USE OF FRUCTOSE-BASED THERAPIES FOR THE TREATMENT OF CANCER
The methods and compositions of the invention are based on the preferential utilization of fructose by cancer cells. This invention relates to compositions, methods and kits utilizing fructose and other monosaccharides for the treatment of cancer. This invention also relates to methods and kits for using compositions to mimic or corrupt metabolic pathways of fructose and/or signal transduction pathways related to cancer cells for the treatment of cancer.
Latest CEDARS-SINAI MEDICAL CENTER Patents:
- L-glass: a novel functionalization method for covalently attaching ECM protein to optical glass
- Methods for Detecting and Treating Irritable Bowel Syndrome
- NOVEL AND EFFICIENT METHOD FOR REPROGRAMMING IMMORTALIZED LYMPHOBLASTOID CELL LINES TO INDUCED PLURIPOTENT STEM CELLS
- Differentiation technique to generate dopaminergic neurons from induced pluripotent stem cells
- Method for reprogramming blood to induced pluripotent stem cells
This invention relates to compositions, methods and kits utilizing fructose and other monosaccharides for the treatment of cancer. This invention also relates to methods and kits for using compositions to mimic or corrupt metabolic pathways of fructose and/or signal transduction pathways related to cancer cells for the treatment of cancer.
BACKGROUNDAll publications herein are incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The following description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifically or implicitly referenced is prior art.
The prevalence of obesity in the United States, and worldwide is increasing. Approximately 35 percent of U.S. adults 20 or older are overweight (i.e., have a body mass index [BMI] of 25 to 29.9), and an additional 30 percent are obese (i.e., have a BMI that is greater than or equal to 30). Among children, an estimated 16 percent of children ages 6-11 are overweight, over twice as many as two decades ago. Among adolescents ages 12-19, the percentage of obesity has more than tripled from 5 to 16 percent. Although extreme obesity has received the most attention in the clinical setting, moderate obesity is more common in the general population. However, even moderate obesity can contribute to chronic metabolic abnormalities characteristic of the insulin resistance syndrome, such as dyslipidemia, hypertension, insulin resistance, and glucose intolerance particularly when it is associated with intra-abdominal fat deposition (i.e., central obesity). Although it is likely that no single factor is responsible for the increased prevalence of moderate obesity, it is likely that environmental elements are interacting with predisposing genetic factors, and identification of the acquired causes contributing to an increase in the prevalence of obesity is key to developing public health policy and dietary and physical activity recommendations. Existing research indicates that weight, physical activity, and nutrition alter cancer risk and carcinogenesis for many cancers, and evidence is accumulating on the effect of these health factors on cancer prognosis and quality of life among cancer survivors. A recent study of a very large prospective cohort of 900,000 U.S. adults estimated that overweight and obesity in the US could account for 14 percent of all deaths from cancer in men and 20 percent of those in women. An International Agency Research on Cancer (IARC) review entitled, “Weight Control and Physical Activity”, summarized the evidence across basic and population research, and estimated that between one-quarter and one-third of the cases of many common cancers may be attributable to the combined effect of increased body weight and inadequate physical activity.
The role of dietary changes as contributing factors to the development of obesity are under investigation, and along with an increase in total energy consumption over the past few decades, a clear shift in the types of nutrients consumed in the American diet has been highlighted. Specifically, the consumption of fructose has increased dramatically, primarily because of increased consumption of beverages that are high in fructose and the consumption of other foods such as breakfast cereals, baked goods, condiments, and prepared desserts sweetened with sucrose and high-fructose corn syrup (HFCS). HFCS is produced by the enzymatic isomerization of dextrose to fructose, and most HFCS used in beverages contains about 55% fructose. Its commercial use increased in the 1970s so that by 1985, HFCS accounted for about 35% of the total amount of sweeteners by dry weight in the food supply. Intakes based on the 1977-1978 US Department of Agriculture Nationwide Food Consumption Survey estimated the mean individual consumption of fructose in adolescents and adults was about 40 g/d, the range being 29-54 g/d. Thirteen of the 40 g of dietary fructose was estimated to come from naturally occurring sources of fructose, and 27 g from added sources of fructose. More recent data on fructose consumption in the United States are not available, but food disappearance data, which can serve as an indicator of trends in consumption over time show that although the per capita use of sucrose has decreased moderately from 46.4 kg (102 lb) in 1970 to 30.5 kg (67 lb) in 1997, the per capita use of HFCS has increased from a negligible 0.23 kg (0.5 lb) in 1970 to 28.4 kg (62.4 lb) in 1997. This means that the combined consumption of sucrose, and high fructose corn syrup have increased by 26% from 64/g/day in 1970 to 81/g/day in 1997. This represents an average daily energy intake from added fructose of about 1356 kJ (324 kcal). In fact, just two 355-mL (12-oz) soft drinks can supply up to 50 g/fructose (about 840 kJ, or 200 kcal) or >10% of the daily energy requirements for an average-weight woman, without considering any other dietary sources of fructose. Thus, fructose consumption now makes up a significant proportion of energy intake in the American diet, and this increase in fructose consumption has coincided with the increased prevalence of obesity over the past 2 decades. These observations raise the question as to whether current fructose intakes could contribute to weight gain and its metabolic sequelae, including cancer.
Pancreatic cancer is the fourth leading cause of death in the US (Czito B. Willett C. Clark J. et al: Chemoradiation for unresectable pancreatic cancer. in Cameron J L (ed). Pancreatic Cancer. Hamilton. Ontario. Canada. B C Decker. 2001), 5-year survival is only 5%. Present molecular pathology, and cancer genetic studies indicate that pancreatic adenocarcinoma originates from pancreatic ductal cells, arises via a series of progressive structural stages of neoplastic growth, termed pancreatic intraepithelial neoplasia (PanINs), that are precursors to pancreatic adenocarcinomas, and associated with genetic alterations occurring in a temporal sequence (Bardeesy N, DePinho R A. Pancreatic Cancer Biology, and genetics Nat Rev Cancer 2: 897-909, 2002; Cubila A L, Fitzgerald P J. Morphological lesions associated with human primary invasive nonendocrine pancreas cancer. Cancer Res 36, 2690-9, 1976). The earliest abnormalities include activating KRAS mutations, detectable in ˜30% of the earliest PanIN (Kinstra D S, Longnecker D S. K-ras mutations in pancreatic ductal proliferative lesions. Am J pathol 145, 1547-50, 1994; Rozenblum E et al. Tumor-suppressive pathways in pancreatic cancer. Cancer Res 57, 1731-4, 1997), and altered epidermal growth factor (EGF) signalling (both ERBB2 or Her2/neu, and ERBB3) (Korc M et al. Overexpression of the epidermal growth factor receptor in human pancreatic cancer is associated with concomitant increases in the levels of epidermal growth factor and transforming growth factor alpha. J Clin Invest 90, 1352-60 1992; Friess H et al. Pancreatic cancer: the potential clinical relevance of growth factors and their receptors. J Mol med 74; 35-42 1996; Siblia M et al. The EGF receptor provides an essential survival signal for SOS-dependent skin tumor development. Cell 102, 211-220 2000). In late stage PaniNs, inactivation of INK4A (Rozenblum E et al. Tumor-suppressive pathways in pancreatic cancer. Cancer Res 57, 1731-4, 1997), and TP53 (Rozenblum E et al. Tumor-suppressive pathways in pancreatic cancer. Cancer Res 57, 1731-4, 1997) are observed, the former cooperatively accentuating RAS oncogenicity (Chin L et al. Cooperative effects of INK4A, and RAS in melanoma susceptibility in vivo. Genes Dev 11, 2822-2834 1997), and the latter facilitating genetic instability, including telomere dysfunction (Chin L et al. P53 deficiency rescues the adverse effects of telomere loss and coperates with telomere dysfunction to accelerate carcinogenesis. Cell 97 527-538 1999). Inherited BRCA2 mutations, typically associated with familial breast, and ovarian tumors are found in ˜17% of late stage pancreatic cancers in families harboring BRCA2 mutations (Cancer risks in BRCA2 mutation carriers. The breast cancer linkage consortium. J Natl Cancer Inst 91; 1310-1316 1999; Goggins M, Hruban R H, Kern S E. BRCA2 is inactivated in the development of pancreatic intraepithelial neoplasia: evidence and implications. Am J Pathol 156; 1767-1771, 2000.), and late PanINs frequently manifest loss of SMAD/DPC4, which encodes a key transcriptional regulator of transforming growth factors-β family signaling (Hahn S A et al. DPC4, a candidate tumor suppressor gene at human chromosome 19q21.1. Science 271 350-353 1996; Luttges J et al. Allelic loss is often the first hit in the biallelic inactivation of the p53 and DPC4 genes during pancreatic carcinogenesis. Am J Pathol 158 1677-1683 2001.).
The only well-established environmental etiologic factor is cigarette smoking, although chronic pancreatitis has been reported to confer a 20-fold excess risk (Lowenfels A B, Maisonneuve P, Cavallini G, et al. Pancreatitic and the risk of pancreatic cancer. N Engl J Med 1993; 328: 1433-7), and evidence points to an association between diabetes mellitus and pancreas cancer, but whether these diseases are due to a common exposure or are causally connected remains unknown (Anderson K E, Potter J D, Mack T M. Pancreatic cancer. In: Schottenfeld D, Fraumeni J Jr, eds. Cancer epidemiology and prevention. New York, N.Y.: Oxford University Press, 1996: 725-71; Everhart J, Wright D. Diabetes mellitus as a risk factor for pancreatic cancer: a meta-analysis. JAMA 1995; 273: 1605-9). Additionally, higher fasting plasma glucose (>140 mg/dl) (Jee S H, Ohrr H, Sull J W, Yun J E, Samet J M. Fasting serum glucose level and cancer risk in Korean men and women. JAMA 2005; 293:194-202), or postload (Gapstur S M, Gann P H, Lowe W, et al. Abnormal glucose metabolism and pancreatic cancer mortality. JAMA 2000; 283: 2552-8) plasma glucose levels have been associated with increased pancreas cancer mortality. A number of studies have investigated the role of dietary factors in pancreatic cancer risk. As with other epithelial cancers, a diet high in vegetables and fruit- and perhaps specifically high in folate has been associated with a lower risk, though not consistently (World Cancer Research Fund Panel. Food, nutrition, and the prevention of cancer: a global perspective. Washington, D.C.: American Institute for Cancer Research, 1997; Nkondjock A, Krewski D, Johnson K C, Ghadirian P, and the Canadian Cancer Registries Epidemiology Research Group. Dietary patterns and risk of pancreatic cancer. Int J Cancer May 1; 114(5):817-823, 2005). Other studies have identified dietary intake of lycopene or vitamin C as potentially protective factors (Nkondjock A, Ghadirian P, Johnson K C, Krewski D and the Canadian Cancer Registries Epidemiology Research Group. Dietary intake of lycopene is associated with reduced pancreatic cancer risk, J Nutr 135:592-597, 2004; Lin Y, Tamakoska A, Hayakawa T, Narus S, Kitagawa M and Ohno Y. Nutritional factors and risk of pancreatic cancer: A population-based case-control study based on direct interview in Japan. J. Gastroenterol. Mar 40(3):324-325, 2005). Some studies have reported increased pancreatic cancer risk associated with high cholesterol intake (Lin Y, Tamakoska A, Hayakawa T. Narus S, Kitagawa M and Ohno Y. Nutritional factors and risk of pancreatic cancer: A population-based case-control study based on direct interview in Japan. J. Gastroenterol. Mar 40(3):324-325, 2005), and at least six case control studies have reported a positive association between meat intake, and pancreatic cancer risk (Gapstur S M, Gann P H, Lowe W, et al. Abnormal glucose metabolism and pancreatic cancer mortality. JAMA 2000; 283: 2552-8; Howe G R and Burch J D. Nutrition and pancreatic cancer. Cancer Causes Control 7:69-82, 1996). However, in the large prospective 18-year follow-up Nurse Health Study of 121,700 women, no relationship between total fat, fat type, and cholesterol was observed in the 178 women who developed pancreatic cancer (Michaud D S, Giovannucci E, Willett W C, Colditz G A and Fuchs C S. Dietary meat, dairy products, fat and cholesterol and pancreatic cancer risk in a prospective study. J Epidemiol 157(12):1115-1125, 2003).
SUMMARY OF THE INVENTIONThe following embodiments and aspects thereof are described and illustrated in conjunction with compositions and methods which are meant to be exemplary and illustrative, not limiting in scope.
The present invention provides for methods and kits of the treatment of cancer.
One embodiment of the present invention provides for a method of treating cancer in a mammal, comprising providing a composition capable of inhibiting or regulating a metabolic pathway of fructose; and administering a therapeutically effective amount of the composition to the mammal. In one embodiment, the composition may be a composition that is capable of modulating an enzyme in the metabolic pathway of fructose. In another embodiment, the composition may be a composition that is capable of modulating hexokinase, fructokinase-1, fructose-1-P adolase, transketolase or an analog thereof. In one embodiment, the composition capable of modulating transketolase is a small interfering RNA (siRNA) capable of suppressing transketolase mRNA expression.
In another embodiment, the composition may comprise a fructose analog, whereby the fructose analog competes with fructose to enter the metabolic pathway of fructose. In another embodiment, the composition may comprise a thiamine inhibitor. In another embodiment, the composition may comprise oxythiamine.
Another embodiment of the present invention provides for a method of treating cancer in a mammal, comprising providing a composition capable of modulating a GLUT mRNA expression or a GLUT function; and administering a therapeutically effective amount of the composition to the mammal. In one embodiment, the GLUT may be GLUT-5. In another embodiment, the composition may comprise a small interfering RNA (siRNA) capable of suppressing the GLUT mRNA expression. In another embodiment, the composition is an antagonist of GLUT. In another embodiment, the composition is an antagonist of GLUT-5.
Another embodiment of the present invention provides for a method of treating cancer in a mammal, comprising providing a fructose-based or a fructose-analog based composition; and administering a therapeutically effective amount of the fructose-based or the fructose-analog based composition to the mammal, wherein the fructose-based or the fructose-analog based composition may comprise fructose conjugated to a compound. The compound may be a toxin, a cell signal deactivator, a radioactive agent or combinations thereof. In one embodiment, the deactivator may be a cyclin-dependent kinase inhibitor. In various embodiments, the compound may be conjugated to fructose at the first or the second carbon atom. The toxin may be botulinum or diphtheria. The radioactive agent may be any molecule or atom that emits radioactive rays; for example, gamma rays. Radioactive agents include but are not limited to radioactive isotopes of carbon, oxygen, hydrogen, fluorine, iodine, gallium, technetium, indium and copper.
Another embodiment of the present invention provides for a method for treating cancer in a mammal, comprising providing a composition comprising a radioactive isotope of fructose or a fructose analog; and administering a therapeutically effective amount of the composition to the mammal, wherein the radioactive isotope is incorporated into nucleic acid synthesis. In one embodiment, the radioactive isotope may be carbon-11 (11C). In another embodiment the radioactive isotope may be oxygen 15 (15O).
Another embodiment of the present invention provides for a method for treating cancer in mammal, comprising providing a fructose analog capable of being cleaved into a toxic metabolite; and administering a therapeutically effective amount of the fructose analog to the mammal, whereby a cellular enzyme converts the fructose analog into the toxic metabolite.
Other embodiments of the present invention provide for kits for the treatment of cancer in a mammal. The kits may comprise an agent, which may be a composition capable of inhibiting or regulating a metabolic pathway of fructose; a composition capable of modulating a GLUT mRNA expression or a GLUT function; a fructose-based or a fructose-analog based composition, wherein the fructose-based or the fructose-analog based composition may comprise fructose conjugated to a compound, which may be a toxin, a cell signal deactivator, a radioactive agent and combinations thereof; a radioactive isotope of fructose or a fructose analog wherein the radioactive isotope is incorporated into nucleic acid synthesis; or a fructose analog capable of being cleaved into a toxic metabolite; and instructions to use the agent to treat cancer.
In one embodiment of the kit, the composition capable of inhibiting or regulating a metabolic pathway of fructose may be a composition capable of modulating hexokinase, fructokinase-1, fructose-1-P adolase, transketolase or an analog thereof. In another embodiment, the composition capable of inhibiting or regulating a metabolic pathway of fructose may comprise a fructose analog, whereby the fructose analog competes with fructose to enter the metabolic pathway of fructose. In another embodiment, the composition capable of modulating the GLUT mRNA expression may comprises a small interfering RNA (siRNA) capable of suppressing the GLUT mRNA expression. In another embodiment, the composition capable of modulating GLUT function may be an antagonist of GLUT.
Other features and advantages of the invention will become apparent from the following detailed description, taken in conjunction with the accompanying drawings, which illustrate, by way of example, various features of embodiments of the invention.
Exemplary embodiments are illustrated in referenced figures. It is intended that the embodiments and figures disclosed herein are to be considered illustrative rather than restrictive.
All references cited herein are incorporated by reference in their entirety as though fully set forth. Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, N.Y. 1994); March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., J. Wiley & Sons (New York, N.Y. 1992); and Sambrook and Russel, Molecular Cloning: A Laboratory Manual 3rd ed., Cold Spring Harbor Laboratory Press (Cold Spring Harbor, N.Y. 2001), provide one skilled in the art with a general guide to many of the terms used in the present application.
One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described. For purposes of the present invention, the following terms are defined below.
“Alleviating” specific cancers and/or their pathology includes degrading a tumor, for example, breaking down the structural integrity or connective tissue of a tumor, such that the tumor size is reduced when compared to the tumor size before treatment. “Alleviating” metastasis of cancer includes reducing the rate at which the cancer spreads to other organs.
“Beneficial results” may include, but are in no way limited to, lessening or alleviating the severity of the disease condition, preventing the disease condition from worsening, curing the disease condition and prolonging a patient's life or life expectancy.
“Cancer” and “cancerous” refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include, but are not limited to, colorectal cancer, lung cancer, prostate cancer, hepatocellular cancer, gastric cancer, pancreatic cancer, cervical cancer, ovarian cancer, liver cancer, bladder cancer, cancer of the urinary tract, thyroid cancer, renal cancer, carcinoma, melanoma, head and neck cancer, brain cancer, and breast cancer; including, but not limited to, ductal carcinoma, lobular carcinoma, Paget's disease, inflammatory breast cancer, medullary carcinoma, tubular carcinoma, mucinous carcinoma, cribriform carcinoma, papillary carcinoma, and phyllodes tumors.
“Conditions” and “disease conditions,” as used herein may include, but are in no way limited to any form of cancer; in particular, pancreatic cancer and breast cancer, including but not limited to ductal carcinoma, lobular carcinoma, Paget's disease, inflammatory breast cancer, medullary carcinoma, tubular carcinoma, mucinous carcinoma, cribriform carcinoma, papillary carcinoma, and phyllodes tumors.
“Curing” cancer includes degrading a tumor such that a tumor cannot be detected after treatment. The tumor may be reduced in size or become undetectable, for example, by atrophying from lack of blood supply or by being attacked or degraded by one or more components administered according to the invention.
“Fructose-based” as used herein includes compositions and therapies which include fructose or its analogs.
“Mammal” as used herein refers to any member of the class Mammalia, including, without limitation, humans and nonhuman primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs, and the like. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be included within the scope of this term.
“Metabolic pathway” as used herein refers to a series of consecutive enzymatic reactions that produce specific products.
“Pathology” of cancer includes all phenomena that compromise the well-being of the patient. This includes, without limitation, abnormal or uncontrollable cell growth, metastasis, interference with the normal functioning of neighboring cells, release of cytokines or other secretory products at abnormal levels, suppression or aggravation of inflammatory or immunological response, neoplasia, premalignancy, malignancy, invasion of surrounding or distant tissues or organs, such as lymph nodes, etc.
“Therapeutically effective amount” as used herein refers to that amount which is capable of achieving beneficial results in a patient with cancer. A therapeutically effective amount can be determined on an individual basis and will be based, at least in part, on consideration of the physiological characteristics of the mammal, the type of delivery system or therapeutic technique used and the time of administration relative to the progression of the disease.
“Treatment” and “treating,” as used herein refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) the targeted pathologic condition or disease even if the treatment is ultimately unsuccessful. Those in need of treatment include those already with the Pathologic condition or disease as well as those prone to have the pathologic condition or disease or those in whom the pathologic condition or disease is to be prevented. In tumor (e.g., cancer) treatment, a therapeutic agent may directly decrease the pathology of tumor cells, or render the tumor cells more susceptible to treatment by other therapeutic agents, e.g., radiation and/or chemotherapy.
“Tumor,” as used herein refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.
The inventors' data show that fructose induces higher cancer proliferative rates than glucose, and their metabolomic studies demonstrate that cancer cells differentially utilize glucose and fructose, preferentially metabolizing fructose via transketolase for nucleic acid synthesis. The inventors believe that increased cancer proliferation rates due to fructose are not limited to pancreatic cancer or breast cancer. Indeed, fructose induces high proliferation rates in all cancers since fructose may be utilized as an energy source. To place these in vitro observations in the context of human disease, the inventors demonstrated that human circulating fructose concentrations are at levels higher than those which mediate pro-proliferative effects in pancreatic cancer, and that the capacity to control serum fructose levels after a refined fructose load appears inferior to that which control blood glucose.
Embodiments of the present invention are based upon the inventors' discovery as described herein. The present invention includes methods, kits and models useful in the treatment and study of cancer in a mammal, such as a human, utilizing monosaccharide-based therapies and/or approaches.
In various embodiments of the present invention, the monosaccharide is a pentose and/or a hexose. Examples of pentose monosaccarides include but are not limited to, arabinose, lyxose, ribose, ribulose, xylose, and xylulose. Examples of hexose monosaccharides include but are not limited to, allose, altrose, fructose, galactose, gulose, idose, mannose, psicose, sorbose, tagatose, and talose. In one embodiment, the monosaccharide may be fructose.
In other embodiments of the present invention, the monosaccharide may be a ketose. Examples of ketoses include but are not limited to erythrulose, ribulose, xylulose, fructose, psicose, sorbose, and tagatose. In one embodiment, the ketose is fructose.
In one embodiment of the present invention, the cancer may be breast cancer. In another embodiment of the present invention, the cancer may be pancreatic cancer.
The fructose-based compositions and/or therapies may be administered by any appropriate technique, as will be readily appreciated by those of skill in the art. By way of example and not to be interpreted as limiting, the composition and/or therapy may be administered via oral administration or intravenous administration.
Further embodiments include compositions, such as metabolites, and use of these compositions to mimic and/or corrupt metabolic pathways related to cancer cells.
Additional embodiments take advantage of the preferential use of fructose for nucleic acid synthesis. Thus, in various embodiments, a radioactive isotope of fructose may be used to treat cancer, wherein the radioactive isotope is incorporated into nucleic acid synthesis. Due to the instability of the isotope, the energy released by the isotope may damage the DNA and may be toxic to the cell. The isotopic change may be for the carbon, the hydrogen, or the oxygen atom of fructose or fructose analog, or any combination of such atoms. One example is the C-11 isotope (11C). In another embodiment, 15O may be used. One of skill in the art will appreciate appropriate isotopes that may be used with embodiments of the present invention.
Other embodiments of the present invention relate to the treatment of cancer by identifying and administering compositions that inhibit various metabolic pathways related to monosaccharides and in particular, fructose. In one embodiment, a composition may be used to inhibit a metabolic pathway. Other embodiments include compositions and/or peptides to block particular enzymes in metabolic pathways related to cancer cells. Various embodiments include compositions and/or peptides to block hexokinase, fructokinase-1 (FK-1), fructose-1-P adolase (FPA) and transketolase. See
Additional embodiments include analogs of fructose and use of these analogs to block fructose metabolism. The inventors believe that analogs of fructose may be used to compete with fructose and enter the metabolic pathway of fructose, and thus block fructose metabolism and thus decrease an energy source for cancer cells, thereby reducing the growth of cancer cells. See
Other embodiments of the present invention include monosaccharide-based compositions, use of monosaccharide-based compositions and methods for delivery of monosaccharide-based compositions for the treatment of cancer cells. Particular embodiments include fructose-based compositions. Further embodiments include linking a toxin (e.g., a cytotoxin) or a radioactive agent to a monosaccharide, such as fructose, to target and kill cancer cells. Examples of toxins include but are not limited to botulinum, and diptheria. Examples of radioactive agents include but are not limited to carbon-11 (11C) and iodine-131 (131I), fluorine, iodine, gallium, technetium, indium and copper. Other embodiments include linking a compound to a monosaccharide, such as fructose, to target and inhibit the proliferation of cancer cells.
Another embodiment of the present invention provide for a method for treating cancer in a mammal, comprising a fructose analog, wherein the fructose analog is capable of entering the cell and be converted into a toxic metabolite by an enzyme in the cell. In another embodiment, the fructose analog may be capable of entering the metabolic pathway of fructose and may be converted into a toxic metabolite by an enzyme in the metabolic pathway of fructose. For example, a fructose analog may be a fructose analog that is capable of being converted to a peroxide molecule or is capable of being converted into a metabolite with a peroxide functional group, which may be toxic to the cells.
Other embodiments of the present invention are methods for delivery of fructose-based therapeutic compositions for the treatment of cancer cells by administering a therapeutically effective amount to a mammal. The inventors believe that fructose-based therapies, in which fructose is preferentially used by the cancer cells is effective in targeting the cancer cells and thus provide beneficial results to the mammal.
Additional embodiments relate to the solute carriers such as glucose transporters (GLUT). Particular embodiments relate to GLUT type 2 (GLUT-2) and GLUT type 5 (GLUT-5), which facilitate cellular glucose and fructose uptake, respectively. Various embodiments include compositions that modulate GLUT mRNA expression. Other embodiments include methods and approaches that modulate GLUT mRNA expression. In another embodiment, a siRNA approach is used to silence a GLUT that facilitates fructose uptake. In one embodiment, a siRNA approach is used to silence GLUT-5 expression. Further embodiments include compositions, methods and approaches that regulate the amount of GLUT in the cells. Further embodiments include agonists and/or antagonists and use of agonists and/or antagonists of GLUT to regulate the fructose uptake of cells. The inventors have shown that cancer cells preferentially utilize fructose as their energy source and have a higher proliferation rate in fructose than in glucose. Thus, the inhibiting the uptake of fructose may decrease the proliferation rate of cancer cells.
Further embodiments include fructose-based compositions containing cell signal deactivators. These fructose-based compositions containing deactivators may be preferentially utilized by cancer cells and thus the deactivators may effect cell signaling. A cell signal deactivator may target cellular signals relating to the proliferation of the cell and may be used to keep the cell in G1/G0 phase, rather than having the cell in the S1 phase. Deactivators such as cyclin-dependent kinase inhibitors, p53 and p73 may be carried into the cancer cell using fructose-based compounds to inhibit cell division. In another embodiment, as demonstrated by the inventors, transketolase is a key mediator of fructose-induced cancer cell proliferation. As such, therapies that target transketolase may be used to inhibit the growth of cancerous cells. For example, silencing TKK RNA expression may inhibit the growth of cancerous cells. In one embodiment, TKK may be silenced using siRNA methods.
Another embodiment of the present invention provide for a method for treating cancer in a mammal, comprising a fructose analog, wherein the fructose analog is capable of entering the metabolic pathway of fructose and being converted into a toxic metabolite.
In various embodiments, the compositions utilized by the present inventive methods may include a pharmaceutically acceptable excipient. “Pharmaceutically acceptable excipient” means an excipient that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic, and desirable, and includes excipients that are acceptable for veterinary use as well as for human pharmaceutical use. Such excipients may be solid, liquid, semisolid, or, in the case of an aerosol composition, gaseous.
In various embodiments, the pharmaceutical compositions according to the invention may be formulated for delivery via any route of administration. “Route of administration” may refer to any administration pathway known in the art, including but not limited to aerosol, nasal, oral, transmucosal, transdermal or parenteral. “Parenteral” refers to a route of administration that is generally associated with injection, including intraorbital, infusion, intraarterial, intracapsular, intracardiac, intradermal, intramuscular, intraperitoneal, intrapulmonary, intraspinal, intrasternal, intrathecal, intrauterine, intravenous, subarachnoid, subcapsular, subcutaneous, transmucosal, or transtracheal. Via the parenteral route, the compositions may be in the form of solutions or suspensions for infusion or for injection, or as lyophilized powders.
The pharmaceutical compositions according to the invention can also contain any pharmaceutically acceptable carrier. “Pharmaceutically acceptable carrier” as used herein refers to a pharmaceutically acceptable material, composition, or vehicle that is involved in carrying or transporting a compound of interest from one tissue, organ, or portion of the body to another tissue, organ, or portion of the body. For example, the carrier may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or a combination thereof. Each component of the carrier must be “pharmaceutically acceptable” in that it must be compatible with the other ingredients of the formulation. It must also be suitable for use in contact with any tissues or organs with which it may come in contact, meaning that it must not carry a risk of toxicity, irritation, allergic response, immunogenicity, or any other complication that excessively outweighs its therapeutic benefits.
The pharmaceutical compositions according to the invention can also be encapsulated, tableted or prepared in an emulsion or syrup for oral administration. Pharmaceutically acceptable solid or liquid carriers may be added to enhance or stabilize the composition, or to facilitate preparation of the composition. Liquid carriers include syrup, peanut oil, olive oil, glycerin, saline, alcohols and water. Solid carriers include starch, lactose, calcium sulfate, dihydrate, terra alba, magnesium stearate or stearic acid, talc, pectin, acacia, agar or gelatin. The carrier may also include a sustained release material such as glyceryl monostearate or glyceryl distearate, alone or with a wax.
The pharmaceutical preparations are made following the conventional techniques of pharmacy involving milling, mixing, granulation, and compressing, when necessary, for tablet forms; or milling, mixing and filling for hard gelatin capsule forms. When a liquid carrier is used, the preparation will be in the form of a syrup, elixir, emulsion or an aqueous or non-aqueous suspension. Such a liquid formulation may be administered directly p.o. or filled into a soft gelatin capsule.
The pharmaceutical compositions according to the invention may be delivered in a therapeutically effective amount. The precise therapeutically effective amount is that amount of the composition that will yield the most effective results in terms of efficacy of treatment in a given subject. This amount will vary depending upon a variety of factors, including but not limited to the characteristics of the therapeutic compound (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the subject (including age, sex, disease type and stage, general physical condition, responsiveness to a given dosage, and type of medication), the nature of the pharmaceutically acceptable carrier or carriers in the formulation, and the route of administration. One skilled in the clinical and pharmacological arts will be able to determine a therapeutically effective amount through routine experimentation, for instance, by monitoring a subject's response to administration of a compound and adjusting the dosage accordingly. For additional guidance, see Remington: The Science and Practice of Pharmacy (Gennaro ed. 20th edition, Williams & Wilkins P A, USA) (2000).
Embodiments of the present invention are also directed to kits for the treatment of cancer. The kit is an assemblage of materials or components, including at least one of the compositions described herein for the treatment of cancer. Thus, in some embodiments the kit contains a composition including; for example, a composition capable of inhibiting or regulating a metabolic pathway of fructose; a composition capable of modulating a GLUT mRNA expression or a GLUT function; a fructose-based or a fructose-analog based composition, wherein the fructose-based or the fructose-analog based composition comprises fructose conjugated to a compound selected from the group consisting of a toxin, a cell signal deactivator, a radioactive agent and combinations thereof; a radioactive isotope of fructose or a fructose analog wherein the radioactive isotope is incorporated into nucleic acid synthesis; or a fructose analog capable of being cleaved into a toxic metabolite, as described herein.
The exact nature of the components configured in the inventive kit depends on its intended purpose. In one embodiment, the kit is configured particularly for the purpose of treating mammalian subjects. In another embodiment, the kit is configured particularly for the purpose of treating human subjects. In further embodiments, the kit is configured for veterinary applications, treating subjects such as, but not limited to, farm animals, domestic animals, and laboratory animals.
Instructions for use may be included in the kit. “Instructions for use” typically include a tangible expression describing the technique to be employed in using the components of the kit to effect a desired outcome, such as to treat cancer. For example, instructions may include instructions to administer a therapeutically effective amount of a composition, as described herein, to the mammal. Optionally, the kit also contains other useful components, such as, diluents, buffers, pharmaceutically acceptable carriers, syringes, catheters, applicators, pipetting or measuring tools or other useful paraphernalia as will be readily recognized by those of skill in the art.
The materials or components assembled in the kit can be provided to the practitioner stored in any convenient and suitable ways that preserve their operability and utility. For example the components can be in dissolved, dehydrated, or lyophilized form; they can be provided at room, refrigerated or frozen temperatures. The components are typically contained in suitable packaging material(s). As employed herein, the phrase “packaging material” refers to one or more physical structures used to house the contents of the kit, such as inventive compositions and the like. The packaging material is constructed by well known methods, preferably to provide a sterile, contaminant-free environment. The packaging materials employed in the kit are those customarily utilized in cancer treatment. As used herein, the term “package” refers to a suitable solid matrix or material such as glass, plastic, paper, foil, and the like, capable of holding the individual kit components. The packaging material generally has an external label which indicates the contents and/or purpose of the kit and/or its components.
Refined Carbohydrates, Fructose and Cancer Insulin Resistance and Insulin-Mediated Growth Promoting ActionsHigh carbohydrate intake has been hypothesized to be a risk factor for breast cancer, possibly mediated by elevated levels of free insulin, estrogen and insulin-like growth factor-I. This hypothesis is supported by population-based case-control studies. In a Mexican population characterized by relatively high fat and high carbohydrate intakes, carbohydrate intake was positively associated with breast cancer risk, and the relative risk of breast cancer for women in the highest quartile of CHO-intake was 2.22 [95% confidence interval (95% Cl)1.63-3.04], compared with women in the lowest quartile, adjusting for total energy and potential confounding variables (P trend<0.0001) (Romieu I, Lazcano-Ponce E, Sanchez-Zamorano L M, Willett W, Hernandez-Avila M. Carbohydrates and the risk of breast cancer among Mexican women. Cancer Epidemiol Biomarkers Prev 13:1283-9, 2004). This association was present in both premenopausal and postmenopausal women, and among carbohydrate components, the strongest associations were observed for sucrose and fructose (Romieu I, Lazcano-Ponce E, Sanchez-Zamorano L M, Willett W, Hernandez-Avila M. Carbohydrates and the risk of breast cancer among Mexican women. Cancer Epidemiol Biomarkers Prev 13:1283-9, 2004).
In animal studies, chronic administration of a 60% fructose diet to normal rats led to both hyperinsulinemia and in vivo insulin resistance. The fructose feeding-induced insulin resistance was mainly due to a diminished ability of insulin to suppress hepatic glucose output, and not due to decreased insulin-stimulated glucose uptake by muscle (Tobey T A, Mondon C E, Zavaroni I, Reaven G M. Mechanism of insulin resistance in fructose-fed rats. Metabolism. 31:608-12, 1982). In other studies fructose feeding to lean and obese Zucker rats, led to increased kidney, liver, and retroperitoneal adipose tissue weights, emphasizing the growth promoting effects of fructose (Koh E T, Mueller J, Osilesi 0, Knehans A, Reiser S Effects of fructose feeding on lipid parameter in lean, diabetic and nondiabetic Zucker rats. J. Nutr. 115: 1274-84, 1985.).
In humans, epidemiological studies support an association between fructose-intake specifically, and cancer risk. Food-frequency questionnaires, documenting CHO intake, glycemic load, in addition to sucrose, and fructose intake, collected from a cohort of US women (n=88,802) participating in the Nurse' Health Study, revealed a 53% increased risk of pancreatic cancer development in women who had a high glycemic intake, and particularly in the cohort who reported a high fructose-intake (57% increased risk) (Michaud D S, Liu S, Giovannucci E, Willett W C, Colditz G A, Fuchs C. Dietary sugar, glycemic load, and pancreatic cancer risk in prospective study. J Natl Cancer Inst. 94: 1293-300, 2002). This association was most pronounced in women who additionally had an increased BMI (>25) or sedentary lifestyle, and relative risk in this group was 2.67 (95% Cl 1.02-6.99, p=0.03) for glycemic load, and 3.17 (95% Cl 1.13-8.91, p=0.04) for high fructose intake, suggesting that high fructose intake may be an additive risk factor on top of obesity (Michaud D S, Liu S, Giovannucci E, Willett W C, Colditz G A, Fuchs C. Dietary sugar, glycemic load, and pancreatic cancer risk in prospective study. J Natl Cancer Inst. 94: 1293-300, 2002).
Fructose intake stimulates lipogenesis in animals, and although data in humans is less conclusive, several studies have demonstrated significant increases in lipid parameters on fructose versus glucose diets (Silvera et al., Glycemic index, glycemic load and pancreatic cancer risk (Canada). Cancer Causes Control May 16(4):431-436, 2005; Brand-Miller J C. Glycemic index in relation to coronary disease. Asia Pac J Clin Nutr 13: S3, 2004; Laio et al., Genetic evidence for a common pathway mediating oxidative stress, inflammatory gene induction, and aortic fatty streak formation in mice. J Clin Invest 94(2): 877-884, 1994; Vakkila et al., Inflammation and necrosis promote tumour growth. Nat Rev Immunol. 4: 641-8, 2004; Calle et al., Overweight, obesity and cancer: epidemiological evidence and proposed mechanisms. Nat Rev Cancer 4: 579-91, 2004).
The Fructose-Lipid ConnectionThe association between obesity and cancer, including but not limited to breast and pancreatic cancer, is likely multifactorial, and in addition to insulin resistance, lipids and triglyceride levels have been associated with increased breast cancer risk. Several mechanisms by which elevated lipids, and triglycerides might increase breast cancer risk have been proposed. For example, the hypertriglyceridemia, and accompanying excess of circulating free fatty acids may contribute to the development of a chronic low-grade inflammatory state, and recent studies in cardiovascular disease have emphasized the role of markers of systemic inflammation as independent risk factors of coronary artery disease. Similarly, more recent studies have begun to unravel the role of low-level chronic systemic inflammation in the development, and progression of solid tumors including breast cancer, and the NF-kappaB signaling cascade is emerging as a key mediator in this regard (Laio F, Andalibi A, Qiao J H, Allayee H, Fogelman A M, and Lusis A J. Genetic evidence for a common pathway mediating oxidative stress, inflammatory gene induction, and aortic fatty streak formation in mice. J Clin Invest 94(2): 877-884, 1994; Vakkila J, Lotze M T. Inflammation and necrosis promote tumour growth. Nat Rev Immunol. 4: 641-8, 2004). The pro-inflammatory environment related to triglyceride and free fatty acid excess promotes and supports tumorigenesis in multiple ways including alteration in cell adhesion, platelet function, measures of oxidative stress, pro- and anti-inflammatory cytokines, and immune function (Calle E E, Kaaks R. Overweight, obesity and cancer: epidemiological evidence and proposed mechanisms Nat Rev Cancer. 4: 579-91, 2004). Fructose intake stimulates lipogenesis in animals, and although data in humans is less conclusive, several studies have demonstrated significant increases in lipid parameters on fructose versus glucose diets (Sleder J, Chen Y-ID, Cully M D, Reaven G M. Hyperinsulinemia in fructose-induced hypertriglyceridemia in the rat. Metabolis 71:835-42, 1972; Zakim D. The effects of fructose on hepatic synthesis of fatty acids. Acta Med Scand 542: 205-14, 1972; Bantle J P, Raatz S K, Thomas W and Georgopoulos A. Effects of dietary fructose on plasma lipids in healthy subjects 1-3. Am J Clin Nutr 72 1128-1134, 2000; Henry R R, Crapo P A. Current issues in fructose metabolism. Ann Rev Nutr 11: 21-39, 1991; Hollenbeck C B. Dietary fructose effects on lipoprotein metabolism and risk for coronary artery disease. Am J Clin Nutr 58 (suppl) 800S-9S, 1993).
Carbohydrate MetabolismDietary carbohydrate from which humans gain energy enters the body in complex forms, such as disaccharides and the polymers starch (amylose and amylopectin) and glycogen. The first step in the metabolism of digestible carbohydrate is the conversion of the higher polymers to simpler, soluble forms that can be transported across the intestinal wall and delivered to the tissues. The breakdown of polymeric sugars begins in the mouth by the enzyme lingual amylase. Once the food has arrived in the stomach, acid hydrolysis contributes to its degradation. In the small intestine the main polymeric-carbohydrate digesting enzyme is pancreas-derived α-amylase, which has similar activity to salivary amylase, producing disaccharides and trisaccharides. The latter are converted to monosaccharides by intestinal saccharidases, including maltases that hydrolyze di- and trisaccharides, and the more specific disaccharidases, sucrase, lactase, and trehalase. The net result is the almost complete conversion of digestible carbohydrate to its constituent monosaccharides. The resultant simple carbohydrates such as glucose, and fructose are transported across the intestinal wall to the hepatic portal vein and then to liver parenchymal cells and other tissues for oxidation in a process known as glycolysis.
Glucose and fructose are the two most important simple sugars for human consumption. They have the same molecular formula, C6H12O6, but have different structures. The sugars differ in the bond environment of the oxygen atom in the sugar, but each is a carbohydrate comprising 6 water molecules and 6 carbon dioxide molecules with the yield of 6 oxygen molecules. They are classified differently as hydrocarbon derivatives, glucose being classified as an aldehyde and fructose as a ketone, but are otherwise structurally identical. Although both glucose and fructose metabolism is similar in many respects, there are important differences that the inventors believe may be important in cancer growth. Transport of glucose or fructose across the cell membrane is the first rate-limiting step for sugar metabolism and is facilitated by glucose/fructose transport (GLUT) proteins, twelve (GLUT1-12) of which have been identified (Bantle et al., Effects of dietary fructose on plasma lipids in healthy subjects 1-3. Am J Clin Nutr 72: 1128-1134, 2000). Once in the cell, glucose is oxidized to either lactate or pyruvate, and under aerobic conditions, the dominant product in most tissues is pyruvate. In cancer cells, high glycolytic flux is required for rapid tumor growth, and glucose uptake, and lactic acid levels correlate with tumor progression, invasiveness, patient morbidity, and mortality (Henry et al., Current issues in fructose metabolism. Ann Rev Nutr 11: 21-39, 1991; Hollenbeck C B. Dietary fructose effects on lipoprotein metabolism and risk for coronary artery disease. Am J Clin Nutr 58 (suppl) 800S-9S, 1993; Tharanathan R N. Food-derived carbohydrates: structural complexity and functional diversity. Crit. Rev Biotechnol. 22:65-84, 2002; Kim et al., Multifaceted roles of glycolytic enzymes Trends Biochem Sci. 30:142-50, 2005; Medina R A and Owen. Glucose transporters: Expression, regulation and cancer. Biol Res 35(1):9-26, 2002; Gatenby R A, Gillies R J. Why do cancers have high aerobic glycolysis Nat Rev Cancer, 4(11):891-9, 2004.). Additionally, cancer cells maintain an abnormally high glycolytic rate even in the presence of oxygen, a phenomena first described by Otto Warburg (Warburg effect) (Eigenbrodt E. Glycolysis: one of the keys to cancer? Trends Pharmacol Sci 1: 240-245, 1980; Hennipman et al., Glycolytic enzyme activities in breast cancer metastases. Tumour Biol 9: 241-248, 1988; Warburg et al., On the metabolism of cancer cells. Biochem Z 152: 319-344, 1924; Bares et al., F-18 fluorodeoxygiucose PET in vivo evaluation of pancreatic glucose metabolism for detection of pancreatic cancer. Radiology, 192: 79-86, 1994). High glycolytic flux is required for rapid tumor growth, and glucose uptake, and lactic acid levels accurately predict tumor progression, invasiveness, metastatic tendency, and overall patient morbidity, and mortality (Bares, R., Klever, P″ HauPlrnann, S., Hellwig, D., Fass, J., Cremerius, U., Schurnpelick, V., Mittemtayer, C., and Bull, U. F-18 fluorodeoxygiucose PET in vivo evaluation of pancreatic glucose Iretabolism for detection of pancreatic cancer. Radiology, 192: 79-86, 1994; Conti, P. S., Lilien, D. L., Hawley. K., Keppler, J., Gmfton, S. T., and Bading, J. R. PET am [18F]-FDG in oncology: a clinical update. Nucl. Moo. Biol., 23: 717-735, 1996; Walenta, S., Wetterling, M., Lehrlce, M., Schwicken, G., Sundfor, K., Rofstad, E. K., and Mueller-Klieser, W. High lactate levels in head and neck cancers predict likelihood of metastases, tumor recurrence, and restricted patient survival in human cervical cancers. Cancer Res., 60: 916-921, 2000; Walenta, S., Salameh, A., Lyng, H., Evensen, J. F., MitZe, M., Rofslad, E. K., and Mueller-Klieser, W. Correlation of high lactate levels in head and neck tumors with incidence of metastasis. Am. J. Pathol., 150: 409-415, 1997; Di Chiro, G., DeLaPaz, R. L., Brooks, R. A., Sokoloff, L., Komblith, P. L., Smith, B. H., Patronas, N. J., Kufta, C. V., Kessler, R. M., Johnston, G. S. Manning, R. G., and Wolf, A. P. Glucose utilization of cerebral gliomas measured by [18F] fluoro-deoxyglucose and posilron emission tomography. Neurology, 32: 1323-1329, 1982; Noguchi, Y., Saito, A., Miyagi, Y., Yamanaka, S., Macat, D., Doi, C., Yoshikawa, T., Tsuburaya, A., Ito, T., and Satoh, S. Suppression of facilitative glucose transporter 1 mRNA can suppress tumor growth. Cancer Lett., 154: 175-182, 2000).
Fructose MetabolismDiets containing large amounts of fructose or sucrose (a disaccharide of glucose and fructose) can utilize the fructose as a major source of energy. Like glucose, fructose is taken into the cell by 3 fructose-selective GLUTs 2, and 5, and 7. (Bantle et al., Effects of dietary fructose on plasma lipids in healthy subjects 1-3. Am J Clin Nutr 72: 1128-1134, 2000; Conti et al., PET am [18F]-FDG in oncology: a clinical update. Nucl. Moo. Biol., 23: 717-735, 1996; Walenta et al., High lactate levels in head and neck cancers predict likelihood of metastases, tumor recurrence, and restricted patient survival in human cervical cancers. Cancer Res., 60: 916-921, 2000). Fructose can enter the metabolic pathway in two ways, depending on which tissue is involved (muscle or liver). As most tissues contains only the enzyme hexokinase, fructose is phosphorylated at the sixth carbon atom, competing with glucose for the hexokinase involved (
While not wishing to be bound by any particular theory, it is believed that the glycolytic reactions (
In T47-D breast cancer cells, progestin treatment led to increased PFK-2 expression, and increased the number of cells in S-phase (Hamilton J A, Callaghan M J, Sutherland R L, and Watts C K. Identification of PRG1, a novel progestin-responsive gene with sequence homology to 6-phospho-fructo-2-kinase/fructose, 2,6-biophosphatase. Mol Endocrinol 11: 490-502, 1997). In summary, fructose conversion to fructose 2,6 bisphosphate by the isoforms of PFK-2 acts to speed transit of fructose, and glucose through the glycolytic pathway to increase energy availability for cell proliferation. While not wishing to be bound by any particular theory, the inventors believe that the increased fructose-induced breast cancer proliferative rates are due to increased inducible PFK-2 (iPFK-2/PFKFB-3) levels generating fructose-2,6-bisphophate that in turn potently stimulates phosphofructo-1-kinase, thereby transiting both glucose and fructose faster through the glycolytic pathway to generate increased energy for cell proliferation. The data demonstrate that MCF-7 breast cancer cells express fructokinase-1 (FK-1). This enzyme potentially enables breast cancer cells to metabolize fructose directly to fructose-1-phosphate (
Additionally, the data demonstrate pancreatic cancer FK-1, and fructose-1-P-aldolase mRNA expression, and increased GLUT-5 mRNA levels following fructose-treatment.
While not wishing to be bound to any particular theory, it is believed that the form in which fructose is ingested, is extremely important. Clearly, fruit, and vegetables contain fructose, but this is mixed with significant quantities of fiber, which limits fructose absorption rates, and contains antioxidant vitamins, particularly vitamins C and A, and additional components that provide anticancer benefits. While not wishing to be bound by any particular theory, the inventors believe that it is dietary sources of refined fructose that are the real risk, in the form of fructose corn syrup. The inventors also believed that the increased proliferative actions of fructose are not restricted to breast cancers with disrupted EGFR-signaling.
While not wishing to be bound by any particular theory, the inventors also believed that refined fructose is an independent risk factor for in vivo breast cancer development and progression. The effects of fructose in vivo may be multifactorial and include effects due to increased insulin resistance, effects due to an enhanced inflammatory state, and effects due to associated obesity.
In vitro data demonstrated that breast cancer cells proliferate more rapidly in medium containing fructose than glucose, and express fructo-kinase-1 (FK-1), a glycolytic enzyme that is usually only found in significant amounts in normal hepatic and intestinal cells. While not wishing to be bound by any particular theory, it is believed that aberrant breast cancer FK-1 expression and increased expression of a second key glycolytic enzyme, inducible phospho-fructokinase-2 (iPFK-2/PFKFB-3) underlie the increased fructose-mediated proliferation the inventors have observed. Fructo-kinase-1 expression allows breast cancer cells to metabolize fructose to fructose-1-phosphate, thereby bypassing key rate limiting steps that regulate glucose metabolism. The second enzyme, iPFK-2/PFKFB-3 generates fructose 2, 6 bisphosphate (F 2,6 BP), which is a potent inducer of phosphofructokinase-1 activity, the rate-limiting enzyme of glycolysis.
The inventors' demonstration (
The following examples are provided to better illustrate the claimed invention and are not to be interpreted as limiting the scope of the invention. To the extent that specific materials are mentioned, it is merely for purposes of illustration and is not intended to limit the invention. One skilled in the art may develop equivalent means or reactants without the exercise of inventive capacity and without departing from the scope of the invention.
Example 1 Breast Cancer Cells Exhibit Increased In Vitro Proliferative Rates in Fructose Versus GlucoseStandard media for breast cancer cell culture contain either 5-7 mM (low) and 12-25 mM (high) glucose concentrations. Estrogen receptor (ER) positive MCF-7, and ER negative MDA-MB231 cells were cultured overnight in 2 mM glucose standard DMEM medium containing 10% fetal bovine serum prior to incubation for periods between 8, and 72 hours in standard DMEM medium containing 10% fetal bovine serum, and 5 mM glucose or 5 mM fructose.
Proliferative rates were then measured in replicate (minimum of 6) aliquot wells of the breast cancer cells grown in glucose, or fructose containing medium. As depicted in
While not wishing to be bound by any particular theory, it is believed that the increased breast cancer proliferative rates are due to increased expression of several key glycolytic enzymes, including fructokinase-1, and inducible phosphofructokinase (iPFK-2/PFKFB-3) levels. The inventors used RT-PCR analysis and specific primer pairs (SEQ ID NO: 1 (3′cctgccagatgtgtctgcta), SEQ ID NO: 2 (5′aagtgcttggccacatcttt)) to examine fructokinase-1 (FK-1) mRNA levels in glucose- or fructose-treated breast cancer cells. As depicted in
FK-1 catalyzes the conversion of fructose to fructose-1-phosphate, the first step by which fructose can enter the fatty acid synthesis pathway. The data demonstrate that breast cancer cells also express fructose 1-P-aldolase (FPA) mRNA, the second enzyme in this pathway. As depicted in
In additional studies, the inventors used Northern blot to confirm significant FK-1 mRNA expression in the breast cancer cells. As depicted in
Cellular fructose uptake is facilitated by a member of solute carrier family 2, called glucose transporter type 5 (GLUT-5). Following incubation of MCF-7 breast cancer cells in 2 mM, 5.5 mM glucose or 5.5 mM fructose for 48 h, total RNA was harvested, and analyzed by quantitative real-time RT-PCR analysis using GLUT-5 specific primers to quantify GLUT-5 mRNA expression. GLUT-5 expression was normalized to GAPGH mRNA expression, and expressed as fold-change in comparison to control breast cancer cells incubated in 2 mM glucose for 4, and 24 hours. As depicted in
Although several signal transduction pathways are likely involved in the fructose-mediated enhanced breast cancer growth and while not wishing to be bound by any particular theory, the inventors believe that the MAP-kinase pathway is involved. The inventors have used Western blot analysis to examine the MAPK pathway in breast cancer cells incubated in 2 mM glucose, 5.5 mM glucose, and 5.5 mM fructose for 48 hours. MEK mediated phosphorylation of the p44/42 MAP kinase (ERK) is the first step in this cascade and the inventors observed increased expression of phospho-MEK (pMEK) in MCF-7, and MDA-MB231 breast cancer cells grown in 5.5 mM fructose, in comparison to cells grown in 5.5, and 2 mM glucose. Activation of MEK, and subsequently ERK results in phosphorylation of p90Rsk, which leads to transcriptional activation of CREB and AP1, which bind to cAMP or AP1 response elements respectively, activating gene transcription and promoting cellular growth. After 24 h incubation of breast cancer cells in 5.5 mM fructose, the inventors observed increased phospho-Rsk (pRsk), and phospho-CREB (pCREB), in comparison to cells grown in 5.5, and 2 mM glucose for the same time period. Furthermore, using an ELISA-based transbinding AP1 assay (Panomics), the inventors demonstrated a 3-fold increase in AP1 activation in 5.5 mM fructose-treated cells in comparison to a 2.2 fold increase in cells treated with 5.5 mM glucose (
Firstly, ER-positive MCF-7, and ER-negative MDA-MB231 breast cancer cells are cultured in a range of concentrations of glucose, and fructose to confirm, and extend the findings that culture in fructose results in increased breast cancer growth. The data (
Briefly, MCF-7, and MDA-MB231 cells (˜10,000 per well) are first plated on to 96-well plates, in standard whole serum (10% FBS), high glucose (25 mM) DMEM medium. Cells are then incubated overnight in whole serum (10% FBS) low glucose (2 mM) DMEM. The following day, cells are changed to medium containing a range of glucose or fructose (5, 10, 25, 50, 75, & 100 mM) for times 24, 48, 72 and 96 h. Proliferative rates are measured in the cells using the MTS assay. Briefly, cells are incubated with ‘One Solution’ (containing tetrazolium compound MTS and phenazine ethosulfate reagent) at 37° C. for 2 h. Absorbance (490 nm) which correlates closely with cell proliferation measured using CellTiter 96 AQueous One Solution Cell Proliferation Assay (MTS) according to manufacturer's instructions (Promega, Madison, Wis., USA). This rapid assay is ideal for these large numbers of samples, and quickly allows determination of optimal dose ranges, and treatment times for subsequent experiments. The focus is on physiologically relevant glucose & fructose concentrations (5-25 mM), to translate these findings to human breast cancer. Proliferative rates are also quantified by measurement of bromodeoxyuridine (BRDU) uptake in the fructose-, and glucose-treated cells. Breast cancer cells are also plated in 12-well dishes, incubated in a similar range of glucose, and fructose concentrations for 24-96 h, and aliquots of the fructose-, and glucose-treated cells then prepared for FACS analysis to measure cell-cycle profiles.
Example 7 Fructose/Glucose Uptake and Oxidative PhosphorylationTwo areas are important: (1) Increased GLUT expression resulting in increased fructose uptake into the cell; and (2) Increased expression of key glycolytic enzymes, particularly fructokinase-1, and inducible phosphofructokinase-2, that result in increased oxidative phosphorylation.
GLUT ExpressionAs noted above, a family of glucose-uptake and transporter (GLUT) proteins regulate cellular glucose uptake, and previous studies have demonstrated increased GLUT expression in cancer, including the fructose-selective GLUT-5 (Zamora-Leon S P, Dolde D W, Concha I I, Rivas C I, Delgado-Lopez F, Baselga J, Nualart F, Carlos-Vera J. Expression of the fructose transporter GLUT5 in human breast cancer. Proc Natl Acad Sci 93: 1847-52, 1996; Macheda M L, Rogers S, and Best J D. Molecular and cellular regulation of glucose transporter (GLUT) proteins in cancer. J Cellular Physiol 202: 654-662, 2005; Smith T A D. Facilitative glucose transporter expression in human cancer tissue. Brit J Biomed Sci 56(4): 285-292, 1999; Rogers S, Docherty S E, Slavin J L, Henderson and Best J D. Differential expression of GLUT12 in breast cancer and normal breast tissue. Cancer Letters 193(2): 225-233, 2003). Increased GLUT-mediated fructose uptake, thereby increasing substrate availability, contributes to increased proliferation. Therefore, breast cancer GLUT expression is examined RT-PCR and Western blot analysis in the fructose- and glucose-treated breast cancer cells. While not wishing to be bound by any particular theory, it is believed that the increased fructose-mediated proliferation is due to enhanced GLUT-5-trafficked fructose uptake, and fructose is able to self-regulate its own transporter. SiRNA approaches are employed to silence GLUT-5 expression in the breast cancer cells and to determine the alteration in increased growth rates observed in the fructose-treated breast cancer cells. In parallel experiments, vectors harboring GLUT-5 are transiently transfected into MCF-7, and MDA-MB231 cells. Increased GLUT-5 expression are confirmed by Western blot, and the effects of increased GLUT-5 expression on breast cancer cell growth rates across a range of fructose and glucose concentrations examined.
Oxidative PhosphorylationThree approaches are used to examine oxidative phosphorylation in the fructose-treated and glucose-treated breast cancer cells. Firstly, several key glycolytic enzymes following breast cancer fructose-, or glucose-treatment, is quantitated using RT-PCR, and Northern blot analysis. While not wishing to be bound by any particular theory, it is believed that there is increased glycolysis, and hence oxidative phosphorylation in the fructose-versus glucose-treated cells, one would expect that expression of the key glycolytic enzyme phospho-fructokinase-1 is increased in the fructose-treated breast cancer cells, compared to the glucose-treated cells. Briefly, after glucose- or fructose-treatment, total RNA (1-2 μg) from the MCF-7, and MDA-MB231 breast cancer cells are treated with DNAse I, at 37° C. for 30 min and reverse transcribed using SuperScript First-Strand Synthesis system for RT-PCR (Invitrogen). Specific oligonucleotide primer pairs are used to amplify phospho-fructokinase-1 expression in the glucose- or fructose-treated cells (PFK-1: SEQ ID NO: 3 (3′agcctccctatccaggaaaa) and SEQ ID NO: 4 (5′tagacagcagccaggacctt)) using polymerase chain reaction (PCR). PCR for 18S is performed as an internal control on both RT positive and negative samples to confirm cDNA product integrity. Aliquots of the PCR products are electrophoresed on 1% agarose gels and stained with ethidium bromide to visualize PCR products. Band intensity is quantified using scanning densitometry.
While not wishing to be bound by any particular theory, it is believed that the increased glycolysis is due to increased cancer fructose kinase-1 (FK-1), and inducible phosphofructokinase-2 (iFPK-2) activity. Northern blot analysis is used to quantify FK-1, and iPFK-2/FBPase-2. Briefly, total RNA is extracted from the fructose-, or glucose-treated MCF-7, and MDA-MB231 breast cancer cells in Trizol, and Northern blot analyses using full-length FK-1, or iPFK-2/FBPase-2 [α-32P]dCTP—random primer labeled cDNA as probes, performed by standard procedures (Heaney A P, Singson R, McCabe C J, Nelson V, Nakashima M, Melmed S. Pituitary Tumor Transforming Gene: a novel marker in colorectal tumors. Lancet 355:716-719, 2000). RNA integrity is verified by observing the rRNA bands in ethidium bromide gels under UV, and the level of mRNA is quantified by densitometric scanning of the autoradiograms and corrected for 18 s rRNA expression (Sambrook J, Fristsch E F, and Maniatis T. Molecular Cloning: A Laboratory Manual, edited by Nolan C. Cold Spring Harbor, N.Y.: Cold Spring Harbor, p. 7.3-7.5, 1989).
If inducible phosphofructokinase-2 (iFPK-2) activity is increased, increased levels of the metabolite fructose-2, 6 bisphosphate (Fru-2,6-P2) in the fructose—compared to glucose- or vehicle-treated cells may be observed. Therefore, Fru-2,6-P2 levels are quantitated. Briefly, fructose-, or glucose-treated MCF-7, and MDA-MB231 cells are homogenized in 0.1 M NaOH, heated to 80° C. for 15 min, and centrifuged at 12,000 g for 5 min. Fru-2,6-P2 is then determined in the supernatants by its ability to activate pyrophosphate-dependent iPFK-1 from potato tubers as described by Van Schaftingen et al. (Van Schaftingen E. Fructose 2,6-bisphosphate. Adv Enzymol Relat Areas Mol Biol 59: 315-395, 1987; Van Schaftingen E, Lederer B, Bartrons R, and Hers H G. A kinetic study of pyrophosphate: fructose-6-phosphate phosphotransferase from potato tubers. Application to a microassay of fructose 2,6-bisphosphate. Eur J Biochem 129: 191-195, 1982; Van Schaftingen E, Jett M F, Hue L, and Hers H G. Control of liver 6-phos-phofructokinase by fructose 2,6-biosphophate and other effectors. Proc Natl Acad Sci USA 78: 3483-3486, 1981). The glycolytic metabolites are then measured spectrophotometrically in neutralized perchloric extracts, using standard enzymatic methods.
As discussed above, fructose can potentially bypass the rate-limiting step (catalyzed by PFK-1) of glycolysis, if it is metabolized directly to fructose-1-phosphate by the enzyme fructokinase-1. The inventors' data demonstrates that breast cancer MCF-7 cells express FK-1 mRNA. Therefore, Northern blot is used to quantify fructokinase-1, and fructose 1-P aldolase mRNA levels, the second enzyme in this pathway. The latter catalyzes the conversion of fructose-1-phosphate to dihydroxyacetone phosphate, and its presence confirms that breast cancer cells can traffic fructose directly into the lipogenesis pathway, bypassing regulatory controls that restrict glycolytic glucose trafficking. To determine the activity of fructokinase-1 (FK-1), fructose 1-phosphate levels, the metabolite of the FK-1 catalyzed reaction, are measured Fructose 1-phosphate is measured using a commercially available assay based on its conversion to fructose 1,6-bisphosphate by a bacterial fructose-1-phosphate kinase. Briefly, the open reading frame encoding Escherichia coli Fru1PK has been introduced in an expression plasmid (pET3a) based on the T7 promoter-driven system, and is used to overexpress the enzyme, and the preparation can be used in an enzymatic assay to measure specifically fructose 1-phosphate levels in cell or tissue extracts.
Thirdly, lactate production, as this is a key metabolite of glycolysis, and as noted previously serum lactate levels correlate with several outcome measures in human cancer, is measured. For measurement of lactate production, cell suspensions attached to microcarriers are used. Briefly, after incubation of the breast cancer cells in fructose or glucose, cells are trypsinized, washed, and added to preswollen Cytodex-1 microcarriers (Pharmacia Biotech), and suspended in DMEM. To achieve a maximum yield of cells attached to microcarriers, the cultures are stirred for 5 min every 30 min. After 2 h, the medium is changed and the cultures stirred continuously at 60 rpm. Microcarrier cultures are then incubated for up to 48 h. Cells attached to microcarriers are then rinsed and suspended in Krebs bicarbonate buffer containing 2.5 mM CaC12, 2% BSA, and 10 mM glucose prior to measurement of lactate production.
Expression vectors harboring full-length wild-type cDNA from iPFK-2/FBPase-2, and a truncated mutant iPFK-2/FBPase-2 that only exhibits bisphosphatase activity (pFBPase-2) are generated. Wt- and Mut-iPFK-2/FBPase-2 are transiently transfected into MCF-7, and MDA-MM231 cells, and expression is confirmed by RT-PCR analysis using specific sense and antisense Wt-, and Mut-primers (Darville M I. Crepin K M, Vandekerckhove J, Van-Damme J, Octave I N, Rider M H, Marchand M J, Hue L, and Rousseau G G. Complete nucleotide sequence coding for rat liver 6-phosphofructo-2-kinase/fructose-2,6-bis phosphatase derived from a cDNA clone. FEBS Lett 224: 317-321, 1987). Wt-, and Mut-MCF-7, and MDA-MB231 transfectants are incubated in fructose, or glucose for 24 h, and effects of overexpression of the Wt-, or Mut-iPFK-2/FBPase-2 on proliferative rates are examined. As Wt-iPFK-2/FBPase-2 further increases Fru-2,6-P2 levels to further induce PFK-1, and while not wishing to be bound by any particular theory, it is believed that breast cancer cells transfected with the Wt-iPFK-2/FBPase-2 will exhibit higher proliferative rates than vector-transfected cells, and the proliferative rates will be further increased by fructose-treatment. While not wishing to be bound by any particular theory, the inventors believe that Mut-iPFK-2/FBPase-2 expression drives glycolysis towards glycogen synthesis, reduces proliferative rates, and abrogates the fructose-induced breast cancer proliferative rates.
Example 8 Signal TransductionAlthough it is likely that several signal transduction pathways are involved in fructose-mediated breast cancer proliferation, previous studies have demonstrated that ras-transformation in rat-1 fibroblasts led to increased F2, 6 BP levels, and aerobic glycolysis, and multiple potential binding sites for several ras-activated transcription factors, including myc, and nuclear factor kB have been identified on the iPFK-2 promoter (Norris J L and Baldwin A S Jr. Oncogenic ras enhances NF-κB transcriptional activity through Raf-dependent and Raf-independent mitogen-activated protein kinase signaling pathways. J Biol Chem 274: 13841-13846, 1999; Minchenko A, Leschinsky I, Opentanova I, Sang N, Srinivas V, Armstead V and Caro J. Hypoxia-inducible factor-1-mediated expression of the 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 (PFKFB3) gene. Its possible role in the Warburg effect. J Biol Chem 277: 6183-6187, 2002). Therefore, while not wishing to be bound by any particular theory, the inventors believe that the MAP-kinase pathway is likely to be important. Several MAPK cascades have been identified including the extracellular signal-related kinase pathways (ERK 1/2, ERK5), and the stress activated kinase pathways (JNK/SAPK, p38 MAPK). As all MAPK pathways operate through sequential phosphorylation events, Western blot analysis using phospho-specific antibodies is employed to examine p90RSK, CREB, c-fos, and ELK-3 levels in protein lysates harvested from MCF-7, and MDA-MB231 cells cultured in 2, 5, 10, and 25 mM fructose, and glucose for 24 h. Additionally, MCF-7, and MDA-MB231 cells are transiently transfected with CRE-luciferase, AP-1-luciferase, and SRE-luciferase reporter constructs. A β-Galactosidase reporter construct is co-transfected as a control. Following incubation of the transient transfectants in a range of glucose, and fructose concentrations as before (5, 10, & 25 mM) for 24 h, cell lysates are harvested, and luciferase activities measured, and normalized for μ-Gal to correct for changes in cell number or transfection efficiency. All samples are analyzed in triplicate, a minimum of three separate experiments are conducted for each study outlined above, and statistically analyzed as described below. To further characterize the role of the MAP-kinase pathway in fructose-mediated breast cancer proliferation, proliferative rates in the fructose-, and glucose-treated breast cancer cells with, and without pharmacological inhibition of the MAPK-pathway using the specific MKK 1/2 and, MEK 1/2 inhibitors PD98059, and UO126, are compared. Additionally, plasmids encoding a dominant negative MAPK, or empty vector alone (Pearson G, Robinson F, Gibson T B, Xu B, Karandikar M, Berman K, Cobb M H. 2001. Mitogen-activated protein (MAP) kinase pathways: Regulation and physiological functions. Endo Rev 22: 153-183) are transiently co-transfected into MCF-7 and MDA-MB231 breast cancer cells before incubation in fructose or glucose. Dominant negative (DN) MAPK expression is confirmed by western blot, and proliferative rates in fructose-treated DN MAP-kinase expressing breast cancer cells compared with glucose-treated DN MAP-kinase expressing cells, and fructose-, and glucose-treated control vector transfected cells. Protein aliquots from fructose-, and glucose-treated breast cancer cells are also analyzed to examine activation of other signal transduction pathways, including the PI-3K/AKT and phospholipase-C-γ pathways, as these pathways are extremely important in breast cancer (Mills G B, Kohn E, Lu Y, Eder A, Fang X, Wang H, Bast R C, Gray J, Jaffe R, Hortobagyi G Linking molecular diagnostics to molecular therapeutics: targeting the PI3K pathway in breast cancer Semin Oncol. 30 (Suppl 16): 93-104, 2003).
Example 9 Determine Effects of Refined Fructose Consumption on In Vivo Breast Cancer GrowthThe effects of 10% and 20% added refined fructose and glucose on breast cancer development are examined. These percentages are chosen as they are conservative but meaningful equivalent to current human refined carbohydrate intake. Therefore, refined glucose or fructose is administered to mice overexpressing activated neu oncogene under the control of the mouse mammary tumor virus (MMTV) promoter. Effects of treatments on time to tumor development and tumor multiplicity are examined.
Example 10 Transgenic MiceFemale MMTV-erbB2 transgenic mice are purchased from the Jackson Laboratory. In this murine breast cancer model, the MMTV promoter from the mouse mammary tumor virus long terminal repeat causes the erbB2 gene to be expressed in the mammary gland. These animals reproducibly develop focal mammary tumors that arise spontaneously at 4 months, with a median incidence of 205 days. Mice are housed in animal facilities, in accordance with institutional care and use guidelines.
Example 11 Treatment and Data CollectionThe mice receives a commercially purchased standard chow diet (Labdiet.com, certified rodent diet 5002), eat ˜5 g per day, and receive a total daily intake of approximately 1700 Kcal, comprising 64.5% CHO, 11.8% fat, 23.5% protein, and 4.6% fiber. Mice also receive a fructose or glucose sugar solution containing 0.42 g or 0.84 g fructose or glucose (diluted in 100 ml) which equate to 10% or 20% added refined carbohydrate respectively or vehicle daily from age 3 months to 12 months. Developing tumors in the fructose-, glucose-, and vehicle-fed mice are measured twice a week with electronic calipers, and tumor volumes determined by multiplying the square of the width (w) by the length (l) and dividing by two (i.e., (w2l)/2). Individual animal weights, tumor size and tumor location are recorded for each animal twice a week. Animals are euthanitized when they develop tumors of 1000 mm3 or more or at the end of the experiment, at the same time of day (9 am) to limit temporal variations in glucose, insulin, and other parameters. Two hours before killing, the mice are injected intraperitoneally with bromodeoxyuridine (3 mg/mL) in phosphate-buffered saline, (100 μL/10 g body weight). The end of the experiment is defined as the time when all vehicle-treated mice have developed a tumor (usually at ˜330 days of age). At that time, all remaining mice (vehicle-, glucose-, and fructose-treated) are killed, tumors resected, and studied as below.
Example 12 Histology and Biomarker Analysis—Breast CancerFor histology, breast tumors are fixed in 10% formalin and embedded in paraffin. Tissue sections are mounted on slides and processed for hematoxylin-eosin staining. Immunohistochemical staining is performed for erbB2 to confirm tumor expression, and for proliferating cell nuclear antigen (PCNA & Ki-67) to compare tumor proliferative rates in the mice. Briefly, tissue sections are deparaffinized in xylene, rehydrated, endogenous peroxidase activity blocked, and non-specific binding reduced with goat serum. Sections are then incubated with one of the following antibodies: rabbit anti-c-erbB2 antibody (Neomarkers) (1:50), or monoclonal anti-PCNA Or Ki-67 (MIB-1) antibodies (1:200). Washed sections are incubated with biotinylated goat anti-rabbit antibody, incubated with the ABC kit (Vector labs), and 3-amino-9-ethylcarbazole to visualize the peroxidase complex. Levels of pRb are evaluated by visual assessment with a semiquantitative scoring system rating staining intensity (from 0 to 3). Staining for bromodeoxyuridine (BRDU) is performed with the DAKO Animal Research Kit system. Briefly, tissue sections are prepared, endogenous peroxidase blocked, and nonspecific binding reduced as before. BRDU are stained with a mouse anti-BRDU monoclonal antibody (DAKO). Slides are incubated with streptavidin-horseradish peroxidase, and visualized with diaminobenzidine chromagen. Counterstaining is performed with hematoxylin. Stained sections are reviewed, and scored by counting the positive and negative cells in 10 high-powered fields in tissue samples from 4 mice from each group. Results are expressed as an average percentage with 95% confidence intervals.
Example 13 Glucose, Insulin, IGF1, Lipid, and Inflammatory Cytokine LevelsFructose-, glucose-, and vehicle-treated mice are fasted for 24 h (9 am -9 am) every 4 weeks, and at euthanasia, blood are collected by the tail clip method into chilled tubes for assay of glucose, insulin, lipid and inflammatory cytokine levels. Plasma glucose concentrations are determined using Glucotrend 2 (Roche Diagnostics); plasma insulin (Linco Res), and IGF-1 Phoenix Pharmaceuticals levels are measured using solid phase two site enzyme immunoassays; plasma triglyceride, free fatty acids, lactate, and μ-hydroxybutyrate concentrations are analyzed using commercially available kits (Sigma Diagnostics). Serum inflammatory markers include C-reactive protein, IL-6 (R&D Systems), serum sialic acid, soluble intracellular and vascular adhesion molecules (sICAM-1, and sVCAM-1) (Bender MedSystems Inc), and amyloid A levels, and are assayed using commercially purchased ELISA based kits (R & D, Quantikine). All parameters are measured in triplicate in the breast cancer susceptible mice, and means compared between the fructose-, and glucose-, and vehicle-fed animals, at the various timepoints using ANOVA with Bon-Ferroni post t-tests for multiple comparisons. Time curves are graphed to compare trends in fasting glucose, insulin, lipid, and triglyceride levels, and inflammatory markers over the course of dietary treatment.
Example 14 Alternative ApproachesAllotypic graft tumors are generated by injecting cells derived from erbB2 Tg mice (NK), into the mammary gland of FVB/N mice (these are the background strain).
Example 15 Pancreatic Cancer Cells Exhibit Increased In Vitro Proliferation in Fructose in Comparison to GlucoseStandard media for maintenance cancer cell line culture, including pancreatic cancer cells such as PANC-1 cells contain either low—(5-7 mM), or high—(12-25 mM) glucose concentrations. Clearly, apart from the setting of hyperglycemia, as in patients with diabetes, the glucose concentrations in which pancreatic cancer cells are maintained in vitro are much higher than normal physiological conditions, which range between 2-5 mM glucose. While the inventors did not wish to expose the cells to serum-free conditions, as is customary when testing potential “growth-factor” effects, the inventors sought to conduct the experiments under conditions that might ultimately be physiologically relevant to patients with pancreatic cancer. Therefore, the inventors first pre-treated the pancreatic cancer cells overnight in standard DMEM medium containing low physiological glucose concentrations (2 mM glucose), and standard 10% fetal bovine serum. The pancreatic cancer cells were then incubated for times between 12, and 96 hours in standard DMEM medium containing 10% fetal bovine serum, and 5.5 mM glucose or 5.5 mM fructose. Proliferative rates were then measured in replicate (minimum of 6) aliquot wells of the pancreatic cancer cells, and the change (expressed as percent increase) in proliferative rates compared between cells grown in glucose, or fructose containing medium. As depicted in
This first result intrigued the inventors, but given there is little documentation regarding physiological fructose concentrations, the inventors first considered that the “apparent” pro-proliferative effects of fructose were simply a consequence of the highly stylized in vitro experimental conditions, and that if the pancreatic cancer cells were cultured in higher glucose concentrations, this would result in similar proliferative rates to those the inventors observed following culture in 5.5 mM fructose. Therefore, in the next experiments, the inventors compared proliferative rates of the PANC-1 pancreatic cancer cells following culture for 72 h in a range of fructose, and glucose concentrations (2-25 mM). This timepoint was chosen as the inventors had seen maximal pancreatic cancer cell proliferation in 5.5 mM fructose at 72 h. As depicted in
As a further measure of PANC-1 proliferative rates, the inventors compared bromodeoxyuridine (BRDU) uptake following PANC-1 cell treatment as before with 2 mM, and 5.5 mM glucose, or 5.5 mM fructose for 72 h. In the final 12 h, 10 μM BRDU was added to the glucose-, and fructose-treated cells, after which BRDU-positive cells were counted. As depicted in
As depicted in
Additionally, protein extracts were harvested in RIPA buffer from the PANC-1 cells following 2 mM, 5.5 mM glucose-, and fructose-treatment for 48 h, analyzed by Western blot, and immunoblotted using a specific monoclonal antibody to proliferating cell nuclear antigen (PCNA). As depicted in
In the course of obtaining fresh surgically resected pancreatic cancer tissue, the inventors also obtained some peripherally adjacent “normal” pancreatic tissue and normal tissue from a patient undergoing pancreas resection for complications of chronic pancreatitis. The inventors studied 5 of these “normal” pancreas tissues, and although caveats may exist given that they were derived from pancreases which were involved with another disease entity, the inventors believe they offer a useful comparator for the tumors. Similar to the pancreatic cancers, normal pancreatic tissue was mechanically and enzymatically dispersed, and cells seeded into 6-well plates containing 2 mM glucose, 5.5 mM glucose, or 5.5 mM fructose for 72 h. As before, BRDU (10 □M) was added, after which BRDU-uptake was quantified. In parallel experiments, when sufficient normal pancreatic issue was available, proliferative rates following 72 h incubation in the sugars were also measured using the MTS proliferation assay. As depicted in
Firstly, the inventors believed that pancreatic cancer cells may express fructokinase-1 and fructose-1-P aldolase, enzymes that would enable them to metabolize fructose to fructose-1-phosphate, allowing fructose to enter the TCA cycle downstream of the negative regulatory feedback of phosphofructokinase. To examine this, the inventors used RT-PCR analysis and specific primer pairs to examine fructokinase-1 (FK-1) and fructose-1-P aldolase (FPA) mRNA levels in glucose- or fructose-treated PANC-1 cells, and in surgically resected human pancreatic cancers. As depicted in
A family of facilitative glucose/fructose transporter (GLUT) proteins regulate cellular sugar uptake, and previous studies have demonstrated increased cancer GLUT expression, including the fructose-selective GLUT-5 (Zamora-Leon S P, Dolde D W, Concha I I, Rivas C I, Delgado-Lopez F, Baselga J, Nualart F, Carlos-Vera J. Expression of the fructose transporter GLUT5 in human breast cancer. Proc Natl Acad Sci 93: 1847-52, 1996; Macheda M L, Rogers S, and Best J D. Molecular and cellular regulation of glucose transporter (GLUT) proteins in cancer. J Cellular Physiol 202: 654-662, 2005; Smith T A D. Facilitative glucose transporter expression in human cancer tissue. Brit J Biomed Sci 56(4): 285-292, 1999; Rogers S, Docherty S E, Slavin J L, Henderson and Best J D. Differential expression of GLUT12 in breast cancer and normal breast tissue. Cancer Letters 193(2): 225-233, 2003). Therefore, the inventors' believed that if pancreatic cancer cells exhibited increased GLUT expression, this may increase carbohydrate (fructose) substrate availability, to mediate increased pancreatic cancer proliferation. Teal-time RT-PCR was used to measure GLUT-5 mRNA expression following 2 mM, and 5.5 mM glucose-, and 5.5 mM fructose-treatment for 4 h, and 24 h respectively. GLUT-5 mRNA was expressed as the fold-change relative to GLUT-5 mRNA levels in 2 mM glucose-treated cells. As depicted in
Several signal transduction pathways may be involved in fructose-mediated pancreatic cancer growth but given the importance of the MAPK pathway in proliferation, the inventors believed that MAPK was involved. In the MAPK pathway, MEK mediated phosphorylation of the p44/42 MAP kinase (ERK) is the first step in this cascade, which results in phosphorylation of p90Rsk, leading to transcriptional activation of CREB, and AP1, activating gene transcription and promoting cellular growth. The inventors employed Western blot analysis to examine MAPK pathway expression in pancreatic cancer cells incubated in 2 mM glucose, 5.5 mM glucose, and 5.5 mM fructose for 48 hours. Levels of the active phosphorylated proteins, pERK, pRSK, and pMEK were normalized to total ERK, RSK, and MEK levels respectively, and compared between the fructose-, and glucose-treated PANC-1 cells. As depicted in
In separate experiments PANC-1 cells, and primary cultures of surgically resected pancreatic tumors were incubated in 2 mM glucose, or 5.5 mM glucose or 5.5 mM fructose for 48 h, after which nuclear extracts were incubated with a biotinylated AP-1 probe in binding buffer. AP-1/AP1 probe complexes were next conjugated to a streptavidin-coated assay plate and detected using an AP-1 specific antibody, followed by binding of a horseradish-peroxidase conjugated secondary antibody, and detection by a colorimetric reagent. As depicted in
Following incubation of the PANC-1 cells in 5.5 mM glucose, an approximate 2-fold increase in luciferase activity was noted in comparison to 2 mM glucose. Highest AP-1 luciferase reporter activity was observed in the PANC-1 cells that had been incubated in 5.5 mM fructose, which was approximately 40% higher than luciferase levels measured in the PANC-1 cells which had been incubated in 5.5 mM glucose, further demonstrating the importance of MAPK-signalling in fructose-mediated pancreatic cancer effects. In a primary culture of a pancreatic tumor, prepared as previously described (
Metabolism comprises anabolic (converting small molecules into big ones) and catabolic processes (converting food into useful energy), predicts the functional state of a cell, and analyzes the levels of the end products (metabolites) of anabolism and catabolism. Metabolic profiling using stable isotope tracer technology ([1,2-13C] sugars) allows the measurement of the changing pattern of distribution of 13C carbons from [1,2-13C] glucose in intracellular metabolic intermediates, and provides a simultaneous measure of carbon flow toward the pentose cycle, glycolysis, direct glucose oxidation, tricarboxylic acid (TCA) cycle and fatty acid synthesis (Cascante, M., Boros, L. G., Comin, B., Atauri, P., Centelles, J. J., Lee, W-N. P. Metabolic control analysis in drug discovery and disease. Nature Biotechnology 20: 246-249, 2002; Boros L G, Cascante M, Lee W N. Metabolic profiling of cell growth and death in cancer: applications in drug discovery. Drug Discovery Today 7: 364-72, 2002). It also reveals specific flux changes in lactate, glutamate, nucleic acid ribose, palmitate and CO2, and is a useful complement to the understanding of diseases, including cancer. The inventors employed [1, 2-13C2] glucose, or [1,2-13C2] fructose stable isotope-based dynamic metabolic profiling (SiDMAP, Los Angeles, US) to track and quantify changes in glucose, and fructose carbon re-distribution among major metabolic pathways in pancreatic cancer cells (Lee W N, Boros L G, Puigjaner J, Bassilian S, Lim S, Cascante M. Mass istopomer study of transketolase-transaldolase pathways of the pentose cycle with [1,2-13C2]glucose. Am J Physiol 274:E843-51, 1998; Lee W N, Byerley L O, Bassilian S, Ajie H O, Clark I, Edmond J. Isotopomer study of lipogenesis in human hepatoma cells in culture: contribution of carbon and hydrogen atoms from glucose. Anal Biochem 226: 100-112). The principles of this methodology are outlined below in a series of schematics (
Secondly, as depicted in
As depicted in
Ribose and deoxyribose synthesis, the building blocks of nucleotides, following glucose, and fructose-treatment were also compared. 13C incorporation from glucose or fructose into RNA ribose or DNA deoxyribose indicates changes in nucleic acid synthesis rates through the respective branches of the pentose cycle. Following the [1,2-13C2]D-glucose-, or [1, 2-13C2]D-fructose-treatments, RNA ribose was isolated by acid hydrolysis of cellular RNA after Trizol purification of cell extracts. Total RNA was quantified by spectrophotometric determination, in triplicate cultures. Ribose was then derivatized to its aldonitrile acetate form using hydroxylamine in pyridine with acetic anhydride (Supelco, Bellefonte, Pa.) before mass spectral analyses. The ion cluster was monitored around the m/z 256 (carbons 1-5 of ribose) (chemical ionization, CI) and m/z 217 (carbons 3-5 of ribose) and m/z 242 (carbons 1-4 of ribose) (electron impact ionization, EI) to determine molar enrichment and the positional distribution of 13C in ribose. Ribose molecules labeled with a single 13C atom on the first carbon position (m1) recovered from RNA were used to gauge the ribose fraction produced by direct oxidation of glucose or fructose through the G6PD pathway. Ribose molecules labeled with 13C on the first two carbon positions (m2) were used to measure the fraction produced by transketolase. Doubly labeled ribose molecules (m2 and m4) on the fourth and fifth carbon positions were used to measure molar fraction produced by triose phosphate isomerase and transketolase. In contrast to the relatively lower contribution of 5.5 mM fructose to glycolysis, and to fatty acid synthesis in comparison to glucose, as depicted in
In separate studies, the inventors treated primary cultures of 4 pancreatic adenocarcinomas, and 3 normal pancreas tissues with the [1,2-13C2]D-glucose-, or -fructose-tracers as before for 72 h, and carried out metabolomic studies. A representative experiment is depicted in
These fascinating metabolomic results demonstrated for the first time that metabolism of fructose by pancreatic cancer cells was strikingly different to that of glucose. Although both sugars were utilized to some extent in glycolysis, fatty acid, and nucleic acid synthesis, there are differences in the metabolism of glucose, and fructose, at least at these concentrations, and times, by pancreatic cancer cells. Whereas a considerable proportion of administered glucose was metabolized via glycolysis, and fatty acid synthesis, fructose was in large part metabolized by the non-oxidative pentose phosphate shunt to synthesize nucleic acids. These results also indicated that the mechanism of fructose-mediated increased growth may be more complex and interesting. These results provided important insights into fructose-mediated increased pancreatic cancer cell proliferation, and proposed an important role for the enzyme transketolase.
Example 22 Pancreatic Cancer Cells Utilize Fructose for Purine SynthesisBased on the metabolomic studies which led the inventors to believe that fructose was metabolized in pancreatic cancer cells in large part to generate nucleic acids, the inventors devised a series of experiments to examine nucleic acid synthesis in the pancreatic cancer cells following either glucose or fructose-treatment. PANC-1 cells were incubated as before in 5.5 mM glucose or fructose for 24 h, following an ELISA-based fluorimetric assay (Amplex Red Uric acid uricase assay kit, Invitrogen) was employed to measure uricase activity in conditioned medium derived from the pancreatic cancer cells (Shi Y, Evans J E, Rock K L. Molecular identification of a danger signal that alerts the immune system to dying cells Nature 425, 516-21, 2003). Uricase activity correlates highly with uric acid production, a purine by-product of nucleic acid synthesis. Briefly, in the assay, uricase catalyzes the conversion of uric acid to allantoin, hydrogen peroxide (H2O2), and carbon dioxide. The H2O2 then, in the presence of horseradish peroxidase, reacts stoichiometrically with Amplex Red reagent to generate the red-fluorescent oxidation product, resorufin. Fluoresence was measured in a fluorescence microplate reader using excitation at 530 nm and detection at 590 nm, and the assay can detect levels as low as 100 nM uric acid. As demonstrated in
As noted previously, the metabolomic studies indicated that the enzyme transketolase (TKK) was important in the metabolism of fructose via the pentose phosphate pathway to increase nucleic acid synthesis. The inventors believe that fructose-treatment of pancreatic cancer cells led to an increase in TKK-driven nucleic acid synthesis, and thus fructose-treatment would result in an increase in either PANC-1 TKK expression and/or activity in comparison to equivalent glucose concentrations. Western blot analysis on protein lysates derived from fructose-, and glucose-treated PANC-1 cells were performed (5.5 mM fructose, and glucose for 24, and 48 h as per previous protocol) using a specific TKK antibody, and compared TKK expression in the fructose-, and glucose-treated PANC-1 cells. As depicted in
The normal circulating concentrations of fructose are unknown. To gain insight as to the potential relevance of the in vitro studies which demonstrate a pro-proliferative effect of fructose at concentrations above 4-5 mM, the inventors developed a sensitive, and specific ELISA-based assay to measure fructose levels in human sera, and tissue fluids. Briefly, aliquots (20 μl) of fructose standards (0.1, 0.5, 1, 2, 4, 6, and 8 mM) or unknown serum samples were mixed with 5 μl of a stock solution (125 U/ml) of the enzyme fructose dehydrogenase (Sigma) in 175 μl citric acid (0.05 M) phosphate (0.09 M) buffer (pH 4.5), and 20 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), and phenazine methosulfate (Promega), incubated for 30 minutes, after which absorbance at 570 nM was recorded in a 96-well spectrophotometer. In additional studies, the inventors confirmed that the assay did not cross-react with glucose, ribose, mannose or xylose, and additional controls included fructose standard samples with added glucose, which confirmed that the assay could specifically detect the sugar fructose. As the first analysis, in accordance with institutional review board guidelines, the inventors obtained 32 serum samples randomly selected from anonymous inpatients at Cedars-Sinai Medical Center. The inventors also measured glucose in these same samples using standard glucose oxidase based methods. No details of medical condition were known for these patients, and as depicted in
The inventors have performed the experiments in the primary tumor pancreatic cancer PANC-1 cell-line. As the inventors have also observed similar fructose-mediated effects on proliferation, MAPK-activation, and similar metabolomic profiles in primary cultures of freshly resected pancreatic tumors, the inventors believe that the PANC-1 cell is a good model to study fructose-mediated effects in pancreatic cancer. Extending the studies, and examining proliferative rates and metabolomic profiles in pancreatic cancer cell lines of various phenotypes may be done. These include MiaPaCa-2, another primary pancreatic cancer cell line, ASPC-1, and HPAF II, pancreatic cancer cell lines derived from ascitic fluid, and Capan1, and Hs766T, both derived from pancreatic cancer metastases. Additionally, the immortalized epithelial cell line derived from normal human pancreatic ducts HPDE6, which has previously been shown to maintain the phenotypic, and genotypic characteristics of normal human pancreatic ducts (Ouyang H, Mou Lj, Luk C, Liu N, Karaskova J, Squire J, Tsao M S. Immortal human pancreatic duct epithelial cell lines with near normal genotype and phenotype. Am J Pathol 157:1623-31, 2000) may be used. For proliferation assays, the pancreatic cells (˜10,000 per well) will be plated onto 96-well plates, in standard 10% FBS, high glucose (25 mM) DMEM medium. Cells are then incubated overnight in 10% FBS, low glucose (2 mM) DMEM, then switched to medium containing a range of glucose or fructose concentrations (2.5, 5, 7.5, 10, 15, 25, 50, 75, & 100 mM) for times 24, 48, 72 & 96 h. Proliferative rates are measured using CellTiter 96 AQueous One Solution Cell Proliferation Assay (MTS), according to manufacturers instructions (Promega, Madison, Wis., USA). This rapid assay is ideal for these large numbers of samples and will quickly allow for the determination of optimal dose ranges and treatment times for subsequent experiments. Proliferative rates are also quantified by BRDU-uptake in the fructose-, and glucose-treated cells, as employed in the studies. Following the glucose-, and fructose-treatments, aliquots of the pancreatic cancer cells will also be prepared for FACS analysis to characterize cell-cycle profiles, determining the percentage of cells in the resting G0/G1 phase, and the proliferative DNA synthesis-(S−) phase. In separate studies, pancreatic cancer cells, primary pancreatic cancers, and normal pancreas cultures will be treated with the [1,2-13C2]D-glucose-, or -fructose-tracers as before for 72 h, and submitted for metabolomic studies.
Example 26 Fructose-Enhanced Pancreatic Cancer Proliferation Involves MAPK ActivationBased on the results demonstrating higher pMEK, pRsk, and pCREB expression, and greater AP-1 luciferase activity in PANC-1 pancreatic cancer cells following fructose-treatment in comparison to glucose-treatment, the inventors believe that the MAPK pathway is a key mediator of fructose-induced pancreatic cancer growth. This hypothesis will be tested by examining pancreatic cancer MAPK signalling following glucose, and fructose-treatment in a variety of pancreatic cancer cells of different phenotypes, and normal pancreatic epithelial cells. Briefly, pancreatic cancer cells are seeded in 6-well plates, and treated with a range of glucose, and fructose concentrations (2, 5, 7.5, 10, 12.5, and 15 mM) for a range of times (6, 12, 24, 48, 72, and 96 h), after which aliquots of protein are harvested in RIPA buffer, and western blot analysis employed to measure activation of the MAPK pathway. Image analysis, with densitometric quantitation of immunoblots, is used to measure activation of the MAPK components. For example, the ratio of levels of phosphorylated CREB are corrected for total CREB levels, for each of the treatments, and times and then used to compare the responsivity of the MAPK pathway to the different sugars in the cell-lines of different phenotypic origins. While not wishing to be bound by any particular theory, the inventors believe that the pancreatic cancer cell-lines with more aggressive phenotypes, such as Capan1, and Hs766T, exhibits greater MAPK activation in response to fructose-treatment, in comparison to the primary pancreatic cancer cell lines such as PANC-1. Pharmacological and molecular approaches to regulate MAPK signaling, and examine the effects on proliferation of the pancreatic cancer cells are used. Firstly, the specific MAPK inhibitor, PD 98059 (10-7 to 10-5M), which is added to the pancreatic cancer cells in combination with the glucose-, and fructose-treatments is used. In a second approach, zinc-inducible plasmids encoding dominant negative (DN−) MAPK cDNA is employed to downregulate MAPK expression in the cell lines which exhibit comparatively high level MAPK expression following fructose-treatment.
Example 27 Preferential Fructose-Utilization for Nucleic Acid Synthesis is Due to GLUT-5-Mediated Increased Substrate AvailabilityOne question that arises from the metabolomic results is how fructose, a “substrate” leads to increased nucleic acid synthesis, activation of MAPK signal transduction, and ultimately increased pancreatic cancer cell proliferation. While not wishing to be bound by any particular theory, the inventors believe that the difference in structure of fructose (a ketone), and glucose (an aldehyde) plays a role. Analysis of the metabolic pathway of fructose reveals that fructose can readily be converted to fructose-6-phosphate by hexokinase, thereby allowing rapid entry into the pentose phosphate shunt to generate nucleic acids, whereas glucose must first be converted to glucose-6-phosphate, and then converted to fructose-6-phosphate by an isomerase. Increased fructose-mediated nucleic acid synthesis may be a consequence of the molecular structure of fructose, serving as a ketone donor. Thus, efforts to reduce cellular availability of fructose may result in reduced pancreatic cancer proliferative rates as well as the proliferative rates of other cancers. Both glucose and fructose gain entry to the cell via active transport assisted by a family of glucose uptake and transport proteins (GLUT 1-12). Three of the GLUT proteins (GLUT 2, 5 & 7) show specificity for fructose uptake, and GLUT-5 appears to be the predominant fructose-transport protein, as reported in several solid tumors. No studies have focused on pancreatic cancer. Real-time quantitative RT-PCR is used to measure expression of all twelve GLUT mRNA's (GLUT 1-12) following treatment with a range of glucose, and fructose-concentrations (2, 5, 7.5, 10, 12.5, and 15 mM) for a range of times (6, 12, 24, 48, 72, and 96 h). As depicted in the data,
The inventors believe that transketolase is required for fructose-induced cancer proliferation as demonstrated by increased pancreatic cancer transketolase expression (
The effects of 10% and 20% added refined fructose and glucose on pancreatic cancer development are examined. These percentages are chosen as they are conservative but meaningful equivalent to current human refined carbohydrate intake. Therefore, refined glucose or fructose is administered to mice innoculated subcutaneously with PANC-1 pancreatic cancer cells. Effects of treatments on time to tumor development, and tumor multiplicity are examined.
Example 30 Pancreatic Cancer Xenograft Tumor Model in Nu/Nu MiceFemale athymic Nu/Nu mice are purchased from Jackson Laboratories. PANC-1 cells (3×106) are inoculated subcutaneously on the flank of the mice, under isoflurane anesthesia, in accordance with institutional animal care and use guidelines. These animals reproducibly develop flank pancreatic tumors between 4-5 weeks. The mice receive a commercially purchased standard chow diet (Labdiet.com, certified rodent diet 5002), eat ˜5 g per day, and receive a total daily intake of approximately 1700 Kcal, comprising 64.5% CHO, 11.8% fat, 23.5% protein, and 4.6% fiber. Mice also receive a fructose or glucose sugar solution containing 0.42 g or 0.84 g fructose or glucose (diluted in 100 ml) which equate to 10% or 20% added refined carbohydrate respectively or vehicle daily from age 3 months to 12 months. Developing tumors in the fructose-, glucose-, and vehicle-fed mice are measured twice a week with electronic calipers, and tumor volumes determined by multiplying the square of the width (w) by the length (l) and dividing by two (i.e., (w2l)/2). Individual animal weights, tumor size and tumor location will be recorded for each animal twice a week. Animals are euthanized when they develop tumors of 1000 mm3 or more or at the end of the experiment, at the same time of day to limit temporal variations in glucose, insulin, and other parameters. Two hours before killing, the mice are injected intraperitoneally with bromodeoxyuridine (3 mg/mL) in phosphate-buffered saline, (100 μL/10 g body weight). The end of the experiment is defined as the time when all vehicle-treated mice have developed a tumor. At that time, all remaining mice (vehicle-, glucose-, and fructose-treated) are, tumors resected, and studied.
Example 31 Histology and Biomarker Analysis—Pancreatic CancerFor histology, pancreatic tumors are fixed in formalin and paraffin-embedded. Tissue sections are processed for immunohistochemical staining for the proliferative markers, PCNA, and Ki-67 to compare tumor proliferative rates derived from the fructose-, and glucose-treated mice. Briefly, tissue sections are deparaffinized in xylene, rehydrated, endogenous peroxidase activity blocked, non-specific binding reduced with goat serum, after which sections are incubated with antibodies to PCNA or Ki-67 (MIB-1) (1:200). Washed sections are incubated with biotinylated goat anti-mouse antibody, incubated with the ABC kit (Vector labs), and 3-amino-9-ethylcarbazole to visualize the peroxidase complex. Levels of immunostaining are evaluated by visual assessment with a semiquantitative scoring system rating staining intensity (from 0 to 3). Staining for bromodeoxyuridine (BRDU) is performed with the DAKO Animal Research Kit system. Briefly, tissue sections are prepared, as above, and BRDU stained with a mouse anti-BRDU monoclonal antibody (DAKO), slides incubated with streptavidin-horseradish peroxidase, and visualized with diaminobenzidine chromagen. Counterstaining is performed with hematoxylin, sections are scored by counting the positive and negative cells in 10 high-powered fields in tissue samples from 4 mice in each group. Results are expressed as the mean percentage with 95% Cl.
Example 32 Glucose, Insulin, IGF1, Lipid, and Inflammatory Cytokine LevelsFructose-, glucose-, and vehicle-treated mice will be fasted for 24 h (9 am-9 am) every 4 weeks, and blood will be collected by the tail clip method into chilled tubes for assay of glucose, insulin, lipid and inflammatory cytokine levels. Blood will also be collected at euthanasia. Plasma glucose concentrations will be determined using Glucotrend 2 (Roche Diagnostics); plasma insulin (Linco Res), and IGF-1 Phoenix Pharmaceuticals levels are measured using solid phase two site enzyme immunoassays; plasma triglyceride, free fatty acids, lactate, and β-hydroxybutyrate concentrations are analyzed using commercially available kits (Sigma Diagnostics). Serum inflammatory markers include C-reactive protein, IL-6 (R&D Systems), serum sialic acid, soluble intracellular and vascular adhesion molecules (sICAM-1, and sVCAM-1) (Bender MedSystems Inc), and amyloid A levels, and are assayed using commercially purchased ELISA based kits (R & D, Quantikine). All parameters are measured in triplicate in the pancreatic cancer cell innoculated mice, and means compared between the fructose-, and glucose-, and vehicle-fed animals, at the various timepoints using ANOVA with Bon-Ferroni post t-tests for multiple comparisons. Time curves are graphed to compare trends in fasting glucose, insulin, lipid, and triglyceride levels, and inflammatory markers across the dietary treatment.
While the description above refers to particular embodiments of the present invention, it should be readily apparent to people of ordinary skill in the art that a number of modifications may be made without departing from the spirit thereof. The accompanying claims are intended to cover such modifications as would fall within the true spirit and scope of the invention. The presently disclosed embodiments are, therefore, to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims rather than the foregoing description. All changes that come within the meaning of and range of equivalency of the claims are intended to be embraced therein.
Claims
1. A method of treating cancer in a mammal, comprising:
- providing a composition capable of inhibiting and/or regulating a metabolic pathway of fructose; and
- administering a therapeutically effective amount of the composition to the mammal.
2. The method of claim 1, wherein the composition is capable of modulating an enzyme in the metabolic pathway of fructose.
3. The method of claim 1, wherein the composition is capable of modulating hexokinase, fructokinase-1, fructose-1-P adolase, transketolase or an analog thereof.
4. The method of claim 3, wherein the composition comprises a small interfering RNA (siRNA) capable of suppressing transketolase mRNA expression.
5. The method of claim 1, wherein the composition comprises a fructose analog adapted to compete with fructose to enter the metabolic pathway of fructose.
6. The method of claim 1, wherein the composition comprises a thiamine inhibitor.
7. The method of claim 1, wherein the composition comprises oxythiamine.
8. A method of treating cancer in a mammal, comprising:
- providing a composition capable of modulating a GLUT mRNA expression and/or a GLUT function; and
- administering a therapeutically effective amount of the composition to the mammal.
9. The method of claim 8, wherein the GLUT is GLUT-5.
10. The method of claim 8, wherein the composition comprises a small interfering RNA (siRNA) capable of suppressing the GLUT mRNA expression.
11. The method of claim 8, wherein the composition comprises an antagonist of GLUT.
12. The method of claim 8, wherein the composition comprises an antagonist of GLUT-5.
13. A method of treating cancer in a mammal, comprising:
- providing a fructose-based or a fructose analog-based composition, comprising a fructose or fructose analog conjugated to a compound selected from the group consisting of a toxin, a cell signal deactivator, a radioactive agent and combinations thereof; and
- administering a therapeutically effective amount of the fructose-based or the fructose-analog based composition to the mammal.
14. The method of claim 13, wherein the compound is conjugated to fructose at the first or the second carbon atom.
15. The method of claim 13, wherein the toxin is selected from the group consisting of botulinum, diphtheria and combinations thereof.
16. The method of claim 13, wherein the deactivator is a cyclin-dependent kinase inhibitor.
17. The method of claim 13, wherein the radioactive agent is selected from the group consisting of radioactive isotopes of carbon, oxygen, hydrogen, fluorine, iodine, gallium, technetium, indium, copper and combinations thereof.
18. A method for treating cancer in a mammal, comprising:
- providing a composition comprising a radioactive isotope of fructose or a fructose analog; and
- administering a therapeutically effective amount of the composition to the mammal,
- whereby the radioactive isotope is incorporated into nucleic acid synthesis.
19. The method of claim 18, wherein the radioactive isotope is selected from the group consisting of carbon-11 (11C), oxygen-15 (15O) and combinations thereof.
20. A method for treating cancer in mammal, comprising:
- providing a fructose analog capable of being cleaved into a toxic metabolite; and
- administering a therapeutically effective amount of the fructose analog to the mammal,
- whereby a cellular enzyme converts the fructose analog into the toxic metabolite.
21. A kit for the treatment of cancer in a mammal, comprising:
- an agent selected from the group consisting of: a composition capable of inhibiting and/or regulating a metabolic pathway of fructose, a composition capable of modulating a GLUT mRNA expression and/or a GLUT function, a fructose-based or a fructose-analog based composition, wherein the fructose-based or the fructose-analog based composition comprises fructose conjugated to a compound selected from the group consisting of a toxin, a cell signal deactivator, a radioactive agent and combinations thereof, a radioactive isotope of fructose or a fructose analog capable of being incorporated into nucleic acid synthesis, and a fructose analog capable of being cleaved into a toxic metabolite, and combinations thereof; and
- instructions to use the agent to treat cancer.
22. The kit of claim 21, wherein the composition capable of inhibiting and/or regulating a metabolic pathway of fructose is a composition capable of modulating hexokinase, fructokinase-1, fructose-1-P adolase, transketolase or an analog thereof.
23. The kit of claim 21, wherein the composition capable of inhibiting and/or regulating a metabolic pathway of fructose comprises a fructose analog, wherein, upon administration to the mammal, the fructose analog competes with fructose to enter the metabolic pathway of fructose.
24. The kit of claim 21, wherein the composition capable of modulating the GLUT mRNA expression and/or the GLUT function comprises a small interfering RNA (siRNA) capable of suppressing the GLUT mRNA expression.
25. The kit of claim 21, wherein the composition capable of modulating the GLUT mRNA expression and/or the GLUT function comprises an antagonist of GLUT.
Type: Application
Filed: Aug 24, 2006
Publication Date: Sep 17, 2009
Applicant: CEDARS-SINAI MEDICAL CENTER (Los Angeles, CA)
Inventors: Anthony P. Heaney (Los Angeles, CA), Hongxiang Hui (Los Angeles, CA)
Application Number: 12/064,491
International Classification: A61K 51/06 (20060101); A61P 35/00 (20060101); A61K 31/713 (20060101); A61K 31/70 (20060101); A61K 39/385 (20060101); A61K 31/51 (20060101); A61K 101/00 (20060101); A61K 101/02 (20060101); A61K 103/00 (20060101); A61K 103/10 (20060101); A61K 103/20 (20060101); A61K 103/30 (20060101);