TRPV1 + SENSORY NEURONS CONTROL OF BETA-CELL STRESS AND ISLET INFLAMMATION IN DIABETES
A process is disclosed for controlling inflammatory tissue access through release of neuropeptides, such as substance P (sP), to insulin-responsive sensory neurons, whereby simultaneous control of insulin sensitivity/resistance is manifested. In models of Type 1 and Type 2 diabetes, sensory afferents, in particular TRPV1, have fundamental roles in insulin/glucose homeostasis, islet physiology and autoimmune tissue inflammation. By manipulation of the TRPV1 neuro-β-cell circuit or enhancement of pancreatic sP levels, normalization of insulin resistance, clearance of inflammation and prevention of both Type 1 and Type 2 diabetes is realized.
Latest The Hospital for Sick Children Patents:
This invention generally relates to nervous system involvement in the manifestation of insulitis and diabetes; particularly to the mechanisms of the transient receptor potential vanilloid-1 receptor (TRPV1), as such mechanism relates to clear chronic inflammatory cell infiltrations; and most particularly to the use of Substance P, or similar neuropeptides from sensory afferent neurons, as agents effective for the normalization of elevated insulin resistance and for the rapid resolution of tissue inflammation and infiltration by immune cells.
BACKGROUND OF THE INVENTIONType 1 diabetes (T1D) is an autoimmune disease observed in many mammalian species, governed by multiple genetic and environmental risk factors. Overt diabetes reflects glucose intolerance due to insulin deficiency. It is the end result of prediabetes, with progressive lymphoid infiltration around and then inside pancreatic islets of Langerhans, and subsequent destruction of insulin-producing β-cells by autoreactive T lymphocytes (Anderson and Bluestone, 2005). T1D is characterized by a permissive immune system that fails to impose tolerance to arrays of self-antigens. Although the initiating events are not fully understood, β-cell stress and β-cell death in the course of early islet restructuring are thought to provide sensitizing autoantigens which expand autoreactive T cell pools in pancreatic lymph nodes (Mathis et al., 2001; Rosmalen et al., 2002; Trudeau et al., 2000; Zhang et al., 2002).
Self-antigens targeted in T1D are expressed in β-cells and, in most cases, elsewhere in the body. They prominently include neuronal antigens, recognized by T cells with pathogenic potential (Salomon et al., 2001; Winer et al., 2001). It is unclear why, in T1D, T cells infiltrate only islets and their associated glia (Winer et al., 2003). It is also unclear whether autoimmunity and islet inflammation are related to hyperinsulinism and insulin resistance typical for even young NOD mice (Amrani et al., 1998; Chaparro et al., 2006).
There is evidence for functional interactions between nervous and immune systems (e.g. (Wang et al., 2003)), but connections between islet autoimmunity and the nervous system remain ill defined (Carrillo et al., 2005). The interface between nervous system, external and tissue environments is the primary sensory afferent neuron. Primary afferents also have efferent function through local release of mediators such as neuropeptides (e.g. substance P, sP and CGRP). There is evidence that islets may be innervated by primary sensory neurons, but their local function is uncertain (Ahren, 2000).
SUMMARY OF THE INVENTIONWith regard to Type I diabetes, it is known that T-cell-mediated death of pancreatic β-cells leads to insulin deficiency, although the mechanism behind what attracts and restricts broadly autoreactive lymphocyte pools to the pancreas remains unclear. The data disclosed herein point to a fundamental role for insulin-responsive TRPV1+ sensory neurons in β-cell function diabetes pathoetiology.
The instant inventors have now determined that in diabetes-prone NOD mice, the role of insulin-responsive TRPV1+ sensory neurons plays a role in the regulation of both islet autoimmunity and of β-cell stress from insulin resistance. The instant disclosure demonstrates that eliminating these neurons prevents islet inflammation and diabetes, whereas systemic, pathogenic T-cells autoreactivity persists. Additionally, it has been determined that the insulin resistance and β-cell stress of prediabetic NOD mice fail to develop when TRPV1+ neurons are eliminated. TRPV1NOD in the Idd4.1 T1D-risk locus, is a hypo-functional mutant, mediating depressed neurogenic inflammation.
It is herein demonstrated that delivering a mediator of neurogenic inflammation, substance P, by intra-arterial injection into the NOD pancreas rapidly reverses islet inflammation, abnormal insulin resistance and diabetes for several weeks in animals with sufficient P-cell reserve. Concordantly, TRPV1-knockout significantly enhances insulin-sensitivity, while insulitis/diabetes-resistant NODxB6Idd4 congenic mice, carrying wild type TRPV1, show restored TRPV1 function and insulin sensitivity.
Accordingly, it is a primary objective of the instant invention to demonstrate the relationship between the presence of TRPV1+ sensory afferent neurons, and the manifestation of insulitis and diabetes.
It is a further objective of the instant invention to demonstrate that elimination of these neurons, in a selective manner, is effective to prevent islet inflammation and diabetes (both Type I and Type II), although systemic, pathogenic T-cell autoreactivity nevertheless persists.
It is yet another objective of the instant invention to demonstrate that appropriate delivery of a mediator of neurogenic inflammation, such as Substance P, is effective, at least transiently, to rapidly reverse islet inflammation, abnormal insulin resistance and Type I and Type II diabetes, in subjects with sufficient β-cell reserve.
It is a still further objective of the invention to demonstrate that an insufficiency in the release of Substance P results in manifestation of insulin resistance and the development of both Type I and Type II diabetes.
Other objects and advantages of this invention will become apparent from the following description taken in conjunction with any accompanying drawings wherein are set forth, by way of illustration and example, certain embodiments of this invention. Any drawings contained herein constitute a part of this specification and include exemplary embodiments of the present invention and illustrate various objects and features thereof.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
It is known that a prominent subset of sensory neurons expresses the Transient Receptor Potential Vanilloid-1 (TRPV1) protein, a non-specific cation channel that was first identified as the receptor for capsaicin (Caterina et al., 2000; Prescott and Julius, 2003). It is further known that TRPV1+ neurons are of importance in proinflammatory reactions (O'Connor et al., 2004), and that islet infiltrating lymphocytes express receptors for neuropeptides (Persson-Sjogren et al., 2005). Thus, the instant inventors set out to investigate the possibility that these sensory neurons may have a role in T1D.
Results: TRPV1+ Sensory Afferents Control Onset of Islet Inflammation & Diabetes
Using immunofluorescence, it was observed that murine islets are associated with meshworks of TRPV1+ fibers (
Islet infiltration by hematopoietic inflammatory cells begins by 4-5 wk of age, accumulating at the peri-islet Schwann cell (pSC) border; the autoimmune destruction of the pSC mantle is extensive by 8 wks of age, 2 months before the onset of overt diabetes (Winer et al., 2003). In NODcaps mice, islet infiltrations were significantly reduced, compared with NODctrl (
It was observed that NOD mice spontaneously develop a Sjögren-like disease (sialitis/lacrimitis) which is under genetic controls separate from diabetes (Boulard et al., 2002; Cha et al., 2002). NODcaps mice exhibited the same submandibular lymphocyte infiltrates as untreated controls (
The observed effects of capsaicin treatment on islet infiltration and disease development could either reflect a failure to generate islet autoreactive T cell pools, a block of tissue accumulation for relevant immune cell pools or a change in regulatory mechanisms. Capsaicin was reported to affect some immune functions in other animal models (Chancellor-Freeland et al., 1995; Helme et al., 1987; Nilsson et al., 1991; Santoni et al., 1996). To investigate the possible effect of capsaicin on immune functions or development in the NOD mouse, we compared systemic (
In contrast, pancreatic NODcaps lymph node tissue contained significantly reduced proportions and absolute numbers of CD8+ and of activated CD8+CD69+ effector T lymphocytes, cells critical for islet destruction (DiLorenzo et al., 1998) (
Conceivably, undetected abnormalities in the NODcaps immune system might have influenced T cell pathogenicity and diabetes development. However, NODcaps animals that did develop disease showed insulitis and spleen cells from these animals transferred T1D with normal kinetics to lymphocyte-free NOD.scid recipients that were not treated with capsaicin (
We also compared the ability of splenocytes from randomly selected NODcaps and NODctrl to initiate insulitis in such NOD.scid mice. NODcaps and NODctrl splenocytes initiated insulitis equally (
Low dose cyclophosphamide accelerates NOD diabetes by multiple mechanisms (Hadaya et al., 2005). Low dose cyclophosphamide accelerated diabetes development in both NODcaps and NODctrl (p=ns,
Collectively, our observations separate loss of self-tolerance from target tissue invasion as distinct elements of T1D pathogenesis and they demonstrate that the NODcaps immune system retains pathogenic potential. TRPV1+ sensory neurons thus appear critical for the immune cell accumulation in the pancreas.
NOD TRPV1 is PolymorphicThe above findings identify an important role of TRPV1+ primary afferent neurons in the initiation and progression of islet inflammation and T1D. TRPV1 maps to the Idd4.1 NOD diabetes-risk sublocus on mouse chromosome 11, into an approximately 0.3 cM interval downstream of D11 Ndsl (
Congenic replacement of the NOD Idd4 locus with the homologous B6 genomic interval protects from insulitis and, consequently, diabetes, although splenocytes from these congenic animals transfer both, insulitis and diabetes to NOD.scid mice (Grattan et al., 2002). The NOD Idd4 risk locus differs from the homologous genomic region in the insulitis- and diabetes-resistant NOR strain, that carries nearly 90% of the NOD genome, including histocompatibility genes and most other T1D risk loci (Ivakine et al., 2005; Serreze et al., 1994).
We cloned and sequenced TRPV1 cDNA from NOD and NOR mouse dorsal root ganglia (DRG), and confirmed selected sequence regions in NOD and NOR genomic DNA. The NOR TRPV1 was identical to the published wild type (B6 and DBA) sequence, but the NOD sequence has two in-frame base exchanges, leading to predicted P322->A322 and D734->E734 amino acid replacements (
Further investigation allowed us to determine whether the sequence differences in TRPV1NOD might cause abnormalities of TRPV1 function. The innervation of skin by TRPV1+ sensory afferents allowed assessment of potential functional differences by whole-animal experiments in which these afferents were stimulated by cutaneous capsaicin application (
The depressed NOD acute nociceptive and neurogenic inflammatory responses were not due to ongoing autoimmune inflammation, since NOD.scid mice, which lack lymphocytes, were not different from NOD (
To assess TRPV1 function more directly, we recorded capsaicin-evoked Ca2+ responses in dorsal root ganglion (DRG) neurons from NOD and NOR mice (
The most direct readout of TRPV1 function are stimulus-evoked current responses, and we found that capsaicin-evoked whole-cell currents were significantly smaller in DRG neurons from NOD mice as compared with NOR mice (
Because of the depressed TRPV1 function, we measured TRPV1 protein expression in DRGs and found that the basal TRPV1 protein level in NOD mice was lower than that in NOR (
We reasoned that abnormal TRPV1 function might selectively lead to islet pathology, if there was a local, disease-predisposing TRPV1 effect on β-cell function, and if that effect was removed in NODcaps mice. The insulin-rich islet milieu represents a unique environment for TRPV1+ nerve terminals, as they express insulin receptors and insulin sensitizes and lowers the activation threshold of TRPV1 channels (Van Buren et al., 2005). Based on the diminished capsaicin-evoked neurogenic inflammation in NOD mice, and the reduced TRPV1 expression and function, we hypothesized that release of mediators of neurogenic inflammation from the peripheral terminals of sensory neurons may be depressed in these mice. One of the principal mediators of neurogenic inflammation is the neuropeptide, substance P (sP) (O'Connor et al., 2004), and consistent with reduced release we found that sP levels were elevated in NOD compared with NOR dorsal root ganglia, the location of substance P synthesis (
If depressed sP release was critical for NOD islet pathology, then increasing pancreatic sP levels is predicted to relieve the pathogenic process. We therefore injected sP via the pancreatic artery.
Analogous observations were made following pancreatic i.a. injection of sP into newly diabetic NOD mice, 2-3 d after diagnosis. Following sP administration, and without insulin therapy, over half of the i.a. injected diabetics normalized blood glucose levels (
Abundant expression of the NK1R sP receptor has been reported for islet infiltrating lymphocytes (Persson-Sjogren et al., 2005), and, therefore, one likely target for sP is activated pancreatic T cells. We detected NK1R expression on a portion of T cells from pancreatic lymph nodes (
To determine the in vivo effect of pancreatic i.a. sP injection on clonal T cell expansion in pancreatic lymph node, we used islet reactive, BDC2.5 T cell receptor transgenic T cells after labeling with the fluorescent dye, CFSE (Ji et al., 1999). Cells were transferred into 12 wk-old, normoglycemic NOD females which had received pancreatic i.a. or systemic i.v. sP (red lines) or vehicle injections 12-16 hr prior (
Taken together, the data suggest that reduced neuropeptide release by pancreatic TRPV1+ nerve terminals is a pathogenic event in NOD diabetes, amenable to therapeutic correction.
TRPV1 Function and B-Cell Stress1-cell stress has previously been suggested as an early element of T1D pathoetiology, thus an additional objective of this work became the determination of whether the hypofunctional TRPV1NOD is related to signs of b-cell stress, hyperinsulinism and abnormal glucose clearance, observed even in young NOD mice (Rosmalen et al., 2000; van de Wall et al., 2005). We compared measures of β-cell function in untreated and in capsaicin treated NOD.scid mice, and in C57/BL6J (‘B6’) and B6.TRPV1−/− mice, the latter with a normal complement of sensory afferent neurons but absent TRPV1 expression (Caterina et al., 2000). NOD.scid mice were used to ascertain absence of lymphoid islet infiltrations in NOD experiments, CD1 mice provided controls (
The high-normal serum glucose levels after i.p. glucose challenge in 10-12 wk old NOD.scidctrl mice were significantly reduced in NOD.scidcaps mice (
B6 mice develop elevated insulin resistance and type 2 diabetes-like disease (Parekh et al., 1998), attributed to the functional deletion of nicotinamide transhydrogenase (Freeman et al., 2006). Consistently, we observed high blood glucose levels after standard i.p. glucose challenge (
To more directly assess if both data sets could reflect enhanced insulin sensitivity due to TRPV1 removal, we measured glucose clearance after a single insulin injection. Compared to their respective control animals, NODcaps and B6.TRPV1−/− mice showed significantly enhanced and accelerated glucose clearance, which we interpreted as evidence for reduced insulin resistance due to the absence of TRPV1 in these two independent animal models. Similar outcomes in NODcaps and B6.TRPV1−/− mice link the observed effects on β-cell function to TRPV1. Enhanced insulin resistance associated with TRPV1NOD constitutes a persistent β-cell stress, likely worsening with progressive islet inflammation (Nielsen et al., 2004). TRPV1 and TRPV1+ sensory neurons impact insulin homeostasis in these models of Type 1 and Type 2 diabetes.
Congenic Replacement of NOD.Idd4As a test of our conclusions that TRPV1 plays a fundamental role in islet inflammation and insulin homeostasis, we investigated NOD.B6.Idd4-congenic mice (
These NOD congenic mice resemble NODcaps mice, as both are insulitis/diabetes protected, although their T cells transfer diabetes to NOD.scid recipients. TRPV1NOD adds elevated insulin resistance as new, strikingly diabetes-relevant phenotype to the NOD Idd4.1 risk locus, presently associated only with insulitis; transgenic rescue experiments will be required for formal proof that TRPV1 is or is not the Idd4.1 diabetes risk gene.
Experimental Methods MiceNOD, NOD.scid, BDC2.5 TCR transgenic NOD mice (‘BDC2.5-NOD’), NOD-β2mnull, C57BL/6 (‘B6’), B6-TRPV1null, NOR NODxB6 Idd4 congenic mice (NOD.B6-(D11Nds1-D11Mit325)/DelJ) were obtained from the Jackson Laboratories (Bar Harbor, Me.) and maintained under approved protocols in our vivarium (NOD female diabetes incidence: 85-90%). For removal of TRPV1+ neurons, 50 mg/kg capsaicin (20 μL, Sigma, St. Louis, Mo.) was subcutaneously injected into 2 d-old mice with no signs of adverse effects (NODcaps). Control mice (NODctrl) received 20 μL vehicle (10% ethanol, 10% Tween, 80% saline). In adoptive transfer experiments, splenocytes from 4-6 diabetic NOD females were pooled and 107 cells/mouse were injected (100 μL i.v.) into irradiated (300 rad) 6- to 8 wk-old NOD.scid recipients. Diastix strips were used to screen for glucosuria (Bayer HealthCare), diabetes was confirmed by diabetic blood glucose measurements on 2 consecutive days (>13.8 mM/l; SureStep, Life Technologies Inc., Burnaby, British Columbia, Canada).
Delayed type hypersensitivity (DTH): DTH responses were elicited after sensitizing 6 wk old mice with 7% TNCB in 4:1(vol/vol) acetone/olive oil. Abdomens were shaved and 100 μl of the allergen were applied. 6 d later, the baseline thickness of right ears were measured by gauge before application of 10 μl 1% TNCB in oil or carrier only. Ear thickness was re-measured in sensitized and naïve animals 24 hr later.
T-Cell StudiesSpienocytes from 3- to 24 wk-old NOD females were cultured (4×105 cells/well) in AIM V serum-free medium (Life Technologies) containing antigen (0.002-50 μg/ml), baculovirus-derived human GAD65 (Diamyd Diagnostics, Stockholm, Sweden), human GFAP (>90% pure) and bovine S100b (>98% pure; Calbiochem, San Diego, Calif.) were purchased, other antigens were previously generated and described (Winer et al., 2003). After 72 hrs, cultures were pulsed (1 μCi, [3H]thymidine/18 hrs) and counted by liquid scintillation. Lymph node assays were similar, but used 2×105 lymph node cells plus 2×105 irradiated (1,100 rad), syngeneic splenocytes/well. To normalize pooled data, we calculated a stimulation index (SI, cpm antigen stimulated/medium control), background counts were <1500 cpm in spleen cell and <1000 cpm in lymph node cultures. In some proliferation studies, plate-bound anti-CD3 (0.001-3 μg/ml; BD PharMingen) and anti-CD28 (0.2 μg/ml; BD PharMingen) were used to stimulate CD4+T-cells negatively selected from NOD β2 mnull splenocytes in the presence of substance P.
Intra-Arterial Pancreas InjectionAnimals were anaesthetized with isoflurane and the aorta developed with minimal trauma to ligate above and below the celiac artery. A 32G needle was used to inject Evans Blue (3 mg/kg/100 μl; Sigma), substance P (2 nmol/100 μl; Sigma) or saline into the aorta just prior to the celiac branching. Ligations are released after closure of the injection site. For insulitis studies, pancreata from treated mice were obtained 48-72 hr after pancreas injection treatment and histology performed. In diabetes reversal experiments, newly diagnosed NOD female mice were treated with either saline or substance P and followed without exogenous insulin treatment.
5- and 6-Carboxyl-Fluorescien Succimidyl Ester (CFSE) LabelingFor dye dilution in vivo clonal expansion studies, splenic CD4+ T-cells from NOD-BDC2.5 females were isolated by negative selection (Stemcell Technologies, Vancouver, Canada) and incubated with 2.5 μM CFSE (10′/37° C., Molecular Probes, Eugene, Oreg.) in PBS. Prediabetic (12 wk) NOD females pretreated 12 hr prior with substance P or saline, were injected i.v. with 3×106 CFSE-labeled CD4+ T-cells in sterile PBS.
Immunofluorescence and HistologyFrozen murine pancreas sections were fixed in 4% paraformaldehyde, blocked with 5% normal donkey serum (Jackson), and stained with polyclonal rat or goat antibodies against GFAP (Signet Pathology Systems, Dedham, Mass.), polyclonal rabbit anti-TRPV1 (Oncogene) or guinea-pig antibody against insulin (DAKO, Carpinteria, Calif.). Bound antibodies were detected with biotinylated donkey anti-guinea pig or rat IgG (1:200, Jackson), Streptavidin AlexaFluor 546 or 633 (1:300, Molecular Probes, Eugene, Oreg.), and FITC conjugated donkey anti-rabbit IgG (1:25, Jackson). When the biotin-streptavidin system was used, sections were also blocked using an avidin/biotin blocking kit (Vector, Burlingame, Calif.). TRPV1 staining was performed on snap-frozen sections of NOD female pancreas with an overnight incubation of primary antibody at 4° C. To score insulitis severity, pancreata were fixed in 10% buffered formalin for a minimum of 24 hr. Histological sections were stained with hematoxylin and eosin and three blinded observers scored at the following scale: 0, normal islet; 1, peri-insulitis or encroachment of <25% of the islet surface area; 2, infiltration of 25-50% of the islet surface area; 3, infiltration of >50% of the islet surface area (Winer et al., 2003). Spleen and lymph node cells were stained with either 2 nM PE-conjugated NRP-V7/H-2 Kd or TUM/H-2 Kd tetramers, the latter a negative control, in FACS buffer (1% v/v FBS, 0.1% w/v NaN3 in PBS) at 4° C. for 1 hr, followed by staining with FITC-conjugated anti-CD8 mAb (clone 53-6.7; 5 μg/μL) and PerCP-conjugated anti-B220 Ab (clone RA6-3B2; 2 μg/μL, both from BD Pharmingen). Tetramer positivity was analyzed on gated CD8+B220-cells and reported as percentage of cells binding the NRP-V7/H-2 Kd tetramer minus the percentage of cells binding the negative control, TUM/H-2 Kd tetramer.
Flow CytometryLymphocytes from thymus, pancreatic/axillary lymph nodes and spleen were stained with FITC, PE, and APC conjugated antibodies to CD3, CD4, CD8, CD44, CD25, CD69 CD62L and FoxP3 (BD Pharmingen, not all combinations are shown). NK-1R and Vβ4 antibodies were obtained from Novus Biologicals (Littleton, Colo.) and Cedarlane (Hornby, Canada), respectively. Live events were collected based on forward- and side-scatter profiles on a FACScan flow cytometer (BD) and analyzed using FlowJo software (Stanford University).
Molecular CloningPCR amplification was performed with cDNA from NOD, NOR, and B6 dorsal root ganglia using TRPV1 specific primers. Forward: 5′ATGGAGAAATGGGCTAGCTTAG3′, reverse: 5′TCATTTCTCCCCTGGGGCCATGG3′. We cloned TRPV1 cDNA using the TOPO®XL PCR Cloning Kit (Invitrogen, Mississauga, ON). Genomic fragments of polymorphic TRPV1 regions were cloned using genomic DNA and the following primers: 5′ATGGAGAAATGGGCTAGCTTAG3′, 5′TGTTGTCAGCTGTGTTATCTGCC3′, 5′TTCAGCCATCGCAAGGAGTA3′, and 5′TCATTTCTCCCCTGGGGCCATGG3, 3-5 independent clones from each mouse strain were sequenced with reproducible results.
RT-PCR: Trizol (Sigma) was used for mRNA extraction from tissues. RT reactions used SuperScript™II RnaseH-reverse transcriptase (Invitrogen): forward
Male NOD, NOR, NOD.scid and NOD.B6.Idd4-congenic mice, 5-10 wk old, were used for behavioral and paw volume measurements. All behavioral tests were conducted between 9:00 and 16:00 hr. Before testing, mice were allowed to acclimatize to the testing environment for 30 minutes and to the testing apparatus for 1 hr. Paw thermal withdrawal thresholds were measured with a paw thermal stimulator system (UCLA, San Diego, Calif.). The stimulus current was maintained at 4.8 amperes while a 24 second cut-off was used to limit possible tissue damage. The tail-flick assay was conducted using a tail-flick analgesia meter (Columbus Instruments). Paw volumes were measured using a commercially available plethysmometer (Ugo Basile) and values were standardized by expression as a percentage of individual preinjection volumes, to accommodate the variation in body weights. Capsaicin (0.1 μg/10 μl) was injected s.c. into the plantar part of mouse hind paw. Capsaicin induced biting/licking time was recorded for the first 5 minutes. Paw withdrawal thresholds were measured 15 min following capsaicin, and paw volume was measured 45 min following capsaicin injection. NODcaps and NODctrl thermosensitivity was analyzed by standard heated (56° C.) plate assay, measuring time to biting/licking response.
Ca2+ Response MeasurementDorsal root ganglia from male NOD, NOR mice and NOD.B6.Idd4-congenic (5-10 wk) were isolated and cultured in F12 medium (Invitrogen) with 10 ng/mL nerve- and 10 ng/mL glial-derived nerve growth factor. Cultures were used 3-5 d after plating. The Ca2+-sensitive fluorophore, fura-2 (Molecular Probes, Eugene, Oreg.), was used to assess [Ca2+]i by ratiometric measurement. Excitation (340 and 380 nm) was generated by a xenon arc lamp and passed through a high-speed, computer-controlled, variable-wavelength monochromator. This light was transmitted to the recording dish via a fiberoptic cable. Emitted light was directed through a 510 nm bandpass filter and detected by an intensified CCD camera. Image data were analyzed off-line. Each 340 nm image was divided, on a pixel-by-pixel basis, by the corresponding 380 nm image, producing a ratio. Averaged values of the ratios within each region of interest were plotted as a function of time.
Electrophysiological Recording of TPRV1 CurrentsWhole-cell patch-clamp recordings were performed 3-5 d after preparation of DRG neurons. Standard bath solution contained (in mM): 140 NaCl, 5 KCl, 2 CaCl2, 10 HEPES, and 10 glucose, pH 7.4 (adjusted with NaOH). Pipette solution contained (in mM): 140 CsF, 10 BAPTA, 1 CaCl2, 2 MgCl2, 10 HEPES and 4 K2ATP, pH 7.3, osmolarity 300 mosM. All patch-clamp experiments were performed at room temperature. TRPV1 currents were recorded using an Axopatch 1-D amplifier, data were digitized with DigiData 1322, filtered (2 kHz), and acquired by the pClamp9.0 program. Recordings in which the series resistance varied by more than 10% were rejected.
ImmunoblottingDRG or dorsal horns (spinal cord) were dissected and immediately frozen at −80° C. Upon thawing, they were homogenized in lysis buffer (in mM: 20 Tris, pH8, 137 NaCl, 2 EDTA, 1 sodium vanadate, 5 NaF, 1 phenylmethanesulfonyl fluoride (PMSF), glycerol 10%, Nonidet P-40 1%, SDS 1%, anti-pain 10 μg/mL, leupeptin 10 μg/mL, pepstatin 10 μg/mL, all Sigma) at 4° C. Total protein (45 μg DRG protein, 30 μg spinal cord) were electrophoresed (10% acrylamide gels), western blotted, probed overnight with rabbit anti-TRPV1 antibody (1:250, Oncogene) and developed with the ECL kit (Amersham). As a loading control for each lane, membranes were stripped and reprobed with mouse anti-β actin antibody (1:4000, Sigma). Densitometric analysis employed NIH Image-J software.
StatisticsAll tests were 2-tailed, significance was set at 5%. Life tables, t-tests (flow cytometry), ANOVA and Fisher's exact test were used as described in the text.
CONCLUSIONSIn summary, in the different, independent animal strains and experimental conditions analyzed, TRPV1 emerges as a central controller of both islet stress and T cell infiltration. Elimination of TRPV1+ neurons by capsaicin, transient functional normalization by acute local sP injection or replacement with wild type TRPV1 in Idd4 congenics all have the same, islet-specific outcomes: normalized insulin sensitivity and abrogation of insulitis, despite unimpeded generation of autoreactive lymphocytes that can transfer disease to untreated NOD hosts.
One explanation which unifies these observations is a local feedback interaction between β-cells and the primary sensory neurons innervating the islets (
With specific reference to
Neonatal capsaicin treatment suppresses NOD islet infiltration and local expansion of diabetogenic T-cells without detectable impairment of global T-cell function, including typical NOD autoreactivity. The treatment normalizes β-cell stress as measured through insulin sensitivity and glucose responses. We have mapped this effect to the TRPV1NOD gene in the Idd4 diabetes risk region, and shown that that TRPV1NOD is a hypo-functional mutant with considerable reduction in TRPV1 signaling, expression and downstream release of neuropeptides. Focusing on one major neuropeptide secreted by TRPV1+ neurons, sP, we demonstrate that sP has a direct deleterious effect on T cells, most expressing detectable NK1R sP receptors following activation.
A direct neuropeptide effect for β-cells has previously been reported, with deleterious outcomes at low concentrations, but β-cell augmenting effects at higher concentrations (Barakat et al., 1994; Bretherton-Watt et al., 1992; Hermansen and Ahren, 1990). Our hypothesis, based on the foregoing, that in NOD mice suppressed neuropeptide secretion is a pathogenic event, was positively answered through two independent approaches: removal of TRPV1+ neurons and local i.a. pancreas injection with sP, both of which evidenced similar results.
Pancreas sP injection normalized all parameters tested: clearing of insulitis lesions, enhancement of insulin sensitivity and consequent reversal of overt diabetes that lasted for a period of weeks. This methodology is in marked contrast to the only other strategy to reverse NOD diabetes, which is toxic immunosuppression with anti-CD3 antibodies, now also in clinical trials with human diabetics (Keymeulen et al., 2005).
When viewed in their totality, our findings are inconsistent with the view that diabetes is due solely to immunological and endocrine abnormalities. Rather, our observations demonstrate that the nervous system, in particular TRPV1+ primary afferent neurons, have a critical role in diabetes pathoetiology. Analogous findings in NODcaps, NOD.Idd4 congenics and in TRPV1 knockout mice add strength to our conclusions, as does an earlier report demonstrating that another TRPV1-dependent neuropeptide, CGRP, prevents diabetes when transgenically overexpressed in the islet (Khachatryan et al., 1997).
We have recently generated preliminary evidence for insulitis and diabetes protection by selective trans-section of sensory nerves innervating the pancreas, providing yet another line of support for the role of TRPV1+ sensory neurons in T1D pathoetiology.
The mapping of several NOD disease-associated phenotypes to a single, mutant protein, TRPV1, implies that TRPV1+ sensory afferents are key elements for normal islet physiology, opening broad new areas of research including insulin resistance, which remains a challenge after decades of intense investigation (LeRoith and Gavrilova, 2006), that recently has included sensory nervous system elements (Moesgaard et al., 2005).
The data generated to date has enabled us to identify the molecular mechanism that translates a system-wide genetic TRPV1 defect into pancreas-specific disease. TRPV1+ sensory neurons express high affinity insulin receptors, insulin potentiates TRPV1 currents (Van Buren et al., 2005), and lowers TRPV1 thermal activation thresholds (Sathianathan et al., 2003). At body temperature, the insulin-rich islet milieu should generate tonic TRPV1 current activation with associated neuropeptide release impacting on basal insulin secretion, a local control circuit first envisioned over a decade ago (Hermansen and Ahren, 1990). In NOD mice, this sensory nerve terminal-β-cell circuit has gone astray, with disease prevention through either its removal, or through sufficient localized supply of the deficient neuropeptide or a neuropeptide offering an equivalent mode of action.
Our data demonstrates that TRPV1+ sensory afferents control pancreatic tissue access for immune cells, which may occur through modifying their immigration, residence, emigration or a combination of these elements. It is likely that progressive islet infiltration will also compound β-cell stress, which we believe is central to T1D, including attraction of autoreactive T cell pools. There is human disease precedence for a role of sensory neurons controlling lymphocyte tissue access, since rare patients without sensory nerves (CIPA syndrome) succumb to massive infections with little tissue infiltration, despite normal in vitro immune functions (Indo et al., 1996).
We discovered mutations in the coding sequence of TRPV1NOD gene contained within the Idd4 diabetes risk locus (Grattan et al., 2002; Ivakine et al., 2005; McAleer et al., 1995). NOD.B6.Idd4 congenic mice show normalized behavioral, electrophysiological and insulin-resistance phenotypes. Intriguingly, the TRPV1 locus is contained within other overlapping autoimmune loci (eae7, orch3, streptozotocin sensitivity) (Babaya et al., 2005; Butterfield et al., 1999; Butterfield et al., 1998), raising the possibility that TRPV1 may play a role in other autoimmune conditions. Indeed, B6 mice, relatively resistant to streptozotocin-induced T1D, show increased diabetes susceptibility in B6.TRPV1−/− mice (data not shown).
In conclusion, our collective findings identify TRPV1+ sensory neurons as important elements of diabetes pathoetiology, with effects that are suggestive of possible mechanisms of the tissue-selectivity of the disease, its links to p-cell physiology, stress and insulin resistance. Our observations open the possibility that sensory nerve dysfunction may contribute to prediabetes initiation and progression in diabetes-prone humans.
All patents and publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains. All patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.
It is to be understood that while a certain form of the invention is illustrated, it is not to be limited to the specific form or arrangement herein described and shown. It will be apparent to those skilled in the art that various changes may be made without departing from the scope of the invention and the invention is not to be considered limited to what is shown and described in the specification and any drawings/figures included herein.
One skilled in the art will readily appreciate that the present invention is well adapted to carry out the objectives and obtain the ends and advantages mentioned, as well as those inherent therein. The embodiments, methods, procedures and techniques described herein are presently representative of the preferred embodiments, are intended to be exemplary and are not intended as limitations on the scope. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention and are defined by the scope of the appended claims. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art are intended to be within the scope of the following claims.
Claims
1-6. (canceled)
7. A method comprising the following steps:
- (a) identifying a mammal having any one or more of the following: hyperinsulinism, insulin deficiency, high blood glucose levels, abnormal insulin resistance, glucose intolerance, pancreatic islet inflammation, or pancreatic islet infiltration of T cells; and
- (b) administering to said mammal a composition comprising a sensory afferent neuron neuropeptide.
8. The method of claim 7, wherein said mammal has diabetes or prediabetes.
9. The method of claim 8, wherein said mammal has Type 1 diabetes (T1D).
10. The method of claim 8, wherein said mammal has Type 2 diabetes (T2D).
11. The method of claim 7, wherein said mammal is a human.
12. The method of claim 7, wherein said sensory afferent neuron neuropeptide is substance P (sP).
13. The method of claim 7, wherein said composition is administered in step (b) via intra-arterial (i.a.) injection.
14. The method of claim 7, wherein said composition comprises an amount of said sensory afferent neuron neuropeptide effective to reduce insulin resistance or enhance insulin sensitivity in said mammal.
15. The method of claim 7, wherein said composition comprises an amount of said sensory afferent neuron neuropeptide effective to reduce or normalize blood glucose levels in said mammal.
16. The method of claim 7, wherein said composition comprises an amount of said sensory afferent neuron neuropeptide effective to reduce inflammation or T cell infiltration in the pancreatic islet of said mammal.
17. A method comprising the following steps:
- (a) identifying a mammal having any one or more of the following: hyperinsulinism, insulin deficiency, high blood glucose levels, abnormal insulin resistance, glucose intolerance, pancreatic islet inflammation, or pancreatic islet infiltration of T cells; and
- (b) administering to said mammal a composition comprising a capsaicinoid compound.
18. The method of claim 17, wherein said mammal has diabetes or prediabetes.
19. The method of claim 18, wherein said mammal has Type 1 diabetes (T1D).
20. The method of claim 18, wherein said mammal has Type 2 diabetes (T2D).
21. The method of claim 17, wherein said mammal is a human.
22. The method of claim 17, wherein said capsaicinoid compound is capsaicin.
23. The method of claim 17, wherein said composition is administered in step (b) via intra-arterial (i.a.) injection.
24. The method of claim 17, wherein said composition comprises an amount of said capsaicinoid compound effective to reduce insulin resistance or enhance insulin sensitivity in said mammal.
25. The method of claim 17, wherein said composition comprises an amount of said capsaicinoid compound effective to reduce or normalize blood glucose levels in said mammal.
26. The method of claim 17, wherein said composition comprises an amount of said capsaicinoid compound effective to reduce inflammation or T cell infiltration in the pancreatic islet of said mammal.
Type: Application
Filed: Feb 27, 2009
Publication Date: Sep 3, 2009
Applicant: The Hospital for Sick Children (Toronto)
Inventors: Hans-Michael DOSCH (Toronto), Lan Tang (Toronto), Yin Chan (Toronto), Michael Salter (Etobicoke)
Application Number: 12/394,261
International Classification: A61K 38/08 (20060101); A61K 31/165 (20060101); A61P 3/10 (20060101);