARNT, also known as the Hypoxia-Inducible Factor 1, heterodimerizes with both BMAL1 and BMAL2 to regulate gene transcription. These and our data implicating Arntl2 in type 1 diabetes in the mouse suggest some communality of genetic and molecular pathways of type 1 and type 2 diabetes, and that ARNT like genes may set the clock for mechanisms of disease protection.
In view of the foregoing, the present invention provides a method of diagnosing the susceptibility of a subject to developing insulin-dependent diabetes by:
a) acquiring a sample from said subject;
b) determining the expression level of the Arntl2 gene in said sample;
c) comparing the expression level of the Arntl2 gene determined in (b) with that of the average expression level of the Arntl2 gene in samples of the corresponding type obtained from the population to which said subject belongs, wherein an expression level of the Arntl2 gene in said subject that is lower than that of the average expression level of the Arntl2 gene is correlated with an increased susceptibility in developing insulin-dependent diabetes.
Within this embodiment, any mammal may be used as the subject. Examples of mammals suitable for use in the present invention include humans, rats, and mice.
In this embodiment, it is preferred that the Arntl2 gene is at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous, and most preferably at least 95% homologous to the sequence of SEQ ID NO: 3. Further, it is preferred that the Arntl2 gene encodes a protein that is at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous, and most preferably at least 95% homologous to the sequence of SEQ ID NO: 4. Still further, it is preferred that the Arntl2 gene product possess aryl hydrocarbon receptor nuclear translocator activity.
In this embodiment, the term “% homologous” includes “% similarity” and “% identity”. Incidentally, it is preferred that the Arntl2 gene is at least 70% identical, preferably at least 80% identical, more preferably at least 90% identical, and most preferably at least 95% identical to the sequence of SEQ ID NO: 3. Further, it is preferred that the Arntl2 gene encodes a protein that is at least 70% identical, preferably at least 80% identical, more preferably at least 90% identical, and most preferably at least 95% identical to the sequence of SEQ ID NO: 4. Still further, it is preferred that the Arntl2 gene product possess aryl hydrocarbon receptor nuclear translocator activity.
Since the Arntl2 gene is found to be ubiquitously expressed (see, for example, Schoenhard et al, Am. J. Physiol Cell Physiol. 2002 July; 283(1):C103-114), within this embodiment, the sample may be obtained from one of several sources. These sources include many other body tissues and/or cells. Particular exemplary cell types include: mucosa, spleen, thymus, blood, and pancreas. The skilled artisan would know how to and would select the most appropriate source for the samples for use in the methods of the present invention.
Preferably, the sample contains at least one type of cells selected from the group consisting of CD4(+) T cells, CD8(+) T cells, B cells, and macrophages. In an aspect of this embodiment, the sample is obtained from the spleen.
Within this embodiment, the sample may be acquired by conventional techniques that are readily known to the skilled artisan. For example, the sample may be obtained by tissue biopsy, a blood sample, or a mucosa sample.
The determination method of the expression level of the Arntl2 gene may be achieved by any known method. For example, it is possible to quantitate the amount of Arntl2 transcripts by quantitative PCR techniques using primers designed based upon the known sequence of the Arntl2 gene. The artisan is referred to Current Protocols in Molecular Biology, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (2000), among other well known treatises for a discussion of standard PCR protocols. Other quantitation techniques that may be used to effectuate the expression level determination include ELISA and/or Western blot techniques.
Within this embodiment, the expression level of the Anrtl2 gene of the candidate subject is compared to that of the average expression level of the Arntl2 gene in splenic samples of the corresponding type (i.e., where the sample from the subject is acquired from the spleen the comparative expression level would be from spleen, etc.) obtained from the population to which said subject belongs. It is also envisioned in the present invention that the sample may be from a variable source (e.g., thymus, spleen, pancreas, blood, mucosa, etc.) while the comparative expression level is that for a known standard source (e.g., blood).
To this end, the basal expression level for each individual member of the population may be obtained via the same procedure as that of the candidate subject. Following collection of a representative number of members in the population to which the candidate subject belongs an average expression level is determined to which the expression level of the candidate subject can be compared. Within this embodiment, it is preferred that the representatives of the population be clinically screened as to their type 1 diabetes status so as to ensure an unbiased population.
As set forth in the Examples of the present application, in subjects that are resistant to diabetes the expression level of the Arntl2 gene is significantly higher than that found in diabetes-sensitive subjects. As such, where the expression level of the Arntl2 gene in the candidate subject is lower than that of the average expression level of the Arntl2 gene this decreased expression may be correlated to an increased susceptibility in developing insulin-dependent diabetes.
In another embodiment of the present invention is a method for identifying a compound effective for treating or preventing insulin-dependent diabetes in a subject in need thereof by:
a) acquiring a control sample from a diabetes-sensitive NOD mouse;
b) determining the expression level of the Arntl2 gene in said control sample;
c) administering at least one candidate compound to said diabetes-sensitive NOD mouse;
d) acquiring a test sample from said diabetes-sensitive NOD mouse after said administering;
e) determining the expression level of the Arntl2 gene in said test sample; and
e) comparing the expression level of the Arntl2 gene determined in (b) with that determined in (e), wherein an increase in the expression level of the Arntl2 gene in (e) as compared to (b) is correlated with an increase in insulin-dependent diabetes resistance.
In this embodiment, it is preferred that the Arntl2 gene is at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous, and most preferably at least 95% homologous to the sequence of SEQ ID NO: 1. Further, it is preferred that the Arntl2 gene encodes a protein that is at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous, and most preferably at least 95% homologous to the sequence of SEQ ID NO: 2. Still further, it is preferred that the Arntl2 gene product possess aryl hydrocarbon receptor nuclear translocator activity.
In this embodiment, the term “% homologous” includes “% similarity” and “% identity”. Incidentally, it is preferred that the Arntl2 gene is at least 70% identical, preferably at least 80% identical, more preferably at least 90% identical, and most preferably at least 95% identical to the sequence of SEQ ID NO: 1. Further, it is preferred that the Arntl2 gene encodes a protein that is at least 70% identical, preferably at least 80% identical, more preferably at least 90% identical, and most preferably at least 95% identical to the sequence of SEQ ID NO: 2. Still further, it is preferred that the Arntl2 gene product possess aryl hydrocarbon receptor nuclear translocator activity.
In a preferred aspect of this embodiment, the control sample is obtained from the spleen of the diabetes-sensitive NOD mouse. Preferably, the control sample contains at least one type of splenic cells selected from the group consisting of CD4(+) T cells, CD8(+) T cells, B cells, and macrophages. Alternatively, it is possible that the foregoing control sample may be obtained from the thymus, pancreas, a blood sample, or a mucosa sample of the diabetes-sensitive NOD mouse.
In a preferred aspect of this embodiment, the test sample is obtained from the spleen of the diabetes-sensitive NOD mouse. Preferably, the test sample contains at least one type of splenic cells selected from the group consisting of CD4(+) T cells, CD8(+) T cells, B cells, and macrophages. Alternatively, it is possible that the foregoing test sample may be obtained from the thymus of the of the diabetes-sensitive NOD mouse. In addition, the test sample may be obtained from other tissue and/or cell sources, such as the pancreas. In addition to a tissue biopsy, the sample may also be acquired from a blood sample or a mucosa sample.
Within this embodiment, the sample may be acquired by conventional techniques that are readily known to the skilled artisan. For example, the sample may be obtained by tissue biopsy, a blood sample, or a mucosa sample.
The determination method of the expression level of the Arntl2 gene may be achieved by any known method. For example, it is possible to quantitate the amount of Arntl2 transcripts by quantitative PCR techniques using primers designed based upon the known sequence of the Arntl2 gene. Examples of suitable PCR primers include the primer pairs represented by SEQ ID NO: 11 (071-248F) and SEQ ID NO: 12 (071-334R) or SEQ ID NO: 13 (AY-56F) and SEQ ID NO: 14 (AY-136R). Additional primers suitable for use are the primer pair: 071-43F—GGGAGGATTGTTAGCACGTCTGTGA (SEQ ID NO: 31) and 071-2122R—the reverse and complementary sequence of 5′-CACTGTACTCTTGAGCACTGTATTG-3′ (SEQ ID NO: 32).
The artisan is referred to Current Protocols in Molecular Biology, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (2000), among other well known treatises for a discussion of standard PCR protocols. Other quantitation techniques that may be used to effectuate the expression level determination include ELISA and/or Western blot techniques.
As set forth in the Examples of the present application, in subjects that are resistant to diabetes the expression level of the Arntl2 gene is significantly higher than that found in diabetes-sensitive subjects. As such, where the expression level of the Arntl2 gene in the test sample as compared to the control sample has increased due to contact with the candidate compound(s), the increased expression level of the Arntl2 gene may be correlated with an increase in insulin-dependent diabetes resistance.
In the context of the present invention a difference in expression level is considered to be “significant” when it is a reproducible and noticeable and/or measurable difference. More preferably, the term “significant” refers to a statistically significant difference. As the skilled artisan would appreciate, statistically significance can be determined by any conventional statistical analysis method. The difference is considered statistically significant when the p-value is 5%, more preferably 1%, and most preferably 0.1%.
Within this embodiment, the candidate compound(s) is not particularly limited. It is envisioned that in the present invention the candidate compound(s) may be a drug, a polynucleotide, a polypeptide, immunogenic fragments of polypeptides, a hormone, etc. or a salt thereof. Further, within this embodiment there is no particular limitation on the number of compounds that may be simultaneously administered to the subject. In other words, a compound may be separately administered or multiple compounds may be administered sequentially or simultaneously. Further, the compounds may be administered as pharmaceutical compositions containing one or more pharmaceutically acceptable carriers, diluents, excipients, and adjuvants, or mixtures of the same.
Also, the present method is adaptable to determining the effect of a wide range of dosage forms and amounts. Therefore, it is envisioned that the compound(s) may be administered via any route including orally, parenterally, intravenously, intradermally, subcutaneously, or topically, in liquid or solid form.
The time between the administration of the candidate compound(s) and the recovery of a test sample may range from instantaneous to minutes to hours to weeks. Further, the administration may be either a single administration or may include multiple repeated administration events prior to recovery of a test compound. For example, the present invention embraces repeated individual administration events of the same (or different compounds) once hourly, every four to six hours, twice daily, once daily, once weekly, etc.
The phrase “effective for treating a subject having insulin-dependent diabetes” or the term “treating” as used herein means that the administration of the compound(s) results in a reduction of symptoms associated with insulin-dependent diabetes or of at least one disorder induced, caused or mediated by insulin-induced diabetes by at least 10%, preferably at least 25%, more preferably at least 50%, still more preferably at least 75%, even more preferably at least 80%, yet more preferably at least 90%, and most preferably at least 95%.
The phrase “effective for preventing a subject having insulin-dependent diabetes” or the term “preventing” as used herein means that the administration of the compound(s) results in a reduction in the likelihood that a subject with a propensity of developing or believed to be at risk for developing insulin-dependent diabetes will indeed develop insulin-dependent diabetes. Preferably, in the context of the present invention, this phrase means that the administration of the compound(s) results in the elimination of the likelihood or probability that a subject with a propensity of developing or believed to be at risk for developing insulin-dependent diabetes will indeed develop insulin-dependent diabetes.
In another embodiment of the present invention is a method of treating insulin-dependent diabetes in a subject in need thereof by administering an effective amount of a composition containing a compound(s) that was determined to be effective for treating a subject having insulin-dependent diabetes by the method of the foregoing embodiment.
In another embodiment of the present invention is a method of preventing insulin-dependent diabetes in a subject in need thereof by administering an effective amount of a composition containing a compound(s) that was determined to be effective for preventing insulin-dependent diabetes in a subject in need thereof having by the method of the foregoing embodiment.
As used in the present application, the term “subject in need thereof” is used to designate the subject as being one with a recognized need for prophylactic and/or therapeutic treatment of at least one disorder induced, caused or mediated by insulin-induced diabetes. Within this embodiment and the present invention as a whole, the subject may be any mammal, including by not limited to: a human, a rat, and a mouse.
Within this embodiment, there is no particular limitation on the number of compounds that may be simultaneously administered to the subject. In other words, a compound may be separately administered or multiple compounds may be administered sequentially or simultaneously. Further, the compounds may be administered as pharmaceutical compositions containing one or more pharmaceutically acceptable carriers, diluents, excipients, and adjuvants, or mixtures of the same.
Also, the present method is adaptable to a wide range of dosage forms and amounts. Therefore, it is envisioned that the compound(s) may be administered via any route including orally, parenterally, intravenously, intradermally, subcutaneously, or topically, in liquid or solid form.
Within this embodiment, the composition may be administered in single or repeated dosages. For example, the composition may be administered once hourly, every four to six hours, twice daily, once daily, once weekly, etc.
Further, the term “effective amount” is any amount that results in the reduction of symptoms associated with insulin-dependent diabetes or of at least one disorder induced, caused or mediated by insulin-induced diabetes by at least 10%, preferably at least 25%, more preferably at least 50%, still more preferably at least 75%, even more preferably at least 80%, yet more preferably at least 90%, and most preferably at least 95%.
However, it is generally preferred that the nature of the compound and the nature of the administration method and dosage be tailored to that determined to be effective by the above-described identification method.
Yet another embodiment of the present invention is a method of enhancing protection against insulitis progression or autoimmune diabetes development in a subject in need thereof comprising modulating expression of a target gene of the Arntl2 gene in cells of said subject.
Suitable targets within the scope of the present invention include Pla2g4a, Gpx, Chi313, and Mpo (see Example 8).
Therefore, in still another embodiment of the present invention is a method of enhancing protection against insulitis progression and/or autoimmune diabetes development in a subject in need thereof by enhancing expression of the Arntl2 gene in the cells of said subject.
This embodiment is based on the observation in the Examples below that Arntl2 upregulation was not associated with changes in the expression levels of other circadian genes in the spleen, but did correlate with the upregulation of the ARNT-binding motif containing Pla2g4a gene, that has recently been described as being protective for the progression of insulitis and autoimmune diabetes in the NOD mouse. The present application provides that the HIFβ-homologous Arntl2 gene is involved in the control of type 1 diabetes. As such, enhancing the expression of the Arntl2 gene in the cells of a subject would be expected to upregulate the expression level of the Pla2g4a gene, which in turn would enhance protection against insulitis progression and/or autoimmune diabetes development.
In accordance with the definition of “subject in need thereof” defined above, within this embodiment, the subject may be any mammal, including but not limited to: a human, a rat, and a mouse.
In this embodiment, it is preferred that the Arntl2 gene is at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous, and most preferably at least 95% homologous to the sequence of SEQ ID NO: 1. Further, it is preferred that the Arntl2 gene encodes a protein that is at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous, and most preferably at least 95% homologous to the sequence of SEQ ID NO: 2. Still further, it is preferred that the Arntl2 gene product possess aryl hydrocarbon receptor nuclear translocator activity.
In this embodiment, the term “% homologous” includes “% similarity” and “% identity”. Incidentally, it is preferred that the Arntl2 gene is at least 70% identical, preferably at least 80% identical, more preferably at least 90% identical, and most preferably at least 95% identical to the sequence of SEQ ID NO: 1. Further, it is preferred that the Arntl2 gene encodes a protein that is at least 70% identical, preferably at least 80% identical, more preferably at least 90% identical, and most preferably at least 95% identical to the sequence of SEQ ID NO: 2. Still further, it is preferred that the Arntl2 gene product possess aryl hydrocarbon receptor nuclear translocator activity.
In this embodiment, it is preferred that the Arntl2 gene is at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous, and most preferably at least 95% homologous to the sequence of SEQ ID NO: 3. Further, it is preferred that the Arntl2 gene encodes a protein that is at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous, and most preferably at least 95% homologous to the sequence of SEQ ID NO: 4. Still further, it is preferred that the Arntl2 gene product possess aryl hydrocarbon receptor nuclear translocator activity.
In this embodiment, the term “% homologous” includes “% similarity” and “% identity”. Incidentally, it is preferred that the Arntl2 gene is at least 70% identical, preferably at least 80% identical, more preferably at least 90% identical, and most preferably at least 95% identical to the sequence of SEQ ID NO: 3. Further, it is preferred that the Arntl2 gene encodes a protein that is at least 70% identical, preferably at least 80% identical, more preferably at least 90% identical, and most preferably at least 95% identical to the sequence of SEQ ID NO: 4. Still further, it is preferred that the Arntl2 gene product possess aryl hydrocarbon receptor nuclear translocator activity.
As stated above, since the Arntl2 gene is found to be ubiquitously expressed (see, for example, Schoenhard et al, Am. J. Physiol Cell Physiol. 2002 July; 283(1):C103-114), within this embodiment and the present invention as a whole, the sample may be obtained from one of several sources. These sources include many other body tissues and/or cells. Particular exemplary cell types include: spleen, thymus, blood, mucosa, and pancreas.
In an aspect of this embodiment, the sample is obtained from the spleen. Preferably, the sample contains at least one type of splenic cells selected from the group consisting of CD4(+) T cells, CD8(+) T cells, B cells, and macrophages.
Within this embodiment, the sample may be acquired by conventional techniques that are readily known to the skilled artisan. For example, the sample may be obtained by tissue biopsy, a blood sample, or a mucosa sample.
As a means of enhancing expression of the Arntl2 gene, the following methods may be mentioned, but are not intended to be an exhaustive list of suitable methods:
-
- overexpression by gene therapy;
- administration of specific drugs that inhibit Arntl2 protein degradation;
- therapy to produce a stable form of Arntl2.
As used herein, the term “Arntl2” is used to designate the polynucleotide sequence of SEQ ID NO: 1 obtained from mice and SEQ ID NO: 3 obtained from humans and homologous sequences coding for polypeptides with the same function as the polypeptides shown by SEQ ID NO: 2 or 4. Specifically, the term “Arntl2” is used to designate the open-reading frame, inclusive of exons and introns. However, it is to be recognized that the protein encoded by the Arntl2 gene would constitute only the exonic regions. Where necessary to distinguish, the present application refers to the mouse Arntl2 gene as “mArntl2” and the human Arntl2 gene as “hArntl2.”
The present invention also includes polynucleotides that hybridize to the complement of the polynucleotide sequence of Arntl2, or homologs and/or fragments thereof, under stringent conditions.
The terms “stringent conditions” or “stringent hybridization conditions” includes reference to conditions under which a polynucleotide will hybridize to its target sequence, to a detectably greater degree than other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing).
Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37° C., and a wash in 1× to 5×SSC, preferably 1× to 2×SSC, (20×SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 68° C., preferably 50 to 55° C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.5× to 1×SSC at 55 to 60° C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C.
Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl, Anal. Biochem., 138:267-284 (1984): Tm=81.5° C.+16.6 (log M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1° C. for each 1% of mismatching; thus, Tm, hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with approximately 90% identity are sought, the Tm can be decreased 10° C. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize hybridization and/or wash at 1, 2, 3, or 4° C. lower than the thermal melting point (Tm); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10° C. lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20° C. lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 45° C. (aqueous solution) or 32° C. (formamide solution) it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Current Protocols in Molecular Biology, Chapter 2, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (2000).
In the context of the present invention, a polynucleotide sequence is “homologous” with the sequence according to the invention if at least 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95% of its base composition and base sequence is identical to the sequence according to the invention (i.e., Arntl2).
Another object of the present invention are the polypeptide sequences encoded by Arntl2, or a homolog thereof. The polypeptides of the present invention exhibit aryl hydrocarbon receptor nuclear translocator activity.
According to the invention, a “homologous protein” or “homologous polypeptide” is to be understood to comprise proteins (polypeptides) which contain an amino acid sequence at least 70% of which, preferably at least 80% of which, more preferably at least 90%, most preferably at least 95% of which corresponds (i.e., is identical and/or similar) to the amino acid sequence encoded by Arntl2. It is particularly preferred that the homologous protein retain at least 50%, preferably at least 70%, more preferably at least 80%, most preferably at least 90% of the residual activity of the wild-type hydrocarbon receptor nuclear translocator activity. The homologous proteins embrace homologous and non-homologous amino acid substitutions, as well as polymorphs and alternative spliced variants.
The expression “homologous amino acids” denotes those that have corresponding properties, particularly with regard to their charge, hydrophobic character, steric properties, etc.
Homology, sequence similarity or sequence identity of nucleotide or amino acid sequences may be determined conventionally by using known software or computer programs such as the BestFit or Gap pairwise comparison programs (GCG Wisconsin Package, Genetics Computer Group, 575 Science Drive, Madison, Wis. 53711). BestFit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981), to find the best segment of identity or similarity between two sequences. Gap performs global alignments: all of one sequence with all of another similar sequence using the method of Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970). When using a sequence alignment program such as BestFit, to determine the degree of sequence homology, similarity or identity, the default setting may be used, or an appropriate scoring matrix may be selected to optimize identity, similarity or homology scores. Similarly, when using a program such as BestFit to determine sequence identity, similarity or homology between two different amino acid sequences, the default settings may be used, or an appropriate scoring matrix, such as blosum45 or blosum80, may be selected to optimize identity, similarity or homology scores. Sequence alignments can also be performed using the Align.ppc program (Mac Molly TetraLite, Mologen) or ClustalW.
One skilled in the art is also aware of conservative amino acid replacements such as the replacement of glycine by alanine or of aspartic acid by glutamic acid in proteins as “sense mutations” which do not result in any fundamental change in the activity of the protein, i.e. which are functionally neutral. It is also known that changes at the N- and/or C-terminus of a protein do not substantially impair the function thereof, and may even stabilize said function.
The term “isolated” means separated from its natural environment.
The term “polynucleotide” refers in general to polyribonucleotides and polydeoxyribonucleotides, and can denote an unmodified RNA or DNA or a modified RNA or DNA. Further, this term embraces recombinant polynucleotides. Of course, this term also embraces salt forms thereof.
The term “polypeptides” is to be understood to mean peptides or proteins that contain two or more amino acids that are bound via peptide bonds. Further, this term embraces recombinant polypeptides. Of course, this term also embraces salt forms thereof.
The present inventors have sequenced the murine gene Arntl2 in the NOD/Lt and C3HHeJ strains and identified polymorphisms between the diabetes sensitive strain NOD/Lt and the diabetes resistant strain C3HHeJ (see Example 6 and
The above written description of the invention provides a manner and process of making and using it such that any person skilled in this art is enabled to make and use the same, this enablement being provided in particular for the subject matter of the appended claims, which make up a part of the original description.
As used above, the phrases “selected from the group consisting of,” “chosen from,” and the like include mixtures of the specified materials.
Where a numerical limit or range is stated herein, the endpoints are included. Also, all values and subranges within a numerical limit or range are specifically included as if explicitly written out.
The above description is presented to enable a person skilled in the art to make and use the invention, and is provided in the context of a particular application and its requirements. Various modifications to the preferred embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the invention. Thus, this invention is not intended to be limited to the embodiments shown, but is to be accorded the widest scope consistent with the principles and features disclosed herein.
Having generally described this invention, a further understanding can be obtained by reference to certain specific examples, which are provided herein for purposes of illustration only, and are not intended to be limiting unless otherwise specified.
EXAMPLES Material and MethodsRNA Preparation, cDNA Synthesis and Microarray Analysis—
Total RNA was prepared using RNABle (Eurobio). Random cDNA synthesis was carried out on 6 μg DNAseI treated total RNA using SuperScript™ II reverse transcriptase (Invitrogen) according to the manufacturer's conditions. For microarray experiments, RNA quality was examined using an Agilent 2100 Bioanalyser (Agilent). DNA-microarrays (8 k mouse cDNA, Agilent) were hybridised using 10 μg of total RNA transcribed in the presence of Cy3-dCTP or Cy5-dCTP, respectively. Data were from four individual experiments, each including a dye swap, were analysed using Feature Extraction and Rosetta resolver software (p<0.05) and annotated using SOURCE software (provided by the Genetics Department, Stanford University).
Northern Blot and Race Experiment—Total RNA of various tissues from the 6.VIII and NOD control strains was separated in TBE on 1% agarose gels containing 1% formaldehyde and transferred on Hybond N+ membranes (Amersham). Northern blots were hybridized using a 3′ NOD cDNA fragment amplified with the Arntl2 specific primers AY-555F 5′-AGGCAACACCAGAGCACTGA-3′ (SEQ ID NO: 5) and AY334R 071-334R 5′-GCCAGGATTACAAAGTGTGCAC-3′ (SEQ ID NO: 6). 5′ and 3′ RACE experiments were performed using both total spleen RNA extracted from NOD CO and 6.VIII strain and the GeneRacer Kit (Invitrogen).
Quantitative PCR—Quantitative PCR was performed on an ABIPRISM 7700 Sequence detector using the SYBR Green PCR Master Mix (PE Biosystems) according to the manufacturer's conditions. Primers were designed using PrimerExpress software and used at optimal concentration. Quantification of the amplification product was carried out using the Standard curve method. For the circadian rhythm analysis we used the ΔCT method and the Gapdh gene expression as reporter. Sequences of the oligonucleotides used were as follows:
DNA fragments were amplified and sequenced from genomic DNA or cDNA of the NOD.C3H strain 6.VIII and the NOD control mice. Polymporphisms were identified by sequence alignment using Megalign (DNASTAR Inc.). Potential transcription factor binding sites were identified by using the MatInspector program, which is available from Genomatix Software GmbH (Munich, Germany) (41).
Construction of Mouse Strains—The subcongenic strains were constructed by intercrossing the Idd6 congenic NOD.C3H 6.VIII strain (6.VIII) and the NOD control congenic strain (CO), both originally derived from crosses between C3H/HeJ and NOD/Lt mice (17). Male mice heterozygous for the Idd6 interval were then backcrossed to the CO strain. Recombinant offspring were selected using the polymorphic markers D6Mit14, D6Mit15, D6Mit294 and D6Mit304. The corresponding subcongenic intervals were fixed by intercrossing of the heterozygous offspring resulting from a backcross to the CO strain.
Diabetes Assessment and Transfer Assays—Spontaneous diabetes incidence was monitored weekly from 10 to 30 weeks of age by assessment of glucosuria (Diabur test, Roche). Splenocyte co-transfer was performed by transferring 107 splenocytes from diabetic NOD mice together with 2×107 splenocytes from seven week old mice of various mouse strains onto five week old NOD/Scid mice. Cumulative diabetes incidence was monitored weekly throughout 10 weeks post transfer.
Statistical Analysis—Statistics were performed by Kaplan-Meier estimation and log-rank test for group comparison. Pooled data from quantitative RT-PCR were compared as mean+/−standard deviation.
Example 1 Refinement of the Idd6 Interval by Haplotype MappingThe original microsatellite based genotyping of the diabetes-resistant Idd6 congenic strain NOD.C3H 6.VIII (strain 6.VIII) indicated that the C3H introgressed donor sequence was located at the end of chromosome 6, distal to the microsatellite marker D6Mit113 (17, 25). Random sampling of potential SNPs listed in the genomic databases identified four polymorphisms located between bps 144,874,468 and 144,874,516 on mouse chromosome 6. These SNPs included a SNP at bp position 144,874,516 associated with a silent amino acid exchange in the Sox5 gene, located distal to D6Mit113 (Ensembl mouse database for Mus musculus) (Table 1). The mapping of these newly identified SNPs allowed the Idd6 locus to be restrained from a 6.1 Mb to a 5.4 Mb interval lying in between the Sox5 locus and the telomere of mouse chromosome 6.
In order to further refine the type 1 diabetes associated Idd6 candidate region localising within 4 cM (5.4 Mb) of distal mouse chromosome 6, we constructed a series of subcongenic strains by intercrossing the Idd6 congenic NOD.C3H 6.VIII strain (6.VIII) and the NOD control congenic strain (CO), that were originally derived from crosses between the C3H/HeJ and NOD/Lt mouse strains. Heterozygous male mice resulting from the intercross were then again backcrossed to the CO strain and recombinants were selected amongst the offspring using the polymorphic markers D6Mit14, D6Mit15, D6Mit294 and D6Mit304 (
We tested the diabetes incidence weekly for all three subcongenic strains in parallel to the parental strains over a period of 30 weeks (
We have previously shown that Idd6 modifies suppression of diabetes in co-transfer assays when using splenocytes. We tested whether this splenocyte sub-phenotype segregates with one or other of the newly derived C3H derived sub-intervals. A total of 2×107 splenocytes from 7 week-old mice were injected into NOD/Scid recipient mice together with 107 total splenocytes from diabetic mice. As expected, injection of the diabetogenic cells alone resulted in the rapid induction of diabetes in the NOD/Scid recipient. Co-transfer of splenocytes inhibited significantly the diabetes transfer in all the groups tested (
Diabetes associated genes are expected to be either functional coding sequence variants or to show differential regulation between diabetes sensitive and a diabetes resistant strains. Detection of functional coding variants would require extensive sequencing efforts throughout the entire 5.4 Mb Idd6 candidate interval, which contains some hundred potential genes, which would likely through up a very large number of sequence variants for evaluation. We turned therefore first to expression analysis for the identification of potential candidate genes responsible for the susceptibility to IDDM. Potential mouse transcripts within Idd6 were identified from the Celera and public databases. Additional information was obtained by examination of the syntenic region to Idd6 in the human genome, which maps to the 12p11-p12.2 chromosomal region (NCBI version 35.1,
Since our previous results had indicated that splenocytes contribute to the disease regulation mediated by Idd6, the expression profiles of potential transcripts in the spleen were examined. Those genes that were expressed in the spleen were then analysed by real time RT-PCR for differential expression in the diabetes-sensitive NOD mice and the diabetic-resistant congenic strain 6.VIII. Spleen samples from both four weeks old and six to seven weeks old mice were chosen in order to capture genes showing differences during the primary stages of disease progression before the onset of overt diabetes. Six transcripts were found to have such differential expression in spleen. These genes were Bcat1, Csac1 (Las1), Arntl2 (Bmal2), a gene of unknown function represented by two EST clones BE647206 and AW120472, Mlstd1 (Ms12), and the predicted transcript mCG1027210 (Celera database) (Table 1).
The 700 kb Idd6.3 interval contains a total of ten genes (
The Arntl2 gene encodes a basic helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) transcription factor and has been functionally linked to circadian clock mediated activities and to the regulation of cell proliferation (26). The Arntl2 gene was expressed in significantly higher amounts in spleen samples obtained from either 4 weeks old or 6-7 weeks old diabetes-resistant strain 6.VIII animals than from diabetes-sensitive NOD mice (
The detailed transcript pattern of Arntl2 in multiple tissues was examined in strain 6.VIII and NOD mice. For most of the organs examined such as brain or lung, the major transcripts identified were 9 kb or 0.6 kb in size. The transcript profiles of the spleen and thymus were however surprisingly varied compared to those of other organs, and additional 3.9 kb and 1.6 kb transcripts were found in both spleen and thymus. A 1.4 kb transcript was exclusively found in thymus. The common 0.6 kb transcript, present in most of organs, was not detected in the thymus (
Prior studies have identified two protein products of Bmal2, Bmal2a and Bmal2b (27) containing respectively 579 and 199 amino acids. While examining the transcripts expressed in spleen of strain 6.VIII and NOD CO mice, a third putative alternative spliced variant, Bmal2c, was identified in a 5′ RACE experiment. This transcript initiated within an intron, 100 nucleotides upstream of the start of exon 7 in the consensus mRNA (AY005163, Arntl2a mRNA). This transcript encoded a 355 amino acid protein containing only the C-terminal half of the full-length protein and was missing both the bHLH and PAS-A domains (
To validate Arntl2 as a candidate gene, we analysed the sequence of its coding, 3′ UTR and 5′ UTR regions for polymorphisms between strain 6.VIII and NOD CO mice. Within exonic regions, one synonymous polymorphism at the wobble position of amino acid 94 (6.VIII: A and NOD mice: G), five non-synonymous polymorphisms and one insertion/deletion were identified (
The 3′ UTR sequences of the Arntl2 gene also showed striking variation. Multiple long insertion/deletions lying between the sequence position 147,759,748, located some 90 nucleotides distal to the stop codon of Arntl2, and the position 147,760,154 on mouse chromosome 6, resulted in major variation of the lengths of the DNA fragments in 6.VIII (409 bp) and in NOD (529 bp). Numerous base substitutions were also identified (
Analysis of the EST clone BY242187 allowed the identification of the upstream 5′UTR sequence of Arntl2. Two additional exons were identified between positions 147,716,951 and 147,717,036 (E1′) and between positions 147,723,827 and 147,723,947 with the E1′ exon locating about 9.4 kb upstream of the ATG. The position of the splice donor of the initial exon of AY005163 was found at position 147,726,370, some 95 nucleotides upstream of the ATG. No polymorphisms were identified within the 5′UTR region. However, numerous SNPs were identified adjacent to the E1′ exon.
The foregoing sequences are and explanatory information is provided in
The circadian expression of Arntl2 (Bmal2) in spleen was examined in mice housed under a cycle of fourteen hours artificial light and ten hours obscurity. These settings were identical to that used when diabetes incidence was monitored. Whilst splenic expression of Bmal2 oscillated moderately during the day, the differences in transcript level between strain 6.VIII and the NOD control were maintained over the whole 24-hour period (
In addition, the plasminogen activator inhibitor 1 (PAI-1) gene, a downstream circadian output gene regulated by Bmal2 in vitro (30), did not display strain specific differences in its transcription level (
From microarray experiments using pooled spleen samples from four eight-week old pre-diabetic females we concluded that the replacement of the 5.4 Mb Idd6 interval by C3H alleles resulted in a deregulation of about 5% of the transcriptome in 6.VIII mice compared to CO mice. We selected 7 downregulated and 14 upregulated transcripts with known or potential immune function to test whether their expression difference in spleen of 6.VIII mice would correlate with that of Arntl2.
Real-time RT-PCR using pooled RNA from 6-7 week-old females confirmed the microarray results for two of the downregulated and nine of the upregulated genes that showed fold changes in excess of 1.5. Highest upregulation in the 6.VIII mice was found for the Chitinase 3-like 1 (Chi311) (5.6 fold), the Myeloperoxidase (Mpo) (2.1 fold), and Cytosolic phospholipase A2 (Pla2g4a) (1.7 fold) genes. When the genes were subject to detailed transcriptional analysis using spleen samples from mice of different ages, the hypoxia-involved Pla2g4a gene (34, 35) showed a particular interesting expression as it was, like Arntl2, upregulated in strain 6.VIII at all ages (
A potential ARNT binding site (TGCGTG) was identified +101 to +106 of its transcription start site, which indicated that Pla2g4a might be a direct target of Arntl2. Similar to Arntl2, Pla2ga4a expression was upregulated in different splenic cell population, including CD4(+) T cells, CD8(+) T cell, B cells, and macrophages. We analysed its circadian profile and showed that whilst the expression of Pla2g4a oscillated mildly, the variation between strain 6.VIII and CO mice was maintained throughout the day (
The present inventors were interested in exploring the adequacy of ex vivo systems in the characterization of the candidate gene. To this end the present inventors have undertaken studies on the RAW264.7 cell macrophage line and several other currently used mouse cell lines. The present inventors have been able to show that these cell lines can be used for the systematic testing of RNAi constructs cloned into the pSUPER vector system (Oligogene) prior to their sub-cloning into lentiviral vectors. The RAW264.7 is of particular interest for some of these studies because it can also be used for functional studies of the mediated Arntl2 pathways.
In these experiments, transient transfection using the lipofection method (jetPEI™ transfection reagent, Polyplus) of the RAW264.7 cell line results in about a 60% reduction of gene expression, when tested on Arntl2. Stable integrants can be expected to show about 90% reduction of expression. Arntl2 downregulation resulted in deregulation of other genes, known to be involved in diabetes development.
Numerous modifications and variations on the present invention are possible in light of the above teachings. It is, therefore, to be understood that within the scope of the accompanying claims, the invention may be practiced otherwise than as specifically described herein.
REFERENCES
- 1. Bottazzo, G. F., Todd, I., Mirakian, R., Belfiore, A. and Pujol-Borrell, R. (1986) Organ-specific autoimmunity: a 1986 overview. Immunol Rev, 94, 137-69.
- 2. Tisch, R. and McDevitt, H. (1996) Insulin-dependent diabetes mellitus. Cell, 85, 291-7.
- 3. Todd, J. A. and Wicker, L. S. (2001) Genetic protection from the inflammatory disease type 1 diabetes in humans and animal models. Immunity, 15, 387-95.
- 4. Serreze, D. V. and Leiter, E. H. (2001) Genes and cellular requirements for autoimmune diabetes susceptibility in nonobese diabetic mice. Curr Dir Autoimmun, 4, 31-67.
- 5. Makino, S., Kunimoto, K., Muraoka, Y., Mizushima, Y., Katagiri, K. and Tochino, Y. (1980) Breeding of a non-obese, diabetic strain of mice. Jikken Dobutsu, 29, 1-13.
- 6. Hattori, M., Buse, J. B., Jackson, R. A., Glimcher, L., Dorf, M. E., Minami, M., Makino, S., Moriwaki, K., Kuzuya, H., Imura, H. et al. (1986) The NOD mouse: recessive diabetogenic gene in the major histocompatibility complex. Science, 231, 733-5.
- 7. Deruytter, N., Boulard, O. and Garchon, H. J. (2004) Mapping non-class II H2-linked loci for type 1 diabetes in nonobese diabetic mice. Diabetes, 53, 3323-7.
- 8. Prochazka, M., Serreze, D. V., Worthen, S. M. and Leiter, E. H. (1989) Genetic control of diabetogenesis in NOD/Lt mice. Development and analysis of congenic stocks. Diabetes, 38, 1446-55.
- 9. McAleer, M. A., Reifsnyder, P., Palmer, S. M., Prochazka, M., Love, J. M., Copeman, J. B., Powell, E. E., Rodrigues, N. R., Prins, J. B., Serreze, D. V. et al. (1995) Crosses of NOD mice with the related NON strain. A polygenic model for IDDM. Diabetes, 44, 1186-95.
- 10. Wicker, L. S., Todd, J. A. and Peterson, L. B. (1995) Genetic control of autoimmune diabetes in the NOD mouse. Annu Rev Immunol, 13, 179-200.
- 11. Rogner, U. C. and Avner, P. (2003) Congenic mice: cutting tools for complex immune disorders. Nat Rev Immunol, 3, 243-52.
- 12. Lyons, P. (2002) Gene-expression profiling and the genetic dissection of complex disease. Curr Opin Immunol, 14, 627.
- 13. Eckenrode, S. E., Ruan, Q., Yang, P., Zheng, W., McIndoe, R. A. and She, J. X. (2004) Gene Expression Profiles Define a Key Checkpoint for Type I Diabetes in NOD Mice. Diabetes, 53, 366-75.
- 14. Ghosh, S., Palmer, S. M., Rodrigues, N. R., Cordell, H. J., Hearne, C. M., Cornall, R. J., Prins, J. B., McShane, P., Lathrop, G. M., Peterson, L. B. et al. (1993) Polygenic control of autoimmune diabetes in nonobese diabetic mice. Nat Genet, 4, 404-9.
- 15. de Gouyon, B., Melanitou, E., Richard, M. F., Requarth, M., Hahn, I. H., Guenet, J. L., Demenais, F., Julier, C., Lathrop, G. M., Boitard, C. et al. (1993) Genetic analysis of diabetes and insulitis in an interspecific cross of the nonobese diabetic mouse with Mus spretus. Proc Natl Acad Sci USA, 90, 1877-81.
- 16. Melanitou, E., Joly, F., Lathrop, M., Boitard, C. and Avner, P. (1998) Evidence for the presence of insulin-dependent diabetes-associated alleles on the distal part of mouse chromosome 6. Genome Res, 8, 608-20.
- 17. Rogner, U. C., Boitard, C., Morin, J., Melanitou, E. and Avner, P. (2001) Three loci on mouse chromosome 6 influence onset and final incidence of type 1 diabetes in NOD.C3H congenic strains. Genomics, 74, 163-71.
- 18. Carnaud, C., Gombert, J., Donnars, O., Garchon, H. and Herbelin, A. (2001) Protection against diabetes and improved NK/NKT cell performance in NOD.NK1.1 mice congenic at the NK complex. J Immunol, 166, 2404-11.
- 19. Dallas-Pedretti, A., McDuffie, M. and Haskins, K. (1995) A diabetes-associated T-cell autoantigen maps to a telomeric locus on mouse chromosome 6. Proc Natl Acad Sci USA, 92, 1386-90.
- 20. Leijon, K., Hammarstrom, B. and Holmberg, D. (1994) Non-obese diabetic (NOD) mice display enhanced immune responses and prolonged survival of lymphoid cells. Int Immunol, 6, 339-45.
- 21. Penha-Goncalves, C., Leijon, K., Persson, L. and Holmberg, D. (1995) Type I diabetes and the control of dexamethazone-induced apoptosis in mice maps to the same region on chromosome 6. Genomics, 28, 398-404.
- 22. Bergman, M. L., Duarte, N., Campino, S., Lundholm, M., Motta, V., Lejon, K., Penha-Goncalves, C. and Holmberg, D. (2003) Diabetes protection and restoration of thymocyte apoptosis in NOD Idd6 congenic strains. Diabetes, 52, 1677-82.
- 23. Bergman, M. L., Penha-Goncalves, C., Lejon, K. and Holmberg, D. (2001) Low rate of proliferation in immature thymocytes of the non-obese diabetic mouse maps to the Idd6 diabetes susceptibility region. Diabetologia, 44, 1054-61.
- 24. Rogner, U. C., Lepault, F., Gagnerault, M. C., Vallois, D., Morin, J., Avner, P. and Boitard, C. (2006) The Diabetes Type I Locus Idd6 Modulates Activity of CD4+CD25+ Regulatory T-Cells. Diabetes, 55, 186-92.
- 25. Grimm, C. H., Rogner, U. C. and Avner, P. (2003) Lrmp and Bcat1 are candidates for the type I diabetes susceptibly locus Idd6.Autoimmunity, 36, 241-246.
- 26. Yeh, C. T., Lu, S.C., Tseng, I. C., Lai, H. Y., Tsao, M. L., Huang, S. F. and Liaw, Y. F. (2003) Antisense overexpression of BMAL2 enhances cell proliferation. Oncogene, 22, 5306-14.
- 27. Okano, T., Yamamoto, K., Okano, K., Hirota, T., Kasahara, T., Sasaki, M., Takanaka, Y. and Fukada, Y. (2001) Chicken pineal clock genes: implication of BMAL2 as a bidirectional regulator in circadian clock oscillation. Genes Cells, 6, 825-36.
- 28. Atchley, W. R. and Fitch, W. M. (1997) A natural classification of the basic helix-loop-helix class of transcription factors. Proc Natl Acad Sci USA, 94, 5172-6.
- 29. Chavali, G. B., Vijayalakshmi, C. and Salunke, D. M. (2001) Analysis of sequence signature defining functional specificity and structural stability in helix-loop-helix proteins. Proteins, 42, 471-80.
- 30. Schoenhard, J. A., Smith, L. H., Painter, C. A., Eren, M., Johnson, C. H. and Vaughan, D. E. (2003) Regulation of the PAI-1 promoter by circadian clock components: differential activation by BMAL1 and BMAL2. J Mol Cell Cardiol, 35, 473-81.
- 31. Hogenesch, J. B., Gu, Y. Z., Moran, S. M., Shimomura, K., Radcliffe, L. A., Takahashi, J. S. and Bradfield, C. A. (2000) The basic helix-loop-helix-PAS protein MOP9 is a brain-specific heterodimeric partner of circadian and hypoxia factors. J Neurosci, 20, RC83.
- 32. Garayoa, M., Martinez, A., Lee, S., Pio, R., An, W. G., Neckers, L., Trepel, J., Montuenga, L. M., Ryan, H., Johnson, R. et al. (2000) Hypoxia-inducible factor-1 (HIF-1) up-regulates adrenomedullin expression in human tumor cell lines during oxygen deprivation: a possible promotion mechanism of carcinogenesis. Mol Endocrinol, 14, 848-62.
- 33. Makino, Y., Nakamura, H., Ikeda, E., Ohnuma, K., Yamauchi, K., Yabe, Y., Poellinger, L., Okada, Y., Morimoto, C. and Tanaka, H. (2003) Hypoxia-inducible factor regulates survival of antigen receptor-driven T cells. J Immunol, 171, 6534-40.
- 34. Ichinose, F., Ullrich, R., Sapirstein, A., Jones, R. C., Bonventre, J. V., Serhan, C. N., Bloch, K. D. and Zapol, W. M. (2002) Cytosolic phospholipase A (2) in hypoxic pulmonary vasoconstriction. J Clin Invest, 109, 1493-500.
- 35. Bazan, N. G. and Lukiw, W. J. (2002) Cyclooxygenase-2 and presenilin-1 gene expression induced by interleukin-1beta and amyloid beta 42 peptide is potentiated by hypoxia in primary human neural cells. J Biol Chem, 277, 30359-67. Epub 2002 Jun. 5.
- 36. Schoenhard, J. A., Eren, M., Johnson, C. H. and Vaughan, D. E. (2002) Alternative splicing yields novel BMAL2 variants: tissue distribution and functional characterization. Am J Physiol Cell Physiol, 283, C103-14.
- 37. Oikawa, Y., Yamato, E., Tashiro, F., Yamamoto, M., Uozumi, N., Shimada, A., Shimizu, T. and Miyazaki, J. (2005) Protective role for cytosolic phospholipase A2alpha in autoimmune diabetes of mice. FEBS Lett, 579, 3975-8.
- 38. Fontenot, J. D., Rasmussen, J. P., Williams, L. M., Dooley, J. L., Farr, A. G. and Rudensky, A. Y. (2005) Regulatory T cell lineage specification by the forkhead transcription factor foxp3. Immunity, 22, 329-41.
- 39. Gunton, J. E., Kulkarni, R. N., Yim, S., Okada, T., Hawthorne, W. J., Tseng, Y. H., Roberson, R. S., Ricordi, C., O'Connell, P. J., Gonzalez, F. J. et al. (2005) Loss of ARNT/HIF1beta mediates altered gene expression and pancreatic-islet dysfunction in human type 2 diabetes. Cell, 122, 337-49.
- 40. Levisetti, M. G. and Polonsky, K. S. (2005) Diabetic pancreatic beta cells ARNT all they should be. Cell Metab, 2, 78-80.
- 41. Cartharius, K., Frech, K., Grote, K., Klocke, B., Haltmeier, M., Klingenhoff, A., Frisch, M., Bayerlein, M. and Werner, T. (2005) MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics, 21, 2933-42. Epub 2005 Apr. 28.
- 42. Grand, E. K., Grand, F. H., Chase, A. J., Ross, F. M., Corcoran, M. M., Oscier, D. G. and Cross, N. C. (2004) Identification of a novel gene, FGFR1OP2, fused to FGFR1 in 8p11 myeloproliferative syndrome. Genes Chromosomes Cancer, 40, 78-83.
- 43. Akashi, H., Han, H. J., Iizaka, M., Nakajima, Y., Furukawa, Y., Sugano, S., Imai, K. and Nakamura, Y. Isolation and characterization of a novel gene encoding a putative seven-span transmembrane protein, TM7SF3, 305-9.
- 44. Tudor, M., Murray, P. J., Onufryk, C., Jaenisch, R. and Young, R. A. (1999) Ubiquitous expression and embryonic requirement for RNA polymerase II coactivator subunit Srb7 in mice. Genes Dev, 13, 2365-8.
Claims
1. A method of determining the susceptibility of a subject to developing insulin-dependent diabetes comprising:
- a) acquiring a sample from said subject;
- b) determining the expression level of the Arntl2 gene in said sample;
- c) comparing the expression level of the Arntl2 gene determined in (b) with that of the average expression level of the Arntl2 gene in samples of the corresponding type obtained from the population to which said subject belongs, wherein an expression level of the Arntl2 gene in said subject that is lower than that of the average expression level of the Arntl2 gene is correlated with an increased susceptibility in developing insulin-dependent diabetes.
2. The method of claim 1, wherein said subject is a human.
3. The method of claim 1, wherein said Arntl2 gene is at least 90% homologous to the sequence of SEQ ID NO: 3.
4. The method of claim 1, wherein said Arntl2 gene is at least 95% homologous to the sequence of SEQ ID NO: 3.
5. The method of claim 1, wherein said sample comprises splenic cells.
6. The method of claim 5, wherein said splenic cells are at least one type selected from the group consisting of CD4(+) T cells, CD8(+) T cells, B cells, and macrophages.
7. A method for identifying a compound effective for treating or preventing insulin-dependent diabetes in a subject in need thereof comprising:
- a) acquiring a control sample from a diabetes-sensitive NOD mouse;
- b) determining the expression level of the Arntl2 gene in said control sample;
- c) administering at least one candidate compound to said diabetes-sensitive NOD mouse;
- d) acquiring a test sample from said diabetes-sensitive NOD mouse after said administering;
- e) determining the expression level of the Arntl2 gene in said test sample; and
- e) comparing the expression level of the Arntl2 gene determined in (b) with that determined in (e), wherein an increase in the expression level of the Arntl2 gene in (e) as compared to (b) is correlated with an increase in insulin-dependent diabetes resistance.
8. The method of claim 7, wherein said control sample is acquired from the spleen of said diabetes-sensitive NOD mouse.
9. The method of claim 8, wherein said test sample is acquired from the spleen of said diabetes-sensitive NOD mouse.
10. The method of claim 7, wherein said control sample is acquired from the thymus of said diabetes-sensitive NOD mouse.
11. The method of claim 10, wherein said test sample is acquired from the thymus of said diabetes-sensitive NOD mouse.
12. The method of claim 7, wherein said Arntl2 gene is at least 90% homologous to the sequence of SEQ ID NO: 1.
13. The method of claim 7, wherein said Arntl2 gene is at least 95% homologous to the sequence of SEQ ID NO: 1.
14. The method of claim 7, wherein said sample comprises at least one type of splenic cells selected from the group consisting of CD4(+) T cells, CD8(+) T cells, B cells, and macrophages.
15. The method of claim 7, wherein said determining comprises quantitative PCR.
16. The method of claim 15, wherein said quantitative PCR utilizes the primer pair represented by SEQ ID NO: 11 and SEQ ID NO: 12.
17. The method of claim 15, wherein said quantitative PCR utilizes the primer pair represented by SEQ ID NO: 13 and SEQ ID NO: 14.
18. The method of claim 15, wherein said quantitative PCR utilizes the primer pair represented by SEQ ID NO: 31 and the reverse complementary sequence of SEQ ID NO:32.
19. A method of treating insulin-dependent diabetes in a subject in need thereof comprising administering an effective amount of a composition comprising a compound identified by the method of claim 7.
20. The method of claim 19, wherein said subject in need thereof is a human.
21. A method of preventing insulin-dependent diabetes in a subject in need thereof comprising administering an effective amount of a composition comprising a compound identified by the method of claim 7.
22. The method of claim 21, wherein said subject in need thereof is a human.
23. A method of enhancing protection against insulitis progression or autoimmune diabetes development in a subject in need thereof comprising, enhancing expression of the Arntl2 gene in cells of said subject.
24. The method of claim 23, wherein said cells are splenic cells.
25. The method of claim 24, wherein said splenic cells are at least one type selected from the group consisting of CD4(+) T cells, CD8(+) T cells, B cells, and macrophages.
26. The method of claim 23, wherein said Arntl2 gene is at least 90% homologous to the sequence of SEQ ID NO: 3.
27. The method of claim 23, wherein said Arntl2 gene is at least 95% homologous to the sequence of SEQ ID NO: 3.
28. The method of claim 23, wherein said method is a method of enhancing protection against insulitis progression.
29. The method of claim 23, wherein said method is a method of enhancing protection against autoimmune diabetes development.
30. A method of enhancing protection against insulitis progression or autoimmune diabetes development in a subject in need thereof comprising modulating expression of a target gene of the Arntl2 gene in cells of said subject.
31. The method of claim 30, wherein said target gene is selected from the group consisting of Pla2g4a, Gpx, Chi313, and Mpo.
Type: Application
Filed: Feb 27, 2007
Publication Date: Jul 16, 2009
Applicant: INSTITUT PASTEUR (Paris)
Inventors: Philip Avner (Paris), Ute Christine Rogner (Paris), Ming-Shiu Hung (Taoyuan)
Application Number: 12/280,822
International Classification: A61K 31/7088 (20060101); C12Q 1/68 (20060101);