PRODUCTION OF GLUCAGON LIKE PEPTIDE 2 AND ANALOGS

GLP-2 peptides and analogs thereof are produced in high yield and with desired, authentic termini by isolation from a GLP-2 peptide multimer in which at least two units of GLP-2 peptide are coupled through a linker that presents an N-terminal acid cleavage site and a C-terminal enzyme cleavage site. In a specific embodiment, [Gly2]hGLP-2 is produced from a multimeric precursor comprising 2-30 units thereof.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
RELATED APPLICATIONS

This application is a divisional of U.S. patent application Ser. No. 10/993,127, filed Nov. 22, 2004, which claimed priority to U.S. Provisional Application No. 60/523,667, filed Nov. 21, 2003, which applications are incorporated by reference.

FIELD OF THE INVENTION

This invention applies the art of molecular biology in the field of protein production. More particularly, the invention relates to the production of recombinant glucagon-like peptide 2, or GLP-2, and analogs thereof.

BACKGROUND TO THE INVENTION

GLP-2 is a 33 amino acid product of the proglucagon gene. Recent evidence indicates that GLP-2 promotes nutrient absorption via expansion of the mucosal epithelium by stimulation of crypt cell proliferation and inhibition of apoptosis in the small intestine. GLP-2 also reduces epithelial permeability, and decreases meal-stimulated gastric acid secretion and gastrointestinal mobility. Many of these effects have been attributed not only to the wild type peptide, but also to analogs thereof, including particularly those rendered resistant to digestion by serum-borne enzymes, such as DPP-IV, by substitution of the alanine resident at position 2 with, for instance, glycine. A variety of bioactive GLP-2 analogs are described, for instance, in U.S. Pat. No. 5,789,379.

With recent recognition of its pharmaceutical properties, there is a demand for large quantities of GLP-2 and analogs thereof to permit development and subsequent medical use of these products. Solid or solution phase synthetic methods have typically been applied to produce the research quantities of GLP-2 and analogs used to date. The production of GLP-2 as a recombinant product of genetically engineered hosts has been suggested, for instance in U.S. Pat. No. Nos. 5,789,379 and 6,287,806, and is described in U.S. Pat. No. 5,629,205. However, prior art production systems have limitations in terms of product yield and quality, and it would be desirable to provide a system that yields quality GLP-2 peptide in a cost-effective manner.

It is accordingly an object of the present invention to provide a process, and intermediates and reagents useful therein, by which commercial quantities of GLP-2 can be produced.

It is another object of the present invention to provide GLP-2 and analogs thereof, particularly the [Gly2]hGLP-2 analog, in structurally authentic form.

SUMMARY OF THE INVENTION

In accordance with the present invention, there is provided a process by which GLP-2 and analogs thereof are produced not only in relatively high yield, but also as structurally authentic products, comprising only the natural form of the naturally occurring amino acids in the sequence constituting the GLP-2 peptide. Preferably, the N- and C-terminal residues are “terminally authentic”. In particular, the present process yields the desired GLP-2 as a peptide having N- and C-terminal residues that are without residual amino acids and other chemical moieties that often result from recombinant methods of protein production, particularly those which rely on production of the protein as a fused precursor from which the target protein must be released.

More particularly, and according to one aspect of the present invention, there is provided a single chain polypeptide precursor in which two or more copies of the GLP-2 peptide are coupled tandemly through a linker that is cleavable to release each unit of GLP-2 peptide as a product having authentic N- and C-termini. In a particular embodiment of the invention, the GLP-2 peptides are coupled using a linker that presents cleavage sites at each of its flanks. In a specific embodiment, the linker presents an acid cleavage site at one flank, and an enzyme cleavage site at its other flank.

In another aspect, the present invention provides a process for producing a GLP-2 peptide having authentic N- and C-termini, in which the present GLP-2 peptide multimer is cleaved to release each GLP-2 peptide unit resident therein.

In other aspects of the present invention, there are further provided polynucleotides, genetic constructs, and transformed host cells useful in the production of such multimeric GLP-2 peptide precursors.

In still another aspect, the present invention provides [Gly2]hGLP-2 as a recombinant product characterized by a mass essentially identical to theoretical mass. In a related aspect, the present invention provides a pharmaceutical composition comprising such peptide in a therapeutically useful amount and a pharmaceutically acceptable carrier

Both the foregoing general description and the following brief description of the drawings and detailed description are exemplary and explanatory and are intended to provide further explanation of the invention as claimed. Other objects, advantages, and novel features will be readily apparent to those skilled in the art from the following detailed description of the invention.

BRIEF REFERENCE TO THE DRAWINGS

FIG. 1 illustrates PCR-based construction of a gene that encodes a [Gly2]hGLP-2 unit flanked by a thrombin cleavage site (SEQ ID NO: 5 encodes SEQ ID NO: 6) and an acid cleavage site (SEQ ID NOS 7 and 8);

FIG. 2 illustrates the expected DNA sequence of the amplification product of FIG. 1 (SEQ ID NO: 3 encodes SEQ ID NO: 4). The sequence of the [Gly2]hGLP-2 unit is underlined;

FIG. 3 is a plasmid map of pKS58 carrying a gene that encodes a [Gly2]hGLP-2 hexamer;

FIG. 4 provides the nucleotide sequence of pKS58 (SEQ ID NO: 1), carrying a construct encoding a [Gly2]hGLP-2 hexamer, where the amino acid sequence is also illustrated (SEQ ID NO: 2), showing the GLP-2 peptide units in bold; and

FIG. 5 provides a mass spectrometric analysis of a GLP-2 peptide produced as herein described.

DETAILED DESCRIPTION OF THE INVENTION

In one aspect, the present invention provides a genetic construct, in the form of a polynucleotide, adapted to produce the GLP-2 peptide as a single chain, multimeric precursor comprising at least two copies of a GLP-2 peptide. Each such peptide is coupled to the next through a linker having flanks that present cleavage sites permitting the release of the GLP-2 peptides as monomers having N- and C-termini that are authentic, and thus are essentially free from chemical residues originating from the linker or the cleavage process. As a recombinant product, the resulting GLP-2 peptide is also free from chemical moieties such as blocking groups used in solution and solid phase peptide synthesis.

In the present invention, GLP-2 peptide units within the multimer are coupled using a linker that presents cleavage sites at the N- and C-termini of the resident GLP-2 peptide units. These sites, and the agents used to cleave them, are selected so that the GLP-2 peptide remains intact during the cleavage process, so that isolation and purification yields a GLP-2 peptide having the desired N- and C-terminal residues without any requirement for further processing.

In a preferred embodiment of the present invention, the linker is a relatively short peptide sequence, consisting of not more than about 25 residues, desirably less than about 20 residues, suitably less than about 15 residues, and most suitably less than about 10 residues. The sequence of the linker is chosen to avoid formation of complex secondary structures that mask the linker to the chosen cleaving agent. The cleavage site presented by the linker can be a site that is vulnerable to cleavage by enzyme or chemical conditions such as pH.

In a preferred embodiment, the linker is desirably one that presents an enzyme cleavage site at one flank, and an acid cleavage site at another flank. The site sensitive to cleavage by enzyme can be any site that is not reproduced elsewhere in the GLP-2 peptide multimer and is cleaved by any enzyme not present otherwise during the manufacturing process. Enzymes suitable for such cleavage, and sequences recognized and cleaved by those enzymes, include enterokinase and the sequence Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 9), and Factor Xa and the sequence Ile-Glu-Gly-Arg (SEQ ID NO: 10). In a preferred embodiment, the enzyme cleavage site is one cleaved by thrombin, and the thrombin cleavage sequence is ValSerGlyProArg (SEQ ID NO: 11).

An acid cleavage site presented in the GLP-2 peptide multimer is suitably the sequence Asp-Pro, which is cut under low pH conditions between the Asp and Pro residues.

In embodiments of the present invention, the linker provides, within the multimer, an acid cleavage site at its N-terminus and a thrombin cleavage site at its C-terminus. In a specific embodiment, the linker has the amino acid sequence ProValSerGlyProArg (SEQ ID NO: 12). Alternatively, it will be appreciated that the N-terminal Pro residue and the C-terminal thrombin cleavage site can be separated by additional amino acid sequence that does not detract from the vulnerability of the flanks to the desired cleavage conditions. When the noted particular linker is incorporated into the multimer, the GLP-2 peptide units are those that incorporate Asp as a C-terminal residue, and which otherwise lack both an acid cleavage site and a thrombin cleavage site. When linked between such GLP-2 peptide units, the N-terminal Pro residue of the linker, together with the C-terminal Asp residue of the upstream GLP-2 peptide unit, form the Asp-Pro site that is cleavable in acid, i.e., at low pH, to yield the authentic C-terminus of the GLP-2 peptide. Moreover, the linker sequence ValSerGlyProArg (SEQ ID NO: 11) presents a thrombin recognition sequence that is cleaved by thrombin on the C-terminal side of its Arg residue, to yield an authentic N-terminal residue in the GLP-2 peptide unit downstream thereof. While a specific thrombin cleavage sequence is shown, it will be understood that any equivalent sequence recognized and cleaved by thrombin can be incorporated in the linker, including those sequences reported by Chang, J. (1985) Eur. J. Biochem. 151, 217-224, incorporated herein by reference. It will also be appreciated that any GLP-2 peptide unit within the multimer should not incorporate any thrombin cleavage sequence within the primary structure of that GLP-2 unit.

Thus, in a valuable aspect of the present invention, there is provided a single chain polypeptide that incorporates at least two GLP-2 peptide units coupled tandemly through a linker having the sequence ProValSerGlyProArg (SEQ ID NO: 12), wherein the GLP-2 peptide incorporates a C-terminal Asp residue, and otherwise lacks both a thrombin cleavage sequence and an acid cleavage sequence.

In a preferred embodiment of this aspect of the present invention, the GLP-2 peptide unit incorporated within the multimer is the analog of human GLP-2 in which the Ala at position 2 is substituted by Gly, i.e., [Gly2]hGLP-2, having the amino acid sequence illustrated in FIG. 2. In the alternative, the GLP-2 peptide can be the wild type human GLP-2 having the amino acid sequence reported by Buhl et al. in J. Biol. Chem., 1988, 263(18):8621, a homolog thereof, or any other analog thereof that retains a C-terminal Asp residue and is otherwise lacking in both thrombin and acid cleavage sites. Suitable analogs can be selected for instance from those described in co-assigned U.S. Pat. Nos. 5,789,379 and 6,184,201, the disclosures of which are incorporated herein by reference.

In other embodiments, the multimeric GLP-2 peptide precursor comprises at least two GLP-2 peptide units, and as many as 10 or more such units, e.g. up to about 30 units and more suitably up to about 20 units, linked in tandem through the noted linker. In specific embodiments, the number of units of GLP-2 peptide in the precursor is 2, 3, 4, 5, 6 or 7. In one preferred embodiment, the multimeric precursor incorporates six GLP-2 peptide units. In another preferred embodiment, the precursor incorporates seven GLP-2 peptide units.

It will be appreciated that the GLP-2 peptide multimer, for expression as a recombinant product, will incorporate an N-terminal extension that incorporates at least an initial Methionine residue. In embodiments, the N-terminal extension is incorporated as a carrier peptide that bears the N-terminal methionine residue and is cleavable from the multimer per se. The carrier peptide thus can be a secretion signal that is cleaved by the host in the process of secreting the mature multimer. Alternatively and desirably, the carrier peptide is not a secretion signal, and the multimeric product accumulates in the cytoplasm of the host where it is recovered optionally in the form of inclusion bodies. Where the carrier peptide is not designed to be removed by the host cell, the carrier peptide desirably further incorporates amino acids that constitute the same enzyme cleavage site presented within the multimer at the N-terminal flank of each GLP-2 peptide unit. In this arrangement, treatment of the expressed GLP-2 multimer with the selected enzyme not only cuts the carrier from the multimer, but also cuts the multimer at the N-terminus of each GLP-2 peptide unit resident therein. In one embodiment, the carrier peptide initiates with a Met residue and terminates with a thrombin cleavage site, such as ValSerGlyProArg (SEQ ID NO: 11). The N-terminal carrier peptide of the GLP-2 multimer can further incorporate other intervening sequences functional, for instance, in purification of the multimer such as the so-called His-Tag, in enhancing the level of expression of the multimer by the selected host, or in promoting formation of the multimer as inclusion bodies such as hydrophobic amino acid sequences.

It will also be appreciated that the GLP-2 peptide multimer can terminate with a GLP-2 peptide unit or, if desired, can terminate with a peptide extension thereof useful, for instance, in the purification of the multimer. If a C-terminal extension peptide is incorporated, it desirably incorporates a Pro residue as its initial residue, so that treatment of the resulting multimer with acid cleaves not only the C-terminal extension but also at the C-terminus of each GLP-2 peptide unit within the multimer.

In a most preferred embodiment of the invention, there is provided a GLP-2 peptide multimer having the sequence illustrated in FIG. 4, comprising 6 units of [Gly2]hGLP-2 and incorporating, as a linker, the sequence ProValSerGlyProArg (SEQ ID NO: 12).

The production of such a multimer can be achieved in any cellular host for which expression systems have been developed. GLP-2 and its analogs do not require post-translational modification for activity, and can thus be produced in a variety of bacterial as well as eukaryotic hosts.

In one embodiment, the multimer is expressed in bacterial cells, such as E. coli cells, using expression systems adapted and well established for this purpose. A polynucleotide encoding the multimer can for instance be incorporated for expression within cassettes that drive expression from such promoters as lac, tac, trp, T7 and the like. The strain of E. coli chosen as host can also vary widely, and includes DH5, JM101 and BL21 among others. Vectors useful in transforming the selected host will typically include plasmids that incorporate origins of replication and selectable markers that enable detection and selective survival of the transformants.

Similarly, a variety of eukaryotic hosts and expression systems can be exploited. These include Saccharomyces cerevisiae and expression systems based on the mating factor alpha system, Aspergillus nidulans hosts utilizing the alcohol dehydrogenase (alcA) system, or Aspergillus nidulans utilizing the glucoamylase gene-based expression system, as well as mammalian cell systems such as the COS cell systems and the CHO-based systems.

Polynucleotides encoding the GLP-2 multimer can of course be produced synthetically de novo, or can be prepared from DNA coding for the GLP-2 peptide unit following a series of amplification and ligation steps, all in accordance with standard practise, and as exemplified herein.

The culturing conditions chosen for the transformed cellular host will also depend of course on the host species, and on the expression system utilized. In one embodiment, where the host is an E. coli species and the expression system relies on the tac promoter, the transformant will be cultured at commercial scale in the presence of antibiotic to maintain selective pressure on transformants. At or near log growth phase, the culture will receive IPTG to de-repress the promoter and allow expression to commence. Culturing can be performed at commercial scale of at or beyond about 200 litres.

Following culturing, the expressed GLP-2 multimer can be isolated by size selection chromatography, by ion-exchange chromatography, or by affinity chromatography particularly in the case where an affinity tag is incorporated in the multimer. When the multimer is produced as an intracellular product, the cultured cells can be treated in a first step to lyse the cells and release the multimer and other intracellular products, for instance using 8M urea or 6M guanidine hydrochloride or mechanical cell disruptions such as a homogenizer or sonicator. It is not necessary to separate the contents for further processing. In an embodiment of the invention, the products of lysis are treated in situ to establish dissociating conditions, such as by the addition of guanidinium chloride, and the mixture is then pH adjusted with HCl, or equivalent acid, to introduce acid conditions, in the pH range from about 1-3. At this pH, the Asp-Pro site is disrupted at each interface between the C-terminus of a GLP-2 peptide unit and the N-terminus of the linker. The resulting cleavage products, including GLP-2 peptide units bearing linker residues at the N-terminus, can then be isolated by any convenient means such as by HPLC, by size exclusion chromatography, by ion-exchange chromatography, or by affinity chromatography. The recovered products can then be subjected to an enzyme cleavage step in which exposure to thrombin results in the removal of residual linker at the N-terminus of each GLP-2 unit. The result is a multi-molar yield of GLP-2 peptides from a single GLP-2 multimer, each GLP-2 peptide having N- and C-termini that, as desired, are authentic and lacking in any undesired chemical modification.

As noted in the examples that follow, production by this method has produced [Gly2]hGLP-2 as a terminally authentic product having a mass (3752.59) that is essentially equivalent to theoretical (3751.99).

The GLP-2 peptide so produced is formulated, on an aspect of the present invention, for pharmaceutical use by forming a pharmaceutical composition in which a therapeutically useful amount of the peptide is combined with a pharmaceutically acceptable carrier. In one embodiment, the composition is formulated for parenteral administration, and comprises a unit dose of the GLP-2 peptide and an aqueous vehicle that is buffered to within a physiologically tolerable pH range and tonicity, e.g., pH 4-8, using for instance phosphate buffer saline as the vehicle. The formulation can also comprise a stabilizing agent, such as histidine, as disclosed in WO 01/49314, or a depot agent such as gelatin as disclosed in U.S. Pat. No. 5,789,379, the disclosures of which are incorporated herein by reference. Unit doses of the GLP-2 peptide lie typically within the range from 0.1 to 50 mg in an injection volume of about 1 mL.

The following examples are given to illustrate the present invention. It should be understood, however, that the invention is not to be limited to the specific conditions or details described in these examples. Throughout the specification, any and all references to a publicly available document, including a U.S. patent, are specifically incorporated by reference.

EXAMPLES

Various multimer constructs of [Gly2]hGLP-2 gene can be made in a one pot reaction by taking advantage of the restriction endonuclease, Bsal. This endonuclease recognizes the non-palindromic sequence (GGTCTC), so that the linker and [Gly2]hGLP-2 genes can be ligated in only one direction, head to tail ligation.

To obtain the maximum level of expression, the multimer gene constructs were inserted into a plasmid under the control of bacteriophage T7 promoter. Using this strategy, seven multimer constructs were obtained, containing 2 to 7 [Gly2]hGLP-2 gene units (from dimer to heptamer). The multimer genes were expressed after induction by IPTG. The greatest level of expression was found from hexamer and heptamer constructs.

A convenient cell lysis and acid cleavage method was also developed. After induction, the cell pellet was lysed with 6M guanidine hydrochloride and centrifuged. The supernatant solution was pH-adjusted to 1.8 by addition of HCl. Thus, cell lysis and acid cleavage were accomplished in very simple steps without any purification between lysis and acid cleavage. It may be possible to achieve cell lysis and acid cleavage in a single reaction, if 6M guanidine hydrochloride is pH adjusted to 1.8 with HCl and then it is added to E. coli cell pellet.

The acid cleaved products were purified by HPLC using a C18 column and then treated with thrombin to obtain mature [Gly2]hGLP-2, which was further purified by HPLC using the same C18 column. Only two HPLC steps (first after acid cleavage and second after thrombin cleavage) were needed to purify [Gly2]hGLP-2, and the purified [Gly2]hGLP-2 was confirmed to be authentic [Gly2]hGLP-2 by mass spectrometry.

Example 1 Gene Construction

To construct multimers of [Gly2]hGLP-2 gene, a [Gly2]hGLP-2 gene, as shown below, was first amplified by PCR using a plasmid, pG3M, which carried a codon optimized [Gly2]hGLP-2 gene and was re-named as pEW3G.

As shown in FIG. 1, the forward PCR primer sequence (Primer KS1-5) contained NdeI and Bsal endonuclease recognition sites, and thrombin cleavage site, which are followed by 18 nucleotides encoding the first six amino acids of [Gly2]hGLP-2.

The reverse PCR primer (Primer KS2-3) contained BamHI and Bsal endonuclease recognition sites, acid cleavage site, and an 18 nucleotide sequence, which encode the last six amino acid residues of [Gly2]hGLP-2.

For PCR reaction, the lower PCR reaction mixture was first prepared in a PCR tube. The lower mixture contained 41 μL of water, 5 of 10×TsgPlus buffer, 2 μL of deoxynucleotide mixture (2.5 mM each), 1 μL of primer KS 1-5 (100 pM), and 1 μL of primer KS2-3 (100 pM). To the lower mixture, a piece of Ampliwax® was added and heated at 65° C. for 5 min and then cooled to room temperature on a bench. After a thin layer of wax was formed, the upper mixture contained 43.5 μL, of water, 51AL of 10×TsgPlus buffer, 0.2 ng of plasmid, pG3M, in 1 μL, and 0.5 μL of Tsg Plus enzyme. Tsg Plus enzyme was a mixture of Tsg DNA polymerase and Pfu DNA polymerase. The 10×Tsg Plus buffer contained 200 mM Tris-HCl (pH8.8), 100 mM KCl, 100 mM (NH4)2SO4, 20 mM MgSO4, 1% Triton X100, and 1 mg/mL bovine serum albumin.

The thermocycler conditions were as follows:

Step 1: 95° C. for 2 min Step 2: 95° C. for 1 min Step 3: 50° C. for 1 min Step 4: 72° C. for 15 sec

Step 5: Go to Step 2 and repeat Step 2 through Step 4 nine more times

Step 6: 95° C. for 1 min Step 7: 65° C. for 30 sec Step 8: 72° C. for 15 sec

Step 9: Go to Step 6 and repeat Step 6 through Step 8 nineteen more times

Step 10: 72° C. for 5 min

Step 11: 4° C. overnight

After the whole cycle of PCR reaction, as described above, the expected product (a DNA band of approximately 140 bp), and as shown in FIG. 2, was confirmed by 1.5% agarose gel electrophoresis.

Forty μL out of the 100 μL PCR reaction mixture were purified using a QIA EA kit according to the manufacturer's instruction, and then digested with BamHI and NdeI restriction enzymes. The digested DNA was separated by 2% agarose gel electrophoresis, the DNA band was cut out of the gel and then purified using QIA ExII. The purified PCR product digested with the two enzymes and purified was ligated into pET29a, which was previously digested with the same two restriction enzymes, NdeI and BamHI. The ligation was performed using Quick T4 DNA ligase at room temperature for 6 minutes.

Next, competent cells of E. coli DH5α were transformed with the ligation product. To 50 μL of thawed competent cells in a microfuge tube (1.8 mL capacity), 3 μL out of 21 μL ligation mixture were added. The competent cell mixture was kept on ice for 30 min, heat-shocked at 37° C. for 20 sec, and then kept on ice for 2 minutes. To the heat-shocked cells, 900 μL of pre-warmed Super Optimal Catabolite (“SOC”) medium (37° C.) was added. After shaking the cell suspension at 225 rpm at 37° C. for 1 hour, 50 μL and 200 μL of the cell suspension were spread on LB agar plates containing kanamycin (50 μg/mL) and incubated at 37° C. overnight.

Single colonies were isolated from the agar plates the next day, and cultured in 7 mL of LB broth containing kanamycin (50 μg/mL) at 37° C. at 250 rpm overnight. Six mL out of 7 mL culture were centrifuged at 3,000 rpm for 15 min and plasmid was isolated from the cell pellet using QIAprep Spin Plasmid Miniprep kit.

To identify if the plasmid carried the insert, the isolated plasmid was digested by a restriction enzyme, PmII, at 37° C. for 2 hours and then separated by 0.8% agarose gel electrophoresis. The plasmid was also digested by Bsal enzyme at 50° C. for 2.5 hours and analyzed on 1.5% agarose gel. As seen in FIG. 2, the PCR amplified insert carried a single PmII site and two Bsal sites, but the vector, pET29a, did not carry those restriction enzyme sites. Therefore, only the plasmid, which carried the insert, was digested by PmII and Bsal.

The insert portion of the plasmid was then sequenced from both directions using the two primers shown below (Forward and Reverse primers) to confirm the correct sequence of the insert on the plasmid. One of the plasmids, which carried the single insert with a correct nucleotide sequence, was designated as pKS35.

Example 2 Vector Construction

To construct multimers of [Gly2]hGLP-2 gene, pKS35 was digested with Bsal at 50° C. for 2.5 hour and separated on 1.5% agarose gel. The larger DNA band (the vector portion) was cut out of the gel and DNA was extracted from the gel piece using QIA quick gel extraction kit. The smaller DNA band (the insert, approximately 110 bp) was cut out of the gel and the DNA was extracted using QIA ExII. The large vector portion was further treated with calf intestine alkaline phosphatase (CIP) to minimize self-ligation of the vector and purified by QIAPCR purification kit.

The CIP-treated vector DNA and the smaller insert DNA were mixed and ligated using Quick T4 ligase. The ligation mixture was used to transform DH5α, as described above, and then the bacteria cells were plated 2×Yeast Extract (2×YE) agar plates containing kanamycin (30 μg/mL).

To examine the number of [Gly2]hGLP-2 gene units present on plasmid in each transformant, the inserts were directly amplified from heat-lysed E. coli cells by PCR and examined by agarose gel electrophoresis. As shown below, the forward primer used for the PCR (KS003-5) was a 20 base oligo nucleotide, which annealed to the phage T7 promoter region on pET29a. The reverse primer (KS004-3) was a 19 base oligonucleotide, which bound to the T7 transcription terminator region on the plasmid.

Forward Primer: TAATACGACTCACTATAGGG (SEQ ID NO: 13) Reverse Primer:  GCTAGTTATTGCTCAGCGG (SEQ ID NO: 14)

The PCR lower mixture contained 42 μL of water, 5 μL of 10×Tsg Plus buffer, 2 of deoxynucleotide mixture (2.5 mM each), 0.5 μL of 100 μM forward primer KS003-5, and 0.5 μL of 100 μM reverse primer KS004-3 in the total of 50 μL. A piece of Ampliwax was added to the lower mixture in a PCR tube, heated at 63° C. for 5 minutes, and then solidified at room temperature. To the top of solidified wax, the upper mixture (50 μL) was added. The upper mixture contained 44.5 μL of water, 5 μL, of 10×Tsg Plus buffer, and 0.5 μL of Tsg Plus enzyme. Next, a single colony among many transformants was picked with a sterile toothpick from agar plate and suspended in the upper mixture. The PCR tube was then subjected to the PCR heating cycles using a thermocycler, as described below.

The thermocycler conditions were as follows:

Step 1: 95° C. for 5 min Step 2: 95° C. for 1 min Step 3: 55° C. for 30 sec Step 4: 72° C. for 1 min

Step 5: Go to Step 2 and repeat Step 2 through Step 4 twenty nine more times

Step 6: 72° C. for 10 min

Step 7: 4° C. overnight

The PCR products were separated by 1.5% agarose gel electrophoresis and seven different sizes of PCR products were detected on the gel. By comparison with DNA size markers (100 by ladder), they were identified as monomer, dimer, trimer, tetramer, pentamer, hexamer and heptamer. These multimers were also subjected to nucleotide sequencing analysis, which demonstrated that all had correct sequences of multimers.

Example 3 Transformation and Culturing

The [Gly2]hGLP-2 multimer constructs were cloned into a plasmid pET29a in such a way that they were expressed under the control of phage T7 promoter. E. coli RNA polymerase cannot recognize the T7 promoter. T7 RNA polymerase is required for the transcription from T7 promoter. E. coli strain, BLR(DE3), carries a phage T7 RNA polymerase gene on its chromosome. Moreover, recA gene in BLR(DE3) is inactivated so that the chance of losing [Gly2]hGLP-2 gene units in the multimer constructs by homologous recombination is minimal in this strain. Both DH5α. and BLR(DE3) strains are available commercially, as is the T7 system used herein.

The pET29a carrying a hexamer construct of [Gly2]hGLP-2 was designated as pKS58 and isolated from the transformant cells using Qiagen Plasmid Midi Prep kit. The frozen competent cells of BLR(DE3) (20 μL) were thawed, mixed with 1 μL of pKS58, kept on ice for 5 minutes, heat-shocked at 42° C. for 30 sec, and then kept on ice for 2 minutes. To the cell mixture, 80 μL of SOC medium was added and incubated at 37° C. at 250 rpm for 1 hour. Portions of cell suspension (20 and 50 μL) were plated on 2×YE agar plates containing kanamycin (30 μg/mL) and incubated at 37° C. overnight.

For expression, a single colony from each of the transformation plates of BLR(DE3), carrying a [Gly2]hGLP-2 gene multimer unit, was suspended in 50 mL of 2×YE broth containing kanamycin (30 μg/mL) in a 250 mL Erlenmeyer flask and shaken at 37° C. at 300 rpm overnight. An aliquot (200 μL) of the culture was added into 50 mL of pre-warmed 2×YE broth containing kanamycin (30 μg/mL) and shaken at 37° C. at 300 rpm. After 2 hours and 10 minutes when O.D. at 600 nm was approximately 0.35, IPTG was added to make a final concentration of 2 mM to induce the multimer gene.

At 2 and 3 hours after addition of IPTG, 2 mL of cell suspension were harvested and microfuged at 15,000 rpm for 15 minutes. The cell pellets were lysed with 50 μL of cell lysis buffer at 100° C. for 5 minutes. A portion of the cell lysate (12 μL) was mixed with 3 μL, of SDS-PAGE loading buffer and proteins were separated by SDS-PAGE. The proteins on the gels were stained with Coomassie Blue. The expression of multimer constructs was examined by comparison with the protein molecular weight markers and the protein profile of uninduced cells.

Example 4 Multimer Processing and Peptide Isolation

After induction, the cells were harvested by centrifugation and one gram of the fresh cell pellets were lysed in 20 mL of 6M guanidine hydrochloride. The cell suspension was incubated on ice for 1 hour with occasional mixing and centrifuged at 12,000×g for 30 mM. After addition of 30 mL of 6M guanidine hydrochloride to the supernatant solution, the pH of supernatant solution was adjusted to 1.8 by adding drops of 1 N—HCl first and 0.1 N—HCl and then incubated at 65° C. for 12-14 hours with gentle swirling. The reaction mixture was then separated by HPLC using a C18 column and the elution by an acetonitrile gradient from 30 to 60% in 0.1% trifluoroacetic acid.

The acid-cleaved product peak ([Gly2]hGLP-2 with a short peptide linker) was collected and dried. Next, the dried material was dissolved in thrombin buffer (20 mM Tris, 150 mM NaC1, 2.5 mM CaC12, pH8.4) and treated with thrombin at 37° C. overnight and the reaction was then stopped by addition of ACN 20% to final volume. The digestion product was then purified by HPLC using the same conditions described above.

The digestion product was then subjected to analysis by mass spectrometry, using a Micromass Quattro Micro™ mass spectrometer equipped with a Z-spray source operating in the positive ion mode with the following parameters: Data range: m/z 400-1600; Cone Voltage: 30-35 V; Source Temperature: 80° C.; Desolvation Temperature: 200° C.; Flow injection was via an HP1100; Solvent: 50:50 Acetonitrile: Water+0.1% formic acid; Software: Data were acquired using MassLynx 4.0. Calibration was performed using an MS spectrum of myoglobin and histatin 5.

As noted in FIG. 5, the mass of the predominant peak, representing authentic, recombinant (genetically produced) [Gly2]hGLP-2 has a mass that is 3752.59, which is essentially the same as the theoretical mass of 3751.99.

The recovery of GLP-2 monomer from the multimer can also conveniently be achieved in a “one-pot” reaction using the multimer as reagent and providing the authentic, mature monomer as end-product, without requiring numerous separation of intermediate products and transfer steps.

With reference to the example provided above, the one pot process eliminates the step of cell lysis by 6M guanidine HCl, and first mechanically disrupts the expression host cells using for instance a homogenizer, or a sonicator. After cell disruption, the pH of the suspension is brought down, for instance to pH 1-3, by addition for instance of HCl. As described above, the suspension is then incubated at an appropriate temperature, such as 40-80C e.g., 65C, to complete the acid cleavage of multimer to produce the monomer intermediates bearing the N-terminal peptide linkers. The pH of the reaction mixture is then elevated, for instance using Tris-HCl, to within the pH range suitable for thrombin activity e.g., 7.5-9.0 and preferably about 8.4. The thrombin is then added to cause cleavage of the N-terminal peptide linkers, thereby to generate the mature GLP-2 product bearing authentic termini.

It will be apparent to those skilled in the art that various modifications and variations can be made in the methods and compositions of the present invention without departing from the spirit or scope of the invention. Thus, it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents.

Claims

1. A single chain protein multimer comprising at least two units of a GLP-2 peptide coupled tandemly by a linker that provides an acid cleavage site at the N-terminus of each GLP-2 unit, and an enzyme cleavage site at the C-terminus of each GLP-2 unit, wherein cleavage of said multimer with an acid and an enzyme liberates said GLP-2 peptide units, each having authentic N- and C-terminal residues.

2. A multimeric protein according to claim 1, wherein said linker has the sequence ProValSerGlyProArg.

3. A multimeric protein according to claim 1, wherein said GLP-2 peptide is [Gly2]hGLP-2.

4. A multimeric protein according to claim 2, wherein said GLP-2 peptide is [Gly2]hGLP-2.

5. A multimeric protein according to claim 1, further comprising a carrier protein coupled releasably at the N-terminus thereof, the carrier protein providing a Met residue at the N-terminus thereof and, at the C-terminus thereof, a site cleavable by said enzyme.

6. A process for preparing a multimer according to claim 1, comprising the step of culturing a cellular host that incorporates an expression construct in which a DNA molecule coding for said multimer is linked operably with DNA providing for the expression thereof.

7. The process according to claim 6, wherein said host is an E. coli host.

8. The process according to claim 6, wherein the expression construct further comprises expression controlling elements of the T7 gene.

9. DNA coding for multimer according to any one of claim 1.

10. A process for preparing a GLP-2 peptide, comprising:

(a) the steps of obtaining a multimer according to claim 1,
(b) treating the multimer with acid and with enzyme to cleave linker resident therein, and
(c) isolating the resulting GLP-2 peptide units.

11. The process according to claim 10, comprising:

(a) first cleaving the multimer with acid,
(b) isolating the resulting cleaved multimer;
(c) cleaving with enzyme, and
(d) isolating the resulting GLP-2 peptide units having authentic termini.

12. The process according to claim 10, wherein the acid cleavage step is performed at the time of extracting the GLP-2 peptide multimer from a cellular host producing said multimer.

13. The method according to claim 10, wherein the step of treating the multimer with acid and with enzyme is performed without separation of reaction products prior to enzyme treatment.

14. Recombinant [Gly2]hGLP-2, having a mass essentially identical to theoretical mass.

15. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically useful amount of recombinant [Gly2]hGLP-2 having a mass essentially identical to theoretical mass.

Patent History
Publication number: 20110092424
Type: Application
Filed: Sep 30, 2010
Publication Date: Apr 21, 2011
Applicant: NPS PHARMACEUTICALS, INC. (Bedminster, NJ)
Inventors: Ken Sasaki (Thornhill), Vanessa Jane Williamson (Guelph), Alberto de Araujo (Mississauga), Ewa Walczyk (Caledon)
Application Number: 12/895,517