THERAPEUTIC AGENTS USEFUL FOR TREATING PAIN

- Purdue Pharma L.P.

A compound of formula: wherein A, Ar, R3, R6, and m are disclosed herein, or a pharmaceutically acceptable salt thereof (a “Cyanoiminopiperazine Compound”), compositions comprising an effective amount of a Cyanoiminopiperazine Compound, and methods for treating or preventing pain, urinary incontinence, an ulcer, inflammatory-bowel disease, irritable-bowel syndrome, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, amyotrophic lateral sclerosis, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia or depression in an animal comprising administering to an animal in need thereof an effective amount of a Cyanoiminopiperazine Compound are disclosed.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description

This application claims the benefit of U.S. Provisional Application No. 60/391,962, filed Jun. 28, 2002; U.S. Provisional Application No. 60/411,030, filed Sep. 17, 2002; U.S. Provisional Application No. 60/413,148, filed Sep. 25, 2002; and U.S. Provisional Application No. 60/416,582, filed Oct. 8, 2002, each of which is incorporated herein by reference in its entirety.

1. FIELD OF THE INVENTION

The present invention relates to Cyanoiminopiperazine Compounds, compositions comprising an effective amount of a Cyanoiminopiperazine Compound and methods for treating or preventing pain, urinary incontinence (UI), an ulcer, inflammatory-bowel disease (IBD), irritable-bowel syndrome (IBS), an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, amyotrophic lateral sclerosis (ALS), dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia or depression, comprising administering to an animal in need thereof an effective amount of a Cyanoiminopiperazine Compound.

2. BACKGROUND OF THE INVENTION

Pain is the most common symptom for which patients seek medical advice and treatment. Pain can be acute or chronic. While acute pain is usually self-limited, chronic pain persists for 3 months or longer and can lead to significant changes in a patient's personality, lifestyle, functional ability and overall quality of life (K. M. Foley, Pain, in Cecil Textbook of Medicine 100-107 (J. C. Bennett and F. Plum eds., 20th ed. 1996)).

Moreover, chronic pain can be classified as either nociceptive or neuropathic. Nociceptive pain includes tissue injury-induced pain and inflammatory pain such as that associated with arthritis. Neuropathic pain is caused by damage to the peripheral or central nervous system and is maintained by aberrant somatosensory processing. There is a large body of evidence relating activity at both Group I metabotropic glutamate receptors, i.e., metabotropic glutamate receptor 1 (“mGluR1”) and metabotropic glutamate receptor 5 (“mGluR5”) (M. E. Fundytus, CNS Drugs 15:29-58 (2001)), and vanilloid receptors (“VR1”) (V. Di Marzo et al., Current Opinion in Neurobiology 12:372-379 (2002)) to pain processing. Inhibiting mGluR1 or mGluR5 reduces pain, as shown by in vivo treatment with antibodies selective for either mGluR1 or mGluR5, where neuropathic pain in rats was attenuated (M. E. Fundytus et al., NeuroReport 9:731-735 (1998)). It has also been shown that antisense oligonucleotide knockdown of mGluR1 alleviates both neuropathic and inflammatory pain (M. E. Fundytus et al., British Journal of Pharmacology 132:354-367 (2001); M. E. Fundytus et al., Pharmacology, Biochemistry & Behavior 73:401-410 (2002)). Small molecule antagonists for mGluR5-attenuated pain in in vivo animal models are disclosed in, e.g., K. Walker et al., Neuropharmacology 40:1-9 (2000) and A. Dogrul et al., Neuroscience Letters 292:115-118 (2000)).

Nociceptive pain has been traditionally managed by administering non-opioid analgesics, such as acetylsalicylic acid, choline magnesium trisalicylate, acetaminophen, ibuprofen, fenoprofen, diflusinal, and naproxen; or opioid analgesics, including morphine, hydromorphone, methadone, levorphanol, fentanyl, oxycodone, and oxymorphone. Id. In addition to the above-listed treatments, neuropathic pain, which can be difficult to treat, has also been treated with anti-epileptics (e.g. gabapentin, carbamazepine, valproic acid, topiramate, phenyloin), NMDA antagonists (e.g. ketamine, dextromethorphan), topical lidocaine (for post-herpetic neuralgia), and tricyclic antidepressants (e.g. fluoxetine, sertraline and amitriptyline).

UI is uncontrollable urination, generally caused by bladder-detrusor-muscle instability. UI affects people of all ages and levels of physical health, both in health care settings and in the community at large. At present, UI afflicts 15-30% of elderly people living at home, one-third of those living in acute-care settings, and at least one-half of those living in long-term care institutions (R. M. Resnick, Lancet 346:94 (1995)). Persons having UI are predisposed to also having urinary-tract infections, pressure ulcers, perineal rashes and urosepsis. Psychosocially, UI is associated with embarrassment, social stigmatization, depression and a risk of institutionalization (Herzo et al., Annu. Rev. Gerontol. Geriatr. 9:74 (1989)). Economically, the costs of UI are great; in the United States alone, health-care costs associated with UI are over $15 billion per annum.

Physiologic bladder contraction results in large part from acetylcholine-induced stimulation of post-ganglionic muscarinic-receptor sites on bladder smooth muscle. Treatments for UI include the administration of drugs having bladder-relaxant properties, which help to control bladder-detrusor-muscle overactivity. For example, anticholinergics such as propantheline bromide and glycopyrrolate, and combinations of smooth-muscle relaxants such as a combination of racemic oxybutynin and dicyclomine or an anticholinergic, have been used to treat UI (See, e.g., A. J. Wein, Urol. Clin. N. Am. 22:557-577 (1995); Levin et al., J. Urol. 128:396-398 (1982); Cooke et al., S. Afr. Med. J. 63:3 (1983); R. K. Mirakhur et al., Anaesthesia 38:1195-1204 (1983)). These drugs are not effective, however, in all patients having uninhibited bladder contractions. Administration of anticholinergic medications represent the mainstay of this type of treatment.

None of the existing commercial drug treatments for UI, however, has achieved complete success in all classes of UI patients, nor has treatment occurred without significant adverse side effects. For example, drowsiness, dry mouth, constipation, blurred vision, headaches, tachycardia, and cardiac arrhythmia, which are related to the anticholinergic activity of traditional anti-UI drugs, can occur frequently and adversely affect patient compliance. Yet despite the prevalence of unwanted anticholinergic effects in many patients, anticholinergic drugs are currently prescribed for patients having UI. The Merck Manual of Medical Information 631-634 (R. Berkow ed., 1997).

Ulcers are sores occurring where the lining of the digestive tract has been eroded by stomach acids or digestive juices. The sores are typically well-defined round or oval lesions primarily occurring in the stomach and duodenum. About 1 in 10 people develop an ulcer. Ulcers develop as a result of an imbalance between acid-secretory factors, also known as “aggressive factors,” such as stomach acid, pepsin, and Helicobacter pylori infection, and local mucosal-protective factors, such as secretion of bicarbonate, mucus, and prostaglandins.

Treatment of ulcers typically involves reducing or inhibiting the aggressive factors. For example, antacids such as aluminum hydroxide, magnesium hydroxide, sodium bicarbonate, and calcium bicarbonate can be used to neutralize stomach acids. Antacids, however, can cause alkalosis, leading to nausea, headache, and weakness. Antacids can also interfere with the absorption of other drugs into the blood stream and cause diarrhea.

H2 antagonists, such as cimetidine, ranitidine, famotidine, and nizatidine, are also used to treat ulcers. H2 antagonists promote ulcer healing by reducing gastric acid and digestive-enzyme secretion elicited by histamine and other H2 agonists in the stomach and duodenum. H2 antagonists, however, can cause breast enlargement and impotence in men, mental changes (especially in the elderly), headache, dizziness, nausea, myalgia, diarrhea, rash, and fever.

H+, K+-ATPase inhibitors such as omeprazole and lansoprazole are also used to treat ulcers. H+, K+-ATPase inhibitors inhibit the production of enzymes used by the stomach to secrete acid. Side effects associated with H+, K+-ATPase inhibitors include nausea, diarrhea, abdominal colic, headache, dizziness, somnolence, skin rashes, and transient elevations of plasma activities of aminotransferases.

Sucraflate is also used to treat ulcers. Sucraflate adheres to epithelial cells and is believed to form a protective coating at the base of an ulcer to promote healing. Sucraflate, however, can cause constipation, dry mouth, and interfere with the absorption of other drugs.

Antibiotics are used when Helicobacter pylori is the underlying cause of the ulcer. Often antibiotic therapy is coupled with the administration of bismuth compounds such as bismuth subsalicylate and colloidal bismuth citrate. The bismuth compounds are believed to enhance secretion of mucous and HCO3, inhibit pepsin activity, and act as an antibacterial against H. pylori. Ingestion of bismuth compounds, however, can lead to elevated plasma concentrations of Bi+3 and can interfere with the absorption of other drugs.

Prostaglandin analogues, such as misoprostal, inhibit secretion of acid and stimulate the secretion of mucous and bicarbonate and are also used to treat ulcers, especially ulcers in patients who require nonsteroidal anti-inflammatory drugs. Effective oral doses of prostaglandin analogues, however, can cause diarrhea and abdominal cramping. In addition, some prostaglandin analogues are abortifacients.

Carbenoxolone, a mineral corticoid, can also be used to treat ulcers. Carbenoxolone appears to alter the composition and quantity of mucous, thereby enhancing the mucosal barrier. Carbenoxolone, however, can lead to Na+ and fluid retention, hypertension, hypokalemia, and impaired glucose tolerance.

Muscarinic cholinergic antagonists such as pirenzapine and telenzapine can also be used to reduce acid secretion and treat ulcers. Side effects of muscarinic cholinergic antagonists include dry mouth, blurred vision, and constipation. The Merck Manual of Medical Information 496-500 (R. Berkow ed., 1997) and Goodman and Gilman's The Pharmacological Basis of Therapeutics 901-915 (J. Hardman and L. Limbird eds., 9th ed. 1996).

IBD is a chronic disorder in which the bowel becomes inflamed, often causing recurring abdominal cramps and diarrhea. The two types of IBD are Crohn's disease and ulcerative colitis.

Crohn's disease, which can include regional enteritis, granulomatous ileitis, and ileocolitis, is a chronic inflammation of the intestinal wall. Crohn's disease occurs equally in both sexes and is more common in Jews of eastern-European ancestry. Most cases of Crohn's disease begin before age 30 and the majority start between the ages of 14 and 24. The disease typically affects the full thickness of the intestinal wall. Generally the disease affects the lowest portion of the small intestine (ileum) and the large intestine, but can occur in any part of the digestive tract.

Early symptoms of Crohn's disease are chronic diarrhea, crampy abdominal pain, fever, loss of appetite, and weight loss. Complications associated with Crohn's disease include the development of intestinal obstructions, abnormal connecting channels (fistulas), and abscesses. The risk of cancer of the large intestine is increased in people who have Crohn's disease. Often Crohn's disease is associated with other disorders such as gallstones, inadequate absorption of nutrients, amyloidosis, arthritis, episcleritis, aphthous stomatitis, erythema nodosum, pyoderma gangrenosum, ankylosing spondylitis, sacroilitis, uveitis, and primary sclerosing cholangitis. There is no known cure for Crohn's disease.

Cramps and diarrhea, side effects associated with Crohn's disease, can be relieved by anticholinergic drugs, diphenoxylate, loperamide, deodorized opium tincture, or codeine. Generally, the drug is taken orally before a meal.

Broad-spectrum antibiotics are often administered to treat the symptoms of Crohn's disease. The antibiotic metronidazole is often administered when the disease affects the large intestine or causes abscesses and fistulas around the anus. Long-term use of metronidazole, however, can damage nerves, resulting in pins-and-needles sensations in the arms and legs. Sulfasalazine and chemically related drugs can suppress mild inflammation, especially in the large intestine. These drugs, however, are less effective in sudden, severe flare-ups. Corticosteroids, such as prednisone, reduce fever and diarrhea and relieve abdominal pain and tenderness. Long-term corticosteroid therapy, however, invariably results in serious side effects such as high blood-sugar levels, increased risk of infection, osteoporosis, water retention, and fragility of the skin. Drugs such as azathioprine and mercaptourine can compromise the immune system and are often effective for Crohn's disease in patients that do not respond to other drugs. These drugs, however, usually need 3 to 6 months before they produce benefits and can cause serious side effects such as allergy, pancreatitis, and low white-blood-cell count.

When Crohn's disease causes the intestine to be obstructed or when abscesses or fistulas do not heal, surgery can be necessary to remove diseased sections of the intestine. Surgery, however, does not cure the disease, and inflammation tends to recur where the intestine is rejoined. In almost half of the cases a second operation is needed. The Merck Manual of Medical Information 528-530 (R. Berkow ed., 1997).

Ulcerative colitis is a chronic disease in which the large intestine becomes inflamed and ulcerated, leading to episodes of bloody diarrhea, abdominal cramps, and fever. Ulcerative colitis usually begins between ages 15 and 30; however, a small group of people have their first attack between ages 50 and 70. Unlike Crohn's disease, ulcerative colitis never affects the small intestine and does not affect the full thickness of the intestine. The disease usually begins in the rectum and the sigmoid colon and eventually spreads partially or completely through out the large intestine. The cause of ulcerative colitis is unknown.

Treatment of ulcerative colitis is directed to controlling inflammation, reducing symptoms, and replacing lost fluids and nutrients. Anticholinergic drugs and low doses of diphenoxylate or loperamide are administered for treating mild diarrhea. For more intense diarrhea higher doses of diphenoxylate or loperamide, or deodorized opium tincture or codeine are administered. Sulfasalazine, olsalazie, prednisone, or mesalamine can be used to reduce inflammation. Azathioprine and mercaptopurine have been used to maintain remissions in ulcerative-colitis patients who would otherwise need long-term corticosteroid treatment. In severe cases of ulcerative colitis the patient is hospitalized and given corticosteroids intravenously. People with severe rectal bleeding can require transfusions and intravenous fluids. If toxic colitis develops and treatments fail, surgery to remove the large intestine can be necessary. Non-emergency surgery can be performed if cancer is diagnosed, precancerous legions are detected, or unremitting chronic disease would otherwise make the person an invalid or dependent on high doses of corticosteroids. Complete removal of the large intestine and rectum permanently cures ulcerative colitis. The Merck Manual of Medical Information 530-532 (R. Berkow ed., 1997) and Goodman and Gilman's The Pharmacological Basis of Therapeutics (J. Hardman and L. Limbird eds., 9th ed. 1996).

IBS is a disorder of motility of the entire gastrointestinal tract, causing abdominal pain, constipation, and/or diarrhea. IBS affects three-times more women than men. In IBS stimuli such as stress, diet, drugs, hormones, or irritants can cause the gastrointestinal tract to contract abnormally. During an episode of IBS contractions of the gastrointestinal tract become stronger and more frequent, resulting in the rapid transit of food and feces through the small intestine, often leading to diarrhea. Cramps result from the strong contractions of the large intestine and increased sensitivity of pain receptors in the large intestine.

There are two major types of IBS. The first type, spastic-colon type, is commonly triggered by eating, and usually produces periodic constipation and diarrhea with pain. Mucous often appears in the stool. The pain can come in bouts of continuous dull aching pain or cramps, usually in the lower abdomen. The person suffering from spastic-colon type IBS can also experience bloating, gas, nausea, headache, fatigue, depression, anxiety, and difficulty concentrating. The second type of IBS usually produces painless diarrhea or constipation. The diarrhea can begin suddenly and with extreme urgency. Often the diarrhea occurs soon after a meal and can sometimes occur immediately upon awakening.

Treatment of IBS typically involves modification of an IBS-patient's diet. Often it is recommended that an IBS patient avoid beans, cabbage, sorbitol, and fructose. A low-fat, high-fiber diet can also help some IBS patients. Regular physical activity can also help keep the gastrointestinal tract functioning properly. Drugs such as propantheline that slow the function of the gastrointestinal tract are generally not effective for treating IBS. Antidiarrheal drugs, such as diphenoxylate and loperamide, help with diarrhea. The Merck Manual of Medical Information 525-526 (R. Berkow ed., 1997).

Many drugs can cause physical and/or psychological addiction. Those most well known types of these drugs include opiates, such as heroin, opium, and morphine; sympathomimetics, including cocaine and amphetamines; sedative-hypnotics, including alcohol, benzodiazepines and barbiturates; and nicotine, which has effects similar to opioids and sympathomimetics. Drug addiction is characterized by a craving or compulsion for taking the drug and an inability to limit its intake. Additionally, drug dependence is associated with drug tolerance, the loss of effect of the drug following repeated administration, and withdrawal, the appearance of physical and behavioral symptoms when the drug is not consumed. Sensitization occurs if repeated administration of a drug leads to an increased response to each dose. Tolerance, sensitization, and withdrawal are phenomena evidencing a change in the central nervous system resulting from continued use of the drug. This change can motivate the addicted individual to continue consuming the drug despite serious social, legal, physical and/or professional consequences. (See, e.g., U.S. Pat. No. 6,109,269 to Rise et al.).

Certain pharmaceutical agents have been administered for treating addiction. U.S. Pat. No. 5,556,838 to Mayer et al. discloses the use of nontoxic NMDA-blocking agents co-administered with an addictive substance to prevent the development of tolerance or withdrawal symptoms. U.S. Pat. No. 5,574,052 to Rose et al. discloses co-administration of an addictive substance with an antagonist to partially block the pharmacological effects of the substance. U.S. Pat. No. 5,075,341 to Mendelson et al. discloses the use of a mixed opiate agonist/antagonist to treat cocaine and opiate addiction. U.S. Pat. No. 5,232,934 to Downs discloses administration of 3-phenoxypyridine to treat addiction. U.S. Pat. Nos. 5,039,680 and 5,198,459 to Imperato et al. disclose using a serotonin antagonist to treat chemical addiction. U.S. Pat. No. 5,556,837 to Nestler et. al. discloses infusing BDNF or NT-4 growth factors to inhibit or reverse neurological adaptive changes that correlate with behavioral changes in an addicted individual. U.S. Pat. No. 5,762,925 to Sagan discloses implanting encapsulated adrenal medullary cells into an animal's central nervous system to inhibit the development of opioid intolerance. U.S. Pat. No. 6,204,284 to Beer et al. discloses racemic (±)-1-(3,4-dichlorophenyl)-3-azabicyclo[3.1.0]hexane for use in the prevention or relief of a withdrawal syndrome resulting from addiction to drugs and for the treatment of chemical dependencies.

Parkinson's disease is a clinical syndrome comprising bradykinesia (slowness and poverty of movement), muscular rigidity, resting tremor (which usually abates during voluntary movement), and an impairment of postural balance leading to disturbance of gait and falling. The features of Parkinson's disease are a loss of pigmented, dopaminergic neurons of the substantia nigra pars compacta and the appearance of intracellular inclusions known as Lewy bodies (Goodman and Gillman's The Pharmaceutical Basis of Therapeutics 506 (9th ed. 1996)). Without treatment, Parkinson's disease progresses to a rigid akinetic state in which patients are incapable of caring for themselves. Death frequently results from complications of immobility, including aspiration pneumonia or pulmonary embolism. Drugs commonly used for the treatment of Parkinson's disease include carbidopa/levodopa, pergolide, bromocriptine, selegiline, amantadine, and trihexyphenidyl hydrochloride. There remains, however, a need for drugs useful for the treatment of Parkinson's disease and having an improved therapeutic profile.

Anxiety is a fear, apprehension, or dread of impending danger often accompanied by restlessness, tension, tachycardia, and dyspnea. Other symptoms commonly associated with anxiety include depression, especially accompanied with dysthymic disorder (chronic “neurotic” depression); panic disorder; agoraphobia and other specific phobias; eating disorders; and many personality disorders. Often anxiety is unattached to a clearly identified treatable primary illness. If a primary illness is found, however, it can be desirable to deal with the anxiety at the same time as the primary illness.

Currently, benzodiazepines are the most commonly used anti-anxiety agents for generalized anxiety disorder. Benzodiazepines, however, carry the risk of producing impairment of cognition and skilled motor functions, particularly in the elderly, which can result in confusion, delerium, and falls with fractures. Sedatives are also commonly prescribed for treating anxiety. The azapirones, such as buspirone, are also used to treat moderate anxiety. The azapirones, however, are less useful for treating severe anxiety accompanied with panic attacks.

Epilepsy is a disorder characterized by the tendency to have recurring seizures. The etiology commonly consists of lesions in some part of the cortex, such as a tumor; developmental malformation; or damage due to trauma or stroke. In some cases the etiology is genetic. An epileptic seizure can be triggered by repetitive sounds, flashing lights, video games, or touching certain parts of the body. Epilepsy is typically treated with anti-seizure drugs. In epilepsy cases, where anti-seizure drugs are ineffective, and the defect in the brain is isolated to a small area of the brain, surgical removal of that part of the brain can be helpful in alleviating the seizures. In patients who have several sources for the seizures or who have seizures that spread quickly to all parts of the brain, surgical removal of the nerve fibers that connect the two sides of the brain can be helpful.

Examples of drugs for treating a seizure and epilepsy include carbamazepine, ethosuximide, gabapentin, lamotrignine, phenobarbital, phenyloin, primidone, valproic acid, trimethadione, bemzodiaepines, γ-vinyl GABA, acetazolamide, and felbamate. Anti-seizure drugs, however, can have side effects such as drowsiness; hyperactivity; hallucinations; inability to concentrate; central and peripheral nervous system toxicity, such as nystagmus, ataxia, diplopia, and vertigo; gingival hyperplasia; gastrointestinal disturbances such as nausea, vomiting, epigastric pain, and anorexia; endocrine effects such as inhibition of antidiuretic hormone, hyperglycemia, glycosuria, osteomalacia; and hypersensitivity such as scarlatiniform rash, morbilliform rash, Stevens-Johnson syndrome, systemic lupus erythematosus, and hepatic necrosis; and hematological reactions such as red-cell aplasia, agranulocytosis, thrombocytopenia, aplastic anemia, and megaloblastic anemia. The Merck Manual of Medical Information 345-350 (R. Berkow ed., 1997).

A seizure is the result of abnormal electrical discharge in the brain. The discharge can involve a small area of the brain and lead to the person only noticing an odd taste or smell or it can involve a large area of the brain and lead to convulsions, i.e., a seizure that causes jerking and spasms of the muscles throughout the body. Convulsions can also result in brief attacks of altered consciousness and loss of consciousness, muscle control, or bladder control. A seizures is often preceded by auras, i.e., unusual sensations of smell, taste, or vision or an intense feeling that a seizure is about to begin. A seizure typically lasts for about 2 to 5 minutes. When the seizure ends the person can have headache, sore muscles, unusual sensations, confusion, and profound fatigue (postictal state). Usually the person cannot remember what happened during the seizure.

A stroke or cerebrovascular accident, is the death of brain tissue (cerebral infarction) resulting from the lack of blood flow and insufficient oxygen to the brain. A stroke can be either ischemic or hemorrhagic. In an ischemic stroke, blood supply to the brain is cut off because of athersclerosis or a blood clot that has blocked a blood vessel. In a hemorrhagic stroke, a blood vessel bursts preventing normal blood flow and allowing blood to leak into an area of the brain and destroying it. Most strokes develop rapidly and cause brain damage within minutes. In some cases, however, strokes can continue to worsen for several hours or days. Symptoms of strokes vary depending on what part of the brain is effected. Symptoms include loss or abnormal sensations in an arm or leg or one side of the body, weakness or paralysis of an arm or leg or one side of the body, partial loss of vision or hearing, double vision, dizziness, slurred speech, difficulty in thinking of the appropriate word or saying it, inability to recognize parts of the body, unusual movements, loss of bladder control, imbalance, and falling, and fainting. The symptoms can be permanent and can be associated with coma or stupor. Strokes can cause edema or swelling of the brain which can further damage brain tissue. For persons suffering from a stroke, intensive rehabilitation can help overcome the disability caused by impairment of brain tissue. Rehabilitation trains other parts of the brain to assume the tasks previously performed by the damaged part.

Examples of drugs for treating strokes include anticoagulants such as heparin, drugs that break up clots such as streptokinase or tissue plasminogen activator, and drugs that reduce swelling such as mannitol or corticosteroids. The Merck Manual of Medical Information 352-355 (R. Berkow ed., 1997).

Pruritus is an unpleasant sensation that prompts scratching. Pruritus can be attributed to dry skin, scabies, dermatitis, herpetiformis, atopic dermatitis, pruritus vulvae et ani, miliaria, insect bites, pediculosis, contact dermatitis, drug reactions, urticaria, urticarial eruptions of pregnancy, psoriasis, lichen planus, lichen simplex chronicus, exfoliative dermatitis, folliculitis, bullous pemphigoid, and fiberglass dermatitis. Conventionally, pruritus is treated by phototherapy with ultraviolet B or PUVA or with therapeutic agents such as naltrexone, nalmefene, danazol, tricyclics, and antidepressants.

Selective antagonists of the metabotropic glutamate receptor 5 (“mGluR5”) have been shown to exert analgesic activity in in vivo animal models (K. Walker et al., Neuropharmacology 40:1-9 (2000) and A. Dogrul et al., Neuroscience Letters, 292(2):115-118 (2000)).

Selective antagonists of the mGluR5 receptor have also been shown to exert anxiolytic and anti-depressant activity in in vivo animal models (E. Tatarczynska et al., Br. J. Pharmacol. 132(7):1423-1430 (2001) and P. J. M. Will et al., Trends in Pharmacological Sciences 22(7):331-37 (2001)).

Selective antagonists of the mGluR5 receptor have also been shown to exert anti-Parkinson activity in vivo (K. J. Ossowska et al., Neuropharmacology 41(4):413-20 (2001) and P. J. M. Will et al., Trends in Pharmacological Sciences 22(7):331-37 (2001)).

Selective antagonists of the mGluR5 receptor have also been shown to exert anti-dependence activity in vivo (C. Chiamulera et al., Nature Neuroscience 4(9):873-74 (2001)).

International publication no. WO 02/16318 discloses a class of N-cyanoimines allegedly useful for treating a acute pain, urinary bladder hypersensitiveness, an ulcer, IBD, and IBS.

There remains, however, a clear need in the art for new drugs useful for treating or preventing pain, UI, an ulcer, IBD, IBS, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression.

Citation of any reference in Section 2 of this application is not to be construed as an admission that such reference is prior art to the present application

3. SUMMARY OF THE INVENTION

The present invention encompasses compounds having the formula (I):

and pharmaceutically acceptable salts thereof, wherein:

A is —NR4—, —O—, or —S—;

R1 is -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo);

each R2 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R3 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2; or
    • (b) —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of

which is unsubstituted or substituted with one or more R7 groups;

R4 is —(C1-C6)alkyl, or —O—(C1-C6)alkyl;

each R5 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R7 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), —CH(halo)2, —CN, —OH, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

each R8 is independently —H, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), or —CH(halo)2;

each halo is independently —F, —Cl, —Br or —I;

n is an integer ranging from 0 to 3; and

m is an integer ranging from 0 to 2.

The present invention encompasses compounds having the formula (Ia):

and pharmaceutically acceptable salts thereof, wherein:

R1 is -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo);

each R2 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R3 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2; or
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R5 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —S(O)R8, or —S(O)2R8;

R6 is:

    • (a) -naphthyl, —(C14)aryl, or —(C3-C8)cycloalkyl each of which is unsubstituted or substituted with one or more R7 groups; or
    • (b) pyridyl, furyl, benzofuranyl, thiophenyl, benzothiophenyl, quinolinyl, indolyl, oxazolyl, benzoxazolyl, imidazolyl, benzimidazolyl, thiazolyl, benzothiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, pyridazinyl, pyrimidinyl, pyrazinyl, thiadiazolyl, triazinyl, cinnolinyl, phthalazinyl, or quinazolinyl, each of which is substituted with one or more R7 groups;

each R7 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), —CH(halo)2, —CN, —OH, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

each R8 is independently —H, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), or —CH(halo)2;

each halo is independently —F, —Cl, —Br or —I;

n is an integer ranging from 0 to 3; and

m is an integer ranging from 0 to 2.

The present invention encompasses compounds having the formula (Ib):

and pharmaceutically acceptable salts thereof, wherein:

R1 is -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo);

each R2 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R3 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2; or
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R5 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —S(O)R8, or —S(O)2R8;

each R7, R9, and R10 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH(halo)2, —CH2(halo), —CN, —OH, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —S(O)R8, or —S(O)2R8;

each R8 is independently —H, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), or —CH(halo)2;

each halo is independently —F, —Cl, —Br or —I;

n is an integer ranging from 0 to 3;

m is an integer ranging from 0 to 2; and

p is an integer ranging from 0 to 4.

The present invention encompasses compounds having the formula (Ic):

and pharmaceutically acceptable salts thereof, wherein:

A is —NR4—, —O—, or —S—;

each R3 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2; or
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

R4 is —(C1-C6)alkyl, or —O—(C1-C6)alkyl;

each R5 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R7 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH(halo)2, —CH2(halo), —CN, —OH, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

each R8 is independently —H, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), or —CH(halo)2;

R11 is -hydrogen, -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo);

each R12 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or

(c) -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

m is an integer ranging from 0 to 2; and

q is an integer ranging from 0 to 3.

The present invention also encompasses compounds having the formula (II):

and pharmaceutically acceptable salts thereof, wherein:

A is —NR4—, —O—, or —S—;

R1 is -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo);

each R2 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R3 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

R4 is hydrogen, —(C1-C6)alkyl, or —O—(C1-C6)alkyl;

each R5 is independently —CN, —OH, —(C2-C6)alkenyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R7 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), —CH(halo)2, —CN, —OH, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

each R8 is independently —H, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), or —CH(halo)2;

each halo is independently —F, —Cl, —Br or —I;

n is an integer ranging from 0 to 2; and

m is an integer ranging from 0 to 2.

The present invention also encompasses compounds having the formula (IIa):

and pharmaceutically acceptable salts thereof, wherein:

A is —NR4—, —O—, or —S—;

each R3 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

R4 is hydrogen, —(C1-C6)alkyl, or —O—(C1-C6)alkyl;

each R5 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R7 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), —CH(halo)2, —CN, —OH, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

each R8 is independently —H, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), or —CH(halo)2;

R11 is -hydrogen, -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo);

each R12 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups; and

each halo is independently —F, —Cl, —Br or —I;

q is an integer ranging from 0 to 2; and

m is an integer ranging from 0 to 2.

The present invention also encompasses compounds having the formula (III):

and pharmaceutically acceptable salts thereof, wherein:

A is —NR4—, —O—, or —S—;

R1 is -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo);

each R2 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R3 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

R4 is —(C1-C6)alkyl, or —O—(C1-C6)alkyl;

each R5 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R7 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH(halo)2, —CH2(halo), —CN, —OH, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

each R8 is independently —H, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), or —CH(halo)2;

each halo is independently —F, —Cl, —Br or —I;

n is an integer ranging from 0 to 2; and

m is an integer ranging from 0 to 2.

The present invention encompasses compounds having the formula (Ma):

and pharmaceutically acceptable salts thereof, wherein:

R1 is -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo);

each R2 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R3 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2; or
    • (b) —(C1-C10)alkenyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R5 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

R6 is:

    • (a), -naphthyl, —(C14)aryl, or —(C3-C8)cycloalkyl each of which is unsubstituted or substituted with one or more R7 groups; or
    • (b) pyridyl, furyl, benzofuranyl, thiophenyl, benzothiophenyl, quinolinyl, indolyl, oxazolyl, benzoxazolyl, imidazolyl, benzimidazolyl, thiazolyl, benzothiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, pyridazinyl, pyrimidinyl, pyrazinyl, thiadiazolyl, triazinyl, cinnolinyl, phthalazinyl, or quinazolinyl, each of which is substituted with one or more R7 groups;

each R7 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH(halo)2, —CH2(halo), —CN, —OH, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

each R8 is independently —H, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), or —CH(halo)2;

each halo is independently —F, —Cl, —Br or —I;

n is an integer ranging from 0 to 2; and

m is an integer ranging from 0 to 2.

The present invention encompasses compounds having the formula (IIIb):

and pharmaceutically acceptable salts thereof, wherein:

R1 is -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo);

each R2 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R3 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2; or
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R5 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —S(O)R8, or —S(O)2R8;

each R7, R9, and R10 is independently —(C1-C6)alkenyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH(halo)2, —CH2(halo), —CN, —OH, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

each R8 is independently —H, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), or —CH(halo)2;

each halo is independently —F, —Cl, —Br or —I;

n is an integer ranging from 0 to 2;

m is an integer ranging from 0 to 2; and

p is an integer ranging from 0 to 4.

The present invention also encompasses compounds having the formula (IIIc):

and pharmaceutically acceptable salts thereof, wherein:

A is —NR4—, —O—, or —S—;

each R3 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

R4 is —(C1-C6)alkyl, or —O—(C1-C6)alkyl;

each R5 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —S(O)R8, or —S(O)2R8;

R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R7 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH(halo)2, —CH2(halo), —CN, —OH, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —S(O)R8, or —S(O)2R8;

each R8 is independently —H, —(C1-C6)allyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), or —CH(halo)2;

R11 is -hydrogen, -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo);

each R12 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each halo is independently —F, —Cl, —Br or —I;

q is an integer ranging from 0 to 2; and

m is an integer ranging from 0 to 2.

The present invention also encompasses compounds having the formula (IV):

and pharmaceutically acceptable salts thereof, wherein:

A is —NR4—, —O—, or —S—;

R1 is -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo);

each R2 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R3 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

R4 is hydrogen, —(C1-C6)alkyl, or —O—(C1-C6)alkyl;

each R5 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8—-C(O)OR8, —OC(O)R8, —OC(O)OR8, —S(O)R8, or —S(O)2R8;

R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R7 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH(halo)2, —CH2(halo), —CN, —OH, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

each R8 is independently —H, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), or —CH(halo)2;

each halo is independently —F, —Cl, —Br or —I;

n is an integer ranging from 0 to 2; and

m is an integer ranging from 0 to 2.

The present invention also encompasses compounds having the formula (IVa):

and pharmaceutically acceptable salts thereof, wherein:

A is —NR4—, —O—, or —S—;

each R3 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

R4 is hydrogen, —(C1-C6)alkyl, or —O—(C1-C6)alkyl;

each R5 is independently —CN, —OH, —(C1-C6)alkenyl, —(C2-C6)alkenyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R7 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH(halo)2, —CH2(halo), —CN, —OH, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR % —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

each R8 is independently —H, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), or —CH(halo)2; R11 is -hydrogen, -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo);

each R12 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of

which is unsubstituted or substituted with one or more R7 groups;

each halo is independently —F, —Cl, —Br or —I;

q is an integer ranging from 0 to 2; and

m is an integer ranging from 0 to 2.

The present invention also encompasses compounds having the formula (V):

and pharmaceutically acceptable salts thereof, wherein:

A is —NR4—, —O—, or —S—;

R1 is -hydrogen, -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo);

each R3 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)allyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C5-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C10)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

R4 is hydrogen, —(C1-C6)alkyl, or —O—(C1-C6)alkyl;

each R5 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

each R7 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), —CH(halo)2, —CN, —OH, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

each R8 is independently —H, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), or —CH(halo)2;

each halo is independently —F, —Br or —I; and

m is an integer ranging from 0 to 2.

The present invention encompasses compounds having the formula (VI):

and pharmaceutically acceptable salts thereof, wherein:

Ar1 is

Ar2 is

R1 is —H, -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, C(halo)3, —CH(halo)2, or —CH2(halo);

each R2 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, -(3- to 7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl or -(5- to 10-membered)heteroaryl, each of which is unsubstituted or substituted with one or more R6 groups;

each R3 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C10)tricycloalkenyl, -(3- to 7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl or -(5- to 10-membered) heteroaryl, each of which is unsubstituted or substituted with one or more R6 groups;

each R4 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, -(3- to 5-membered)heterocycle, —C(halo)3, —CH(halo)2, or CH2(halo);

each R5 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —S(O)R8, or —S(O)2R8;

each R6 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, -(3- to 5-membered)heterocycle, —C(halo)3, —CH(halo)2, —CH2(halo), —CN, —OH, -halo, —N3, —NO2, —CH═NR7, —NR7OH, —OR7, —COR7, —C(O)OR7, —OC(O)R7, —OC(O)OR7, —S(O)R7, or —S(O)2R7;

each R7 is independently —H, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, -(3- to 5-membered)heterocycle, —C(halo)3, —CH(halo)2, or CH2(halo);

each R8 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —C(halo)3, —CH(halo)2, —CH2(halo), —CN, —OH, -halo, —N3, —NO2, —CH═NR7, —NR7OH, —OR, —COR7, —C(O)OR7, —OC(O)R7, —OC(O)OR7, —SR7, —S(O)R7, or —S(O)2R7;

each R11 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R7)2, —CH═NR7, —NR7OH, —OR7, —COR7, —C(O)OR7, —OC(O)R7, —OC(O)OR7, —SR7, —S(O)R7, or —S(O)2R7;

each halo is independently —F, —Cl, —Br, or —I;

m is 0 or 1;

n is an integer ranging from 0 to 3;

o is an integer ranging from 0 to 4;

p is an integer ranging from 0 to 2;

q is an integer ranging from 0 to 6;

r is an integer ranging from 0 to 5;

s is an integer ranging from 0 to 4; and

t is an integer ranging from 0 to 2.

The present invention encompasses compounds having the formula (VII):

and pharmaceutically acceptable salts thereof, wherein:

Ar1 is

Ar2 is

R1 is —H, -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, C(halo)3, —CH(halo)2, or —CH2(halo);

each R2 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, -(3- to 7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl or -(5- to 10-membered)heteroaryl, each of which is unsubstitute or substituted with one or more R6 groups;

each R3 is independently:

    • (a) -halo, —CN, —OH, —NO2, or —NH2;
    • (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, -(3- to 7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or
    • (c) -phenyl, -naphthyl, —(C14)aryl or -(5- to 10-membered) heteroaryl, each of which is unsubstituted or substituted with one or more R6 groups;

each R4 is independently —(C1-C6)alkyl, —(C2-C8)alkenyl, —(C3-C8)cycloalkyl, —(C8-C8)cycloalkenyl, -phenyl, -(3- to 5-membered)heterocycle, —C(halo)3, —CH(halo)2, or CH2(halo);

each R5 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —C(O)R8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;

each R6 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C8-C8)cycloalkenyl, -phenyl, -(3- to 5-membered)heterocycle, —C(halo)3, —CH(halo)2, —CH2(halo), —CN, —OH, -halo, —N3, —NO2, —CH═NR7, —NR7OH, —OR7, —COR7, —C(O)OR7, —OC(O)R7, —OC(O)OR7, —SR7, —S(O)R7, or —S(O)2R7;

each R7 is independently —H, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C8)alkynyl, —(C3-C8)cycloalkyl, —(C8-C8)cycloalkenyl, -phenyl, -(3- to 5-membered)heterocycle, —C(halo)3, —CH(halo)2, or CH2(halo);

each R8 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C8)alkynyl, —(C3-C8)cycloalkyl, —(C8-C8)cycloalkenyl, -phenyl, —C(halo)3, —CH(halo)2, —CH2(halo), —CN, —OH, -halo, —N3, —NO2, —CH═NR7, —NR7OH, —OR7, —OR7, —C(O)OR7, —OC(O)R7, —OC(O)OR7, —SR7, —S(O)R7, or —S(O)2R7;

each R11 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R7)2, —CH═NR7, —NR7OH, —OR7, —COR7, —C(O)OR7, —OC(O)R7, —OC(O)OR7, —SR7, —S(O)R7, or —S(O)2R7;

each halo is independently —F, —Cl, —Br, or —I;

m is 0 or 1;

n is an integer ranging from 0 to 3;

o is an integer ranging from 0 to 4;

p is an integer ranging from 0 to 2;

q is an integer ranging from 0 to 6;

r is an integer ranging from 0 to 5;

s is an integer ranging from 0 to 4; and

t is an integer ranging from 0 to 2.

A compound of formula (I), (Ia), (Ib), (Ic), (II), (IIa), (III), (IIIa), (IIIb), (IIIc), (IV), (IVa), (V), (VI), or (VII), or a pharmaceutically acceptable salt thereof (a “Cyanoiminopiperazine Compound”) is useful for treating or preventing pain, UI, an ulcer, IBD, IBS, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression (each being a “Condition”) in an animal.

The invention also relates to compositions comprising an effective amount of a Cyanoiminopiperazine Compound and a pharmaceutically acceptable carrier or excipient. The compositions are useful for treating or preventing a Condition in an animal.

The invention further relates to methods for treating a Condition, comprising administering to an animal in need thereof an effective amount of a Cyanoiminopiperazine Compound.

The invention further relates to methods for preventing a Condition, comprising administering to an animal in need thereof an effective amount of a Cyanoiminopiperazine Compound.

The invention still further relates to methods for inhibiting Vanilloid Receptor 1 (“VR1”) function in a cell, comprising contacting a cell capable of expressing VR1 with an effective amount of a Cyanoiminopiperazine Compound.

The invention still further relates to methods for inhibiting mGluR5 function in a cell, comprising contacting a cell capable of expressing mGluR5 with an effective amount of a Cyanoiminopiperazine Compound.

The invention still further relates to methods for inhibiting metabotropic glutamate receptor 1 (“mGluR1”) function in a cell, comprising contacting a cell capable of expressing mGluR1 with an effective amount of a Cyanoiminopiperazine Compound.

The invention still further relates to a method for preparing a composition, comprising the step of admixing a Cyanoiminopiperazine Compound and a pharmaceutically acceptable carrier or excipient.

The invention still further relates to a kit comprising a container containing an effective amount of a Cyanoiminopiperazine Compound.

The present invention may be understood more fully by reference to the following detailed description and illustrative examples, which are intended to exemplify non-limiting embodiments of the invention.

4. DETAILED DESCRIPTION OF THE INVENTION 4.1 Cyanoiminopiperazine Compounds of Formula (I)

As stated above, the present invention encompasses compounds of Formula (I)

and pharmaceutically acceptable salts thereof, where A, R1, R2, R3, R6, n, and m are defined above for the Cyanoiminopiperazine Compounds of formula (I).

In one embodiment n is 0.

In another embodiment, n is 1.

In another embodiment, n is 2.

In another embodiment, n is 3.

In another embodiment, m is 0.

In another embodiment, m is 1.

In another embodiment, m is 2.

In another embodiment, A is —N((C1-C6)alkyl)-.

In another embodiment, A is —N(O(C1-C6)alkyl)-.

In another embodiment, A is —O—.

In another embodiment, A is —S—.

In another embodiment, R1 is halo.

In another embodiment, R1 is —Cl.

In another embodiment, R1 is —Br.

In another embodiment, R1 is —I.

In another embodiment, R1 is —F.

In another embodiment, R1 is —CH3.

In another embodiment, n is 1 and R2 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, n is 1 and R2 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C5-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C3-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, n is 1 and R2 is -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

In another embodiment, m is 1 and R3 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, m is 1 and R3 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C3-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, m is 1 and R3 is -phenyl, -naphthyl, —(C14)aryl or —(C3-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, R6 is -phenyl.

In another embodiment, m is 1 and R3 is —CH3.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (R)-configuration.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (S)-configuration.

In one embodiment, n and m are 0 and R6 is -phenyl. In another embodiment, n is 0, m is 1, R3 is methyl, and R6 is phenyl. In another embodiment, the -phenyl is substituted with a —(C1-C6) alkyl group. In another embodiment, the —(C1-C6) alkyl group is substituted at the 4-position of the -phenyl. In another embodiment, the —(C1-C6) alkyl group is a t-butyl group substituted at 4-position of the -phenyl. In another embodiment, the —(C1-C6) alkyl group is an iso-propyl group substituted at the 4-position of the -phenyl.

In another embodiment, R1 is —CF3 or —CHF2.

In another embodiment, n and m are 0 and R6 is -phenyl substituted at its 4-position with a —CF3 group.

In another embodiment, n and m are 0, R1 is -halo or methyl; and R6 is -phenyl. In one embodiment, -halo is —Cl. In another embodiment, the -phenyl is substituted with a —(C1-C6) alkyl group. In another embodiment, the —(C1-C6) alkyl group is substituted at the 4-position of the -phenyl. In another embodiment, the —(C1-C6) alkyl group is a t-butyl group or an iso-propyl group substituted at the 4-position of the -phenyl.

In another embodiment, n and m are 0, R1 is -halo or methyl; and R6 is -phenyl substituted with —CF3. In another embodiment, -halo is —Cl. In another embodiment, the —CF3 is substituted at the 4-position of the -phenyl. In another embodiment, -halo is —Cl and the —CF3 is substituted at the 4-position of the -phenyl.

4.2 Cyanoiminopiperazine Compounds of Formula (Ia)

The present invention also encompasses compounds of formula (Ia)

and pharmaceutically acceptable salts thereof, wherein R1, R2, R3, R6, n, and m are defined above for the Cyanoiminopiperazine Compounds of formula (Ia).

In one embodiment, R1 is -halo.

In another embodiment, R1 is —Cl.

In another embodiment, R1 is —Br.

In another embodiment, R1 is -L

In another embodiment, R1 is —F.

In another embodiment, R1 is —CH3.

In another embodiment, n is 1 and R2 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, n is 1 and R2 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, n is 1 and R2 is -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, m is 1 and R3 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, m is 1 and R3 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C5-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, m is 1 and R3 is -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, m is 1 and R3 is —CH3.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (R)-configuration.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (S)-configuration.

In another embodiment, R6 is -naphthyl, —(C14)aryl, or —(C3-C8)cycloalkyl each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, R6 is pyridyl, furyl, benzofuranyl, thiophenyl, benzothiophenyl, quinolinyl, indolyl, oxazolyl, benzoxazolyl, imidazolyl, benzimidazolyl, thiazolyl, benzothiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, pyridazinyl, pyrimidinyl, pyrazinyl, thiadiazolyl, triazinyl, cinnolinyl, phthalazinyl, or quinazolinyl, each of which is substituted with one or more R7 groups.

In another embodiment, R6 is pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, or thiadiazolyl.

4.3 Cyanoiminopiperazine Compounds of Formula (Ib)

The present invention encompasses compounds having the formula (Ib):

and pharmaceutically acceptable salts thereof, wherein R1, R2, R3, R9, and halo are defined above for the Cyanoiminopiperazine Compounds of formula (Ib).

In one embodiment, n is 0.

In another embodiment, n is 1.

In another embodiment, n is 2.

In another embodiment, m is 0.

In another embodiment m is 1.

In another embodiment, m is 2.

In another embodiment, R1 is -halo.

In another embodiment, R1 is —Cl.

In another embodiment, R1 is —Br.

In another embodiment, R1 is —I.

In another embodiment, R1 is —F.

In another embodiment, R1 is —CH3.

In one embodiment, n is 1 and R2 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, n is 1 and R2 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, n is 1 and R2 is -phenyl, -naphthyl, —(C14)aryl, or (C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, m is 1 and R3 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, m is 1 and R3 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, m is 1 and R3 is -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, m is 1 and R3 is —CH3.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (R)-configuration.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (S)-configuration.

4.4 Cyanoiminopiperazine Compounds of Formula (Ic)

The present invention encompasses compounds having the formula (Ic):

and pharmaceutically acceptable salts thereof, wherein A, R3, R6, R11, R12, m, and q are defined above for the Cyanoiminopiperazine Compounds of formula (Ic).

In one embodiment, m is 0.

In another embodiment, m is 1.

In another embodiment, m is 2.

In another embodiment, q is 0.

In another embodiment, q is 1.

In another embodiment, q is 2.

In another embodiment, q is 3.

In another embodiment, A is —N((C1-C6)alkyl)-.

In another embodiment, A is —N(O(C1-C6)alkyl)-.

In another embodiment, A is —O—.

In another embodiment, A is —S—.

In another embodiment, m is 1 and R3 is -halo, —CN, —OH, —NO2, or —NH2; or

In another embodiment, m is 1 and R3 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14) tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, m is 1 and R3 is -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, m is 1 and R3 is —CH3.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (R)-configuration.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (S)-configuration.

In another embodiment, R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, R6 is -phenyl.

In another embodiment, R11 is -hydrogen, -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo).

In another embodiment, R11 is -halo.

In another embodiment, R11 is —Cl.

In another embodiment, R11 is —Br.

In another embodiment, R11 is —F.

In another embodiment, R11 is —I.

In another embodiment, R11 is —CH3.

In another embodiment, q is 1 and R12 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, q is 1 and R12 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In one embodiment, q is 1 and R12 is -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

4.5 Cyanoiminopiperazine Compounds of Formula (II)

The present invention also encompasses compounds of formula (II)

and pharmaceutically acceptable salts thereof, wherein A, R1, R2, R3, R6, n, and m are defined above for the Cyanoiminopiperazine Compounds of formula (II).

In one embodiment, n is 0.

In another embodiment, n is 1.

In another embodiment, n is 2.

In another embodiment, m is 0.

In another embodiment, m is 1.

In another embodiment, m is 2.

In another embodiment, R1 is -halo.

In another embodiment, R1 is —Cl.

In another embodiment, R1 is —Br.

In another embodiment, R1 is —I.

In another embodiment, R1 is —F.

In another embodiment, R1 is —CH3.

In another embodiment, A is —NH—.

In another embodiment, A is —N((C1-C6)alkyl)-.

In another embodiment, A is —N(O(C1-C6)alkyl)-.

In another embodiment, A is —O—.

In another embodiment, A is —S—.

In another embodiment, n is 1 and R2 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, n is 1 and R2 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, n is 1 and R2 is -phenyl, -naphthyl, —(C14)aryl, or —(C5-C1)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, m is 1 and R3 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, m is 1 and R3 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, m is 1 and R3 is -phenyl, -naphthyl, —(C14)aryl or —(C6-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, m is 1 and R3 is —CH3.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (R)-configuration.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (S)-configuration.

In another embodiment, R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, R6 is -phenyl.

In one embodiment, n and m are 0 and R6 is -phenyl. In another embodiment, n is 0, m is 1, R3 is methyl, and R6 is phenyl. In another embodiment, the -phenyl is substituted with a —(C1-C6) alkyl group. In another embodiment, the —(C1-C6) alkyl group is substituted at the 4-position of the -phenyl. In another embodiment, the —(C1-C6) alkyl group is a t-butyl group substituted at 4-position of the -phenyl. In another embodiment, the —(C1-C6) alkyl group is an iso-propyl group substituted at the 4-position of the -phenyl.

In another embodiment, R1 is —CF3 or —CHF2.

In another embodiment, n and m are 0 and R6 is -phenyl substituted at its 4-position with a —CF3 group.

In another embodiment, n and m are 0, R1 is -halo or methyl; and R6 is -phenyl. In one embodiment, -halo is —Cl. In another embodiment, the -phenyl is substituted with a —(C1-C6) alkyl group. In another embodiment, the —(C1-C6) alkyl group is substituted at the 4-position of the -phenyl. In another embodiment, the —(C1-C6) alkyl group is a t-butyl group or an iso-propyl group substituted at the 4-position of the -phenyl.

In another embodiment, n and m are 0, R1 is -halo or methyl; and R6 is -phenyl substituted with —CF3. In another embodiment, -halo is —Cl. In another embodiment, the —CF3 is substituted at the 4-position of the -phenyl. In another embodiment, -halo is —Cl and the —CF3 is substituted at the 4-position of the -phenyl.

4.6 Cyanoiminopiperazine Compounds of Formula (IIa)

The present invention also encompasses compounds having the formula (IIa):

and pharmaceutically acceptable salts thereof, wherein A, R3, R6, R11, R12, m, and q are defined above for the Cyanoiminopiperazine Compounds of formula (IIa).

In one embodiment, q is 0.

In another embodiment q is 1.

In another embodiment q is 2.

In one embodiment, m is 0.

In another embodiment, m is 1.

In another embodiment, m is 2.

In another embodiment, A is —N((C1-C6)alkyl)-.

In another embodiment, A is —N(O(C1-C6)alkyl)-.

In another embodiment, A is —O—.

In another embodiment, A is —S—.

In another embodiment, m is 1 and R3 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, m is 1 and R3 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, m is 1 and R3 is -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, m is 1 and R3 is —CH3.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (R)-configuration.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (R)-configuration.

In another embodiment, R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, R6 is -phenyl.

In another embodiment, R11 is -hydrogen, -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo).

In another embodiment, R11 is -halo.

In another embodiment, R11 is —Cl.

In another embodiment, R11 is —Br.

In another embodiment, is —F.

In another embodiment, R11 is —I.

In another embodiment, R11 is —CH3.

In another embodiment, q is 1 and R12 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, q is 1 and R12 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, q is 1 and R12 is -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

4.7 Cyanoiminopiperazine Compounds of Formula (III)

The present invention also encompasses compounds of formula (III)

and pharmaceutically acceptable salts thereof, wherein A, R1, R2, R3, R6, m, and n are defined above for the Cyanoiminopiperazine Compounds of formula (III).

In one embodiment, n is 0.

In one embodiment, n is 1.

In one embodiment, n is 2.

In one embodiment, m is 0.

In one embodiment, m is 1.

In one embodiment, m is 2.

In another embodiment, A is —N((C1-C6)alkyl)-.

In another embodiment, A is —N(O(C1-C6)alkyl)-.

In one embodiment, A is —O—.

In one embodiment, A is —S—.

In one embodiment, R1 is -halo.

In one embodiment, R1 is —Cl.

In one embodiment, R1 is —Br.

In one embodiment, R1 is —I.

In one embodiment, R1 is —F.

In one embodiment, R1 is —CH3.

In one embodiment, n is 1 and R2 is -halo, —CN, —OH, —NO2, or —NH2.

In one embodiment, n is 1 and R2 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In one embodiment, n is 1 and R2 is -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In one embodiment, m is 1 and R3 is -halo, —CN, —OH, —NO2, or —NH2.

In one embodiment, m is 1 and R3 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In one embodiment, m is 1 and R3 is -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, m is 1 and R3 is —CH3.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (R)-configuration.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (S)-configuration.

In one embodiment, R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In one embodiment, R6 is -phenyl.

In one embodiment, n and m are 0 and R6 is -phenyl. In another embodiment,

n is 0, m is 1, R3 is methyl, and R6 is phenyl. In another embodiment, the -phenyl is substituted with a —(C1-C6) alkyl group. In another embodiment, the —(C1-C6) alkyl group is substituted at the 4-position of the -phenyl. In another embodiment, the —(C1-C6) alkyl group is a t-butyl group substituted at 4-position of the -phenyl. In another embodiment, the —(C1-C6) alkyl group is an iso-propyl group substituted at the 4-position of the -phenyl.

In another embodiment, R1 is —CF3 or —CHF2.

In another embodiment, n and m are 0 and R6 is -phenyl substituted at its 4-position with a —CF3 group.

In another embodiment, n and m are 0, R1 is -halo or methyl; and R6 is -phenyl. In one embodiment, -halo is —Cl. In another embodiment, the -phenyl is substituted with a —(C1-C6) alkyl group. In another embodiment, the —(C1-C6) alkyl group is substituted at the 4-position of the -phenyl. In another embodiment, the —(C1-C6) alkyl group is a t-butyl group or an iso-propyl group substituted at the 4-position of the -phenyl.

In another embodiment, n and m are 0, R1 is -halo or methyl; and R6 is -phenyl substituted with —CF3. In another embodiment, -halo is —Cl. In another embodiment, the —CF3 is substituted at the 4-position of the -phenyl. In another embodiment, -halo is —Cl and the —CF3 is substituted at the 4-position of the -phenyl.

4.8 Cyanoiminopiperazine Compounds of Formula (IIIa)

The present invention also encompasses compounds of formula (IIIa)

and pharmaceutically acceptable salts thereof, wherein R1, R2, R3, R6, n, and m are defined above for the Cyanoiminopiperazine Compounds of formula (IIIa).

In one embodiment, n is 0.

In another embodiment, n is 1.

In another embodiment, n is 2.

In another embodiment, m is 0.

In another embodiment, m is 1.

In another embodiment, m is 2.

In another embodiment, R1 is -halo.

In another embodiment, R1 is —Cl.

In another embodiment, R1 is —Br.

In another embodiment, IV is —I.

In another embodiment, R1 is —F.

In another embodiment, R1 is —CH3.

In another embodiment, n is 1 and R2 is -halo, —CN, —OH, —NO2, or —NH2; In another embodiment, n is 1 and R2 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or

In another embodiment, n is 1 and R2 is -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R5 groups;

In another embodiment, m is 1 and R3 is -halo, —CN, —OH, —NO2, or —NH2; or

In another embodiment, m is 1 and R3 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or

In another embodiment, m is 1 and R3 is -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, m is 1 and R3 is —CH3.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (R)-configuration.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (S)-configuration.

In another embodiment, R6 is -naphthyl, —(C14)aryl, or —(C3-C8)cycloalkyl each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, R6 is pyridyl, furyl, benzofuranyl, thiophenyl, benzothiophenyl, quinolinyl, indolyl, oxazolyl, benzoxazolyl, imidazolyl, benzimidazolyl, thiazolyl, benzothiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, pyridazinyl, pyrimidinyl, pyrazinyl, thiadiazolyl, triazinyl, cinnolinyl, phthalazinyl, or quinazolinyl, each of which is substituted with one or more R7 groups.

4.9 Cyanoiminopiperazine Compounds of Formula (IIIb)

The present invention encompasses compounds having the formula (IIIb):

and pharmaceutically acceptable salts thereof, wherein R1, R2, R3, R9, R10, n, m, and p are defined above for the Cyanoiminopiperazine Compounds of formula (IIIb).

In one embodiment, n is 0.

In another embodiment, n is 1.

In another embodiment, n is 2.

In one embodiment, m is 0.

In another embodiment, m is 1.

In another embodiment, m is 2.

In one embodiment, p is 0.

In another embodiment, p is 1.

In another embodiment, p is 2.

In another embodiment, p is 3.

In another embodiment, p is 4.

In another embodiment, R1 is -halo.

In another embodiment, R1 is —Cl.

In another embodiment, R1 is —Br.

In another embodiment, R1 is —I.

In another embodiment, R1 is —F.

In another embodiment, R1 is —CH3.

In another embodiment, n is 1 and R2 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, n is 1 and R2 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, n is 1 and R2 is -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, m is 1 and R3 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, m is 1 and R3 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, m is 1 and R3 is -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, m is 1 and R3 is —CH3.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (R)-configuration.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (S)-configuration.

4.10 Cyanoiminopiperazine Compounds of Formula (IIIc)

The present invention encompasses compounds having the formula (IIIc):

and pharmaceutically acceptable salts thereof, wherein A, R3, R6, R11, R12, m, and q are defined above for the Cyanoiminopiperazine Compounds of formula (IIIc).

In one embodiment, q is 0.

In another embodiment, q is 1.

In another embodiment, q is 2.

In one embodiment, m is 0.

In another embodiment, m is 1.

In another embodiment, m is 2.

In another embodiment, A is —N((C1-C6)alkyl)-.

In another embodiment, A is —N(O(C1-C6)alkyl)-.

In another embodiment, A is —O—.

In another embodiment, A is —S—.

In another embodiment, m is 1 and R3 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, m is 1 and R3 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C5-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, m is 1 and R3 is -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, m is 1 and R3 is —CH3.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (R)-configuration.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (S)-configuration.

In another embodiment, R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C3-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, R6 is -phenyl.

In another embodiment, R11 is -hydrogen, -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo).

In another embodiment, R11 is -halo.

In another embodiment, R11 is —Cl.

In another embodiment, R11 is —Br.

In another embodiment, R11 is —F.

In another embodiment, R11 is —I.

In another embodiment, R11 is —CH3.

In another embodiment, q is 1 and R12 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, q is 1 and R12 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, q is 1 and R12 is -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

4.11 Cyanoiminopiperazine Compounds of Formula (IV)

The present invention also encompasses compounds of formula (IV):

and pharmaceutically acceptable salts thereof, where A, R1, R2, R3, R6, n, and m are defined above for the Cyanoiminopiperazine Compounds of formula (IV).

In one embodiment, n is 0.

In another embodiment, n is 1.

In another embodiment, n is 2.

In one embodiment, m is 0.

In another embodiment, m is 1.

In another embodiment, m is 2.

In another embodiment, A is —NH—.

In another embodiment, A is —N((C1-C6)alkyl)-.

In another embodiment, A is —N(O(C1-C6)alkyl)-.

In another embodiment, A is —O—.

In another embodiment, A is —S—.

In another embodiment, R1 is -halo.

In another embodiment, R1 is —Cl.

In another embodiment, R1 is —Br.

In another embodiment, R1 is —I.

In another embodiment, R1 is —F.

In another embodiment, R1 is —CH3.

In another embodiment, n is one and R2 is -halo, —CN, —OH, —NO2, or —NH2;

In another embodiment, n is 1 and R2 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, n is 1 and R2 is -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;

In another embodiment, m is 1 and R3 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, m is 1 and R3 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, m is 1 and R3 is -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, m is 1 and R3 is —CH3.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (R)-configuration.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (S)-configuration.

In another embodiment, R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, R6 is -phenyl.

In one embodiment, n and m are 0 and R6 is -phenyl. In another embodiment,

n is 0, m is 1, R3 is methyl, and R6 is phenyl. In another embodiment, the -phenyl is substituted with a —(C1-C6) alkyl group. In another embodiment, the —(C1-C6) alkyl group is substituted at the 4-position of the -phenyl. In another embodiment, the —(C1-C6) alkyl group is a t-butyl group substituted at 4-position of the -phenyl. In another embodiment, the —(C1-C6) alkyl group is an iso-propyl group substituted at the 4-position of the -phenyl.

In another embodiment, R1 is —CF3 or —CHF2.

In another embodiment, n and m are 0 and R6 is -phenyl substituted at its 4-position with a —CF3 group.

In another embodiment, n and m are 0, R1 is -halo or methyl; and R6 is -phenyl. In one embodiment, -halo is —Cl. In another embodiment, the -phenyl is substituted with a —(C1-C6) alkyl group. In another embodiment, the —(C1-C6) alkyl group is substituted at the 4-position of the -phenyl. In another embodiment, the —(C1-C6) alkyl group is a t-butyl group or an iso-propyl group substituted at the 4-position of the -phenyl.

In another embodiment, n and m are 0, R1 is -halo or methyl; and R6 is -phenyl substituted with —CF3. In another embodiment, -halo is —Cl. In another embodiment, the —CF3 is substituted at the 4-position of the -phenyl. In another embodiment, -halo is —Cl and the —CF3 is substituted at the 4-position of the -phenyl.

4.12 Cyanoiminopiperazine Compounds of Formula (IVa)

The present invention also encompasses compounds having the formula (IVa):

and pharmaceutically acceptable salts thereof, wherein A, R3, R6, R11, R12, m and q are defined above for the Cyanoiminopiperazine Compounds of formula (IVa).

In one embodiment, q is 0.

In another embodiment, q is 1.

In another embodiment, q is 2.

In one embodiment, m is 0.

In another embodiment, m is 1.

In another embodiment, m is 2.

In another embodiment, A is —NH—.

In another embodiment, A is —N((C1-C6)alkyl)-.

In another embodiment, A is —N(O(C1-C6)alkyl)-.

In another embodiment, A is —O—.

In another embodiment, A is —S—.

In another embodiment, m is 1 and R3 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, m is 1 and R3 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, m is 1 and R3 is -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, m is 1 and R3 is —CH3.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (R)-configuration.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (S)-configuration.

In another embodiment, R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, R6 is -phenyl.

In another embodiment, R11 is -hydrogen, -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo).

In another embodiment, R11 is -halo.

In another embodiment, R11 is —Cl.

In another embodiment, R11 is —Br.

In another embodiment, R11 is —F.

In another embodiment, R11 is —I.

In another embodiment, R11 is —CH3.

In another embodiment, R12 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, R12 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, R12 is -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

4.13 Cyanoiminopiperazine Compounds of Formula (V)

The present invention also encompasses compounds of formula (V)

and pharmaceutically acceptable salts thereof, wherein A, R1, R3, R6, and m are defined above for the Cyanoiminopiperazine Compounds of formula (V).

In one embodiment, m is 0.

In another embodiment, m is 1.

In another embodiment, m is 2.

In another embodiment, A is —NH—

In another embodiment, A is —N((C1-C6)alkyl)-.

In another embodiment, A is —N(O(C1-C6)alkyl)-.

In another embodiment, A is —O—.

In another embodiment, A is —S—.

In another embodiment, R1 is -hydrogen.

In another embodiment, R1 is -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo).

In another embodiment, R1 is -halo.

In another embodiment, R1 is —Cl.

In another embodiment, R1 is —Br.

In another embodiment, R1 is —I.

In another embodiment, R1 is —F.

In another embodiment, R1 is —CH3.

In another embodiment, m is 1 and R3 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, m is 1 and R3 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C8-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, m is 1 and R3 is -phenyl, -naphthyl, —(C14)aryl or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, m is 1 and R3 is —CH3.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (R)-configuration.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (S)-configuration.

In another embodiment, R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups.

In another embodiment, R6 is -phenyl.

In one embodiment, m is 0 and R6 is -phenyl. In another embodiment, m is 1, R3 is methyl, and R6 is phenyl. In another embodiment, the -phenyl is substituted with a —(C1-C6) alkyl group. In another embodiment, the —(C1-C6) alkyl group is substituted at the 4-position of the -phenyl. In another embodiment, the —(C1-C6) alkyl group is a t-butyl group substituted at 4-position of the -phenyl. In another embodiment, the —(C1-C6) alkyl group is an iso-propyl group substituted at the 4-position of the -phenyl.

In another embodiment, R1 is —CF3 or —CHF2.

In another embodiment, m is 0 and R6 is -phenyl substituted at its 4-position with a —CF3 group.

In another embodiment, m is 0, R1 is -halo or methyl; and R6 is -phenyl. In one embodiment, -halo is —Cl. In another embodiment, the -phenyl is substituted with a —(C1-C6) alkyl group. In another embodiment, the —(C1-C6) alkyl group is substituted at the 4-position of the -phenyl. In another embodiment, the —(C1-C6) alkyl group is a t-butyl group or an iso-propyl group substituted at the 4-position of the -phenyl.

In another embodiment, m is 0, R1 is -halo or methyl; and R6 is -phenyl substituted with —CF3. In another embodiment, -halo is —Cl. In another embodiment, the —CF3 is substituted at the 4-position of the -phenyl. In another embodiment, -halo is —Cl and the —CF3 is substituted at the 4-position of the -phenyl.

4.14 Cyanoiminopiperazine Compounds of Formula (VI)

The present invention also encompasses compounds of formula (VI):

and pharmaceutically acceptable salts thereof, wherein Ar1, Ar2 R3, R4, m, and t are defined above for the Cyanoiminopiperazine Compound of formula (VI).

In one embodiment Ar1 is a pyridyl group.

In another embodiment, Art is a pyrimidinyl group.

In another embodiment, Ar1 is a pyridazinyl group.

In another embodiment, Art is a pyrazinyl group.

In another embodiment, Ar1 is a thiadiazolyl group.

In another embodiment, Ar2 is a benzothiazolyl group.

In another embodiment, Ar2 is a benzoimidazolyl group.

In another embodiment, Ar2 is a benzooxazolyl group.

In another embodiment, Ar2 is

In another embodiment, Ar2 is

In another embodiment, Ar2 is

In another embodiment, Ar2 is

In another embodiment, Ar2 is

In another embodiment, Ar2 is

In another embodiment, Ar2 is

In another embodiment, R1 is —H.

In another embodiment, R1 is -halo.

In another embodiment, R1 is —Cl.

In another embodiment, R1 is —Br.

In another embodiment, R1 is —I.

In another embodiment, R1 is —F.

In another embodiment, R1 is —CH3.

In another embodiment, R1 is —NO2.

In another embodiment, R1 is —CN.

In another embodiment, R1 is —OH.

In another embodiment, R1 is —OCH3.

In another embodiment, R1 is —NH2.

In another embodiment, R1 is —C(halo)3.

In another embodiment, R1 is —CH(halo)2.

In another embodiment, R1 is —CH2(halo).

In another embodiment, R2 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, R2 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C3-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, -(3- to 7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or

In another embodiment, R2 is -phenyl, -naphthyl, —(C14)aryl or -(5- to 10-membered)heteroaryl, each of which is unsubstitute or substituted with one or more R6 groups;

In another embodiment, R3 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, R3 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, -(3- to 7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, R3 is -phenyl, -naphthyl, —(C14)aryl or -(5- to 10-membered) heteroaryl, each of which is unsubstituted or substituted with one or more R6 groups.

In another embodiment, R3 is —CH3.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (R)-configuration.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (S)-configuration.

4.15 Cyanoiminopiperazine Compounds of Formula (VII)

The present invention also encompasses compounds of formula (VII):

and pharmaceutically acceptable salts thereof, wherein Ar1, Ar2 R3, R4, m, and t are defined above for formula (VI).

In one embodiment, Ar1 is a pyridyl group.

In another embodiment, Ar1 is a pyrimidinyl group.

In another embodiment, Ar1 is a pyridazinyl group.

In another embodiment, Ar1 is a pyrazinyl group.

In another embodiment, Ar2 is a thiadiazolyl group.

In another embodiment, Ar2 is a benzothiazolyl group.

In another embodiment, Ar2 is a benzoimidazolyl group.

In another embodiment, Ar2 is a benzooxazolyl group.

In another embodiment, Ar2 is

In another embodiment, Ar2 is

In another embodiment, Ar2 is

In another embodiment, Ar2 is

In another embodiment, Ar2 is

In another embodiment, Ar2 is

In another embodiment, Ar2 is

In another embodiment, R1 is —H.

In another embodiment, R1 is -halo.

In another embodiment, R1 is —Cl.

In another embodiment, R1 is —Br.

In another embodiment, R1 is —I.

In another embodiment, R1 is —F.

In another embodiment, R1 is —CH3.

In another embodiment, R1 is —NO2.

In another embodiment, R1 is —CN.

In another embodiment, R1 is —OH.

In another embodiment, R1 is —OCH3.

In another embodiment, R1 is —NH2.

In another embodiment, R1 is —C(halo)3.

In another embodiment, R1 is —CH(halo)2.

In another embodiment, R1 is —CH2(halo).

In another embodiment, R2 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, R2 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, -(3- to 7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or

In another embodiment, R2 is -phenyl, -naphthyl, —(C14)aryl or -(5- to 10-membered)heteroaryl, each of which is unsubstitute or substituted with one or more R6 groups;

In another embodiment, R3 is -halo, —CN, —OH, —NO2, or —NH2.

In another embodiment, R3 is —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, -(3- to 7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups.

In another embodiment, R3 is -phenyl, -naphthyl, —(C14)aryl or -(5- to 10-membered) heteroaryl, each of which is unsubstituted or substituted with one or more R6 groups.

In another embodiment, R3 is —CH3.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (R)-configuration.

In another embodiment, m is 1, R3 is —CH3, and the carbon atom to which the —R3 is attached is in the (S)-configuration.

4.16 Cyanoiminopiperazine Compounds of Formula (I), (IA), (IB), (II), (IIa), (III), (IIIa), (IIIb), (IIIc), (IV), (IVa), (V), (VI), AND (VII)

Certain Cyanoiminopiperazine Compounds may have asymmetric centers and therefore exist in different enantiomeric and diastereomic forms. This invention relates to the use of all optical isomers and stereoisomers of the Cyanoiminopiperazine Compounds, and mixtures thereof, and to all pharmaceutical compositions and methods of treatment that may employ or contain them.

In the Cyanoiminopiperazine Compounds each R3 can be on any carbon of the piperazine ring. In one embodiment, the Cyanoiminopiperazine Compounds have only one R3 group, and that R3 group is attached to a carbon atom adjacent to the nitrogen atom attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group. In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, and that R3 group is attached to a carbon atom adjacent to the nitrogen atom attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl.

In another embodiment, two R3 groups are on a single atom of the piperazine ring. In another embodiment, an R3 group is attached to a carbon atom adjacent to the nitrogen atom attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group and another R3 group is attached to a carbon atom adjacent to the nitrogen atom attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH— phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl.

In another embodiment, the Cyanoiminopiperazine Compound has two R3 groups, each being attached to a different carbon atom adjacent to a nitrogen atom attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group. In another embodiment, the Cyanoiminopiperazine Compound has two R3 groups, each being attached to a different carbon atom adjacent to a nitrogen atom attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl.

In one embodiment, wherein the Cyanoiminopiperazine Compound has one or two R3 groups, the carbon atom to which an R3 group is attached has the (R) configuration. In another embodiment, wherein the Cyanoiminopiperazine Compound has one or two R3 groups, the carbon atom to which the R3 group is attached has the (S) configuration. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, and at least one of the carbon atoms to which an R3 group is attached has the (R) configuration. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, and at least one of the carbon atoms to which an R3 group is attached has the (S) configuration.

In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen atom attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, and the carbon to which the R3 group is attached is in the (R) configuration. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R3 group is attached is in the (R) configuration, and R3 is —(C1-C4)alkyl unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R3 group is attached is in the (R) configuration, and R3 is —CH3. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R3 group is attached is in the (R) configuration, and R3 is —CF3. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R3 group is attached is in the (R) configuration, and R3 is —CH2CH3.

In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen atom attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, and the carbon to which the R3 group is attached is in the (R) configuration. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, the carbon to which the R3 group is attached is in the (R) configuration, and R3 is —(C1-C4)alkyl unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, the carbon to which the R3 group is attached is in the (R) configuration, and R3 is —CH3. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, the carbon to which the R3 group is attached is in the (R) configuration, and R3 is —CF3. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, the carbon to which the R3 group is attached is in the (R) configuration, and R3 is —CH2CH3.

In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen atom attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, and the carbon to which the R3 group is attached is in the (S) configuration. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R3 group is attached is in the (S) configuration, and R3 is —(C1-C4)alkyl unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R3 group is attached is in the (S) configuration, and R3 is —CH3. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R3 group is attached is in the (S) configuration, and R3 is —CF3. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R3 group is attached is in the (S) configuration, and R3 is —CH2CH3.

In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen atom attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, and the carbon to which the R3 group is attached is in the (S) configuration. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, the carbon to which the R3 group is attached is in the (S) configuration, and R3 is —(C1-C4)alkyl unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, the carbon to which the R3 group is attached is in the (S) configuration, and R3 is —CH3. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, the carbon to which the R3 group is attached is in the (S) configuration, and R3 is —CF3. In another embodiment, the Cyanoiminopiperazine Compound has one or two R3 groups, an R3 group is attached to a carbon atom adjacent to a nitrogen attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, the carbon to which the R3 group is attached is in the (S) configuration, and R3 is —CH2CH3.

In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen atom attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, and the carbon to which the R3 group is attached is in the (R) configuration. In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R3 group is attached is in the (R) configuration, and R3 is —(C1-C4)alkyl unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R3 group is attached is in the (R) configuration, and R3 is —CH3. In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R3 group is attached is in the (R) configuration, and R3 is —CF3. In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R3 group is attached is in the (R) configuration, and R3 is —CH2CH3.

In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen atom attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, and the carbon to which the R3 group is attached is in the (R) configuration. In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, the carbon to which the R3 group is attached is in the (R) configuration, and R3 is —(C1-C4)alkyl unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, the carbon to which the R3 group is attached is in the (R) configuration, and R3 is —CH3. In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, the carbon to which the R3 group is attached is in the (R) configuration, and R3 is —CF3. In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, the carbon to which the R3 group is attached is in the (R) configuration, and R3 is —CH2CH3.

In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen atom attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, and the carbon to which the R3 group is attached is in the (S) configuration. In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R3 group is attached is in the (S) configuration, and R3 is —(C1-C4)alkyl unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R3 group is attached is in the (S) configuration, and R3 is —CH3. In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R3 group is attached is in the (S) configuration, and R3 is —CF3. In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R3 group is attached is in the (S) configuration, and R3 is —CH2CH3.

In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen atom attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, and the carbon to which the R3 group is attached is in the (S) configuration. In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, the carbon to which the R3 group is attached is in the (S) configuration, and R3 is —(C1-C4)alkyl unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, the carbon to which the R3 group is attached is in the (S) configuration, and R3 is —CH3. In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, the carbon to which the R3 group is attached is in the (S) configuration, and R3 is —CF3. In another embodiment, the Cyanoiminopiperazine Compound has only one R3 group, the R3 group is attached to a carbon atom adjacent to a nitrogen attached to the —C(═N—CN)-A-R6 group, —C(═N—CN)—NH-phenethyl group, —C(═N—CN)—NH-phenpropyl group, or —C(═N—CN)—NH—(R9)-phenyl, the carbon to which the R3 group is attached is in the (R) configuration, and R3 is —CH2CH3.

The present invention includes the Cyanoiminopiperazine Compounds, and the pharmaceutically acceptable salts thereof, wherein one or more hydrogen, carbon or other atoms are replaced by isotopes thereof. Such compounds may be useful as research and diagnostic tools in metabolism pharmacokinetic studies and in binding assays.

Illustrative Cyanoiminopiperazine Compounds are listed below in Tables 1-8:

TABLE 1 VI and pharmaceutically acceptable salts thereof, wherein: Compound Ar R9 AAA -2-(3-chloropyridyl) -t-butyl AAB -2-(3-chloropyridyl) -iso-butyl AAC -2-(3-chloropyridyl) -sec-butyl AAD -2-(3-chloropyridyl) -cyclohexyl AAE -2-(3-chloropyridyl) -t-butoxy AAF -2-(3-chloropyridyl) -isopropoxy AAG -2-(3-chloropyridyl) —CF3 AAH -2-(3-chloropyridyl) —CH2CF3 AAI -2-(3-chloropyridyl) —OCF3 AAJ -2-(3-chloropyridyl) —Cl AAK -2-(3-chloropyridyl) —Br AAL -2-(3-chloropyridyl) —I AAM -2-(3-chloropyridyl) -n-butyl AAN -2-(3-chloropyridyl) -n-propyl AAO -2-(3-fluoropyridyl) -t-butyl AAP -2-(3-fluoropyridyl) -iso-butyl AAQ -2-(3-fluoropyridyl) -sec-butyl AAR -2-(3-fluoropyridyl) -cyclohexyl AAS -2-(3-fluoropyridyl) -t-butoxy AAT -2-(3-fluoropyridyl) -isopropoxy AAU -2-(3-fluoropyridyl) —CF3 AAV -2-(3-fluoropyridyl) —CH2CF3 AAW -2-(3-fluoropyridyl) —OCF3 AAX -2-(3-fluoropyridyl) —Cl AAY -2-(3-fluoropyridyl) —Br AAZ -2-(3-fluoropyridyl) —I ABA -2-(3-fluoropyridyl) -n-butyl ABB -2-(3-fluoropyridyl) -n-propyl ABC -2-(3-methylpyridyl) -t-butyl ABD -2-(3-methylpyridyl) -iso-butyl ABE -2-(3-methylpyridyl) -sec-butyl ABF -2-(3-methylpyridyl) -cyclohexyl ABG -2-(3-methylpyridyl) -t-butoxy ABH -2-(3-methylpyridyl) -isopropoxy ABI -2-(3-methylpyridyl) —CF3 ABJ -2-(3-methylpyridyl) —CH2CF3 ABK -2-(3-methylpyridyl) —OCF3 ABL -2-(3-methylpyridyl) —Cl ABM -2-(3-methylpyridyl) —Br ABN -2-(3-methylpyridyl) —I ABO -2-(3-methylpyridyl) -n-butyl ABP -2-(3-methylpyridyl) -n-propyl ABQ -2-(3-CF3-pyridyl) -t-butyl ABR -2-(3-CF3-pyridyl) -iso-butyl ABS -2-(3-CF3-pyridyl) -sec-butyl ABT -2-(3-CF3-pyridyl) -cyclohexyl ABU -2-(3-CF3-pyridyl) -t-butoxy ABV -2-(3-CF3-pyridyl) -isopropoxy ABW -2-(3-CF3-pyridyl) —CF3 ABX -2-(3-CF3-pyridyl) —CH2CF3 ABY -2-(3-CF3-pyridyl) —OCF3 ABZ -2-(3-CF3-pyridyl) —Cl ACA -2-(3-CF3-pyridyl) —Br ACB -2-(3-CF3-pyridyl) —I ACC -2-(3-CF3-pyridyl) -n-butyl ACD -2-(3-CF3-pyridyl) -n-propyl ACE -2-(3-CHF2-pyridyl) -t-butyl ACF -2-(3-CHF2-pyridyl) -iso-butyl ACG -2-(3-CHF2-pyridyl) -sec-butyl ACH -2-(3-CHF2-pyridyl) -cyclohexyl ACI -2-(3-CHF2-pyridyl) -t-butoxy ACJ -2-(3-CHF2-pyridyl) -isopropoxy ACK -2-(3-CHF2-pyridyl) —CF3 ACL -2-(3-CHF2-pyridyl) —CH2CF3 ACM -2-(3-CHF2-pyridyl) —OCF3 ACN -2-(3-CHF2-pyridyl) —Cl ACO -2-(3-CHF2-pyridyl) —Br ACP -2-(3-CHF2-pyridyl) —I ACQ -2-(3-CHF2-pyridyl) -n-butyl ACR -2-(3-CHF2-pyridyl) -n-propyl ACS -2-(3-hydroxypyridyl) -t-butyl ACT -2-(3-hydroxypyridyl) -iso-butyl ACU -2-(3-hydroxypyridyl) -sec-butyl ACV -2-(3-hydroxypyridyl) -cyclohexyl ACW -2-(3-hydroxypyridyl) -t-butoxy ACX -2-(3-hydroxypyridyl) -isopropoxy ACY -2-(3-hydroxypyridyl) —CF3 ACZ -2-(3-hydroxypyridyl) —CH2CF3 ADA -2-(3-hydroxypyridyl) —OCF3 ADB -2-(3-hydroxypyridyl) —Cl ADC -2-(3-hydroxypyridyl) —Br ADD -2-(3-hydroxypyridyl) —I ADE -2-(3-hydroxypyridyl) -n-butyl ADF -2-(3-hydroxypyridyl) -n-propyl ADG -2-(3-nitropyridyl) -t-butyl ADH -2-(3-nitropyridyl) -iso-butyl ADI -2-(3-nitropyridyl) -sec-butyl ADJ -2-(3-nitropyridyl) -cyclohexyl ADK -2-(3-nitropyridyl) -t-butoxy ADL -2-(3-nitropyridyl) -isopropoxy ADM -2-(3-nitropyridyl) —CF3 ADN -2-(3-nitropyridyl) —CH2CF3 ADO -2-(3-nitropyridyl) —OCF3 ADP -2-(3-nitropyridyl) —Cl ADQ -2-(3-nitropyridyl) —Br ADR -2-(3-nitropyridyl) —I ADS -2-(3-nitropyridyl) -n-butyl ADT -2-(3-nitropyridyl) -n-propyl ADU -2-(3-cyanopyridyl) -t-butyl ADV -2-(3-cyanopyridyl) -iso-butyl ADW -2-(3-cyanopyridyl) -sec-butyl ADX -2-(3-cyanopyridyl) -cyclohexyl ADY -2-(3-cyanopyridyl) -t-butoxy ADZ -2-(3-cyanopyridyl) -isopropoxy AEA -2-(3-cyanopyridyl) —CF3 AEB -2-(3-cyanopyridyl) —CH2CF3 AEC -2-(3-cyanopyridyl) —OCF3 AED -2-(3-cyanopyridyl) —Cl AEE -2-(3-cyanopyridyl) —Br AEF -2-(3-cyanopyridyl) —I AEG -2-(3-cyanopyridyl) -n-butyl AEH -2-(3-cyanopyridyl) -n-propyl AEI -2-(3-bromopyridyl) -t-butyl AEJ -2-(3-bromopyridyl) -iso-butyl AEK -2-(3-bromopyridyl) -sec-butyl AEL -2-(3-bromopyridyl) -cyclohexyl AEM -2-(3-bromopyridyl) -t-butoxy AEN -2-(3-bromopyridyl) -isopropoxy AEO -2-(3-bromopyridyl) —CF3 AEP -2-(3-bromopyridyl) —CH2CF3 AEQ -2-(3-bromopyridyl) —OCF3 AER -2-(3-bromopyridyl) —Cl AES -2-(3-bromopyridyl) —Br AET -2-(3-bromopyridyl) —I AEU -2-(3-bromopyridyl) -n-butyl AEV -2-(3-bromopyridyl) -n-propyl AEW -2-(3-iodopyridyl) -t-butyl AEX -2-(3-iodopyridyl) -iso-butyl AEY -2-(3-iodopyridyl) -sec-butyl AEZ -2-(3-iodopyridyl) -cyclohexyl AFA -2-(3-iodopyridyl) -t-butoxy AFB -2-(3-iodopyridyl) -isopropoxy AFC -2-(3-iodopyridyl) —CF3 AFD -2-(3-iodopyridyl) —CH2CF3 AFE -2-(3-iodopyridyl) —OCF3 AFF -2-(3-iodopyridyl) —Cl AFG -2-(3-iodopyridyl) —Br AFH -2-(3-iodopyridyl) —I AFI -2-(3-iodopyridyl) -n-butyl AFJ -2-(3-iodopyridyl) -n-propyl AFK -4-(5-chloropyrimidinyl) -t-butyl AFL -4-(5-chloropyrimidinyl) -iso-butyl AFM -4-(5-chloropyrimidinyl) -sec-butyl AFN -4-(5-chloropyrimidinyl) -cyclohexyl AFO -4-(5-chloropyrimidinyl) -t-butoxy AFP -4-(5-chloropyrimidinyl) -isopropoxy AFQ -4-(5-chloropyrimidinyl) —CF3 AFR -4-(5-chloropyrimidinyl) —CH2CF3 AFS -4-(5-chloropyrimidinyl) —OCF3 AFT -4-(5-chloropyrimidinyl) —Cl AFU -4-(5-chloropyrimidinyl) —Br AFV -4-(5-chloropyrimidinyl) —I AFW -4-(5-chloropyrimidinyl) -n-butyl AFX -4-(5-chloropyrimidinyl) -n-propyl AFY -4-(5-methylpyrimidinyl) -t-butyl AFZ -4-(5-methylpyrimidinyl) -iso-butyl AGA -4-(5-methylpyrimidinyl) -sec-butyl AGB -4-(5-methylpyrimidinyl) -cyclohexyl AGC -4-(5-methylpyrimidinyl) -t-butoxy AGD -4-(5-methylpyrimidinyl) -isopropoxy AGE -4-(5-methylpyrimidinyl) —CF3 AGF -4-(5-methylpyrimidinyl) —CH2CF3 AGG -4-(5-methylpyrimidinyl) —OCF3 AGH -4-(5-methylpyrimidinyl) —Cl AGI -4-(5-methylpyrimidinyl) —Br AGJ -4-(5-methylpyrimidinyl) —I AGK -4-(5-methylpyrimidinyl) -n-butyl AGL -4-(5-methylpyrimidinyl) -n-propyl AGM -4-(5-fluoropyrimidinyl) -t-butyl AGN -4-(5-fluoropyrimidinyl) -iso-butyl AGO -4-(5-fluoropyrimidinyl) -sec-butyl AGP -4-(5-fluoropyrimidinyl) -cyclohexyl AGQ -4-(5-fluoropyrimidinyl) -t-butoxy AGR -4-(5-fluoropyrimidinyl) -isopropoxy AGS -4-(5-fluoropyrimidinyl) —CF3 AGT -4-(5-fluoropyrimidinyl) —CH2CF3 AGU -4-(5-fluoropyrimidinyl) —OCF3 AGV -4-(5-fluoropyrimidinyl) —Cl AGW -4-(5-fluoropyrimidinyl) —Br AGX -4-(5-fluoropyrimidinyl) —I AGY -4-(5-fluoropyrimidinyl) -n-butyl AGZ -4-(5-fluoropyrimidinyl) -n-propyl AHA -2-(3-chloropyrazinyl) -t-butyl AHB -2-(3-chloropyrazinyl) -iso-butyl AHC -2-(3-chloropyrazinyl) -sec-butyl AHD -2-(3-chloropyrazinyl) -cyclohexyl AHE -2-(3-chloropyrazinyl) -t-butoxy AHF -2-(3-chloropyrazinyl) -isopropoxy AHG -2-(3-chloropyrazinyl) —CF3 AHH -2-(3-chloropyrazinyl) —CH2CF3 AHI -2-(3-chloropyrazinyl) —OCF3 AHJ -2-(3-chloropyrazinyl) —Cl AHK -2-(3-chloropyrazinyl) —Br AHL -2-(3-chloropyrazinyl) —I AHM -2-(3-chloropyrazinyl) -n-butyl AHN -2-(3-chloropyrazinyl) -n-propyl AHO -2-(3-methylpyrazinyl) -t-butyl AHP -2-(3-methylpyrazinyl) -iso-butyl AHQ -2-(3-methylpyrazinyl) -sec-butyl AHR -2-(3-methylpyrazinyl) -cyclohexyl AHS -2-(3-methylpyrazinyl) -t-butoxy AHT -2-(3-methylpyrazinyl) -isopropoxy AHU -2-(3-methylpyrazinyl) —CF3 AHV -2-(3-methylpyrazinyl) —CH2CF3 AHW -2-(3-methylpyrazinyl) —OCF3 AHX -2-(3-methylpyrazinyl) —Cl AHY -2-(3-methylpyrazinyl) —Br AHZ -2-(3-methylpyrazinyl) —I AIA -2-(3-methylpyrazinyl) -n-butyl AIB -2-(3-methylpyrazinyl) -n-propyl AIC -2-(3-fluoropyrazinyl) -t-butyl AID -2-(3-fluoropyrazinyl) -iso-butyl AIE -2-(3-fluoropyrazinyl) -sec-butyl AIF -2-(3-fluoropyrazinyl) -cyclohexyl AIG -2-(3-fluoropyrazinyl) -t-butoxy AIH -2-(3-fluoropyrazinyl) -isopropoxy AII -2-(3-fluoropyrazinyl) —CF3 AIJ -2-(3-fluoropyrazinyl) —CH2CF3 AIK -2-(3-fluoropyrazinyl) —OCF3 AIL -2-(3-fluoropyrazinyl) —Cl AIM -2-(3-fluoropyrazinyl) —Br AIN -2-(3-fluoropyrazinyl) —I AIO -2-(3-fluoropyrazinyl) -n-butyl AIP -2-(3-fluoropyrazinyl) -n-propyl AIQ -3-(4-chloropyridazinyl) -t-butyl AIR -3-(4-chloropyridazinyl) -iso-butyl AIS -3-(4-chloropyridazinyl) -sec-butyl AIT -3-(4-chloropyridazinyl) -cyclohexyl AIU -3-(4-chloropyridazinyl) -t-butoxy AIV -3-(4-chloropyridazinyl) -isopropoxy AIW -3-(4-chloropyridazinyl) —CF3 AIX -3-(4-chloropyridazinyl) —CH2CF3 AIY -3-(4-chloropyridazinyl) —OCF3 AIZ -3-(4-chloropyridazinyl) —Cl AJA -3-(4-chloropyridazinyl) —Br AJB -3-(4-chloropyridazinyl) —I AJC -3-(4-chloropyridazinyl) -n-butyl AJD -3-(4-chloropyridazinyl) -n-propyl AJE -3-(4-methylpyridazinyl) -t-butyl AJF -3-(4-methylpyridazinyl) -iso-butyl AJG -3-(4-methylpyridazinyl) -sec-butyl AJH -3-(4-methylpyridazinyl) -cyclohexyl AJI -3-(4-methylpyridazinyl) -t-butoxy AJJ -3-(4-methylpyridazinyl) -isopropoxy AJK -3-(4-methylpyridazinyl) —CF3 AJL -3-(4-methylpyridazinyl) —CH2CF3 AJM -3-(4-methylpyridazinyl) —OCF3 AJN -3-(4-methylpyridazinyl) —Cl AJO -3-(4-methylpyridazinyl) —Br AJP -3-(4-methylpyridazinyl) —I AJQ -3-(4-methylpyridazinyl) -n-butyl AJR -3-(4-methylpyridazinyl) -n-propyl AJS -3-(4-fluoropyridazinyl) -t-butyl AJT -3-(4-fluoropyridazinyl) -iso-butyl AJU -3-(4-fluoropyridazinyl) -sec-butyl AJV -3-(4-fluoropyridazinyl) -cyclohexyl AJW -3-(4-fluoropyridazinyl) -t-butoxy AJX -3-(4-fluoropyridazinyl) -isopropoxy AJY -3-(4-fluoropyridazinyl) —CF3 AJZ -3-(4-fluoropyridazinyl) —CH2CF3 AKA -3-(4-fluoropyridazinyl) —OCF3 AKB -3-(4-fluoropyridazinyl) —Cl AKC -3-(4-fluoropyridazinyl) —Br AKD -3-(4-fluoropyridazinyl) —I AKE -3-(4-fluoropyridazinyl) -n-butyl AKF -3-(4-fluoropyridazinyl) -n-propyl AKG -5-(4-chlorothiadiazolyl) -t-butyl AKH -5-(4-chlorothiadiazolyl) -iso-butyl AKI -5-(4-chlorothiadiazolyl) -sec-butyl AKJ -5-(4-chlorothiadiazolyl) -cyclohexyl AKK -5-(4-chlorothiadiazolyl) -t-butoxy AKL -5-(4-chlorothiadiazolyl) -isopropoxy AKM -5-(4-chlorothiadiazolyl) —CF3 AKN -5-(4-chlorothiadiazolyl) —CH2CF3 AKO -5-(4-chlorothiadiazolyl) —OCF3 AKP -5-(4-chlorothiadiazolyl) —Cl AKQ -5-(4-chlorothiadiazolyl) —Br AKR -5-(4-chlorothiadiazolyl) —I AKS -5-(4-chlorothiadiazolyl) -n-butyl AKT -5-(4-chlorothiadiazolyl) -n-propyl AKU -5-(4-methylthiadiazolyl) -t-butyl AKV -5-(4-methylthiadiazolyl) -iso-butyl AKW -5-(4-methylthiadiazolyl) -sec-butyl AKX -5-(4-methylthiadiazolyl) -cyclohexyl AKY -5-(4-methylthiadiazolyl) -t-butoxy AKZ -5-(4-methylthiadiazolyl) -isopropoxy ALA -5-(4-methylthiadiazolyl) —CF3 ALB -5-(4-methylthiadiazolyl) —CH2CF3 ALC -5-(4-methylthiadiazolyl) —OCF3 ALD -5-(4-methylthiadiazolyl) —Cl ALE -5-(4-methylthiadiazolyl) —Br ALF -5-(4-methylthiadiazolyl) —I ALG -5-(4-methylthiadiazolyl) -n-butyl ALH -5-(4-methylthiadiazolyl) -n-propyl ALI -5-(4-fluorothiadiazolyl) -t-butyl ALJ -5-(4-fluorothiadiazolyl) -iso-butyl ALK -5-(4-fluorothiadiazolyl) -sec-butyl ALL -5-(4-fluorothiadiazolyl) -cyclohexyl ALM -5-(4-fluorothiadiazolyl) -t-butoxy ALN -5-(4-fluorothiadiazolyl) -isopropoxy ALO -5-(4-fluorothiadiazolyl) —CF3 ALP -5-(4-fluorothiadiazolyl) —CH2CF3 ALQ -5-(4-fluorothiadiazolyl) —OCF3 ALR -5-(4-fluorothiadiazolyl) —Cl ALS -5-(4-fluorothiadiazolyl) —Br ALT -5-(4-fluorothiadiazolyl) —I ALU -5-(4-fluorothiadiazolyl) -n-butyl ALV -5-(4-fluorothiadiazolyl) -n-propyl

TABLE 2 VII and pharmaceutically acceptable salts thereof, wherein: Compound Ar R9 ALW -2-(3-chloropyridyl) -t-butyl ALX -2-(3-chloropyridyl) -iso-butyl ALY -2-(3-chloropyridyl) -sec-butyl ALZ -2-(3-chloropyridyl) -cyclohexyl AMA -2-(3-chloropyridyl) -t-butoxy AMB -2-(3-chloropyridyl) -isopropoxy AMC -2-(3-chloropyridyl) —CF3 AMD -2-(3-chloropyridyl) —CH2CF3 AME -2-(3-chloropyridyl) —OCF3 AMF -2-(3-chloropyridyl) —Cl AMG -2-(3-chloropyridyl) —Br AMH -2-(3-chloropyridyl) —I AMI -2-(3-chloropyridyl) -n-butyl AMJ -2-(3-chloropyridyl) -n-propyl AMK -2-(3-fluoropyridyl) -t-butyl AML -2-(3-fluoropyridyl) -iso-butyl AMM -2-(3-fluoropyridyl) -sec-butyl AMN -2-(3-fluoropyridyl) -cyclohexyl AMO -2-(3-fluoropyridyl) -t-butoxy AMP -2-(3-fluoropyridyl) -isopropoxy AMQ -2-(3-fluoropyridyl) —CF3 AMR -2-(3-fluoropyridyl) —CH2CF3 AMS -2-(3-fluoropyridyl) —OCF3 AMT -2-(3-fluoropyridyl) —Cl AMU -2-(3-fluoropyridyl) —Br AMV -2-(3-fluoropyridyl) —I AMW -2-(3-fluoropyridyl) -n-butyl AMX -2-(3-fluoropyridyl) -n-propyl AMY -2-(3-methylpyridyl) -t-butyl AMZ -2-(3-methylpyridyl) -iso-butyl ANA -2-(3-methylpyridyl) -sec-butyl ANB -2-(3-methylpyridyl) -cyclohexyl ANC -2-(3-methylpyridyl) -t-butoxy AND -2-(3-methylpyridyl) -isopropoxy ANE -2-(3-methylpyridyl) —CF3 ANF -2-(3-methylpyridyl) —CH2CF3 ANG -2-(3-methylpyridyl) —OCF3 ANH -2-(3-methylpyridyl) —Cl ANI -2-(3-methylpyridyl) —Br ANJ -2-(3-methylpyridyl) —I ANK -2-(3-methylpyridyl) -n-butyl ANL -2-(3-methylpyridyl) -n-propyl ANM -2-(3-CF3-pyridyl) -t-butyl ANN -2-(3-CF3-pyridyl) -iso-butyl ANO -2-(3-CF3-pyridyl) -sec-butyl ANP -2-(3-CF3-pyridyl) -cyclohexyl ANQ -2-(3-CF3-pyridyl) -t-butoxy ANR -2-(3-CF3-pyridyl) -isopropoxy ANS -2-(3-CF3-pyridyl) —CF3 ANT -2-(3-CF3-pyridyl) —CH2CF3 ANU -2-(3-CF3-pyridyl) —OCF3 ANV -2-(3-CF3-pyridyl) —Cl ANW -2-(3-CF3-pyridyl) —Br ANX -2-(3-CF3-pyridyl) —I ANY -2-(3-CF3-pyridyl) -n-butyl ANZ -2-(3-CF3-pyridyl) -n-propyl AOA -2-(3-CHF2-pyridyl) -t-butyl AOB -2-(3-CHF2-pyridyl) -iso-butyl AOC -2-(3-CHF2-pyridyl) -sec-butyl AOD -2-(3-CHF2-pyridyl) -cyclohexyl AOE -2-(3-CHF2-pyridyl) -t-butoxy AOF -2-(3-CHF2-pyridyl) -isopropoxy AOG -2-(3-CHF2-pyridyl) —CF3 AOH -2-(3-CHF2-pyridyl) —CH2CF3 AOI -2-(3-CHF2-pyridyl) —OCF3 AOJ -2-(3-CHF2-pyridyl) —Cl AOK -2-(3-CHF2-pyridyl) —Br AOL -2-(3-CHF2-pyridyl) —I AOM -2-(3-CHF2-pyridyl) -n-butyl AON -2-(3-CHF2-pyridyl) -n-propyl AOO -2-(3-hydroxypyridyl) -t-butyl AOP -2-(3-hydroxypyridyl) -iso-butyl AOQ -2-(3-hydroxypyridyl) -sec-butyl AOR -2-(3-hydroxypyridyl) -cyclohexyl AOS -2-(3-hydroxypyridyl) -t-butoxy AOT -2-(3-hydroxypyridyl) -isopropoxy AOU -2-(3-hydroxypyridyl) —CF3 AOV -2-(3-hydroxypyridyl) —CH2CF3 AOW -2-(3-hydroxypyridyl) —OCF3 AOX -2-(3-hydroxypyridyl) —Cl AOY -2-(3-hydroxypyridyl) —Br AOZ -2-(3-hydroxypyridyl) —I APA -2-(3-hydroxypyridyl) -n-butyl APB -2-(3-hydroxypyridyl) -n-propyl APC -2-(3-nitropyridyl) -t-butyl APD -2-(3-nitropyridyl) -iso-butyl APE -2-(3-nitropyridyl) -sec-butyl APF -2-(3-nitropyridyl) -cyclohexyl APG -2-(3-nitropyridyl) -t-butoxy APH -2-(3-nitropyridyl) -isopropoxy API -2-(3-nitropyridyl) —CF3 APJ -2-(3-nitropyridyl) —CH2CF3 APK -2-(3-nitropyridyl) —OCF3 APL -2-(3-nitropyridyl) —Cl APM -2-(3-nitropyridyl) —Br APN -2-(3-nitropyridyl) —I APO -2-(3-nitropyridyl) -n-butyl APP -2-(3-nitropyridyl) -n-propyl APQ -2-(3-cyanopyridyl) -t-butyl APR -2-(3-cyanopyridyl) -iso-butyl APS -2-(3-cyanopyridyl) -sec-butyl APT -2-(3-cyanopyridyl) -cyclohexyl APU -2-(3-cyanopyridyl) -t-butoxy APV -2-(3-cyanopyridyl) -isopropoxy APW -2-(3-cyanopyridyl) —CF3 APX -2-(3-cyanopyridyl) —CH2CF3 APY -2-(3-cyanopyridyl) —OCF3 APZ -2-(3-cyanopyridyl) —Cl AQA -2-(3-cyanopyridyl) —Br AQB -2-(3-cyanopyridyl) —I AQC -2-(3-cyanopyridyl) -n-butyl AQD -2-(3-cyanopyridyl) -n-propyl AQE -2-(3-bromopyridyl) -t-butyl AQF -2-(3-bromopyridyl) -iso-butyl AQG -2-(3-bromopyridyl) -sec-butyl AQH -2-(3-bromopyridyl) -cyclohexyl AQI -2-(3-bromopyridyl) -t-butoxy AQJ -2-(3-bromopyridyl) -isopropoxy AQK -2-(3-bromopyridyl) —CF3 AQL -2-(3-bromopyridyl) —CH2CF3 AQM -2-(3-bromopyridyl) —OCF3 AQN -2-(3-bromopyridyl) —Cl AQO -2-(3-bromopyridyl) —Br AQP -2-(3-bromopyridyl) —I AQQ -2-(3-bromopyridyl) -n-butyl AQR -2-(3-bromopyridyl) -n-propyl AQS -2-(3-iodopyridyl) -t-butyl AQT -2-(3-iodopyridyl) -iso-butyl AQU -2-(3-iodopyridyl) -sec-butyl AQV -2-(3-iodopyridyl) -cyclohexyl AQW -2-(3-iodopyridyl) -t-butoxy AQX -2-(3-iodopyridyl) -isopropoxy AQY -2-(3-iodopyridyl) —CF3 AQZ -2-(3-iodopyridyl) —CH2CF3 ARA -2-(3-iodopyridyl) —OCF3 ARB -2-(3-iodopyridyl) —Cl ARC -2-(3-iodopyridyl) —Br ARD -2-(3-iodopyridyl) —I ARE -2-(3-iodopyridyl) -n-butyl ARF -2-(3-iodopyridyl) -n-propyl ARG -4-(5-chloropyrimidinyl) -t-butyl ARH -4-(5-chloropyrimidinyl) -iso-butyl ARI -4-(5-chloropyrimidinyl) -sec-butyl ARJ -4-(5-chloropyrimidinyl) -cyclohexyl ARK -4-(5-chloropyrimidinyl) -t-butoxy ARL -4-(5-chloropyrimidinyl) -isopropoxy ARM -4-(5-chloropyrimidinyl) —CF3 ARN -4-(5-chloropyrimidinyl) —CH2CF3 ARO -4-(5-chloropyrimidinyl) —OCF3 ARP -4-(5-chloropyrimidinyl) —Cl ARQ -4-(5-chloropyrimidinyl) —Br ARR -4-(5-chloropyrimidinyl) —I ARS -4-(5-chloropyrimidinyl) -n-butyl ART -4-(5-chloropyrimidinyl) -n-propyl ARU -4-(5-methylpyrimidinyl) -t-butyl ARV -4-(5-methylpyrimidinyl) -iso-butyl ARW -4-(5-methylpyrimidinyl) -sec-butyl ARX -4-(5-methylpyrimidinyl) -cyclohexyl ARY -4-(5-methylpyrimidinyl) -t-butoxy ARZ -4-(5-methylpyrimidinyl) -isopropoxy ASA -4-(5-methylpyrimidinyl) —CF3 ASB -4-(5-methylpyrimidinyl) —CH2CF3 ASC -4-(5-methylpyrimidinyl) —OCF3 ASD -4-(5-methylpyrimidinyl) —Cl ASE -4-(5-methylpyrimidinyl) —Br ASF -4-(5-methylpyrimidinyl) —I ASG -4-(5-methylpyrimidinyl) -n-butyl ASH -4-(5-methylpyrimidinyl) -n-propyl ASI -4-(5-fluoropyrimidinyl) -t-butyl ASJ -4-(5-fluoropyrimidinyl) -iso-butyl ASK -4-(5-fluoropyrimidinyl) -sec-butyl ASL -4-(5-fluoropyrimidinyl) -cyclohexyl ASM -4-(5-fluoropyrimidinyl) -t-butoxy ASN -4-(5-fluoropyrimidinyl) -isopropoxy ASO -4-(5-fluoropyrimidinyl) —CF3 ASP -4-(5-fluoropyrimidinyl) —CH2CF3 ASQ -4-(5-fluoropyrimidinyl) —OCF3 ASR -4-(5-fluoropyrimidinyl) —Cl ASS -4-(5-fluoropyrimidinyl) —Br AST -4-(5-fluoropyrimidinyl) —I ASU -4-(5-fluoropyrimidinyl) -n-butyl ASV -4-(5-fluoropyrimidinyl) -n-propyl ASW -2-(3-chloropyrazinyl) -t-butyl ASX -2-(3-chloropyrazinyl) -iso-butyl ASY -2-(3-chloropyrazinyl) -sec-butyl ASZ -2-(3-chloropyrazinyl) -cyclohexyl ATA -2-(3-chloropyrazinyl) -t-butoxy ATB -2-(3-chloropyrazinyl) -isopropoxy ATC -2-(3-chloropyrazinyl) —CF3 ATD -2-(3-chloropyrazinyl) —CH2CF3 ATE -2-(3-chloropyrazinyl) —OCF3 ATF -2-(3-chloropyrazinyl) —Cl ATG -2-(3-chloropyrazinyl) —Br ATH -2-(3-chloropyrazinyl) —I ATI -2-(3-chloropyrazinyl) -n-butyl ATJ -2-(3-chloropyrazinyl) -n-propyl ATK -2-(3-methylpyrazinyl) -t-butyl ATL -2-(3-methylpyrazinyl) -iso-butyl ATM -2-(3-methylpyrazinyl) -sec-butyl ATN -2-(3-methylpyrazinyl) -cyclohexyl ATO -2-(3-methylpyrazinyl) -t-butoxy ATP -2-(3-methylpyrazinyl) -isopropoxy ATQ -2-(3-methylpyrazinyl) —CF3 ATR -2-(3-methylpyrazinyl) —CH2CF3 ATS -2-(3-methylpyrazinyl) —OCF3 ATT -2-(3-methylpyrazinyl) —Cl ATU -2-(3-methylpyrazinyl) —Br ATV -2-(3-methylpyrazinyl) —I ATW -2-(3-methylpyrazinyl) -n-butyl ATX -2-(3-methylpyrazinyl) -n-propyl ATY -2-(3-fluoropyrazinyl) -t-butyl ATZ -2-(3-fluoropyrazinyl) -iso-butyl AUA -2-(3-fluoropyrazinyl) -sec-butyl AUB -2-(3-fluoropyrazinyl) -cyclohexyl AUC -2-(3-fluoropyrazinyl) -t-butoxy AUD -2-(3-fluoropyrazinyl) -isopropoxy AUE -2-(3-fluoropyrazinyl) —CF3 AUF -2-(3-fluoropyrazinyl) —CH2CF3 AUG -2-(3-fluoropyrazinyl) —OCF3 AUH -2-(3-fluoropyrazinyl) —Cl AUI -2-(3-fluoropyrazinyl) —Br AUJ -2-(3-fluoropyrazinyl) —I AUK -2-(3-fluoropyrazinyl) -n-butyl AUL -2-(3-fluoropyrazinyl) -n-propyl AUM -3-(4-chloropyridazinyl) -t-butyl AUN -3-(4-chloropyridazinyl) -iso-butyl AUO -3-(4-chloropyridazinyl) -sec-butyl AUP -3-(4-chloropyridazinyl) -cyclohexyl AUQ -3-(4-chloropyridazinyl) -t-butoxy AUR -3-(4-chloropyridazinyl) -isopropoxy AUS -3-(4-chloropyridazinyl) —CF3 AUT -3-(4-chloropyridazinyl) —CH2CF3 AUU -3-(4-chloropyridazinyl) —OCF3 AUV -3-(4-chloropyridazinyl) —Cl AUW -3-(4-chloropyridazinyl) —Br AUX -3-(4-chloropyridazinyl) —I AUY -3-(4-chloropyridazinyl) -n-butyl AUZ -3-(4-chloropyridazinyl) -n-propyl AVA -3-(4-methylpyridazinyl) -t-butyl AVB -3-(4-methylpyridazinyl) -iso-butyl AVC -3-(4-methylpyridazinyl) -sec-butyl AVD -3-(4-methylpyridazinyl) -cyclohexyl AVE -3-(4-methylpyridazinyl) -t-butoxy AVF -3-(4-methylpyridazinyl) -isopropoxy AVG -3-(4-methylpyridazinyl) —CF3 AVH -3-(4-methylpyridazinyl) —CH2CF3 AVI -3-(4-methylpyridazinyl) —OCF3 AVJ -3-(4-methylpyridazinyl) —Cl AVK -3-(4-methylpyridazinyl) —Br AVL -3-(4-methylpyridazinyl) —I AVM -3-(4-methylpyridazinyl) -n-butyl AVN -3-(4-methylpyridazinyl) -n-propyl AVO -3-(4-fluoropyridazinyl) -t-butyl AVP -3-(4-fluoropyridazinyl) -iso-butyl AVQ -3-(4-fluoropyridazinyl) -sec-butyl AVR -3-(4-fluoropyridazinyl) -cyclohexyl AVS -3-(4-fluoropyridazinyl) -t-butoxy AVT -3-(4-fluoropyridazinyl) -isopropoxy AVU -3-(4-fluoropyridazinyl) —CF3 AVV -3-(4-fluoropyridazinyl) —CH2CF3 AVW -3-(4-fluoropyridazinyl) —OCF3 AVX -3-(4-fluoropyridazinyl) —Cl AVY -3-(4-fluoropyridazinyl) —Br AVZ -3-(4-fluoropyridazinyl) —I AWA -3-(4-fluoropyridazinyl) -n-butyl AWB -3-(4-fluoropyridazinyl) -n-propyl AWC -5-(4-chlorothiadiazolyl) -t-butyl AWD -5-(4-chlorothiadiazolyl) -iso-butyl AWE -5-(4-chlorothiadiazolyl) -sec-butyl AWF -5-(4-chlorothiadiazolyl) -cyclohexyl AWG -5-(4-chlorothiadiazolyl) -t-butoxy AWH -5-(4-chlorothiadiazolyl) -isopropoxy AWI -5-(4-chlorothiadiazolyl) —CF3 AWJ -5-(4-chlorothiadiazolyl) —CH2CF3 AWK -5-(4-chlorothiadiazolyl) —OCF3 AWL -5-(4-chlorothiadiazolyl) —Cl AWM -5-(4-chlorothiadiazolyl) —Br AWN -5-(4-chlorothiadiazolyl) —I AWO -5-(4-chlorothiadiazolyl) -n-butyl AWP -5-(4-chlorothiadiazolyl) -n-propyl AWQ -5-(4-methylthiadiazolyl) -t-butyl AWR -5-(4-methylthiadiazolyl) -iso-butyl AWS -5-(4-methylthiadiazolyl) -sec-butyl AWT -5-(4-methylthiadiazolyl) -cyclohexyl AWU -5-(4-methylthiadiazolyl) -t-butoxy AWV -5-(4-methylthiadiazolyl) -isopropoxy AWW -5-(4-methylthiadiazolyl) —CF3 AWX -5-(4-methylthiadiazolyl) —CH2CF3 AWY -5-(4-methylthiadiazolyl) —OCF3 AWZ -5-(4-methylthiadiazolyl) —Cl AXA -5-(4-methylthiadiazolyl) —Br AXB -5-(4-methylthiadiazolyl) —I AXC -5-(4-methylthiadiazolyl) -n-butyl AXD -5-(4-methylthiadiazolyl) -n-propyl AXE -5-(4-fluorothiadiazolyl) -t-butyl AXF -5-(4-fluorothiadiazolyl) -iso-butyl AXG -5-(4-fluorothiadiazolyl) -sec-butyl AXH -5-(4-fluorothiadiazolyl) -cyclohexyl AXI -5-(4-fluorothiadiazolyl) -t-butoxy AXJ -5-(4-fluorothiadiazolyl) -isopropoxy AXK -5-(4-fluorothiadiazolyl) —CF3 AXL -5-(4-fluorothiadiazolyl) —CH2CF3 AXM -5-(4-fluorothiadiazolyl) —OCF3 AXN -5-(4-fluorothiadiazolyl) —Cl AXO -5-(4-fluorothiadiazolyl) —Br AXP -5-(4-fluorothiadiazolyl) —I AXQ -5-(4-fluorothiadiazolyl) -n-butyl AXR -5-(4-fluorothiadiazolyl) -n-propyl

TABLE 3 VIII and pharmaceutically acceptable salts thereof, wherein: Compound Ar R9 AXS -2-(3-chloropyridyl) -t-butyl AXT -2-(3-chloropyridyl) -iso-butyl AXU -2-(3-chloropyridyl) -sec-butyl AXV -2-(3-chloropyridyl) -cyclohexyl AXW -2-(3-chloropyridyl) -t-butoxy AXX -2-(3-chloropyridyl) -isopropoxy AXY -2-(3-chloropyridyl) —CF3 AXZ -2-(3-chloropyridyl) —CH2CF3 AYA -2-(3-chloropyridyl) —OCF3 AYB -2-(3-chloropyridyl) —Cl AYC -2-(3-chloropyridyl) —Br AYD -2-(3-chloropyridyl) —I AYE -2-(3-chloropyridyl) -n-butyl AYF -2-(3-chloropyridyl) -n-propyl AYG -2-(3-fluoropyridyl) -t-butyl AYH -2-(3-fluoropyridyl) -iso-butyl AYI -2-(3-fluoropyridyl) -sec-butyl AYJ -2-(3-fluoropyridyl) -cyclohexyl AYK -2-(3-fluoropyridyl) -t-butoxy AYL -2-(3-fluoropyridyl) -isopropoxy AYM -2-(3-fluoropyridyl) —CF3 AYN -2-(3-fluoropyridyl) —CH2CF3 AYO -2-(3-fluoropyridyl) —OCF3 AYP -2-(3-fluoropyridyl) —Cl AYQ -2-(3-fluoropyridyl) —Br AYR -2-(3-fluoropyridyl) —I AYS -2-(3-fluoropyridyl) -n-butyl AYT -2-(3-fluoropyridyl) -n-propyl AYU -2-(3-methylpyridyl) -t-butyl AYV -2-(3-methylpyridyl) -iso-butyl AYW -2-(3-methylpyridyl) -sec-butyl AYX -2-(3-methylpyridyl) -cyclohexyl AYY -2-(3-methylpyridyl) -t-butoxy AYZ -2-(3-methylpyridyl) -isopropoxy AZA -2-(3-methylpyridyl) —CF3 AZB -2-(3-methylpyridyl) —CH2CF3 AZC -2-(3-methylpyridyl) —OCF3 AZD -2-(3-methylpyridyl) —Cl AZE -2-(3-methylpyridyl) —Br AZF -2-(3-methylpyridyl) —I AZG -2-(3-methylpyridyl) -n-butyl AZH -2-(3-methylpyridyl) -n-propyl AZI -2-(3-CF3-pyridyl) -t-butyl AZJ -2-(3-CF3-pyridyl) -iso-butyl AZK -2-(3-CF3-pyridyl) -sec-butyl AZL -2-(3-CF3-pyridyl) -cyclohexyl AZM -2-(3-CF3-pyridyl) -t-butoxy AZN -2-(3-CF3-pyridyl) -isopropoxy AZO -2-(3-CF3-pyridyl) —CF3 AZP -2-(3-CF3-pyridyl) —CH2CF3 AZQ -2-(3-CF3-pyridyl) —OCF3 AZR -2-(3-CF3-pyridyl) —Cl AZS -2-(3-CF3-pyridyl) —Br AZT -2-(3-CF3-pyridyl) —I AZU -2-(3-CF3-pyridyl) -n-butyl AZV -2-(3-CF3-pyridyl) -n-propyl AZW -2-(3-CHF2-pyridyl) -t-butyl AZX -2-(3-CHF2-pyridyl) -iso-butyl AZY -2-(3-CHF2-pyridyl) -sec-butyl AZZ -2-(3-CHF2-pyridyl) -cyclohexyl BAA -2-(3-CHF2-pyridyl) -t-butoxy BAB -2-(3-CHF2-pyridyl) -isopropoxy BAC -2-(3-CHF2-pyridyl) —CF3 BAD -2-(3-CHF2-pyridyl) —CH2CF3 BAE -2-(3-CHF2-pyridyl) —OCF3 BAF -2-(3-CHF2-pyridyl) —Cl BAG -2-(3-CHF2-pyridyl) —Br BAH -2-(3-CHF2-pyridyl) —I BAI -2-(3-CHF2-pyridyl) -n-butyl BAJ -2-(3-CHF2-pyridyl) -n-propyl BAK -2-(3-hydroxypyridyl) -t-butyl BAL -2-(3-hydroxypyridyl) -iso-butyl BAM -2-(3-hydroxypyridyl) -sec-butyl BAN -2-(3-hydroxypyridyl) -cyclohexyl BAO -2-(3-hydroxypyridyl) -t-butoxy BAP -2-(3-hydroxypyridyl) -isopropoxy BAQ -2-(3-hydroxypyridyl) —CF3 BAR -2-(3-hydroxypyridyl) —CH2CF3 BAS -2-(3-hydroxypyridyl) —OCF3 BAT -2-(3-hydroxypyridyl) —Cl BAU -2-(3-hydroxypyridyl) —Br BAV -2-(3-hydroxypyridyl) —I BAW -2-(3-hydroxypyridyl) -n-butyl BAX -2-(3-hydroxypyridyl) -n-propyl BAY -2-(3-nitropyridyl) -t-butyl BAZ -2-(3-nitropyridyl) -iso-butyl BBA -2-(3-nitropyridyl) -sec-butyl BBB -2-(3-nitropyridyl) -cyclohexyl BBC -2-(3-nitropyridyl) -t-butoxy BBD -2-(3-nitropyridyl) -isopropoxy BBE -2-(3-nitropyridyl) —CF3 BBF -2-(3-nitropyridyl) —CH2CF3 BBG -2-(3-nitropyridyl) —OCF3 BBH -2-(3-nitropyridyl) —Cl BBI -2-(3-nitropyridyl) —Br BBJ -2-(3-nitropyridyl) —I BBK -2-(3-nitropyridyl) -n-butyl BBL -2-(3-nitropyridyl) -n-propyl BBM -2-(3-cyanopyridyl) -t-butyl BBN -2-(3-cyanopyridyl) -iso-butyl BBO -2-(3-cyanopyridyl) -sec-butyl BBP -2-(3-cyanopyridyl) -cyclohexyl BBQ -2-(3-cyanopyridyl) -t-butoxy BBR -2-(3-cyanopyridyl) -isopropoxy BBS -2-(3-cyanopyridyl) —CF3 BBT -2-(3-cyanopyridyl) —CH2CF3 BBU -2-(3-cyanopyridyl) —OCF3 BBV -2-(3-cyanopyridyl) —Cl BBW -2-(3-cyanopyridyl) —Br BBX -2-(3-cyanopyridyl) —I BBY -2-(3-cyanopyridyl) -n-butyl BBZ -2-(3-cyanopyridyl) -n-propyl BCA -2-(3-bromopyridyl) -t-butyl BCB -2-(3-bromopyridyl) -iso-butyl BCC -2-(3-bromopyridyl) -sec-butyl BCD -2-(3-bromopyridyl) -cyclohexyl BCE -2-(3-bromopyridyl) -t-butoxy BCF -2-(3-bromopyridyl) -isopropoxy BCG -2-(3-bromopyridyl) —CF3 BCH -2-(3-bromopyridyl) —CH2CF3 BCI -2-(3-bromopyridyl) —OCF3 BCJ -2-(3-bromopyridyl) —Cl BCK -2-(3-bromopyridyl) —Br BCL -2-(3-bromopyridyl) —I BCM -2-(3-bromopyridyl) -n-butyl BCN -2-(3-bromopyridyl) -n-propyl BCO -2-(3-iodopyridyl) -t-butyl BCP -2-(3-iodopyridyl) -iso-butyl BCQ -2-(3-iodopyridyl) -sec-butyl BCR -2-(3-iodopyridyl) -cyclohexyl BCS -2-(3-iodopyridyl) -t-butoxy BCT -2-(3-iodopyridyl) -isopropoxy BCU -2-(3-iodopyridyl) —CF3 BCV -2-(3-iodopyridyl) —CH2CF3 BCW -2-(3-iodopyridyl) —OCF3 BCX -2-(3-iodopyridyl) —Cl BCY -2-(3-iodopyridyl) —Br BCZ -2-(3-iodopyridyl) —I BDA -2-(3-iodopyridyl) -n-butyl BDB -2-(3-iodopyridyl) -n-propyl BDC -4-(5-chloropyrimidinyl) -t-butyl BDD -4-(5-chloropyrimidinyl) -iso-butyl BDE -4-(5-chloropyrimidinyl) -sec-butyl BDF -4-(5-chloropyrimidinyl) -cyclohexyl BDG -4-(5-chloropyrimidinyl) -t-butoxy BDH -4-(5-chloropyrimidinyl) -isopropoxy BDI -4-(5-chloropyrimidinyl) —CF3 BDJ -4-(5-chloropyrimidinyl) —CH2CF3 BDK -4-(5-chloropyrimidinyl) —OCF3 BDL -4-(5-chloropyrimidinyl) —Cl BDM -4-(5-chloropyrimidinyl) —Br BDN -4-(5-chloropyrimidinyl) —I BDO -4-(5-chloropyrimidinyl) -n-butyl BDP -4-(5-chloropyrimidinyl) -n-propyl BDQ -4-(5-methylpyrimidinyl) -t-butyl BDR -4-(5-methylpyrimidinyl) -iso-butyl BDS -4-(5-methylpyrimidinyl) -sec-butyl BDT -4-(5-methylpyrimidinyl) -cyclohexyl BDU -4-(5-methylpyrimidinyl) -t-butoxy BDV -4-(5-methylpyrimidinyl) -isopropoxy BDW -4-(5-methylpyrimidinyl) —CF3 BDX -4-(5-methylpyrimidinyl) —CH2CF3 BDY -4-(5-methylpyrimidinyl) —OCF3 BDZ -4-(5-methylpyrimidinyl) —Cl BEA -4-(5-methylpyrimidinyl) —Br BEB -4-(5-methylpyrimidinyl) —I BEC -4-(5-methylpyrimidinyl) -n-butyl BED -4-(5-methylpyrimidinyl) -n-propyl BEE -4-(5-fluoropyrimidinyl) -t-butyl BEF -4-(5-fluoropyrimidinyl) -iso-butyl BEG -4-(5-fluoropyrimidinyl) -sec-butyl BEH -4-(5-fluoropyrimidinyl) -cyclohexyl BEI -4-(5-fluoropyrimidinyl) -t-butoxy BEJ -4-(5-fluoropyrimidinyl) -isopropoxy BEK -4-(5-fluoropyrimidinyl) —CF3 BEL -4-(5-fluoropyrimidinyl) —CH2CF3 BEM -4-(5-fluoropyrimidinyl) —OCF3 BEN -4-(5-fluoropyrimidinyl) —Cl BEO -4-(5-fluoropyrimidinyl) —Br BEP -4-(5-fluoropyrimidinyl) —I BEQ -4-(5-fluoropyrimidinyl) -n-butyl BER -4-(5-fluoropyrimidinyl) -n-propyl BES -2-(3-chloropyrazinyl) -t-butyl BET -2-(3-chloropyrazinyl) -iso-butyl BEU -2-(3-chloropyrazinyl) -sec-butyl BEV -2-(3-chloropyrazinyl) -cyclohexyl BEW -2-(3-chloropyrazinyl) -t-butoxy BEX -2-(3-chloropyrazinyl) -isopropoxy BEY -2-(3-chloropyrazinyl) —CF3 BEZ -2-(3-chloropyrazinyl) —CH2CF3 BFA -2-(3-chloropyrazinyl) —OCF3 BFB -2-(3-chloropyrazinyl) —Cl BFC -2-(3-chloropyrazinyl) —Br BFD -2-(3-chloropyrazinyl) —I BFE -2-(3-chloropyrazinyl) -n-butyl BFF -2-(3-chloropyrazinyl) -n-propyl BFG -2-(3-methylpyrazinyl) -t-butyl BFH -2-(3-methylpyrazinyl) -iso-butyl BFI -2-(3-methylpyrazinyl) -sec-butyl BFJ -2-(3-methylpyrazinyl) -cyclohexyl BFK -2-(3-methylpyrazinyl) -t-butoxy BFL -2-(3-methylpyrazinyl) -isopropoxy BFM -2-(3-methylpyrazinyl) —CF3 BFN -2-(3-methylpyrazinyl) —CH2CF3 BFO -2-(3-methylpyrazinyl) —OCF3 BFP -2-(3-methylpyrazinyl) —Cl BFQ -2-(3-methylpyrazinyl) —Br BFR -2-(3-methylpyrazinyl) —I BFS -2-(3-methylpyrazinyl) -n-butyl BFT -2-(3-methylpyrazinyl) -n-propyl BFU -2-(3-fluoropyrazinyl) -t-butyl BFV -2-(3-fluoropyrazinyl) -iso-butyl BFW -2-(3-fluoropyrazinyl) -sec-butyl BFX -2-(3-fluoropyrazinyl) -cyclohexyl BFY -2-(3-fluoropyrazinyl) -t-butoxy BFZ -2-(3-fluoropyrazinyl) -isopropoxy BGA -2-(3-fluoropyrazinyl) —CF3 BGB -2-(3-fluoropyrazinyl) —CH2CF3 BGC -2-(3-fluoropyrazinyl) —OCF3 BGD -2-(3-fluoropyrazinyl) —Cl BGE -2-(3-fluoropyrazinyl) —Br BGF -2-(3-fluoropyrazinyl) —I BGG -2-(3-fluoropyrazinyl) -n-butyl BGH -2-(3-fluoropyrazinyl) -n-propyl BGI -3-(4-chloropyridazinyl) -t-butyl BGJ -3-(4-chloropyridazinyl) -iso-butyl BGK -3-(4-chloropyridazinyl) -sec-butyl BGL -3-(4-chloropyridazinyl) -cyclohexyl BGM -3-(4-chloropyridazinyl) -t-butoxy BGN -3-(4-chloropyridazinyl) -isopropoxy BGO -3-(4-chloropyridazinyl) —CF3 BGP -3-(4-chloropyridazinyl) —CH2CF3 BGQ -3-(4-chloropyridazinyl) —OCF3 BGR -3-(4-chloropyridazinyl) —Cl BGS -3-(4-chloropyridazinyl) —Br BGT -3-(4-chloropyridazinyl) —I BGU -3-(4-chloropyridazinyl) -n-butyl BGV -3-(4-chloropyridazinyl) -n-propyl BGW -3-(4-methylpyridazinyl) -t-butyl BGX -3-(4-methylpyridazinyl) -iso-butyl BGY -3-(4-methylpyridazinyl) -sec-butyl BGZ -3-(4-methylpyridazinyl) -cyclohexyl BHA -3-(4-methylpyridazinyl) -t-butoxy BHB -3-(4-methylpyridazinyl) -isopropoxy BHC -3-(4-methylpyridazinyl) —CF3 BHD -3-(4-methylpyridazinyl) —CH2CF3 BHE -3-(4-methylpyridazinyl) —OCF3 BHF -3-(4-methylpyridazinyl) —Cl BHG -3-(4-methylpyridazinyl) —Br BHH -3-(4-methylpyridazinyl) —I BHI -3-(4-methylpyridazinyl) -n-butyl BHJ -3-(4-methylpyridazinyl) -n-propyl BHK -3-(4-fluoropyridazinyl) -t-butyl BHL -3-(4-fluoropyridazinyl) -iso-butyl BHM -3-(4-fluoropyridazinyl) -sec-butyl BHN -3-(4-fluoropyridazinyl) -cyclohexyl BHO -3-(4-fluoropyridazinyl) -t-butoxy BHP -3-(4-fluoropyridazinyl) -isopropoxy BHQ -3-(4-fluoropyridazinyl) —CF3 BHR -3-(4-fluoropyridazinyl) —CH2CF3 BHS -3-(4-fluoropyridazinyl) —OCF3 BHT -3-(4-fluoropyridazinyl) —Cl BHU -3-(4-fluoropyridazinyl) —Br BHV -3-(4-fluoropyridazinyl) —I BHW -3-(4-fluoropyridazinyl) -n-butyl BHX -3-(4-fluoropyridazinyl) -n-propyl BHY -5-(4-chlorothiadiazolyl) -t-butyl BHZ -5-(4-chlorothiadiazolyl) -iso-butyl BIA -5-(4-chlorothiadiazolyl) -sec-butyl BIB -5-(4-chlorothiadiazolyl) -cyclohexyl BIC -5-(4-chlorothiadiazolyl) -t-butoxy BID -5-(4-chlorothiadiazolyl) -isopropoxy BIE -5-(4-chlorothiadiazolyl) —CF3 BIF -5-(4-chlorothiadiazolyl) —CH2CF3 BIG -5-(4-chlorothiadiazolyl) —OCF3 BIH -5-(4-chlorothiadiazolyl) —Cl BII -5-(4-chlorothiadiazolyl) —Br BIJ -5-(4-chlorothiadiazolyl) —I BIK -5-(4-chlorothiadiazolyl) -n-butyl BIL -5-(4-chlorothiadiazolyl) -n-propyl BIM -5-(4-methylthiadiazolyl) -t-butyl BIN -5-(4-methylthiadiazolyl) -iso-butyl BIO -5-(4-methylthiadiazolyl) -sec-butyl BIP -5-(4-methylthiadiazolyl) -cyclohexyl BIQ -5-(4-methylthiadiazolyl) -t-butoxy BIR -5-(4-methylthiadiazolyl) -isopropoxy BIS -5-(4-methylthiadiazolyl) —CF3 BIT -5-(4-methylthiadiazolyl) —CH2CF3 BIU -5-(4-methylthiadiazolyl) —OCF3 BIV -5-(4-methylthiadiazolyl) —Cl BIW -5-(4-methylthiadiazolyl) —Br BIX -5-(4-methylthiadiazolyl) —I BIY -5-(4-methylthiadiazolyl) -n-butyl BIZ -5-(4-methylthiadiazolyl) -n-propyl BJA -5-(4-fluorothiadiazolyl) -t-butyl BJB -5-(4-fluorothiadiazolyl) -iso-butyl BJC -5-(4-fluorothiadiazolyl) -sec-butyl BJD -5-(4-fluorothiadiazolyl) -cyclohexyl BJE -5-(4-fluorothiadiazolyl) -t-butoxy BJF -5-(4-fluorothiadiazolyl) -isopropoxy BJG -5-(4-fluorothiadiazolyl) —CF3 BJH -5-(4-fluorothiadiazolyl) —CH2CF3 BJI -5-(4-fluorothiadiazolyl) —OCF3 BJJ -5-(4-fluorothiadiazolyl) —Cl BJK -5-(4-fluorothiadiazolyl) —Br BJL -5-(4-fluorothiadiazolyl) —I BJM -5-(4-fluorothiadiazolyl) -n-butyl BJN -5-(4-fluorothiadiazolyl) -n-propyl

TABLE 4 IX and pharmaceutically acceptable salts thereof, wherein: Compound Ar R9 BJO (a and b) -2-(3-chloropyridyl) -t-butyl BJP (a and b) -2-(3-chloropyridyl) -iso-butyl BJQ (a and b) -2-(3-chloropyridyl) -sec-butyl BJR (a and b) -2-(3-chloropyridyl) -cyclohexyl BJS (a and b) -2-(3-chloropyridyl) -t-butoxy BJT (a and b) -2-(3-chloropyridyl) -isopropoxy BJU (a and b) -2-(3-chloropyridyl) —CF3 BJV (a and b) -2-(3-chloropyridyl) —CH2CF3 BJW (a and b) -2-(3-chloropyridyl) —OCF3 BJX (a and b) -2-(3-chloropyridyl) —Cl BJY (a and b) -2-(3-chloropyridyl) —Br BJZ (a and b) -2-(3-chloropyridyl) —I BKA (a and b) -2-(3-chloropyridyl) -n-butyl BKB (a and b) -2-(3-chloropyridyl) -n-propyl BKC (a and b) -2-(3-fluoropyridyl) -t-butyl BKD (a and b) -2-(3-fluoropyridyl) -iso-butyl BKE (a and b) -2-(3-fluoropyridyl) -sec-butyl BKF (a and b) -2-(3-fluoropyridyl) -cyclohexyl BKG (a and b) -2-(3-fluoropyridyl) -t-butoxy BKH (a and b) -2-(3-fluoropyridyl) -isopropoxy BKI (a and b) -2-(3-fluoropyridyl) —CF3 BKJ (a and b) -2-(3-fluoropyridyl) —CH2CF3 BKK (a and b) -2-(3-fluoropyridyl) —OCF3 BKL (a and b) -2-(3-fluoropyridyl) —Cl BKM (a and b) -2-(3-fluoropyridyl) —Br BKN (a and b) -2-(3-fluoropyridyl) —I BKO (a and b) -2-(3-fluoropyridyl) -n-butyl BKP (a and b) -2-(3-fluoropyridyl) -n-propyl BKQ (a and b) -2-(3-methylpyridyl) -t-butyl BKR (a and b) -2-(3-methylpyridyl) -iso-butyl BKS (a and b) -2-(3-methylpyridyl) -sec-butyl BKT (a and b) -2-(3-methylpyridyl) -cyclohexyl BKU (a and b) -2-(3-methylpyridyl) -t-butoxy BKV (a and b) -2-(3-methylpyridyl) -isopropoxy BKW (a and b) -2-(3-methylpyridyl) —CF3 BKX (a and b) -2-(3-methylpyridyl) —CH2CF3 BKY (a and b) -2-(3-methylpyridyl) —OCF3 BKZ (a and b) -2-(3-methylpyridyl) —Cl BLA (a and b) -2-(3-methylpyridyl) —Br BLB (a and b) -2-(3-methylpyridyl) —I BLC (a and b) -2-(3-methylpyridyl) -n-butyl BLD (a and b) -2-(3-methylpyridyl) -n-propyl BLE (a and b) -2(3-CF3-pyridyl) -t-butyl BLF (a and b) -2-(3-CF3-pyridyl) -iso-butyl BLG (a and b) -2-(3-CF3-pyridyl) -sec-butyl BLH (a and b) -2-(3-CF3-pyridyl) -cyclohexyl BLI (a and b) -2-(3-CF3-pyridyl) -t-butoxy BLJ (a and b) -2-(3-CF3-pyridyl) -isopropoxy BLK (a and b) -2-(3-CF3-pyridyl) —CF3 BLL (a and b) -2-(3-CF3-pyridyl) —CH2CF3 BLM (a and b) -2-(3-CF3-pyridyl) —OCF3 BLN (a and b) -2-(3-CF3-pyridyl) —Cl BLO (a and b) -2-(3-CF3-pyridyl) —Br BLP (a and b) -2-(3-CF3-pyridyl) —I BLQ (a and b) -2-(3-CF3-pyridyl) -n-butyl BLR (a and b) -2-(3-CF3-pyridyl) -n-propyl BLS (a and b) -2-(3-CHF2-pyridyl) -t-butyl BLT (a and b) -2-(3-CHF2-pyridyl) -iso-butyl BLU (a and b) -2-(3-CHF2-pyridyl) -sec-butyl BLV (a and b) -2-(3-CHF2-pyridyl) -cyclohexyl BLW (a and b) -2-(3-CHF2-pyridyl) -t-butoxy BLX (a and b) -2-(3-CHF2-pyridyl) -isopropoxy BLY (a and b) -2-(3-CHF2-pyridyl) —CF3 BLZ (a and b) -2-(3-CHF2-pyridyl) —CH2CF3 BMA (a and b) -2-(3-CHF2-pyridyl) —OCF3 BMB (a and b) -2-(3-CHF2-pyridyl) —Cl BMC (a and b) -2-(3-CHF2-pyridyl) —Br BMD (a and b) -2-(3-CHF2-pyridyl) —I BME (a and b) -2-(3-CHF2-pyridyl) -n-butyl BMF (a and b) -2-(3-CHF2-pyridyl) -n-propyl BMG (a and b) -2-(3-hydroxypyridyl) -t-butyl BMH (a and b) -2-(3-hydroxypyridyl) -iso-butyl BMI (a and b) -2-(3-hydroxypyridyl) -sec-butyl BMJ (a and b) -2-(3-hydroxypyridyl) -cyclohexyl BMK (a and b) -2-(3-hydroxypyridyl) -t-butoxy BML (a and b) -2-(3-hydroxypyridyl) -isopropoxy BMM (a and b) -2-(3-hydroxypyridyl) —CF3 BMN (a and b) -2-(3-hydroxypyridyl) —CH2CF3 BMO (a and b) -2-(3-hydroxypyridyl) —OCF3 BMP (a and b) -2-(3-hydroxypyridyl) —Cl BMQ (a and b) -2-(3-hydroxypyridyl) —Br BMR (a and b) -2-(3-hydroxypyridyl) —I BMS (a and b) -2-(3-hydroxypyridyl) -n-butyl BMT (a and b) -2-(3-hydroxypyridyl) -n-propyl BMU (a and b) -2-(3-nitropyridyl) -t-butyl BMV (a and b) -2-(3-nitropyridyl) -iso-butyl BMW (a and b) -2-(3-nitropyridyl) -sec-butyl BMX (a and b) -2-(3-nitropyridyl) -cyclohexyl BMY (a and b) -2-(3-nitropyridyl) -t-butoxy BMZ (a and b) -2-(3-nitropyridyl) -isopropoxy BNA (a and b) -2-(3-nitropyridyl) —CF3 BNB (a and b) -2-(3-nitropyridyl) —CH2CF3 BNC (a and b) -2-(3-nitropyridyl) —OCF3 BND (a and b) -2-(3-nitropyridyl) —Cl BNE (a and b) -2-(3-nitropyridyl) —Br BNF (a and b) -2-(3-nitropyridyl) —I BNG (a and b) -2-(3-nitropyridyl) -n-butyl BNH (a and b) -2-(3-nitropyridyl) -n-propyl BNI (a and b) -2-(3-cyanopyridyl) -t-butyl BNJ (a and b) -2-(3-cyanopyridyl) -iso-butyl BNK (a and b) -2-(3-cyanopyridyl) -sec-butyl BNL (a and b) -2-(3-cyanopyridyl) -cyclohexyl BNM (a and b) -2-(3-cyanopyridyl) -t-butoxy BNN (a and b) -2-(3-cyanopyridyl) -isopropoxy BNO (a and b) -2-(3-cyanopyridyl) —CF3 BNP (a and b) -2-(3-cyanopyridyl) —CH2CF3 BNQ (a and b) -2-(3-cyanopyridyl) —OCF3 BNR (a and b) -2-(3-cyanopyridyl) —Cl BNS (a and b) -2-(3-cyanopyridyl) —Br BNT (a and b) -2-(3-cyanopyridyl) —I BNU (a and b) -2-(3-cyanopyridyl) -n-butyl BNV (a and b) -2-(3-cyanopyridyl) -n-propyl BNW (a and b) -2-(3-bromopyridyl) -t-butyl BNX (a and b) -2-(3-bromopyridyl) -iso-butyl BNY (a and b) -2-(3-bromopyridyl) -sec-butyl BNZ (a and b) -2-(3-bromopyridyl) -cyclohexyl BOA (a and b) -2-(3-bromopyridyl) -t-butoxy BOB (a and b) -2-(3-bromopyridyl) -isopropoxy BOC (a and b) -2-(3-bromopyridyl) —CF3 BOD (a and b) -2-(3-bromopyridyl) —CH2CF3 BOE (a and b) -2-(3-bromopyridyl) —OCF3 BOF (a and b) -2-(3-bromopyridyl) —Cl BOG (a and b) -2-(3-bromopyridyl) —Br BOH (a and b) -2-(3-bromopyridyl) —I BOI (a and b) -2-(3-bromopyridyl) -n-butyl BOJ (a and b) -2-(3-bromopyridyl) -n-propyl BOK (a and b) -2-(3-iodopyridyl) -t-butyl BOL (a and b) -2-(3-iodopyridyl) -iso-butyl BOM (a and b) -2-(3-iodopyridyl) -sec-butyl BON (a and b) -2-(3-iodopyridyl) -cyclohexyl BOO (a and b) -2-(3-iodopyridyl) -t-butoxy BOP (a and b) -2-(3-iodopyridyl) -isopropoxy BOQ (a and b) -2-(3-iodopyridyl) —CF3 BOR (a and b) -2-(3-iodopyridyl) —CH2CF3 BOS (a and b) -2-(3-iodopyridyl) —OCF3 BOT (a and b) -2-(3-iodopyridyl) —Cl BOU (a and b) -2-(3-iodopyridyl) —Br BOV (a and b) -2-(3-iodopyridyl) —I BOW (a and b) -2-(3-iodopyridyl) -n-butyl BOX (a and b) -2-(3-iodopyridyl) -n-propyl BOY (a and b) -4-(5-chloropyrimidinyl) -t-butyl BOZ (a and b) -4-(5-chloropyrimidinyl) -iso-butyl BPA (a and b) -4-(5-chloropyrimidinyl) -sec-butyl BPB (a and b) -4-(5-chloropyrimidinyl) -cyclohexyl BPC (a and b) -4-(5-chloropyrimidinyl) -t-butoxy BPD (a and b) -4-(5-chloropyrimidinyl) -isopropoxy BPE (a and b) -4-(5-chloropyrimidinyl) —CF3 BPF (a and b) -4-(5-chloropyrimidinyl) —CH2CF3 BPG (a and b) -4-(5-chloropyrimidinyl) —OCF3 BPH (a and b) -4-(5-chloropyrimidinyl) —Cl BPI (a and b) -4-(5-chloropyrimidinyl) —Br BPJ (a and b) -4-(5-chloropyrimidinyl) —I BPK (a and b) -4-(5-chloropyrimidinyl) -n-butyl BPL (a and b) -4-(5-chloropyrimidinyl) -n-propyl BPM (a and b) -4-(5-methylpyrimidinyl) -t-butyl BPN (a and b) -4-(5-methylpyrimidinyl) -iso-butyl BPO (a and b) -4-(5-methylpyrimidinyl) -sec-butyl BPP (a and b) -4-(5-methylpyrimidinyl) -cyclohexyl BPQ (a and b) -4-(5-methylpyrimidinyl) -t-butoxy BPR (a and b) -4-(5-methylpyrimidinyl) -isopropoxy BPS (a and b) -4-(5-methylpyrimidinyl) —CF3 BPT (a and b) -4-(5-methylpyrimidinyl) —CH2CF3 BPU (a and b) -4-(5-methylpyrimidinyl) —OCF3 BPV (a and b) -4-(5-methylpyrimidinyl) —Cl BPW (a and b) -4-(5-methylpyrimidinyl) —Br BPX (a and b) -4-(5-methylpyrimidinyl) —I BPY (a and b) -4-(5-methylpyrimidinyl) -n-butyl BPZ (a and b) -4-(5-methylpyrimidinyl) -n-propyl BQA (a and b) -4-(5-fluoropyrimidinyl) -t-butyl BQB (a and b) -4-(5-fluoropyrimidinyl) -iso-butyl BQC (a and b) -4-(5-fluoropyrimidinyl) -sec-butyl BQD (a and b) -4-(5-fluoropyrimidinyl) -cyclohexyl BQE (a and b) -4-(5-fluoropyrimidinyl) -t-butoxy BQF (a and b) -4-(5-fluoropyrimidinyl) -isopropoxy BQG (a and b) -4-(5-fluoropyrimidinyl) —CF3 BQH (a and b) -4-(5-fluoropyrimidinyl) —CH2CF3 BQI (a and b) -4-(5-fluoropyrimidinyl) —OCF3 BQJ (a and b) -4-(5-fluoropyrimidinyl) —Cl BQK (a and b) -4-(5-fluoropyrimidinyl) —Br BQL (a and b) -4-(5-fluoropyrimidinyl) —I BQM (a and b) -4-(5-fluoropyrimidinyl) -n-butyl BQN (a and b) -4-(5-fluoropyrimidinyl) -n-propyl BQO (a and b) -2-(3-chloropyrazinyl) -t-butyl BQP (a and b) -2-(3-chloropyrazinyl) -iso-butyl BQQ (a and b) -2-(3-chloropyrazinyl) -sec-butyl BQR (a and b) -2-(3-chloropyrazinyl) -cyclohexyl BQS (a and b) -2-(3-chloropyrazinyl) -t-butoxy BQT (a and b) -2-(3-chloropyrazinyl) -isopropoxy BQU (a and b) -2-(3-chloropyrazinyl) —CF3 BQV (a and b) -2-(3-chloropyrazinyl) —CH2CF3 BQW (a and b) -2-(3-chloropyrazinyl) —OCF3 BQX (a and b) -2-(3-chloropyrazinyl) —Cl BQY (a and b) -2-(3-chloropyrazinyl) —Br BQZ (a and b) -2-(3-chloropyrazinyl) —I BRA (a and b) -2-(3-chloropyrazinyl) -n-butyl BRB (a and b) -2-(3-chloropyrazinyl) -n-propyl BRC (a and b) -2-(3-methylpyrazinyl) -t-butyl BRD (a and b) -2-(3-methylpyrazinyl) -iso-butyl BRE (a and b) -2-(3-methylpyrazinyl) -sec-butyl BRF (a and b) -2-(3-methylpyrazinyl) -cyclohexyl BRG (a and b) -2-(3-methylpyrazinyl) -t-butoxy BRH (a and b) -2-(3-methylpyrazinyl) -isopropoxy BRI (a and b) -2-(3-methylpyrazinyl) —CF3 BRJ (a and b) -2-(3-methylpyrazinyl) —CH2CF3 BRK (a and b) -2-(3-methylpyrazinyl) —OCF3 BRL (a and b) -2-(3-methylpyrazinyl) —Cl BRM (a and b) -2-(3-methylpyrazinyl) —Br BRN (a and b) -2-(3-methylpyrazinyl) —I BRO (a and b) -2-(3-methylpyrazinyl) -n-butyl BRP (a and b) -2-(3-methylpyrazinyl) -n-propyl BRQ (a and b) -2-(3-fluoropyrazinyl) -t-butyl BRR (a and b) -2-(3-fluoropyrazinyl) -iso-butyl BRS (a and b) -2-(3-fluoropyrazinyl) -sec-butyl BRT (a and b) -2-(3-fluoropyrazinyl) -cyclohexyl BRU (a and b) -2-(3-fluoropyrazinyl) -t-butoxy BRV (a and b) -2-(3-fluoropyrazinyl) -isopropoxy BRW (a and b) -2-(3-fluoropyrazinyl) —CF3 BRX (a and b) -2-(3-fluoropyrazinyl) —CH2CF3 BRY (a and b) -2-(3-fluoropyrazinyl) —OCF3 BRZ (a and b) -2-(3-fluoropyrazinyl) —Cl BSA (a and b) -2-(3-fluoropyrazinyl) —Br BSB (a and b) -2-(3-fluoropyrazinyl) —I BSC (a and b) -2-(3-fluoropyrazinyl) -n-butyl BSD (a and b) -2-(3-fluoropyrazinyl) -n-propyl BSE (a and b) -3-(4-chloropyridazinyl) -t-butyl BSF (a and b) -3-(4-chloropyridazinyl) -iso-butyl BSG (a and b) -3-(4-chloropyridazinyl) -sec-butyl BSH (a and b) -3-(4-chloropyridazinyl) -cyclohexyl BSI (a and b) -3-(4-chloropyridazinyl) -t-butoxy BSJ (a and b) -3-(4-chloropyridazinyl) -isopropoxy BSK (a and b) -3-(4-chloropyridazinyl) —CF3 BSL (a and b) -3-(4-chloropyridazinyl) —CH2CF3 BSM (a and b) -3-(4-chloropyridazinyl) —OCF3 BSN (a and b) -3-(4-chloropyridazinyl) —Cl BSO (a and b) -3-(4-chloropyridazinyl) —Br BSP (a and b) -3-(4-chloropyridazinyl) —I BSQ (a and b) -3-(4-chloropyridazinyl) -n-butyl BSR (a and b) -3-(4-chloropyridazinyl) -n-propyl BSS (a and b) -3-(4-methylpyridazinyl) -t-butyl BST (a and b) -3-(4-methylpyridazinyl) -iso-butyl BSU (a and b) -3-(4-methylpyridazinyl) -sec-butyl BSV (a and b) -3-(4-methylpyridazinyl) -cyclohexyl BSW (a and b) -3-(4-methylpyridazinyl) -t-butoxy BSX (a and b) -3-(4-methylpyridazinyl) -isopropoxy BSY (a and b) -3-(4-methylpyridazinyl) —CF3 BSZ (a and b) -3-(4-methylpyridazinyl) —CH2CF3 BTA (a and b) -3-(4-methylpyridazinyl) —OCF3 BTB (a and b) -3-(4-methylpyridazinyl) —Cl BTC (a and b) -3-(4-methylpyridazinyl) —Br BTD (a and b) -3-(4-methylpyridazinyl) —I BTE (a and b) -3-(4-methylpyridazinyl) -n-butyl BTF (a and b) -3-(4-methylpyridazinyl) -n-propyl BTG (a and b) -3-(4-fluoropyridazinyl) -t-butyl BTH (a and b) -3-(4-fluoropyridazinyl) -iso-butyl BTI (a and b) -3-(4-fluoropyridazinyl) -sec-butyl BTJ (a and b) -3-(4-fluoropyridazinyl) -cyclohexyl BTK (a and b) -3-(4-fluoropyridazinyl) -t-butoxy BTL (a and b) -3-(4-fluoropyridazinyl) -isopropoxy BTM (a and b) -3-(4-fluoropyridazinyl) —CF3 BTN (a and b) -3-(4-fluoropyridazinyl) —CH2CF3 BTO (a and b) -3-(4-fluoropyridazinyl) —OCF3 BTP (a and b) -3-(4-fluoropyridazinyl) —Cl BTQ (a and b) -3-(4-fluoropyridazinyl) —Br BTR (a and b) -3-(4-fluoropyridazinyl) —I BTS (a and b) -3-(4-fluoropyridazinyl) -n-butyl BTT (a and b) -3-(4-fluoropyridazinyl) -n-propyl BTU (a and b) -5-(4-chlorothiadiazolyl) -t-butyl BTV (a and b) -5-(4-chlorothiadiazolyl) -iso-butyl BTW (a and b) -5-(4-chlorothiadiazolyl) -sec-butyl BTX (a and b) -5-(4-chlorothiadiazolyl) -cyclohexyl BTY (a and b) -5-(4-chlorothiadiazolyl) -t-butoxy BTZ (a and b) -5-(4-chlorothiadiazolyl) -isopropoxy BUA (a and b) -5-(4-chlorothiadiazolyl) —CF3 BUB (a and b) -5-(4-chlorothiadiazolyl) —CH2CF3 BUC (a and b) -5-(4-chlorothiadiazolyl) —OCF3 BUD (a and b) -5-(4-chlorothiadiazolyl) —Cl BUE (a and b) -5-(4-chlorothiadiazolyl) —Br BUF (a and b) -5-(4-chlorothiadiazolyl) —I BUG (a and b) -5-(4-chlorothiadiazolyl) -n-butyl BUH (a and b) -5-(4-chlorothiadiazolyl) -n-propyl BUI (a and b) -5-(4-methylthiadiazolyl) -t-butyl BUJ (a and b) -5-(4-methylthiadiazolyl) -iso-butyl BUK (a and b) -5-(4-methylthiadiazolyl) -sec-butyl BUL (a and b) -5-(4-methylthiadiazolyl) -cyclohexyl BUM (a and b) -5-(4-methylthiadiazolyl) -t-butoxy BUN (a and b) -5-(4-methylthiadiazolyl) -isopropoxy BUO (a and b) -5-(4-methylthiadiazolyl) —CF3 BUP (a and b) -5-(4-methylthiadiazolyl) —CH2CF3 BUQ (a and b) -5-(4-methylthiadiazolyl) —OCF3 BUR (a and b) -5-(4-methylthiadiazolyl) —Cl BUS (a and b) -5-(4-methylthiadiazolyl) —Br BUT (a and b) -5-(4-methylthiadiazolyl) —I BUU (a and b) -5-(4-methylthiadiazolyl) -n-butyl BUV (a and b) -5-(4-methylthiadiazolyl) -n-propyl BUW (a and b) -5-(4-fluorothiadiazolyl) -t-butyl BUX (a and b) -5-(4-fluorothiadiazolyl) -iso-butyl BUY (a and b) -5-(4-fluorothiadiazolyl) -sec-butyl BUZ (a and b) -5-(4-fluorothiadiazolyl) -cyclohexyl BVA (a and b) -5-(4-fluorothiadiazolyl) -t-butoxy BVB (a and b) -5-(4-fluorothiadiazolyl) -isopropoxy BVC (a and b) -5-(4-fluorothiadiazolyl) —CF3 BVD (a and b) -5-(4-fluorothiadiazolyl) —CH2CF3 BVE (a and b) -5-(4-fluorothiadiazolyl) —OCF3 BVF (a and b) -5-(4-fluorothiadiazolyl) —Cl BVG (a and b) -5-(4-fluorothiadiazolyl) —Br BVH (a and b) -5-(4-fluorothiadiazolyl) —I BVI (a and b) -5-(4-fluorothiadiazolyl) -n-butyl BVJ (a and b) -5-(4-fluorothiadiazolyl) -n-propyl

wherein “a” means that the carbon atom of the piperazino group to which the methyl group is attached is in the R configuration and “b” means that the carbon of the piperazino group to which the methyl group is attached is in the S configuration

TABLE 5 X and pharmaceutically acceptable salts thereof, wherein: Compound Ar R9 BVK (a and b) -2-(3-chloropyridyl) -t-butyl BVL (a and b) -2-(3-chloropyridyl) -iso-butyl BVM (a and b) -2-(3-chloropyridyl) -sec-butyl BVN (a and b) -2-(3-chloropyridyl) -cyclohexyl BVO (a and b) -2-(3-chloropyridyl) -t-butoxy BVP (a and b) -2-(3-chloropyridyl) -isopropoxy BVQ (a and b) -2-(3-chloropyridyl) —CF3 BVR (a and b) -2-(3-chloropyridyl) —CH2CF3 BVS (a and b) -2-(3-chloropyridyl) —OCF3 BVT (a and b) -2-(3-chloropyridyl) —Cl BVU (a and b) -2-(3-chloropyridyl) —Br BVV (a and b) -2-(3-chloropyridyl) —I BVW (a and b) -2-(3-chloropyridyl) -n-butyl BVX (a and b) -2-(3-chloropyridyl) -n-propyl BVY (a and b) -2-(3-fluoropyridyl) -t-butyl BVZ (a and b) -2-(3-fluoropyridyl) -iso-butyl BWA (a and b) -2-(3-fluoropyridyl) -sec-butyl BWB (a and b) -2-(3-fluoropyridyl) -cyclohexyl BWC (a and b) -2-(3-fluoropyridyl) -t-butoxy BWD (a and b) -2-(3-fluoropyridyl) -isopropoxy BWE (a and b) -2-(3-fluoropyridyl) —CF3 BWF (a and b) -2-(3-fluoropyridyl) —CH2CF3 BWG (a and b) -2-(3-fluoropyridyl) —OCF3 BWH (a and b) -2-(3-fluoropyridyl) —Cl BWI (a and b) -2-(3-fluoropyridyl) —Br BWJ (a and b) -2-(3-fluoropyridyl) —I BWK (a and b) -2-(3-fluoropyridyl) -n-butyl BWL (a and b) -2-(3-fluoropyridyl) -n-propyl BWM (a and b) -2-(3-methylpyridyl) -t-butyl BWN (a and b) -2-(3-methylpyridyl) -iso-butyl BWO (a and b) -2-(3-methylpyridyl) -sec-butyl BWP (a and b) -2-(3-methylpyridyl) -cyclohexyl BWQ (a and b) -2-(3-methylpyridyl) -t-butoxy BWR (a and b) -2-(3-methylpyridyl) -isopropoxy BWS (a and b) -2-(3-methylpyridyl) —CF3 BWT (a and b) -2-(3-methylpyridyl) —CH2CF3 BWU (a and b) -2-(3-methylpyridyl) —OCF3 BWV (a and b) -2-(3-methylpyridyl) —Cl BWW (a and b) -2-(3-methylpyridyl) —Br BWX (a and b) -2-(3-methylpyridyl) —I BWY (a and b) -2-(3-methylpyridyl) -n-butyl BWZ (a and b) -2-(3-methylpyridyl) -n-propyl BXA (a and b) -2-(3-CF3-pyridyl) -t-butyl BXB (a and b) -2-(3-CF3-pyridyl) -iso-butyl BXC (a and b) -2-(3-CF3-pyridyl) -sec-butyl BXD (a and b) -2-(3-CF3-pyridyl) -cyclohexyl BXE (a and b) -2-(3-CF3-pyridyl) -t-butoxy BXF (a and b) -2-(3-CF3-pyridyl) -isopropoxy BXG (a and b) -2-(3-CF3-pyridyl) —CF3 BXH (a and b) -2-(3-CF3-pyridyl) —CH2CF3 BXI (a and b) -2-(3-CF3-pyridyl) —OCF3 BXJ (a and b) -2-(3-CF3-pyridyl) —Cl BXK (a and b) -2-(3-CF3-pyridyl) —Br BXL (a and b) -2-(3-CF3-pyridyl) —I BXM (a and b) -2-(3-CF3-pyridyl) -n-butyl BXN (a and b) -2-(3-CF3-pyridyl) -n-propyl BXO (a and b) -2-(3-CHF2-pyridyl) -t-butyl BXP (a and b) -2-(3-CHF2-pyridyl) -iso-butyl BXQ (a and b) -2-(3-CHF2-pyridyl) -sec-butyl BXR (a and b) -2-(3-CHF2-pyridyl) -cyclohexyl BXS (a and b) -2-(3-CHF2-pyridyl) -t-butoxy BXT (a and b) -2-(3-CHF2-pyridyl) -isopropoxy BXU (a and b) -2-(3-CHF2-pyridyl) —CF3 BXV (a and b) -2-(3-CHF2-pyridyl) —CH2CF3 BXW (a and b) -2-(3-CHF2-pyridyl) —OCF3 BXX (a and b) -2-(3-CHF2-pyridyl) —Cl BXY (a and b) -2-(3-CHF2-pyridyl) —Br BXZ (a and b) -2-(3-CHF2-pyridyl) —I BYA (a and b) -2-(3-CHF2-pyridyl) -n-butyl BYB (a and b) -2-(3-CHF2-pyridyl) -n-propyl BYC (a and b) -2-(3-hydroxypyridyl) -t-butyl BYD (a and b) -2-(3-hydroxypyridyl) -iso-butyl BYE (a and b) -2-(3-hydroxypyridyl) -sec-butyl BYF (a and b) -2-(3-hydroxypyridyl) -cyclohexyl BYG (a and b) -2-(3-hydroxypyridyl) -t-butoxy BYH (a and b) -2-(3-hydroxypyridyl) -isopropoxy BYI (a and b) -2-(3-hydroxypyridyl) —CF3 BYJ (a and b) -2-(3-hydroxypyridyl) —CH2CF3 BYK (a and b) -2-(3-hydroxypyridyl) —OCF3 BYL (a and b) -2-(3-hydroxypyridyl) —Cl BYM (a and b) -2-(3-hydroxypyridyl) —Br BYN (a and b) -2-(3-hydroxypyridyl) —I BYO (a and b) -2-(3-hydroxypyridyl) -n-butyl BYP (a and b) -2-(3-hydroxypyridyl) -n-propyl BYQ (a and b) -2-(3-nitropyridyl) -t-butyl BYR (a and b) -2-(3-nitropyridyl) -iso-butyl BYS (a and b) -2-(3-nitropyridyl) -sec-butyl BYT (a and b) -2-(3-nitropyridyl) -cyclohexyl BYU (a and b) -2-(3-nitropyridyl) -t-butoxy BYV (a and b) -2-(3-nitropyridyl) -isopropoxy BYW (a and b) -2-(3-nitropyridyl) —CF3 BYX (a and b) -2-(3-nitropyridyl) —CH2CF3 BYY (a and b) -2-(3-nitropyridyl) —OCF3 BYZ (a and b) -2-(3-nitropyridyl) —Cl BZA (a and b) -2-(3-nitropyridyl) —Br BZB (a and b) -2-(3-nitropyridyl) —I BZC (a and b) -2-(3-nitropyridyl) -n-butyl BZD (a and b) -2-(3-nitropyridyl) -n-propyl BZE (a and b) -2-(3-cyanopyridyl) -t-butyl BZF (a and b) -2-(3-cyanopyridyl) -iso-butyl BZG (a and b) -2-(3-cyanopyridyl) -sec-butyl BZH (a and b) -2-(3-cyanopyridyl) -cyclohexyl BZI (a and b) -2-(3-cyanopyridyl) -t-butoxy BZJ (a and b) -2-(3-cyanopyridyl) -isopropoxy BZK (a and b) -2-(3-cyanopyridyl) —CF3 BZL (a and b) -2-(3-cyanopyridyl) —CH2CF3 BZM (a and b) -2-(3-cyanopyridyl) —OCF3 BZN (a and b) -2-(3-cyanopyridyl) —Cl BZO (a and b) -2-(3-cyanopyridyl) —Br BZP (a and b) -2-(3-cyanopyridyl) —I BZQ (a and b) -2-(3-cyanopyridyl) -n-butyl BZR (a and b) -2-(3-cyanopyridyl) -n-propyl BZS (a and b) -2-(3-bromopyridyl) -t-butyl BZT (a and b) -2-(3-bromopyridyl) -iso-butyl BZU (a and b) -2-(3-bromopyridyl) -sec-butyl BZV (a and b) -2-(3-bromopyridyl) -cyclohexyl BZW (a and b) -2-(3-bromopyridyl) -t-butoxy BZX (a and b) -2-(3-bromopyridyl) -isopropoxy BZY (a and b) -2-(3-bromopyridyl) —CF3 BZZ (a and b) -2-(3-bromopyridyl) —CH2CF3 CAA (a and b) -2-(3-bromopyridyl) —OCF3 CAB (a and b) -2-(3-bromopyridyl) —Cl CAC (a and b) -2-(3-bromopyridyl) —Br CAD (a and b) -2-(3-bromopyridyl) —I CAE (a and b) -2-(3-bromopyridyl) -n-butyl CAF (a and b) -2-(3-bromopyridyl) -n-propyl CAG (a and b) -2-(3-iodopyridyl) -t-butyl CAH (a and b) -2-(3-iodopyridyl) -iso-butyl CAI (a and b) -2-(3-iodopyridyl) -sec-butyl CAJ (a and b) -2-(3-iodopyridyl) -cyclohexyl CAK (a and b) -2-(3-iodopyridyl) -t-butoxy CAL (a and b) -2-(3-iodopyridyl) -isopropoxy CAM (a and b) -2-(3-iodopyridyl) —CF3 CAN (a and b) -2-(3-iodopyridyl) —CH2CF3 CAO (a and b) -2-(3-iodopyridyl) —OCF3 CAP (a and b) -2-(3-iodopyridyl) —Cl CAQ (a and b) -2-(3-iodopyridyl) —Br CAR (a and b) -2-(3-iodopyridyl) —I CAS (a and b) -2-(3-iodopyridyl) -n-butyl CAT (a and b) -2-(3-iodopyridyl) -n-propyl CAU (a and b) -4-(5-chloropyrimidinyl) -t-butyl CAV (a and b) -4-(5-chloropyrimidinyl) -iso-butyl CAW (a and b) -4-(5-chloropyrimidinyl) -sec-butyl CAX (a and b) -4-(5-chloropyrimidinyl) -cyclohexyl CAY (a and b) -4-(5-chloropyrimidinyl) -t-butoxy CAZ (a and b) -4-(5-chloropyrimidinyl) -isopropoxy CBA (a and b) -4-(5-chloropyrimidinyl) —CF3 CBB (a and b) -4-(5-chloropyrimidinyl) —CH2CF3 CBC (a and b) -4-(5-chloropyrimidinyl) —OCF3 CBD (a and b) -4-(5-chloropyrimidinyl) —Cl CBE (a and b) -4-(5-chloropyrimidinyl) —Br CBF (a and b) -4-(5-chloropyrimidinyl) —I CBG (a and b) -4-(5-chloropyrimidinyl) -n-butyl CBH (a and b) -4-(5-chloropyrimidinyl) -n-propyl CBI (a and b) -4-(5-methylpyrimidinyl) -t-butyl CBJ (a and b) -4-(5-methylpyrimidinyl) -iso-butyl CBK (a and b) -4-(5-methylpyrimidinyl) -sec-butyl CBL (a and b) -4-(5-methylpyrimidinyl) -cyclohexyl CBM (a and b) -4-(5-methylpyrimidinyl) -t-butoxy CBN (a and b) -4-(5-methylpyrimidinyl) -isopropoxy CBO (a and b) -4-(5-methylpyrimidinyl) —CF3 CBP (a and b) -4-(5-methylpyrimidinyl) —CH2CF3 CBQ (a and b) -4-(5-methylpyrimidinyl) —OCF3 CBR (a and b) -4-(5-methylpyrimidinyl) —Cl CBS (a and b) -4-(5-methylpyrimidinyl) —Br CBT (a and b) -4-(5-methylpyrimidinyl) —I CBU (a and b) -4-(5-methylpyrimidinyl) -n-butyl CBV (a and b) -4-(5-methylpyrimidinyl) -n-propyl CBW (a and b) -4-(5-fluoropyrimidinyl) -t-butyl CBX (a and b) -4-(5-fluoropyrimidinyl) -iso-butyl CBY (a and b) -4-(5-fluoropyrimidinyl) -sec-butyl CBZ (a and b) -4-(5-fluoropyrimidinyl) -cyclohexyl CCA (a and b) -4-(5-fluoropyrimidinyl) -t-butoxy CCB (a and b) -4-(5-fluoropyrimidinyl) -isopropoxy CCC (a and b) -4-(5-fluoropyrimidinyl) —CF3 CCD (a and b) -4-(5-fluoropyrimidinyl) —CH2CF3 CCE (a and b) -4-(5-fluoropyrimidinyl) —OCF3 CCF (a and b) -4-(5-fluoropyrimidinyl) —Cl CCG (a and b) -4-(5-fluoropyrimidinyl) —Br CCH (a and b) -4-(5-fluoropyrimidinyl) —I CCI (a and b) -4-(5-fluoropyrimidinyl) -n-butyl CCJ (a and b) -4-(5-fluoropyrimidinyl) -n-propyl CCK (a and b) -2-(3-chloropyrazinyl) -t-butyl CCL (a and b) -2-(3-chloropyrazinyl) -iso-butyl CCM (a and b) -2-(3-chloropyrazinyl) -sec-butyl CCN (a and b) -2-(3-chloropyrazinyl) -cyclohexyl CCO (a and b) -2-(3-chloropyrazinyl) -t-butoxy CCP (a and b) -2-(3-chloropyrazinyl) -isopropoxy CCQ (a and b) -2-(3-chloropyrazinyl) —CF3 CCR (a and b) -2-(3-chloropyrazinyl) —CH2CF3 CCS (a and b) -2-(3-chloropyrazinyl) —OCF3 CCT (a and b) -2-(3-chloropyrazinyl) —Cl CCU (a and b) -2-(3-chloropyrazinyl) —Br CCV (a and b) -2-(3-chloropyrazinyl) —I CCW (a and b) -2-(3-chloropyrazinyl) -n-butyl CCX (a and b) -2-(3-chloropyrazinyl) -n-propyl CCY (a and b) -2-(3-methylpyrazinyl) -t-butyl CCZ (a and b) -2-(3-methylpyrazinyl) -iso-butyl CDA (a and b) -2-(3-methylpyrazinyl) -sec-butyl CDB (a and b) -2-(3-methylpyrazinyl) -cyclohexyl CDC (a and b) -2-(3-methylpyrazinyl) -t-butoxy CDD (a and b) -2-(3-methylpyrazinyl) -isopropoxy CDE (a and b) -2-(3-methylpyrazinyl) —CF3 CDF (a and b) -2-(3-methylpyrazinyl) —CH2CF3 CDG (a and b) -2-(3-methylpyrazinyl) —OCF3 CDH (a and b) -2-(3-methylpyrazinyl) —Cl CDI (a and b) -2-(3-methylpyrazinyl) —Br CDJ (a and b) -2-(3-methylpyrazinyl) —I CDK (a and b) -2-(3-methylpyrazinyl) -n-butyl CDL (a and b) -2-(3-methylpyrazinyl) -n-propyl CDM (a and b) -2-(3-fluoropyrazinyl) -t-butyl CDN (a and b) -2-(3-fluoropyrazinyl) -iso-butyl CDO (a and b) -2-(3-fluoropyrazinyl) -sec-butyl CDP (a and b) -2-(3-fluoropyrazinyl) -cyclohexyl CDQ (a and b) -2-(3-fluoropyrazinyl) -t-butoxy CDR (a and b) -2-(3-fluoropyrazinyl) -isopropoxy CDS (a and b) -2-(3-fluoropyrazinyl) —CF3 CDT (a and b) -2-(3-fluoropyrazinyl) —CH2CF3 CDU -2-(3-fluoropyrazinyl) —OCF3 CDV (a and b) -2-(3-fluoropyrazinyl) —Cl CDW (a and b) -2-(3-fluoropyrazinyl) —Br CDX (a and b) -2-(3-fluoropyrazinyl) —I CDY (a and b) -2-(3-fluoropyrazinyl) -n-butyl CDZ (a and b) -2-(3-fluoropyrazinyl) -n-propyl CEA (a and b) -3-(4-chloropyridazinyl) -t-butyl CEB (a and b) -3-(4-chloropyridazinyl) -iso-butyl CEC (a and b) -3-(4-chloropyridazinyl) -sec-butyl CED (a and b) -3-(4-chloropyridazinyl) -cyclohexyl CEE (a and b) -3-(4-chloropyridazinyl) -t-butoxy CEF (a and b) -3-(4-chloropyridazinyl) -isopropoxy CEG (a and b) -3-(4-chloropyridazinyl) —CF3 CEH (a and b) -3-(4-chloropyridazinyl) —CH2CF3 CEI (a and b) -3-(4-chloropyridazinyl) —OCF3 CEJ (a and b) -3-(4-chloropyridazinyl) —Cl CEK (a and b) -3-(4-chloropyridazinyl) —Br CEL (a and b) -3-(4-chloropyridazinyl) —I CEM (a and b) -3-(4-chloropyridazinyl) -n-butyl CEN (a and b) -3-(4-chloropyridazinyl) -n-propyl CEO (a and b) -3-(4-methylpyridazinyl) -t-butyl CEP (a and b) -3-(4-methylpyridazinyl) -iso-butyl CEQ (a and b) -3-(4-methylpyridazinyl) -sec-butyl CER (a and b) -3-(4-methylpyridazinyl) -cyclohexyl CES (a and b) -3-(4-methylpyridazinyl) -t-butoxy CET (a and b) -3-(4-methylpyridazinyl) -isopropoxy CEU (a and b) -3-(4-methylpyridazinyl) —CF3 CEV (a and b) -3-(4-methylpyridazinyl) —CH2CF3 CEW (a and b) -3-(4-methylpyridazinyl) —OCF3 CEX (a and b) -3-(4-methylpyridazinyl) —Cl CEY (a and b) -3-(4-methylpytidazinyl) —Br CEZ (a and b) -3-(4-methylpyridazinyl) —I CFA (a and b) -3-(4-methylpyridazinyl) -n-butyl CFB (a and b) -3-(4-methylpyridazinyl) -n-propyl CFC (a and b) -3-(4-fluoropyridazinyl) -t-butyl CFD (a and b) -3-(4-fluoropyridazinyl) -iso-butyl CFE (a and b) -3-(4-fluoropyridazinyl) -sec-butyl CFF (a and b) -3-(4-fluoropyridazinyl) -cyclohexyl CFG (a and b) -3-(4-fluoropyridazinyl) -t-butoxy CFH (a and b) -3-(4-fluoropyridazinyl) -isopropoxy CFI (a and b) -3-(4-fluoropyridazinyl) —CF3 CFJ (a and b) -3-(4-fluoropyridazinyl) —CH2CF3 CFK (a and b) -3-(4-fluoropyridazinyl) —OCF3 CFL (a and b) -3-(4-fluoropyridazinyl) —Cl CFM (a and b) -3-(4-fluoropyridazinyl) —Br CFN (a and b) -3-(4-fluoropyridazinyl) —I CFO (a and b) -3-(4-fluoropyridazinyl) -n-butyl CFP (a and b) -3-(4-fluoropyridazinyl) -n-propyl CFQ (a and b) -5-(4-chlorothiadiazolyl) -t-butyl CFR (a and b) -5-(4-chlorothiadiazolyl) -iso-butyl CFS (a and b) -5-(4-chlorothiadiazolyl) -sec-butyl CFT (a and b) -5-(4-chlorothiadiazolyl) -cyclohexyl CFU (a and b) -5-(4-chlorothiadiazolyl) -t-butoxy CFV (a and b) -5-(4-chlorothiadiazolyl) -isopropoxy CFW (a and b) -5-(4-chlorothiadiazolyl) —CF3 CFX (a and b) -5-(4-chlorothiadiazolyl) —CH2CF3 CFY (a and b) -5-(4-chlorothiadiazolyl) —OCF3 CFZ (a and b) -5-(4-chlorothiadiazolyl) —Cl CGA (a and b) -5-(4-chlorothiadiazolyl) —Br CGB (a and b) -5-(4-chlorothiadiazolyl) —I CGC (a and b) -5-(4-chlorothiadiazolyl) -n-butyl CGD (a and b) -5-(4-chlorothiadiazolyl) -n-propyl CGE (a and b) -5-(4-methylthiadiazolyl) -t-butyl CGF (a and b) -5-(4-methylthiadiazolyl) -iso-butyl CGG (a and b) -5-(4-methylthiadiazolyl) -sec-butyl CGH (a and b) -5-(4-methylthiadiazolyl) -cyclohexyl CGI (a and b) -5-(4-methylthiadiazolyl) -t-butoxy CGJ (a and b) -5-(4-methylthiadiazolyl) -isopropoxy CGK (a and b) -5-(4-methylthiadiazolyl) —CF3 CGL (a and b) -5-(4-methylthiadiazolyl) —CH2CF3 CGM (a and b) -5-(4-methylthiadiazolyl) —OCF3 CGN (a and b) -5-(4-methylthiadiazolyl) —Cl CGO (a and b) -5-(4-methylthiadiazolyl) —Br CGP (a and b) -5-(4-methylthiadiazolyl) —I CGQ (a and b) -5-(4-methylthiadiazolyl) -n-butyl CGR (a and b) -5-(4-methylthiadiazolyl) -n-propyl CGS (a and b) -5-(4-fluorothiadiazolyl) -t-butyl CGT (a and b) -5-(4-fluorothiadiazolyl) -iso-butyl CGU (a and b) -5-(4-fluorothiadiazolyl) -sec-butyl CGV (a and b) -5-(4-fluorothiadiazolyl) -cyclohexyl CGW (a and b) -5-(4-fluorothiadiazolyl) -t-butoxy CGX (a and b) -5-(4-fluorothiadiazolyl) -isopropoxy CGY (a and b) -5-(4-fluorothiadiazolyl) —CF3 CGZ (a and b) -5-(4-fluorothiadiazolyl) —CH2CF3 CHA (a and b) -5-(4-fluorothiadiazolyl) —OCF3 CHB (a and b) -5-(4-fluorothiadiazolyl) —Cl CHC (a and b) -5-(4-fluorothiadiazolyl) —Br CHD (a and b) -5-(4-fluorothiadiazolyl) —I CHE (a and b) -5-(4-fluorothiadiazolyl) -n-butyl CHF (a and b) -5-(4-fluorothiadiazolyl) -n-propyl

wherein “a” means that the carbon atom of the piperazino group to which the methyl group is attached is in the R configuration and “b” means that the carbon of the piperazino group to which the methyl group is attached is in the S configuration

TABLE 6 XI and pharmaceutically acceptable salts thereof, wherein: Compound Ar R9 CHG -2-(3-chloropyridyl) -t-butyl CHH -2-(3-chloropyridyl) -iso-butyl CHI -2-(3-chloropyridyl) -sec-butyl CHJ -2-(3-chloropyridyl) -cyclohexyl CHK -2-(3-chloropyridyl) -t-butoxy CHL -2-(3-chloropyridyl) -isopropoxy CHM -2-(3-chloropyridyl) —CF3 CHN -2-(3-chloropyridyl) —CH2CF3 CHO -2-(3-chloropyridyl) —OCF3 CHP -2-(3-chloropyridyl) —Cl CHQ -2-(3-chloropyridyl) —Br CHR -2-(3-chloropyridyl) —I CHS -2-(3-chloropyridyl) -n-butyl CHT -2-(3-chloropyridyl) -n-propyl CHU -2-(3-fluoropyridyl) -t-butyl CHV -2-(3-fluoropyridyl) -iso-butyl CHW -2-(3-fluoropyridyl) -sec-butyl CHX -2-(3-fluoropyridyl) -cyclohexyl CHY -2-(3-fluoropyridyl) -t-butoxy CHZ -2-(3-fluoropyridyl) -isopropoxy CIA -2-(3-fluoropyridyl) —CF3 CIB -2-(3-fluoropyridyl) —CH2CF3 CIC -2-(3-fluoropyridyl) —OCF3 CID -2-(3-fluoropyridyl) —Cl CIE -2-(3-fluoropyridyl) —Br CIF -2-(3-fluoropyridyl) —I CIG -2-(3-fluoropyridyl) -n-butyl CIH -2-(3-fluoropyridyl) -n-propyl CII -2-(3-methylpyridyl) -t-butyl CIJ -2-(3-methylpyridyl) -iso-butyl CIK -2-(3-methylpyridyl) -sec-butyl CIL -2-(3-methylpyridyl) -cyclohexyl CIM -2-(3-methylpyridyl) -t-butoxy CIN -2-(3-methylpyridyl) -isopropoxy CIO -2-(3-methylpyridyl) —CF3 CIP -2-(3-methylpyridyl) —CH2CF3 CIQ -2-(3-methylpyridyl) —OCF3 CIR -2-(3-methylpyridyl) —Cl CIS -2-(3-methylpyridyl) —Br CIT -2-(3-methylpyridyl) —I CIU -2-(3-methylpyridyl) -n-butyl CIV -2-(3-methylpyridyl) -n-propyl CIW -2-(3-CF3-pyridyl) -t-butyl CIX -2-(3-CF3-pyridyl) -iso-butyl CIY -2-(3-CF3-pyridyl) -sec-butyl CIZ -2-(3-CF3-pyridyl) -cyclohexyl CJA -2-(3-CF3-pyridyl) -t-butoxy CJB -2-(3-CF3-pyridyl) -isopropoxy CJC -2-(3-CF3-pyridyl) —CF3 CJD -2-(3-CF3-pyridyl) —CH2CF3 CJE -2-(3-CF3-pyridyl) —OCF3 CJF -2-(3-CF3-pyridyl) —Cl CJG -2-(3-CF3-pyridyl) —Br CJH -2-(3-CF3-pyridyl) —I CJI -2-(3-CF3-pyridyl) -n-butyl CJJ -2-(3-CF3-pyridyl) -n-propyl CJK -2-(3-CHF2-pyridyl) -t-butyl CJL -2-(3-CHF2-pyridyl) -iso-butyl CJM -2-(3-CHF2-pyridyl) -sec-butyl CJN -2-(3-CHF2-pyridyl) -cyclohexyl CJO -2-(3-CHF2-pyridyl) -t-butoxy CJP -2-(3-CHF2-pyridyl) -isopropoxy CJQ -2-(3-CHF2-pyridyl) —CF3 CJR -2-(3-CHF2-pyridyl) —CH2CF3 CJS -2-(3-CHF2-pyridyl) —OCF3 CJT -2-(3-CHF2-pyridyl) —Cl CJU -2-(3-CHF2-pyridyl) —Br CJV -2-(3-CHF2-pyridyl) —I CJW -2-(3-CHF2-pyridyl) -n-butyl CJX -2-(3-CHF2-pyridyl) -n-propyl CJY -2-(3-hydroxypyridyl) -t-butyl CJZ -2-(3-hydroxypyridyl) -iso-butyl CKA -2-(3-hydroxypyridyl) -sec-butyl CKB -2-(3-hydroxypyridyl) -cyclohexyl CKC -2-(3-hydroxypyridyl) -t-butoxy CKD -2-(3-hydroxypyridyl) -isopropoxy CKE -2-(3-hydroxypyridyl) —CF3 CKF -2-(3-hydroxypyridyl) —CH2CF3 CKG -2-(3-hydroxypyridyl) —OCF3 CKH -2-(3-hydroxypyridyl) —Cl CKI -2-(3-hydroxypyridyl) —Br CKJ -2-(3-hydroxypyridyl) —I CKK -2-(3-hydroxypyridyl) -n-butyl CKL -2-(3-hydroxypyridyl) -n-propyl CKM -2-(3-nitropyridyl) -t-butyl CKN -2-(3-nitropyridyl) -iso-butyl CKO -2-(3-nitropyridyl) -sec-butyl CKP -2-(3-nitropyridyl) -cyclohexyl CKQ -2-(3-nitropyridyl) -t-butoxy CKR -2-(3-nitropyridyl) -isopropoxy CKS -2-(3-nitropyridyl) —CF3 CKT -2-(3-nitropyridyl) —CH2CF3 CKU -2-(3-nitropyridyl) —OCF3 CKV -2-(3-nitropyridyl) —Cl CKW -2-(3-nitropyridyl) —Br CKX -2-(3-nitropyridyl) —I CKY -2-(3-nitropyridyl) -n-butyl CKZ -2-(3-nitropyridyl) -n-propyl CLA -2-(3-cyanopyridyl) -t-butyl CLB -2-(3-cyanopyridyl) -iso-butyl CLC -2-(3-cyanopyridyl) -sec-butyl CLD -2-(3-cyanopyridyl) -cylcohexyl CLE -2-(3-cyanopyridyl) -t-butoxy CLF -2-(3-cyanopyridyl) -isopropoxy CLG -2-(3-cyanopyridyl) —CF3 CLH -2-(3-cyanopyridyl) —CH2CF3 CLI -2-(3-cyanopyridyl) —OCF3 CLJ -2-(3-cyanopyridyl) —Cl CLK -2-(3-cyanopyridyl) —Br CLL -2-(3-cyanopyridyl) —I CLM -2-(3-cyanopyridyl) -n-butyl CLN -2-(3-cyanopyridyl) -n-propyl CLO -2-(3-bromopyridyl) -t-butyl CLP -2-(3-bromopyridyl) -iso-butyl CLQ -2-(3-bromopyridyl) -sec-butyl CLR -2-(3-bromopyridyl) -cyclohexyl CLS -2-(3-bromopyridyl) -t-butoxy CLT -2-(3-bromopyridyl) -isopropoxy CLU -2-(3-bromopyridyl) —CF3 CLV -2-(3-bromopyridyl) —CH2CF3 CLW -2-(3-bromopyridyl) —OCF3 CLX -2-(3-bromopyridyl) —Cl CLY -2-(3-bromopyridyl) —Br CLZ -2-(3-bromopyridyl) —I CMA -2-(3-bromopyridyl) -n-butyl CMB -2-(3-bromopyridyl) -n-propyl CMC -2-(3-iodopyridyl) -t-butyl CMD -2-(3-iodopyridyl) -iso-butyl CME -2-(3-iodopyridyl) -sec-butyl CMF -2-(3-iodopyridyl) -cyclohexyl CMG -2-(3-iodopyridyl) -t-butoxy CMH -2-(3-iodopyridyl) -isopropoxy CMI -2-(3-iodopyridyl) —CF3 CMJ -2-(3-iodopyridyl) —CH2CF3 CMK -2-(3-iodopyridyl) —OCF3 CML -2-(3-iodopyridyl) —Cl CMM -2-(3-iodopyridyl) —Br CMN -2-(3-iodopyridyl) —I CMO -2-(3-iodopyridyl) -n-butyl CMP -2-(3-iodopyridyl) -n-propyl CMQ -4-(5-chloropyrimidinyl) -t-butyl CMR -4-(5-chloropyrimidinyl) -iso-butyl CMS -4-(5-chloropyrimidinyl) -sec-butyl CMT -4-(5-chloropyrimidinyl) -cylcohexyl CMU -4-(5-chloropyrimidinyl) -t-butoxy CMV -4-(5-chloropyrimidinyl) -isopropoxy CMW -4-(5-chloropyrimidinyl) —CF3 CMX -4-(5-chloropyrimidinyl) —CH2CF3 CMY -4-(5-chloropyrimidinyl) —OCF3 CMZ -4-(5-chloropyrimidinyl) —Cl CNA -4-(5-chloropyrimidinyl) —Br CNB -4-(5-chloropyrimidinyl) —I CNC -4-(5-chloropyrimidinyl) -n-butyl CND -4-(5-chloropyrimidinyl) -n-propyl CNE -4-(5-methylpyrimidinyl) -t-butyl CNF -4-(5-methylpyrimidinyl) -iso-butyl CNG -4-(5-methylpyrimidinyl) -sec-butyl CNH -4-(5-methylpyrimidinyl) -cyclohexyl CNI -4-(5-methylpyrimidinyl) -t-butoxy CNJ -4-(5-methylpyrimidinyl) -isopropoxy CNK -4-(5-methylpyrimidinyl) —CF3 CNL -4-(5-methylpyrimidinyl) —CH2CF3 CNM -4-(5-methylpyrimidinyl) —OCF3 CNN -4-(5-methylpyrimidinyl) —Cl CNO -4-(5-methylpyrimidinyl) —Br CNP -4-(5-methylpyrimidinyl) —I CNQ -4-(5-methylpyrimidinyl) -n-butyl CNR -4-(5-methylpyrimidinyl) -n-propyl CNS -4-(5-fluoropyrimidinyl) -t-butyl CNT -4-(5-fluoropyrimidinyl) -iso-butyl CNU -4-(5-fluoropyrimidinyl) -sec-butyl CNV -4-(5-fluoropyrimidinyl) -cyclohexyl CNW -4-(5-fluoropyrimidinyl) -t-butoxy CNX -4-(5-fluoropyrimidinyl) -isopropoxy CNY -4-(5-fluoropyrimidinyl) —CF3 CNZ -4-(5-fluoropyrimidinyl) —CH2CF3 COA -4-(5-fluoropyrimidinyl) —OCF3 COB -4-(5-fluoropyrimidinyl) —Cl COC -4-(5-fluoropyrimidinyl) —Br COD -4-(5-fluoropyrimidinyl) —I COE -4-(5-fluoropyrimidinyl) -n-butyl COF -4-(5-fluoropyrimidinyl) -n-propyl COG -2-(3-chloropyrazinyl) -t-butyl COH -2-(3-chloropyrazinyl) -iso-butyl COI -2-(3-chloropyrazinyl) -sec-butyl COJ -2-(3-chloropyrazinyl) -cyclohexyl COK -2-(3-chloropyrazinyl) -t-butoxy COL -2-(3-chloropyrazinyl) -isopropoxy COM -2-(3-chloropyrazinyl) —CF3 CON -2-(3-chloropyrazinyl) —CH2CF3 COO -2-(3-chloropyrazinyl) —OCF3 COP -2-(3-chloropyrazinyl) —Cl COQ -2-(3-chloropyraiznyl) —Br COR -2-(3-chloropyrazinyl) —I COS -2-(3-chloropyrazinyl) -n-butyl COT -2-(3-chloropyraiznyl) -n-propyl COU -2-(3-methylpyrazinyl) -t-butyl COV -2-(3-methylpyrazinyl) -iso-butyl COW -2-(3-methylpyrazinyl) -sec-butyl COX -2-(3-methylpyrazinyl) -cyclohexyl COY -2-(3-methylpyrazinyl) -t-butoxy COZ -2-(3-methylpyrazinyl) -isopropoxy CPA -2-(3-methylpyrazinyl) —CF3 CPB -2-(3-methylpyrazinyl) —CH2CF3 CPC -2-(3-methylpyrazinyl) —OCF3 CPD -2-(3-methylpyrazinyl) —Cl CPE -2-(3-methylpyrazinyl) —Br CPF -2-(3-methylpyrazinyl) —I CPG -2-(3-methylpyrazinyl) -n-butyl CPH -2-(3-methylpyrazinyl) -n-propyl CPI -2-(3-fluoropyrazinyl) -t-butyl CPJ -2-(3-fluoropyrazinyl) -iso-butyl CPK -2-(3-fluoropyrazinyl) -sec-butyl CPL -2-(3-fluoropyrazinyl) -cyclohexyl CPM -2-(3-fluoropyrazinyl) -t-butoxy CPN -2-(3-fluoropyrazinyl) -isopropoxy CPO -2-(3-fluoropyrazinyl) —CF3 CPP -2-(3-fluoropyrazinyl) —CH2CF3 CPQ -2-(3-fluoropyazinyl) —OCF3 CPR -2-(3-fluoropyrazinyl) —Cl CPS -2-(3-fluoropyrazinyl) —Br CPT -2-(3-fluoropyrazinyl) —I CPU -2-(3-fluoropyrazinyl) -n-butyl CPV -2-(3-fluoropyrazinyl) -n-propyl CPW -3-(4-chloropyridazinyl) -t-butyl CPX -3-(4-chloropyridazinyl) -iso-butyl CPY -3-(4-chloropyridazinyl) -sec-butyl CPZ -3-(4-chloropyridazinyl) -cyclohexyl CQA -3-(4-chloropyridazinyl) -t-butoxy CQB -3-(4-chloropyridazinyl) -isopropoxy CQC -3-(4-chloropyridazinyl) —CF3 CQD -3-(4-chloropyridazinyl) —CH2CF3 CQE -3-(4-chloropyridazinyl) —OCF3 CQF -3-(4-chloropyridazinyl) —Cl CQG -3-(4-chloropyridazinyl) —Br CQH -3-(4-chloropyridazinyl) —I CQI -3-(4-chloropyridazinyl) -n-butyl CQJ -3-(4-chloropyridazinyl) -n-propyl CQK -3-(4-methylpyridazinyl) -t-butyl CQL -3-(4-methylpyridazinyl) -iso-butyl CQM -3-(4-methylpyridazinyl) -sec-butyl CQN -3-(4-methylpyridazinyl) -cyclohexyl CQO -3-(4-methylpyridazinyl) -t-butoxy CQP -3-(4-methylpyridazinyl) -isopropoxy CQQ -3-(4-methylpyridazinyl) —CF3 CQR -3-(4-methylpyridazinyl) —CH2CF3 CQS -3-(4-methylpyridazinyl) —OCF3 CQT -3-(4-methylpyridazinyl) —Cl CQU -3-(4-methylpyridazinyl) —Br CQV -3-(4-methylpyridazinyl) —I CQW -3-(4-methylpyridazinyl) -n-butyl CQX -3-(4-methylpyridazinyl) -n-propyl CQY -3-(4-fluoropyridazinyl) -t-butyl CQZ -3-(4-fluoropyridazinyl) -iso-butyl CRA -3-(4-fluoropyridazinyl) -sec-butyl CRB -3-(4-fluoropyridazinyl) -cyclohexyl CRC -3-(4-fluoropyridazinyl) -t-butoxy CRD -3-(4-fluoropyridazinyl) -isopropoxy CRE -3-(4-fluoropyridazinyl) —CF3 CRF -3-(4-fluoropyridazinyl) —CH2CF3 CRG -3-(4-fluoropyridazinyl) —OCF3 CRH -3-(4-fluoropyridazinyl) —Cl CRI -3-(4-fluoropyridazinyl) —Br CRJ -3-(4-fluoropyridazinyl) —I CRK -3-(4-fluoropyridazinyl) -n-butyl CRL -3-(4-fluoropyridazinyl) -n-propyl CRM -5-(4-chlorothiadiazolyl) -t-butyl CRN -5-(4-chlorothiadiazolyl) -iso-butyl CRO -5-(4-chlorothiadiazolyl) -sec-butyl CRP -5-(4-chlorothiadiazolyl) -cyclohexyl CRQ -5-(4-chlorothiadiazolyl) -t-butoxy CRR -5-(4-chlorothiadiazolyl) -isopropoxy CRS -5-(4-chlorothiadiazolyl) —CF3 CRT -5-(4-chlorothiadiazolyl) —CH2CF3 CRU -5-(4-chlorothiadiazolyl) —OCF3 CRV -5-(4-chlorothiadiazolyl) —Cl CRW -5-(4-chlorothiadiazolyl) —Br CRX -5-(4-chlorothiadiazolyl) —I CRY -5-(4-chlorothiadiazolyl) -n-butyl CRZ -5-(4-chlorothiadiazolyl) -n-propyl CSA -5-(4-methylthiadiazolyl) -t-butyl CSB -5-(4-methylthiadiazolyl) -iso-butyl CSC -5-(4-methylthiadiazolyl) -sec-butyl CSD -5-(4-methylthiadiazolyl) -cyclohexyl CSE -5-(4-methylthiadiazolyl) -t-butoxy CSF -5-(4-methylthiadiazolyl) -isopropoxy CSG -5-(4-methylthiadiazolyl) —CF3 CSH -5-(4-methylthiadiazolyl) —CH2CF3 CSI -5-(4-methylthiadiazolyl) —OCF3 CSJ -5-(4-methylthiadiazolyl) —Cl CSK -5-(4-methylthiadiazolyl) —Br CSL -5-(4-methylthiadiazolyl) —I CSM -5-(4-methylthiadiazolyl) -n-butyl CSN -5-(4-methylthiadiazolyl) -n-propyl CSO -5-(4-fluorothiadiazolyl) -t-butyl CSP -5-(4-fluorothiadiazolyl) -iso-butyl CSQ -5-(4-fluorothiadiazolyl) -sec-butyl CSR -5-(4-fluorothiadiazolyl) -cyclohexyl CSS -5-(4-fluorothiadiazolyl) -t-butoxy CST -5-(4-fluorothiadiazolyl) -isopropoxy CSU -5-(4-fluorothiadiazolyl) —CF3 CSV -5-(4-fluorothiadiazolyl) —CH2CF3 CSW -5-(4-fluorothiadiazolyl) —OCF3 CSX -5-(4-fluorothiadiazolyl) —Cl CSY -5-(4-fluorothiadiazolyl) —Br CSZ -5-(4-fluorothiadiazolyl) —I CTA -5-(4-fluorothiadiazolyl) -n-butyl CTB -5-(4-fluorothiadiazolyl) -n-propyl

TABLE 7 and pharmaceutically acceptable salts thereof, wherein: Compound Ar R9 CTC -2-(3-chloropyridyl) -t-butyl CTD -2-(3-chloropyridyl) -iso-butyl CTE -2-(3-chloropyridyl) -sec-butyl CTF -2-(3-chloropyridyl) -cyclohexyl CTG -2-(3-chloropyridyl) -t-butoxy CTH -2-(3-chloropyridyl) -isopropoxy CTI -2-(3-chloropyridyl) —CF3 CTJ -2-(3-chloropyridyl) —CH2CF3 CTK -2-(3-chloropyridyl) —OCF3 CTL -2-(3-chloropyridyl) —Cl CTM -2-(3-chloropyridyl) —Br CTN -2-(3-chloropyridyl) —I CTO -2-(3-chloropyridyl) -n-butyl CTP -2-(3-chloropyridyl) -n-propyl CTQ -2-(3-fluoropyridyl) -t-butyl CTR -2-(3-fluoropyridyl) -iso-butyl CTS -2-(3-fluoropyridyl) -sec-butyl CTT -2-(3-fluoropyridyl) -cyclohexyl CTU -2-(3-fluoropyridyl) -t-butoxy CTV -2-(3-fluoropyridyl) -isopropoxy CTW -2-(3-fluoropyridyl) —CF3 CTX -2-(3-fluoropyridyl) —CH2CF3 CTY -2-(3-fluoropyridyl) —OCF3 CTZ -2-(3-fluoropyridyl) —Cl CUA -2-(3-fluoropyridyl) —Br CUB -2-(3-fluoropyridyl) —I CUC -2-(3-fluoropyridyl) -n-butyl CUD -2-(3-fluoropyridyl) -n-propyl CUE -2-(3-methylpyridyl) -t-butyl CUF -2-(3-methylpyridyl) -iso-butyl CUG -2-(3-methylpyridyl) -sec-butyl CUH -2-(3-methylpyridyl) -cyclohexyl CUI -2-(3-methylpyridyl) -t-butoxy CUJ -2-(3-methylpyridyl) -isopropoxy CUK -2-(3-methylpyridyl) —CF3 CUL -2-(3-methylpyridyl) —CH2CF3 CUM -2-(3-methylpyridyl) —OCF3 CUN -2-(3-methylpyridyl) —Cl CUO -2-(3-methylpyridyl) —Br CUP -2-(3-methylpyridyl) —I CUQ -2-(3-methylpyridyl) -n-butyl CUR -2-(3-methylpyridyl) -n-propyl CUS -2-(3-CF3-pyridyl) -t-butyl CUT -2-(3-CF3-pyridyl) -iso-butyl CUU -2-(3-CF3-pyridyl) -sec-butyl CUV -2-(3-CF3-pyridyl) -cyclohexyl CUW -2-(3-CF3-pyridyl) -t-butoxy CUX -2-(3-CF3-pyridyl) -isopropoxy CUY -2-(3-CF3-pyridyl) —CF3 CUZ -2-(3-CF3-pyridyl) —CH2CF3 CVA -2-(3-CF3-pyridyl) —OCF3 CVB -2-(3-CF3-pyridyl) —Cl CVC -2-(3-CF3-pyridyl) —Br CVD -2-(3-CF3-pyridyl) —I CVE -2-(3-CF3-pyridyl) -n-butyl CVF -2-(3-CF3-pyridyl) -n-propyl CVG -2-(3-CHF2-pyridyl) -t-butyl CVH -2-(3-CHF2-pyridyl) -iso-butyl CVI -2-(3-CHF2-pyridyl) -sec-butyl CVJ -2-(3-CHF2-pyridyl) -cyclohexyl CVK -2-(3-CHF2-pyridyl) -t-butoxy CVL -2-(3-CHF2-pyridyl) -isopropoxy CVM -2-(3-CHF2-pyridyl) —CF3 CVN -2-(3-CHF2-pyridyl) —CH2CF3 CVO -2-(3-CHF2-pyridyl) —OCF3 CVP -2-(3-CHF2-pyridyl) —Cl CVQ -2-(3-CHF2-pyridyl) —Br CVR -2-(3-CHF2-pyridyl) —I CVS -2-(3-CHF2-pyridyl) -n-butyl CVT -2-(3-CHF2-pyridyl) -n-propyl CVU -2-(3-hydroxypyridyl) -t-butyl CVV -2-(3-hydroxypyridyl) -iso-butyl CVW -2-(3-hydroxypyridyl) -sec-butyl CVX -2-(3-hydroxypyridyl) -cyclohexyl CVY -2-(3-hydroxypyridyl) -t-butoxy CVZ -2-(3-hydroxypyridyl) -isopropoxy CWA -2-(3-hydroxypyridyl) —CF3 CWB -2-(3-hydroxypyridyl) —CH2CF3 CWC -2-(3-hydroxypyridyl) —OCF3 CWD -2-(3-hydroxypyridyl) —Cl CWE -2-(3-hydroxypyridyl) —Br CWF -2-(3-hydroxypyridyl) —I CWG -2-(3-hydroxypyridyl) -n-butyl CWH -2-(3-hydroxypyridyl) -n-propyl CWI -2-(3-nitropyridyl) -t-butyl CWJ -2-(3-nitropyridyl) -iso-butyl CWK -2-(3-nitropyridyl) -sec-butyl CWL -2-(3-nitropyridyl) -cyclohexyl CWM -2-(3-nitropyridyl) -t-butoxy CWN -2-(3-nitropyridyl) -isopropoxy CWO -2-(3-nitropyridyl) —CF3 CWP -2-(3-nitropyridyl) —CH2CF3 CWQ -2-(3-nitropyridyl) —OCF3 CWR -2-(3-nitropyridyl) —Cl CWS -2-(3-nitropyridyl) —Br CWT -2-(3-nitropyridyl) —I CWU -2-(3-nitropyridyl) -n-butyl CWV -2-(3-nitropyridyl) -n-propyl CWW -2-(3-cyanopyridyl) -t-butyl CWX -2-(3-cyanopyridyl) -iso-butyl CWY -2-(3-cyanopyridyl) -sec-butyl CWZ -2-(3-cyanopyridyl) -cyclohexyl CXA -2-(3-cyanopyridyl) -t-butoxy CXB -2-(3-cyanopyridyl) -isopropxy CXC -2-(3-cyanopyridyl) —CF3 CXD -2-(3-cyanopyridyl) —CH2CF3 CXE -2-(3-cyanopyridyl) —OCF3 CXF -2-(3-cyanopyridyl) —Cl CXG -2-(3-cyanopyridyl) —Br CXH -2-(3-cyanopyridyl) —I CXI -2-(3-cyanopyridyl) -n-butyl CXJ -2-(3-cyanopyridyl) -n-propyl CXK -2-(3-bromopyridyl) -t-butyl CXL -2-(3-bromopyridyl) -iso-butyl CXM -2-(3-bromopyridyl) -sec-butyl CXN -2-(3-bromopyridyl) -cyclohexyl CXO -2-(3-bromopyridyl) -t-butoxy CXP -2-(3-bromopyridyl) -isopropoxy CXQ -2-(3-bromopyridyl) —CF3 CXR -2-(3-bromopyridyl) —CH2CF3 CXS -2-(3-bromopyridyl) —OCF3 CXT -2-(3-bromopyridyl) —Cl CXU -2-(3-bromopyridyl) —Br CXV -2-(3-bromopyridyl) —I CXW -2-(3-bromopyridyl) -n-butyl CXX -2-(3-bromopyridyl) -n-propyl CXY -2-(3-iodopyridyl) -t-butyl CXZ -2-(3-iodopyridyl) -iso-butyl CYA -2-(3-iodopyridyl) -sec-butyl CYB -2-(3-iodopyridyl) -cyclohexyl CYC -2-(3-iodopyridyl) -t-butoxy CYD -2-(3-iodopyridyl) -isopropoxy CYE -2-(3-iodopyridyl) —CF3 CYF -2-(3-iodopyridyl) —CH2CF3 CYG -2-(3-iodopyridyl) —OCF3 CYH -2-(3-iodopyridyl) —Cl CYI -2-(3-iodopyridyl) —Br CYJ -2-(3-iodopyridyl) —I CYK -2-(3-iodopyridyl) -n-butyl CYL -2-(3-iodopyridyl) -n-propyl CYM -4-(5-chloropyrimidinyl) -t-butyl CYN -4-(5-chloropyrimidinyl) -iso-butyl CYO -4-(5-chloropyrimidinyl) -sec-butyl CYP -4-(5-chloropyrimidinyl) -cyclohexyl CYQ -4-(5-chloropyrimidinyl) -t-butoxy CYR -4-(5-chloropyrimidinyl) -isopropoxy CYS -4-(5-chloropyrimidinyl) —CF3 CYT -4-(5-chloropyrimidinyl) —CH2CF3 CYU -4-(5-chloropyrimidinyl) —OCF3 CYV -4-(5-chloropyrimidinyl) —Cl CYW -4-(5-chloropyrimidinyl) —Br CYX -4-(5-chloropyrimidinyl) —I CYY -4-(5-chloropyrimidinyl) -n-butyl CYZ -4-(5-chloropyrimidinyl) -n-propyl CZA -4-(5-methylpyrimidinyl) -t-butyl CZB -4-(5-methylpyrimidinyl) -iso-butyl CZC -4-(5-methylpyrimidinyl) -sec-butyl CZD -4-(5-methylpyrimidinyl) -cyclohexyl CZE -4-(5-methylpyrimidinyl) -t-butoxy CZF -4-(5-methylpyrimidinyl) -isopropoxy CZG -4-(5-methylpyrimidinyl) —CF3 CZH -4-(5-methylpyrimidinyl) —CH2CF3 CZI -4-(5-methylpyrimidinyl) —OCF3 CZJ -4-(5-methylpyrimidinyl) —Cl CZK -4-(5-methylpyrimidinyl) —Br CZL -4-(5-methylpyrimidinyl) —I CZM -4-(5-methylpyrimidinyl) -n-butyl CZN -4-(5-methylpyrimidinyl) -n-propyl CZO -4-(5-fluoropyrimidinyl) -t-butyl CZP -4-(5-fluoropyrimidinyl) -iso-butyl CZQ -4-(5-fluoropyrimidinyl) -sec-butyl CZR -4-(5-fluoropyrimidinyl) -cyclohexyl CZS -4-(5-fluoropyrimidinyl) -t-butoxy CZT -4-(5-fluoropyrimidinyl) -isopropoxy CZU -4-(5-fluoropyrimidinyl) —CF3 CZV -4-(5-fluoropyrimidinyl) —CH2CF3 CZW -4-(5-fluoropyrimidinyl) —OCF3 CZX -4-(5-fluoropyrimidinyl) —Cl CZY -4-(5-fluoropyrimidinyl) —Br CZZ -4-(5-fluoropyrimidinyl) —I DAA -4-(5-fluoropyrimidinyl) -n-butyl DAB -4-(5-fluoropyrimidinyl) -n-propyl DAC -2-(3-chloropyrazinyl) -t-butyl DAD -2-(3-chloopyrazinyl) -iso-butyl DAE -2-(3-chloropyrazinyl) -sec-butyl DAF -2-(3-chloropyrazinyl) -cyclohexyl DAG -2-(3-chloropyrazinyl) -t-butoxy DAH -2-(3-chloropyrazinyl) -isopropoxy DAI -2-(3-chloropyrazinyl) —CF3 DAJ -2-(3-chloropyrazinyl) —CH2CF3 DAK -2-(3-chloropyrazinyl) —OCF3 DAL -2-(3-chloropyrazinyl) —Cl DAM -2-(3-chloropyrazinyl) —Br DAN -2-(3-chloropyrazinyl) —I DAO -2-(3-chloropyrazinyl) -n-butyl DAP -2-(3-chloropyrazinyl) -n-propyl DAQ -2-(3-methylpyrazinyl) -t-butyl DAR -2-(3-methylpyrazinyl) -iso-butyl DAS -2-(3-methylpyrazinyl) -sec-butyl DAT -2-(3-methylpyrazinyl) -cyclohexyl DAU -2-(3-methylpyrazinyl) -t-butoxy DAV -2-(3-methylpyrazinyl) -isopropoxy DAW -2-(3-methylpyrazinyl) —CF3 DAX -2-(3-methylpyrazinyl) —CH2CF3 DAY -2-(3-methylpyrazinyl) —OCF3 DAZ -2-(3-methylpyrazinyl) —Cl DBA -2-(3-methylpyrazinyl) —Br DBB -2-(3-methylpyrazinyl) —I DBC -2-(3-methylpyrazinyl) -n-butyl DBD -2-(3-methylpyrazinyl) -n-propyl DBE -2-(3-fluoropyrazinyl) -t-butyl DBF -2-(3-fluoropyrazinyl) -iso-butyl DBG -2-(3-fluoropyrazinyl) -sec-butyl DBH -2-(3-fluoropyrazinyl) -cyclohexyl DBI -2-(3-fluoropyrazinyl) -t-butoxy DBJ -2-(3-fluoropyrazinyl) -isopropoxy DBK -2-(3-fluoropyrazinyl) —CF3 DBL -2-(3-fluoropyrazinyl) —CH2CF3 DBM -2-(3-fluoropyrazinyl) —OCF3 DBN -2-(3-fluoropyrazinyl) —Cl DBO -2-(3-fluoropyrazinyl) —Br DBP -2-(3-fluoropyrazinyl) —I DBQ -2-(3-fluoropyrazinyl) -n-butyl DBR -2-(3-fluoropyrazinyl) -n-propyl DBS -3-(4-chloropyridazinyl) -t-butyl DBT -3-(4-chloropyridazinyl) -iso-butyl DBU -3-(4-chloropyridazinyl) -sec-butyl DBV -3-(4-chloropyridazinyl) -cyclohexyl DBW -3-(4-chloropyridazinyl) -t-butoxy DBX -3-(4-chloropyridazinyl) -isopropoxy DBY -3-(4-chloropyridazinyl) —CF3 DBZ -3-(4-chloropyridazinyl) —CH2CF3 DCA -3-(4-chloropyridazinyl) —OCF3 DCB -3-(4-chloropyridazinyl) —Cl DCC -3-(4-chloropyridazinyl) —Br DCD -3-(4-chloropyridazinyl) —I DCE -3-(4-chloropyridazinyl) -n-butyl DCF -3-(4-chloropyridazinyl) -n-propyl DCG -3-(4-methylpyridazinyl) -t-butyl DCH -3-(4-methylpyridazinyl) -iso-butyl DCI -3-(4-methylpyridazinyl) -sec-butyl DCJ -3-(4-methylpyridazinyl) -cyclohexyl DCK -3-(4-methylpyridazinyl) -t-butoxy DCL -3-(4-methylpyridazinyl) -isopropoxy DCM -3-(4-methylpyridazinyl) —CF3 DCN -3-(4-methylpyridazinyl) —CH2CF3 DCO -3-(4-methylpyridazinyl) —OCF3 DCP -3-(4-methylpyridazinyl) —Cl DCQ -3-(4-methylpyridazinyl) —Br DCR -3-(4-methylpyridazinyl) —I DCS -3-(4-methylpyridazinyl) -n-butyl DCT -3-(4-methylpyridazinyl) -n-propyl DCU -3-(4-fluoropyridazinyl) -t-butyl DCV -3-(4-fluoropyridazinyl) -iso-butyl DCW -3-(4-fluoropyridazinyl) -sec-butyl DCX -3-(4-fluoropyridazinyl) -cyclohexyl DCY -3-(4-fluoropyridazinyl) -t-butoxy DCZ -3-(4-fluoropyridazinyl) -isopropoxy DDA -3-(4-fluoropyridazinyl) —CF3 DDB -3-(4-fluoropyridazinyl) —CH2CF3 DDC -3-(4-fluoropyridazinyl) —OCF3 DDD -3-(4-fluoropyridazinyl) —Cl DDE -3-(4-fluoropyridazinyl) —Br DDF -3-(4-fluoropyridazinyl) —I DDG -3-(4-fluoropyridazinyl) -n-butyl DDH -3-(4-fluoropyridazinyl) -n-propyl DDI -5-(4-chlorothiadiazolyl) -t-butyl DDJ -5-(4-chlorothiadiazolyl) -iso-butyl DDK -5-(4-chlorothiadiazolyl) -sec-butyl DDL -5-(4-chlorothiadiazolyl) -cyclohexyl DDM -5-(4-chlorothiadiazolyl) -t-butoxy DDN -5-(4-chlorothiadiazolyl) -isopropoxy DDO -5-(4-chlorothiadiazolyl) —CF3 DDP -5-(4-chlorothiadiazolyl) —CH2CF3 DDQ -5-(4-chlorothiadiazolyl) —OCF3 DDR -5-(4-chlorothiadiazolyl) —Cl DDS -5-(4-chlorothiadiazolyl) —Br DDT -5-(4-chlorothiadiazolyl) —I DDU -5-(4-chlorothiadiazolyl) -n-butyl DDV -5-(4-chlorothiadiazolyl) -n-propyl DDW -5-(4-methylthiadiazolyl) -t-butyl DDX -5-(4-methylthiadiazolyl) -iso-butyl DDY -5-(4-methylthiadiazolyl) -sec-butyl DDZ -5-(4-methylthiadiazolyl) -cyclohexyl DEA -5-(4-methylthiadiazolyl) -t-butoxy DEB -5-(4-methylthiadiazolyl) -isopropoxy DEC -5-(4-methylthiadiazolyl) —CF3 DED -5-(4-methylthiadiazolyl) —CH2CF3 DEE -5-(4-methylthiadiazolyl) —OCF3 DEF -5-(4-methylthiadiazolyl) —Cl DEG -5-(4-methylthiadiazolyl) —Br DEH -5-(4-methylthiadiazolyl) —I DEI -5-(4-methylthiadiazolyl) -n-butyl DEJ -5-(4-methylthiadiazolyl) -n-propyl DEK -5-(4-fluorothiadiazolyl) -t-butyl DEL -5-(4-fluorothiadiazolyl) -iso-butyl DEM -5-(4-fluorothiadiazolyl) -sec-butyl DEN -5-(4-fluorothiadiazolyl) -cyclohexyl DEO -5-(4-fluorothiadiazolyl) -t-butoxy DEP -5-(4-fluorothiadiazolyl) -isopropoxy DEQ -5-(4-fluorothiadiazolyl) —CF3 DER -5-(4-fluorothiadiazolyl) —CH2CF3 DES -5-(4-fluorothiadiazolyl) —OCF3 DET -5-(4-fluorothiadiazolyl) —Cl DEU -5-(4-fluorothiadiazolyl) —Br DEV -5-(4-fluorothiadiazolyl) —I DEW -5-(4-fluorothiadiazolyl) -n-butyl DEX -5-(4-fluorothiadiazolyl) -n-propyl

TABLE 8 and pharmaceutically acceptable salts thereof, wherein: Compound Ar n DEY -2-(3-chloropyridyl) 2 DEZ -2-(3-fluoropyridyl) 2 DFA -2-(3-methylpyridyl) 2 DFB -2-(3-CF3-pyridyl) 2 DFC -2-(3-CHF2-pyridyl) 2 DFD -2-(3-hydroxypyridyl) 2 DFE -2-(3-nitropyridyl) 2 DFF -2-(3-cyanopyridyl) 2 DFG -2-(3-bromopyridyl) 2 DFH -2-(3-iodopyridyl) 2 DFI -4-(5-chloropyrimidinyl) 2 DFJ -4-(5-methylpyrimidinyl) 2 DFK -4-(5-fluoropyrimidinyl) 2 DFL -2-(3-chloropyrazinyl) 2 DFM -2-(3-methylpyrazinyl) 2 DFN -2-(3-fluoropyrazinyl) 2 DFO -3-(4-chloropyridazinyl) 2 DFP -3-(4-methylpyridazinyl) 2 DFQ -3-(4-fluoropyridazinyl) 2 DFR -5-(4-chlorothiadiazolyl) 2 DFS -5-(4-methylthiadiazolyl) 2 DFT -5-(4-fluorothiadiazolyl) 2 DFU -2-(3-chloropyridyl) 3 DFV -2-(3-fluoropyridyl) 3 DFW -2-(3-methylpyridyl) 3 DFX -2-(3-CF3-pyridyl) 3 DFY -2-(3-CHF2-pyridyl) 3 DFZ -2-(3-hydroxypyridyl) 3 DGA -2-(3-nitropyridyl) 3 DGB -2-(3-cyanopyridyl) 3 DGC -2-(3-bromopyridyl) 3 DGD -2-(3-iodopyridyl) 3 DGE -4-(5-chloropyrimidinyl) 3 DGF -4-(5-methylpyrimidinyl) 3 DGG -4-(5-fluoropyrimidinyl) 3 DGH -2-(3-chloropyrazinyl) 3 DGI -2-(3-methylpyrazinyl) 3 DGJ -2-(3-fluoropyrazinyl) 3 DGK -3-(4-chloropyridazinyl) 3 DGL -3-(4-methylpyridazinyl) 3 DGM -3-(4-fluoropyridazinyl) 3 DGN -5-(4-chlorothiadiazolyl) 3 DGO -5-(4-methylthiadiazolyl) 3 DGP -5-(4-fluorothiadiazolyl) 3

4.17 Definitions

As used herein, the terms used above having following meaning:

“—(C1-C10)alkyl” means a straight chain or branched non-cyclic hydrocarbon having from 1 to 10 carbon atoms. Representative straight chain —(C1-C10)alkyls include -methyl, -ethyl, -n-propyl, -n-butyl, -n-pentyl, -n-hexyl, -n-heptyl, -n-octyl, -n-nonly and -n-decyl. Representative branched —(C1-C10)alkyls include -isopropyl, -sec-butyl, -isobutyl, -tert-butyl, -isopentyl, -neopentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 1-ethylbutyl, 2-ethylbutyl, 3-ethylbutyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,2-dimethylbutyl, 2,3-dimethylbutyl and 3,3-dimethylbutyl. -isopropyl, -sec-butyl, -isobutyl, 1-methylhexyl, 2-methylhexyl, 3-methylhexyl, 4-methylhexyl, 5-methylhexyl, 1,2-dimethylpentyl, 1,3-dimethylpentyl, 1,2-dimethylhexyl, 1,3-dimethylhexyl, 3,3-dimethylhexyl, 1,2-dimethylheptyl, 1,3-dimethylheptyl, and 3,3-dimethylheptyl.

“—(C1-C6)alkyl” means a straight chain or branched non-cyclic hydrocarbon having from 1 to 6 carbon atoms. Representative straight chain —(C1-C6)alkyls include -methyl, -ethyl, -n-propyl, -n-butyl, -n-pentyl and -n-hexyl. Representative branched —(C1-C6)alkyls include -isopropyl, -sec-butyl, -isobutyl, -tert-butyl, -isopentyl, -neopentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 1-ethylbutyl, 2-ethylbutyl, 3-ethylbutyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,2-dimethylbutyl, 2,3-dimethylbutyl and 3,3-dimethylbutyl.

“—(C2-C10)alkenyl” means a straight chain or branched non-cyclic hydrocarbon having from 2 to 10 carbon atoms and including at least one carbon-carbon double bond. Representative straight chain and branched (C2-C10)alkenyls include -vinyl, -allyl, -1-butenyl, -2-butenyl, -isobutylenyl, -1-pentenyl, -2-pentenyl, -3-methyl-1-butenyl, -2-methyl-2-butenyl, -2,3-dimethyl-2-butenyl, -1-hexenyl, -2-hexenyl, -3-hexenyl, -1-heptenyl, -2-heptenyl, -3-heptenyl, -1-octenyl, -2-octenyl, -3-octenyl, -1-nonenyl, -2-nonenyl, -3-nonenyl, -1-decenyl, -2-decenyl, -3-decenyl and the like.

“—(C2-C6)alkenyl” means a straight chain or branched non-cyclic hydrocarbon having from 2 to 6 carbon atoms and including at least one carbon-carbon double bond. Representative straight chain and branched (C2-C6)alkenyls include -vinyl, -allyl, -1-butenyl, -2-butenyl, -isobutylenyl, -1-pentenyl, -2-pentenyl, -3-methyl-1-butenyl, -2-methyl-2-butenyl, -2,3-dimethyl-2-butenyl, -1-hexenyl, 2-hexenyl, 3-hexenyl and the like.

“—(C2-C10)alkynyl” means a straight chain or branched non-cyclic hydrocarbon having from 2 to 10 carbon atoms and including at lease one carbon-carbon triple bond. Representative straight chain and branched —(C2-C10)alkynyls include -acetylenyl, -propynyl, -1-butynyl, -2-butynyl, -1-pentynyl, -2-pentynyl, -3-methyl-1-butyryl, -4-pentynyl, -1-hexynyl, -2-hexynyl, -5-hexynyl, -1-heptynyl, -2-heptynyl, -6-heptynyl, -1-octynyl, -2-octynyl, -7-octynyl, -1-nonynyl, -2-nonynyl, -8-nonynyl, -1-decynyl, -2-decynyl, -9-decynyl and the like.

“—(C2-C6)alkynyl” means a straight chain or branched non-cyclic hydrocarbon having from 2 to 6 carbon atoms and including at lease one carbon-carbon triple bond. Representative straight chain and branched (C2-C6)alkynyls include -acetylenyl, -propynyl, -1-butynyl, -2-butyryl, -1-pentynyl, -2-pentynyl, -3-methyl-1-butynyl, -4-pentynyl, -1-hexynyl, -2-hexynyl, -5-hexynyl and the like.

“—(C3-C10)cycloalkyl” means a saturated cyclic hydrocarbon having from 3 to 10 carbon atoms. Representative (C3-C10)cycloalkyls are -cyclopropyl, -cyclobutyl, -cyclopentyl, -cyclohexyl, -cycloheptyl, -cyclooctyl, -cyclononyl and -cyclodecyl.

“—(C3-C8)cycloalkyl” means a saturated cyclic hydrocarbon having from 3 to 8 carbon atoms. Representative (C3-C8)cycloalkyls include -cyclopropyl, -cyclobutyl, -cyclopentyl, -cyclohexyl, -cycloheptyl and -cyclooctyl.

“—(C8-C14)bicycloalkyl” means a bi-cyclic hydrocarbon ring system having from 8 to 14 carbon atoms and at least one saturated cyclic alkyl ring. Representative —(C8-C14)bicycloalkyls include -indanyl, -1,2,3,4-tetrahydronaphthyl, -5,6,7,8-tetrahydronaphthyl, -perhydronaphthyl and the like.

“—(C8-C14)tricycloalkyl” means a tri-cyclic hydrocarbon ring system having from 8 to 14 carbon atoms and at least one saturated ring. Representative —(C8-C14)tricycloalkyls include -pyrenyl, -1,2,3,4-tetrahydroanthracenyl, -perhydroanthracenyl -aceanthreneyl, -1,2,3,4-tetrahydropenanthrenyl, -5,6,7,8-tetrahydrophenanthrenyl, -perhydrophenanthrenyl and the like.

“—(C5-C10)cycloalkenyl” means a cyclic non-aromatic hydrocarbon having at least one carbon-carbon double bond in the cyclic system and from 5 to 10 carbon atoms. Representative (C5-C10)cycloalkenyls include -cyclopentenyl, -cyclopentadienyl, -cyclohexenyl, -cyclohexadienyl, -cycloheptenyl, -cycloheptadienyl, -cycloheptatrienyl, -cyclooctenyl, -cyclooctadienyl, -cyclooctatrienyl, -cyclooctatetraenyl, -cyclononenyl -cyclononadienyl, -cyclodecenyl, -cyclodecadienyl and the like.

“—(C5-C8)cycloalkenyl” means a cyclic non-aromatic hydrocarbon having at least one carbon-carbon double bond in the cyclic system and from 5 to 8 carbon atoms. Representative (C5-C8)cycloalkenyls include -cyclopentenyl, -cyclopentadienyl, -cyclohexenyl, -cyclohexadienyl, -cycloheptenyl, -cycloheptadienyl, -cycloheptatrienyl, -cyclooctenyl, -cyclooctadienyl, -cyclooctatrienyl, -cyclooctatetraenyl and the like.

“—(C8-C14)bicycloalkenyl” means a bi-cyclic hydrocarbon ring system having at least one carbon-carbon double bond in each ring and from 8 to 14 carbon atoms. Representative —(C8-C14)bicycloalkenyls include -indenyl, -pentalenyl, -naphthalenyl, -azulenyl, -heptalenyl, -1,2,7,8-tetrahydronaphthalenyl and the like.

“—(C8-C14)tricycloalkenyl” means a tri-cyclic hydrocarbon ring system having at least one carbon-carbon double bond in each ring and from 8 to 14 carbon atoms. Representative —(C8-C14)tricycloalkenyls include -anthracenyl, -phenanthrenyl, -phenalenyl, -acenaphthalenyl, as-indacenyl, s-indacenyl and the like.

“—(C3-C7)heterocycle” or “—(C3-C7)heterocyclo” means a 3- to 7-membered monocyclic heterocyclic ring which is either saturated, unsaturated non-aromatic, or aromatic. A 3-membered —(C3-C7)heterocycle can contain up to 3 heteroatoms, and a 4- to 7-membered —(C3-C7)heterocycle can contain up to 4 heteroatoms. Each heteroatom is independently selected from nitrogen, which can be quaternized; oxygen; and sulfur, including sulfoxide and sulfone. The —(C3-C7)heterocycle can be attached via a nitrogen, sulfur, or carbon atom. Representative —(C3-C7)heterocycles include pyridyl, furyl, thiophenyl, pyrrolyl, oxazolyl, imidazolyl, thiazolyl, thiadiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperazinyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyrindinyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl and the like.

“—(C3-C5)heterocycle” or “—(C3-C5)heterocyclo” means a 3- to 5-membered monocyclic heterocyclic ring which is either saturated, unsaturated non-aromatic, or aromatic. A 3-membered —(C3-C7)heterocycle can contain up to 3 heteroatoms, and a 4- to 5-membered —(C3-C5)heterocycle can contain up to 4 heteroatoms. Each heteroatom is independently selected from nitrogen, which can be quaternized; oxygen; and sulfur, including sulfoxide and sulfone. The —(C3-C5)heterocycle can be attached via a nitrogen, sulfur, or carbon atom. Representative —(C3-C5)heterocycles include furyl, thiophenyl, pyrrolyl, oxazolyl, imidazolyl, thiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, triazinyl, pyrrolidinonyl, pyrrolidinyl, hydantoinyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydrothiophenyl and the like.

“—(C7-C10)bicycloheterocycle” or “—(C7-C10)bicycloheterocyclo” means a 7- to 10-membered bicyclic, heterocyclic ring which is either saturated, unsaturated non-aromatic, or aromatic. A —(C7-C10)bicycloheterocycle contains from 1 to 4 heteroatoms independently selected from nitrogen, which can be quaternized; oxygen; and sulfur, including sulfoxide and sulfone. The (C7-C10)bicycloheterocycle can be attached via a nitrogen, sulfur, or carbon atom. Representative —(C7-C10)bicycloheterocycles include -quinolinyl, -isoquinolinyl, -chromonyl, -coumarinyl, -indolyl, -indolizinyl, -benzo[b]furanyl, -benzo[b]thiophenyl, -indazolyl, -purinyl, -4H-quinolizinyl, -isoquinolyl, -quinolyl, -phthalazinyl, -naphthyridinyl, -carbazolyl, -β-carbolinyl and the like.

“—(C14)aryl” means a 14-membered aromatic carbocyclic moiety such as -anthryl or -phenanthryl.

“—(C5-C10)heteroaryl” means an aromatic heterocycle ring of 5 to 10 members, including both mono- and bicyclic ring systems, wherein at least one carbon atom of one or both of the rings is replaced with a heteroatom independently selected from nitrogen, oxygen and sulfur. One or both of the —(C5-C10)heteroaryl's rings contain at least one carbon atom. Representative (C5-C10)heteroaryls include pyridyl, furyl, benzofuranyl, thiophenyl, benzothiophenyl, quinolinyl, pyrrolyl, indolyl, oxazolyl, benzoxazolyl, imidazolyl, benzimidazolyl, thiazolyl, benzothiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, pyridazinyl, pyrimidinyl, pyrazinyl, thiadiazolyl, triazinyl, cinnolinyl, phthalazinyl, and quinazolinyl.

“-Halogen” or “-Halo” means —F, —Cl, —Br or —I.

The phrase “2-(3-chloropyridyl)” means

The phrase “2-(3-fluoropyridyl)” means

The phrase “2-(3-methylpyridyl)” means

The phrase “2-(3-CF3-methylpyridyl)” means

The phrase “2-(3-CHF2-methylpyridyl)” means

The phrase “2-(3-hydroxypyridyl)” means

The phrase “2-(3-nitropyridyl)” means

The phrase “2-(3-cyanopyridyl)” means

The phrase “2-(3-bromopyridyl)” means

The phrase “2-(3-iodopyridyl)” means

The phrase “4-(5-chloropyrimidinyl)” means

The phrase “4-(5-methylpyrimidinyl)” means

The phrase “4-(5-fluoropyrimidinyl)” means

The phrase “2-(3-chloropyrazinyl)” means

The phrase “2-(3-methylpyrazinyl)” means

The phrase “2-(3-fluoropyrazinyl)” means

The phrase “3-(4-chloropyridazinyl)” means

The phrase “3-(4-methylpyridazinyl)” means

The phrase “3-(4-fluoropyridazinyl)” means

The phrase “5-(4-chlorothiadiazolyl)” means

The phrase “5-(4-methylthiadiazolyl)” means

The phrase “5-(4-fluorothiadiazolyl)” means

The phrase “pyridyl group” in connection with the Cyanoiminopiperazine Compounds of formula (I), (Ia), and (Ib) means

wherein R1, R2, and n are defined above for the Cyanoiminopiperazine Compounds of formula (I), (Ia), and (Ib).

The phrase “pyridyl group” in connection with the Cyanoiminopiperazine Compounds of formula (Ic) means

wherein R11, R12, and q are defined above for the Cyanoiminopiperazine Compounds of formula (Ic).

The phrase “pyrazinyl group” in connection with the Cyanoiminopiperazine Compounds of formula (II) means

wherein R1, R2, and n are defined above for the Cyanoiminopiperazine Compounds of formula (II).

The phrase “pyrazinyl group” in connection with the Cyanoiminopiperazine Compounds of formula (IIa) means

wherein R1, R2, and q are defined above for the Cyanoiminopiperazine Compounds of formula (IIa).

The phrase “pyrimidinyl group” in connection with the Cyanoiminopiperazine Compounds of formula (III), (IIIa), and (Mb) means

wherein R1, R2, and n are defined above for the Cyanoiminopiperazine Compounds of formula (Ma), and (Mb).

The phrase “pyrimidinyl group” in connection with the Cyanoiminopiperazine Compounds of formula (IIIc) means

wherein R11, R12, and q are defined above for the Cyanoiminopiperazine Compounds of formula (IIIc).

The phrase “pyridizanyl group” in connection with the Cyanoiminopiperazine Compounds of formula (IV) means

wherein R1, R2, and n are defined above for the Cyanoiminopiperazine Compounds of formula (IV).

The phrase “pyridizanyl group” in connection with the Cyanoiminopiperazine Compounds of formula (IVa) means

wherein R11, R12, and q are defined above for the Cyanoiminopiperazine Compounds of formula (IVa).

The phrase “thiadiazolyl group” means

wherein R1 is defined above for the Cyanoiminopiperazine Compounds of formula (V).

The phrase “benzothiazolyl group” means

wherein R8 and s are defined above for the Cyanoiminopiperazine Compounds of formulas (VI) and (VII).

The phrase “benzoimidazolyl group” means

wherein R8 and s are defined above for the Cyanoiminopiperazine Compounds of formulas (VI) and (VII).

The phrase “benzooxazolyl group” means

wherein R8 and s are defined above for the Cyanoiminopiperazine Compounds of formulas (VI) and (VII).

The phrase “(R9)-phenyl group” means

The phrase “phenethyl group” means an ethylene group attached to a terminal Ar2 group, wherein one or each of two hydrogens of the ethylene group can optionally be substituted with an R4 group. A phenethyl group is depicted below

wherein R4, Ar2, and t are defined above for the Cyanoiminopiperazine Compounds of formula (VI).

The phrase “phenpropyl group” an n-propylene group attached to a terminal Ar2 group, wherein one or each of two hydrogens of the n-propylene group can optionally be substituted with an R4 group. A phenpropyl group is depicted below

wherein R4, Ar2, and t are defined above for the Cyanoiminopiperazine Compounds of formula (VII).

The term “animal,” includes, but is not limited to, a cow, monkey, horse, sheep, pig, chicken, turkey, quail, cat, dog, mouse, rat, rabbit, guinea pig and human.

The phrase “pharmaceutically acceptable salt,” as used herein, is a salt formed from an acid and a basic nitrogen group of one of the Cyanoiminopiperazine Compounds. Illustrative salts include, but are not limited, to sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, acid phosphate, isonicotinate, lactate, salicylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, and pamoate (i.e., 1,1′-methylene-bis-(2-hydroxy-3-naphthoate)) salts. The term “pharmaceutically acceptable salt” also refers to a salt prepared from a Cyanoiminopiperazine Compound having an acidic functional group, such as a carboxylic acid functional group, and a pharmaceutically acceptable inorganic or organic base. Suitable bases include, but are not limited to, hydroxides of alkali metals such as sodium, potassium, and lithium; hydroxides of alkaline earth metal such as calcium and magnesium; hydroxides of other metals, such as aluminum and zinc; ammonia, and organic amines, such as unsubstituted or hydroxy-substituted mono-, di-, or trialkylamines; dicyclohexylamine; tributyl amine; pyridine; N-methyl, N-ethylamine; diethylamine; triethylamine; mono-, bis-, or tris-(2-hydroxy-lower alkyl amines), such as mono-, bis-, or tris-(2-hydroxyethyl)amine, 2-hydroxy-tert-butylamine, or tris-(hydroxymethyl)methylamine, N,N,-di-lower alkyl-N-(hydroxy lower alkyl)-amines, such as N,N,-dimethyl-N-(2-hydroxyethyl)amine, or tri-(2-hydroxyethyl) amine; N-methyl-D-glucamine; and amino acids such as arginine, lysine, and the like.

When a first group is “substituted with one or more” second groups, each of one or more of the first group's hydrogen atoms is replaced with a second group. In one embodiment, each carbon atom of a first group is independently substituted with one or two second groups. In another embodiment, each carbon atom of a first group is independently substituted with only one second group.

The term “UI” means urinary incontinence.

The term “IBD” means inflammatory-bowel disease.

The term “IBS” means irritable-bowel syndrome.

The term “DIEA” means diisopropylethylamine.

The term “DMSO” means dimethyl sulfoxide.

The term “DMF” means dimethyl formamide.

The term “DCM” means dichloromethane.

The phrase “treatment of” and “treating” includes the amelioration or cessation of a Condition or a symptom thereof.

The phrase “prevention of” and “preventing” includes the avoidance of the onset of a Condition or a symptom thereof.

4.18 Methods for Making the Cyanoiminopiperazine Compounds

The Cyanoiminopiperazine Compounds can be made using conventional organic synthesis or by the following illustrative methods shown in the schemes below. The Cyanoiminopiperazine Compounds wherein A is NR4 can be obtained by the following illustrative methods shown below in Scheme A:

wherein R3, R4, R6, and m are defined above for the Cyanoiminopiperazine Compounds and Ar is:

wherein R1, R2 and n are defined above.

A compound of formula A is reacted with a compound of formula B in an aprotic organic solvent such as diethyl ether, di-n-propyl ether, tetrahydrofuran, methylene chloride, or toluene at a temperature ranging from about room temperature to about the reflux temperature of the solvent for a period of about 0.5 h to about 24 h to provide a Cyanoiminopiperazine Compound wherein A is NR4. In one embodiment, the aprotic organic solvent is di-n-propyl ether. In another embodiment, a reaction mixture of di-n-propyl ether, a compound of formula A and a compound of formula B is heated at a temperature of about 70° to about 80° C. In another embodiment, the reaction mixture of di-n-propyl ether, a compound of formula A and a compound of formula B is heated at a temperature of about at 75° C. for about 12 h.

Compounds of formula A can be obtained as shown below in Scheme B:

An amine of formula NHR6R4, wherein R4 and R6 are defined above, is reacted with diphenylcyanocabonimidate (commercially available from Sigma-Aldrich, St. Louis, Mo. (www.sigma-aldrich.com)) in an aprotic solvent such as diethyl ether, di-n-propyl ether, tetrahydrofuran, methylene chloride, or toluene to provide the compound of formula A. In one embodiment, the aprotic solvent is DCM and the reaction mixture of NHR6R4 and diphenylcyanocabonimidate is allowed to react at about room temperature. In another embodiment, the aprotic solvent is toluene and the reaction mixture of NHR6R4 and diphenylcyanocabonimidate is allowed to react at about 110° C. The NHR6R4 and diphenylcyanocabonimidate is typically allowed to react for a period of about 0.5 h to about 24 h. Typically the compound of formula A is used without further purification.

Compounds of formula B can be obtained as shown below in Scheme C:

wherein R1, R2, R3, m, and n are defined above and X is a halogen. In one embodiment, X is bromide, chloride or iodide.

A compound of formula C1-C5 is reacted with a compound of formula D in an aprotic solvent in the presence of DIEA or triethylamine, optionally with heating, to provide compound B. Compound B is isolated from the reaction mixture and purified. In one embodiment, the reaction is purified using column chromatography or recrystallization.

Compounds of formula C1-C5 and D are commercially available or can be prepared by methods well known to those skilled in the art. The compound of formula D wherein m is 0 is commercially available from Sigma-Aldrich, St. Louis, Mo. (www.sigma-aldrich.com).

The Cyanoiminopiperazine Compounds wherein A is —O— can be obtained as shown below in Scheme D.

wherein R3, R6, m, and Ar are defined above for the Cyanoiminopiperazine Compounds.

A compound of formula B is reacted with a compound of formula E to provide the Cyanoiminopiperazine Compounds wherein A is —O—. Representative procedures for reacting a compound of formula B with a compound of formula E are provided in T. D. Aicher et al., J. Med. Chem. 43(2):236-49 (2000) and German Patent No. 3336409.

The compound of formula E can be obtained as shown below in Scheme E.

wherein R6 is defined above.

The compound of formula E can be obtained by reacting a compound of formula F with cyanamide. Representative procedures for obtaining a compound of formula E from a compound of formula F are provided in R. L. Webb et al., J. Heterocycl. Chem. 19(5):1205-1206 (1982) and U.S. Pat. No. 4,285,878 to Labaw et al.

The compound of formula F can be obtained as shown below in Scheme F.

wherein R6 is defined above.

The compound of formula F can be obtained by reacting a compound of formula G with PCl5. A representative procedure for obtaining a compound of formula F from a compound of formula G is provided in R. L. Webb et al., J. Heterocycl. Chem. 19(5):1205-1206 (1982).

The compound of formula G can be obtained by reacting a compound of formula R6—OH with COCl2, triphosgene, or CO and a Pd catalyst as described in U.S. Pat. No. 6,175,017 to H. Buyschi et al.; A. Gode et al., Chemistry-A European Journal 6(19):3522-30 (2000); or H. Yasuda et al., Organometallics, 21(6):1216-20 (2002), respectively. Compounds of formula R6—OH are commercially available or can be prepared by methods well known to those skilled in the art.

The Cyanoiminopiperazine Compounds wherein A is —S— can be obtained as shown below in Scheme G.

wherein R6, R3, m, and Ar are defined above and R10 is —SCH3 or —O—C6H5.

A compound of formula B is reacted with a compound of formula H to provide the Cyanoiminopiperazine Compounds wherein A is —S—. Representative procedures for reacting a compound of formula B with a compound of formula H are provided in T. D. Aicher et al., J. Med. Chem. 43(2):236-49 (2000) and Ger. Patent No. 3336409.

The compound of formula H can be obtained as shown below in Scheme H.

wherein R6 and R10 are defined above.

A thiol of formula R6SH is reacted with a compound of formula J to provide the compound of formula H. Representative procedures for obtaining compounds of formula J and for obtaining the compound of formula H by reacting a thiol with a compound of formula J are provided in R. L. Webb et al., J. Heterocycl. Chem., 24(1):275-78 (1987); I. Reid et al., Liebigs Ann. Chem. 6:599-601 (1988); and L. S. Wittenbrook et al., J. Heterocycl. Chem. 12(1):37-42 (1975). Compounds of formula R6—SH are commercially available or can be prepared by methods well known to those skilled in the art.

The Cyanoiminopiperazine Compounds of formula VI and VII can be obtained as described below in Scheme I.

An amine of formula I or an amine of formula J is reacted with diphenylcyanocabonimidate (commercially available from Sigma-Aldrich, St. Louis, Mo. (www.sigma-aldrich.com)) in an aprotic solvent such as diethyl ether, di-n-propyl ether, tetrahydrofuran, methylene chloride, or toluene to provide the compound of formula K or a compound of formula L, respectively. In one embodiment, the aprotic solvent is DCM and the reaction mixture of the amine of formula I or the amine of formula J and diphenylcyanocabonimidate is allowed to react at about room temperature. In another embodiment, the aprotic solvent is toluene and the reaction mixture of the amine of formula I or the amine of formula J and diphenylcyanocabonimidate is allowed to react at about 110° C. The amine of formula I or the amine of formula J and diphenylcyanocabonimidate is typically allowed to react for a period of about 0.5 h to about 24 h. Typically the compound of formula K or the compound of formula L is used without further purification.

The compound of formula K or the compound of formula L is then reacted with a compound of formula B, obtained as described above in Scheme B, according to the procedure described above in Scheme A to provide the Cyanoiminopiperazine Compound of formula (VI) or (VII), respectively.

4.19 Therapeutic Uses of the Cyanoiminopiperazine Compounds

In accordance with the invention, the Cyanoiminopiperazine Compounds are administered to an animal in need of treatment or prevention of pain, UI, an ulcer, IBD, IBS, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression.

In one embodiment, an effective amount of a Cyanoiminopiperazine Compound can be used to treat or prevent any condition treatable or preventable by inhibiting VR1. Examples of conditions that are treatable or preventable by inhibiting VR1 include, but are not limited to, pain, UI, an ulcer, IBD, and IBS.

In another embodiment, an effective amount of a Cyanoiminopiperazine Compound can be used to treat or prevent any condition treatable or preventable by inhibiting mGluR5. Examples of conditions that are treatable or preventable by inhibiting mGluR5 include, but are not limited to, pain, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, a pruritic condition, and psychosis.

In another embodiment, an effective amount of a Cyanoiminopiperazine Compound can be used to treat or prevent any condition treatable or preventable by inhibiting mGluR1. Examples of conditions that are treatable or preventable by inhibiting mGluR1 include, but are not limited to, pain, UI, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, and depression.

The Cyanoiminopiperazine Compounds can be used to treat or prevent acute or chronic pain. Examples of pain treatable or preventable using the Cyanoiminopiperazine Compounds include, but are not limited to, cancer pain, central pain, labor pain, myocardial infarction pain, pancreatic pain, colic pain, post-operative pain, headache pain, muscle pain, pain associated with intensive care, arthritic pain, neuropathic pain, and pain associated with a periodontal disease, including gingivitis and periodontitis.

The Cyanoiminopiperazine Compounds can also be used for inhibiting, preventing, or treating pain associated with inflammation or with an inflammatory disease in an animal. The pain to be inhibited, treated or prevented may be associated with inflammation associated with an inflammatory disease, which can arise where there is an inflammation of the body tissue, and which can be a local inflammatory response and/or a systemic inflammation. For example, the Cyanoiminopiperazine Compounds can be used to inhibit, treat, or prevent pain associated with inflammatory diseases including, but not limited to: organ transplant rejection; reoxygenation injury resulting from organ transplantation (see Grupp et al., J. Mol. Cell. Cardiol. 31:297-303 (1999)) including, but not limited to, transplantation of the heart, lung, liver, or kidney; chronic inflammatory diseases of the joints, including arthritis, rheumatoid arthritis, osteoarthritis and bone diseases associated with increased bone resorption; inflammatory lung diseases, such as asthma, adult respiratory distress syndrome, and chronic obstructive airway disease; inflammatory diseases of the eye, including corneal dystrophy, trachoma, onchocerciasis, uveitis, sympathetic ophthalmitis and endophthalmitis; chronic inflammatory diseases of the gum, including gingivitis and periodontitis; tuberculosis; leprosy; inflammatory diseases of the kidney, including uremic complications, glomerulonephritis and nephrosis; inflammatory diseases of the skin, including sclerodermatitis, psoriasis and eczema; inflammatory diseases of the central nervous system, including chronic demyelinating diseases of the nervous system, multiple sclerosis, AIDS-related neurodegeneration and Alzheimer s disease, infectious meningitis, encephalomyelitis, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis and viral or autoimmune encephalitis; autoimmune diseases, including Type I and Type II diabetes mellitus; diabetic complications, including, but not limited to, diabetic cataract, glaucoma, retinopathy, nephropathy (such as microaluminuria and progressive diabetic nephropathy), polyneuropathy, mononeuropathies, autonomic neuropathy, gangrene of the feet, atherosclerotic coronary arterial disease, peripheral arterial disease, nonketotic hyperglycemic-hyperosmolar coma, foot ulcers, joint problems, and a skin or mucous membrane complication (such as an infection, a shin spot, a candidal infection or necrobiosis lipoidica diabeticorum); immune-complex vasculitis, and systemic lupus erythematosus (SLE); inflammatory diseases of the heart, such as cardiomyopathy, ischemic heart disease hypercholesterolemia, and atherosclerosis; as well as various other diseases that can have significant inflammatory components, including preeclampsia, chronic liver failure, brain and spinal cord trauma, and cancer. The Cyanoiminopiperazine Compounds can also be used for inhibiting, treating, or preventing pain associated with inflammatory disease that can, for example, be a systemic inflammation of the body, exemplified by gram-positive or gram negative shock, hemorrhagic or anaphylactic shock, or shock induced by cancer chemotherapy in response to pro-inflammatory cytokines, e.g., shock associated with pro-inflammatory cytokines. Such shock can be induced, e.g., by a chemotherapeutic agent that is adminstered as a treatment for cancer.

The Cyanoiminopiperazine Compounds can be used to treat or prevent UI. Examples of UI treatable or preventable using the Cyanoiminopiperazine Compounds include, but are not limited to, urge incontinence, stress incontinence, overflow incontinence, neurogenic incontinence, and total incontinence.

The Cyanoiminopiperazine Compounds can be used to treat or prevent an ulcer. Examples of ulcers treatable or preventable using the Cyanoiminopiperazine Compounds include, but are not limited to, a duodenal ulcer, a gastric ulcer, a marginal ulcer, an esophageal ulcer, or a stress ulcer.

The Cyanoiminopiperazine Compounds can be used to treat or prevent IBD, including Crohn's disease and ulcerative colitis.

The Cyanoiminopiperazine Compounds can be used to treat or prevent IBS. Examples of IBS treatable or preventable using the Cyanoiminopiperazine Compounds include, but are not limited to, spastic-colon-type IBS and constipation-predominant IBS.

The Cyanoiminopiperazine Compounds can be used to treat or prevent an addictive disorder, including but not limited to, an eating disorder, an impulse-control disorder, an alcohol-related disorder, a nicotine-related disorder, an amphetamine-related disorder, a cannabis-related disorder, a cocaine-related disorder, an hallucinogen-related disorder, an inhalant-related disorders, and an opioid-related disorder, all of which are further sub-classified as listed below.

Eating disorders include, but are not limited to, Bulimia Nervosa, Nonpurging Type; Bulimia Nervosa, Purging Type; Anorexia; and Eating Disorder not otherwise specified (NOS).

Impulse control disorders include, but are not limited to, Intermittent Explosive Disorder, Kleptomania, Pyromania, Pathological Gambling, Trichotillomania, and Impulse Control Disorder not otherwise specified (NOS).

Alcohol-related disorders include, but are not limited to, Alcohol-Induced Psychotic Disorder with delusions, Alcohol Abuse, Alcohol Intoxication, Alcohol Withdrawal, Alcohol Intoxication Delirium, Alcohol Withdrawal Delirium, Alcohol-Induced Persisting Dementia, Alcohol-Induced Persisting Amnestic Disorder, Alcohol Dependence, Alcohol-Induced Psychotic Disorder with hallucinations, Alcohol-Induced Mood Disorder, . Alcohol-Induced Anxiety Disorder, Alcohol-Induced Sexual Dysfunction, Alcohol-Induced Sleep Disorder, Alcohol-Related Disorder not otherwise specified (NOS), Alcohol Intoxication, and Alcohol Withdrawal.

Nicotine-related disorders include, but are not limited to, Nicotine Dependence, Nicotine Withdrawal, and Nicotine-Related Disorder not otherwise specified (NOS).

Amphetamine-related disorders include, but are not limited to, Amphetamine Dependence, Amphetamine Abuse, Amphetamine Intoxication, Amphetamine Withdrawal, Amphetamine Intoxication Delirium, Amphetamine-Induced Psychotic Disorder with delusions, Amphetamine-Induced Psychotic Disorders with hallucinations, Amphetamine-Induced Mood Disorder, Amphetamine-Induced Anxiety Disorder, Amphetamine-Induced Sexual Dysfunction, Amphetamine-Induced Sleep Disorder, Amphetamine Related Disorder not otherwise specified (NOS), Amphetamine Intoxication, and Amphetamine Withdrawal.

Cannabis-related disorders include, but are not limited to, Cannabis Dependence, Cannabis Abuse, Cannabis Intoxication, Cannabis Intoxication Delirium, Cannabis-Induced Psychotic Disorder with delusions, Cannabis-Induced Psychotic Disorder with hallucinations, Cannabis-Induced Anxiety Disorder, Cannabis Related Disorder not otherwise specified (NOS), and Cannabis Intoxication.

Cocaine-related disorders include, but are not limited to, Cocaine Dependence, Cocaine Abuse, Cocaine Intoxication, Cocaine Withdrawal, Cocaine Intoxication Delirium, Cocaine-Induced Psychotic Disorder with delusions, Cocaine-Induced Psychotic Disorders with hallucinations, Cocaine-Induced Mood Disorder, Cocaine-Induced Anxiety Disorder, Cocaine-Induced Sexual Dysfunction, Cocaine-Induced Sleep Disorder, Cocaine Related Disorder not otherwise specified (NOS), Cocaine Intoxication, and Cocaine Withdrawal.

Hallucinogen-related disorders include, but are not limited to, Hallucinogen Dependence, Hallucinogen Abuse, Hallucinogen Intoxication, Hallucinogen Withdrawal, Hallucinogen Intoxication Delirium, Hallucinogen-Induced Psychotic Disorder with delusions, Hallucinogen-Induced Psychotic Disorders with hallucinations, Hallucinogen-Induced Mood Disorder, Hallucinogen-Induced Anxiety Disorder, Hallucinogen-Induced Sexual Dysfunction, Hallucinogen-Induced Sleep Disorder, Hallucinogen Related Disorder not otherwise specified (NOS), Hallucinogen Intoxication, and Hallucinogen Persisting Perception Disorder (Flashbacks).

Inhalant-related disorders include, but are not limited to, Inhalant Dependence, Inhalant Abuse, Inhalant Intoxication, Inhalant Intoxication Delirium, Inhalant-Induced Psychotic Disorder with delusions, Inhalant-Induced Psychotic Disorder with hallucinations, Inhalant-Induced Anxiety Disorder, Inhalant Related Disorder not otherwise specified (NOS), and Inhalant Intoxication.

Opioid-related disorders include, but are not limited to, Opioid Dependence, Opioid Abuse, Opioid Intoxication, Opioid Intoxication Delirium, Opioid-Induced Psychotic Disorder with delusions, Opioid-Induced Psychotic Disorder with hallucinations, Opioid-Induced Anxiety Disorder, Opioid Related Disorder not otherwise specified (NOS), Opioid Intoxication, and Opioid Withdrawal.

The Cyanoiminopiperazine Compounds can be used to treat or prevent Parkinson's disease and parkinsonism and the symptoms associated with Parkinson's disease and parkinsonism, including but not limited to, bradykinesia, muscular rigidity, resting tremor, and impairment of postural balance.

The Cyanoiminopiperazine Compounds can be used to treat or prevent generalized anxiety or severe anxiety and the symptoms associated with anxiety, including but not limited to, restlessness; tension; tachycardia; dyspnea; depression, including chronic “neurotic” depression; panic disorder; agoraphobia and other specific phobias; eating disorders; and personality disorders.

The Cyanoiminopiperazine Compounds can be used to treat or prevent epilepsy, including but not limited to, partial epilepsy, generalized epilepsy, and the symptoms associated with epilepsy, including but not limited to, simple partial seizures, jacksonian seizures, complex partial (psychomotor) seizures, convulsive seizures (grand mal or tonic-clonic seizures), petit mal (absence) seizures, and status epilepticus.

The Cyanoiminopiperazine Compounds can be used to treat or prevent strokes, including but not limited to, ischemic strokes and hemorrhagic strokes.

The Cyanoiminopiperazine Compounds can be used to treat or prevent a seizure, including but not limited to, infantile spasms, febrile seizures, and epileptic seizures.

The Cyanoiminopiperazine Compounds can be used to treat or prevent a pruritic condition, including but not limited to, pruritus caused by dry skin, scabies, dermatitis, herpetiformis, atopic dermatitis, pruritus vulvae et ani, miliaria, insect bites, pediculosis, contact dermatitis, drug reactions, urticaria, urticarial eruptions of pregnancy, psoriasis, lichen planus, lichen simplex chronicus, exfoliative dermatitis, folliculitis, bullous pemphigoid, or fiberglass dermatitis.

The Cyanoiminopiperazine Compounds can be used to treat or prevent psychosis, including but not limited to, schizophrenia, including paranoid schizophrenia, hebephrenic or disorganized schizophrenia, catatonic schizophrenia, undifferentiated schizophrenia, negative or deficit subtype schizophrenia, and non-deficit schizophrenia; a delusional disorder, including erotomanic subtype delusional disorder, grandiose subtype delusional disorder, jealous subtype delusional disorder, persecutory subtype delusional disorder, and somatic subtype delusional disorder; and brief psychosis.

The Cyanoiminopiperazine Compounds can be used to treat or prevent a cognitive disorder, including but not limited to, delirium and dementia such as multi-infarct dementia, dementia pugilistica, dimentia caused by AIDS, and dementia caused by Alzheimer's disease.

The Cyanoiminopiperazine Compounds can be used to treat or prevent a memory deficiency, including but not limited to, dissociative amnesia and dissociative fugue.

The Cyanoiminopiperazine Compounds can be used to treat or prevent restricted brain function, including but not limited to, that caused by surgery or an organ transplant, restricted blood supply to the brain, a spinal cord injury, a head injury, hypoxia, cardiac arrest, or hypoglycemia.

The Cyanoiminopiperazine Compounds can be used to treat or prevent Huntington's chorea.

The Cyanoiminopiperazine Compounds can be used to treat or prevent ALS.

The Cyanoiminopiperazine Compounds can be used to treat or prevent retinopathy, including but not limited to, arteriosclerotic retinopathy, diabetic arteriosclerotic retinopathy, hypertensive retinopathy, non-proliferative retinopathy, and proliferative retinopathy.

The Cyanoiminopiperazine Compounds can be used to treat or prevent a muscle spasm.

The Cyanoiminopiperazine Compounds can be used to treat or prevent a migraine.

The Cyanoiminopiperazine Compounds can be used to inhibit, treat or prevent vomiting, including but not limited to, nausea vomiting, thy vomiting (retching), and regurgitation.

The Cyanoiminopiperazine Compounds can be used to treat or prevent dyskinesia, including but not limited to, tardive dyskinesia and biliary dyskinesia.

The Cyanoiminopiperazine Compounds can be used to treat or prevent depression, including but not limited to, major depression and bipolar disorder.

Applicants believe that the Cyanoiminopiperazine Compounds are antagonists for VR1.

The invention also relates to methods for inhibiting VR1 function in a cell, comprising contacting a cell capable of expressing VR1 with an effective amount of a Cyanoiminopiperazine Compound. This method can be used in vitro, for example, as an assay to select cells that express VR1 and, accordingly, are useful as part of an assay to select compounds useful for treating or preventing pain, UI, an ulcer, IBD, or IBS. The method is also useful for inhibiting VR1 function in a cell in vivo, in an animal, a human in one embodiment, by contacting a cell, in an animal, with an effective amount of a Cyanoiminopiperazine Compound. In one embodiment, the method is useful for treating or preventing pain in an animal. In another embodiment, the method is useful for treating or preventing UI in an animal. In another embodiment, the method is useful for treating or preventing an ulcer in an animal. In another embodiment, the method is useful for treating or preventing IBD in an animal. In another embodiment, the method is useful for treating or preventing IBS in an animal.

Examples of tissue comprising cells capable of expressing VR1 include, but are not limited to, neuronal, brain, kidney, urothelium, and bladder tissue. Methods for assaying cells that express VR1 are well known in the art.

Applicants believe that the Cyanoiminopiperazine Compounds are antagonists for mGluR5.

The invention also relates to methods for inhibiting mGluR5 function in a cell, comprising contacting a cell capable of expressing mGluR5 with an amount of a Cyanoiminopiperazine Compound effective to inhibit mGluR5 function in the cell. This method can be used in vitro, for example, as an assay to select cells that express mGluR5 and, accordingly, are useful as part of an assay to select compounds useful for treating or preventing pain, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, a pruritic condition, or psychosis. The method is also useful for inhibiting mGluR5 function in a cell in vivo, in an animal, a human in one embodiment, by contacting a cell, in an animal, with an amount of a Cyanoiminopiperazine Compound effective to inhibit mGluR5 function in the cell. In one embodiment, the method is useful for treating or preventing pain in an animal in need thereof. In another embodiment, the method is useful for treating or preventing an addictive disorder in an animal in need thereof. In another embodiment, the method is useful for treating or preventing Parkinson's disease in an animal in need thereof. In another embodiment, the method is useful for treating or preventing parkinsonism in an animal in need thereof. In another embodiment, the method is useful for treating or preventing anxiety in an animal in need thereof. In another embodiment, the method is useful for treating or preventing a pruritic condition in an animal in need thereof. In another embodiment, the method is useful for treating or preventing psychosis in an animal in need thereof.

Examples of cells capable of expressing mGluR5 are neuronal and glial cells of the central nervous system, particularly the brain, especially in the nucleus accumbens. Methods for assaying cells that express mGluR5 are well known in the art.

Applicants believe that the Cyanoiminopiperazine Compounds are antagonists for mGluR1.

The invention also relates to methods for inhibiting mGluR1 function in a cell, comprising contacting a cell capable of expressing mGluR1 with an amount of a Cyanoiminopiperazine Compound effective to inhibit mGluR1 function in the cell. This method can be used in vitro, for example, as an assay to select cells that express mGluR1 and, accordingly, are useful as part of an assay to select compounds useful for treating or preventing pain, UI, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression. The method is also useful for inhibiting mGluR1 function in a cell in vivo, in an animal, a human in one embodiment, by contacting a cell, in an animal, with an amount of a Cyanoiminopiperazine Compound effective to inhibit mGluR1 function in the cell. In one embodiment, the method is useful for treating or preventing pain in an animal in need thereof. In another embodiment, the method is useful for treating or preventing UI in an animal in need thereof. In another embodiment, the method is useful for treating or preventing an addictive disorder in an animal in need thereof. In another embodiment, the method is useful for treating or preventing Parkinson's disease in an animal in need thereof. In another embodiment, the method is useful for treating or preventing parkinsonism in an animal in need thereof. In another embodiment, the method is useful for treating or preventing anxiety in an animal in need thereof. In another embodiment, the method is useful for treating or preventing epilepsy in an animal in need thereof. In another embodiment, the method is useful for treating or preventing stroke in an animal in need thereof. In another embodiment, the method is useful for treating or preventing a seizure in an animal in need thereof. In another embodiment, the method is useful for treating or preventing a pruritic condition in an animal in need thereof. In another embodiment, the method is useful for treating or preventing psychosis in an animal in need thereof. In another embodiment, the method is useful for treating or preventing a cognitive disorder in an animal in need thereof. In another embodiment, the method is useful for treating or preventing a memory deficit in an animal in need thereof. In another embodiment, the method is useful for treating or preventing restricted brain function in an animal in need thereof. In another embodiment, the method is useful for treating or preventing Huntington's chorea in an animal in need thereof. In another embodiment, the method is useful for treating or preventing ALS in an animal in need thereof. In another embodiment, the method is useful for treating or preventing dementia in an animal in need thereof. In another embodiment, the method is useful for treating or preventing retinopathy in an animal in need thereof. In another embodiment, the method is useful for treating or preventing a muscle spasm in an animal in need thereof. In another embodiment, the method is useful for treating or preventing a migraine in an animal in need thereof. In another embodiment, the method is useful for treating or preventing vomiting in an animal in need thereof. In another embodiment, the method is useful for treating or preventing dyskinesia in an animal in need thereof. In another embodiment, the method is useful for treating or preventing depression in an animal in need thereof.

Examples of cells capable of expressing mGluR1 include, but are not limited to, cerebellar Purkinje neuron cells, Purkinje cell bodies (punctate), cells of spine(s) of the cerebellum; neurons and neurophil cells of olfactory-bulb glomeruli; cells of the superficial layer of the cerebral cortex; hippocampus cells; thalamus cells; superior colliculus cells; and spinal trigeminal nucleus cells. Methods for assaying cells that express mGluR1 are well known in the art.

4.19.1 Therapeutic/Prophylactic Administration and Compositions of the Invention

Due to their activity, the Cyanoiminopiperazine Compounds are advantageously useful in veterinary and human medicine. As described above, the Cyanoiminopiperazine Compounds are useful for treating or preventing pain, UI, an ulcer, IBD, IBS, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression in an animal in need thereof.

When administered to an animal, the Cyanoiminopiperazine Compounds are administered as a component of a composition that comprises a pharmaceutically acceptable carrier or excipient. The present compositions, which comprise a Cyanoiminopiperazine Compound, can be administered orally. The Cyanoiminopiperazine Compounds of the invention can also be administered by any other convenient route, for example, by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral, rectal, and intestinal mucosa, etc.) and can be administered together with another biologically active agent. Administration can be systemic or local. Various delivery systems are known, e.g., encapsulation in liposomes, microparticles, microcapsules, capsules, etc., and can be used to administer the Cyanoiminopiperazine Compound.

Methods of administration include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intravaginal, transdermal, rectal, by inhalation, or topical, particularly to the ears, nose, eyes, or skin. The mode of administration is left to the discretion of the practitioner. In most instances, administration will result in the release of the Cyanoiminopiperazine Compounds into the bloodstream.

In specific embodiments, it can be desirable to administer the Cyanoiminopiperazine Compounds locally. This can be achieved, for example, and not by way of limitation, by local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository or enema, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.

In certain embodiments, it can be desirable to introduce the Cyanoiminopiperazine Compounds into the central nervous system or gastrointestinal tract by any suitable route, including intraventricular, intrathecal, and epidural injection, and enema. Intraventricular injection can be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir.

Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent, or via perfusion in a fluorocarbon or synthetic pulmonary surfactant. In certain embodiments, the Cyanoiminopiperazine Compounds can be formulated as a suppository, with traditional binders and excipients such as triglycerides.

In another embodiment, the Cyanoiminopiperazine Compounds can be delivered in a vesicle, in particular a liposome (see Langer, Science 249:1527-1533 (1990) and Treat et al., Liposomes in the Therapy of Infectious Disease and Cancer 317-327 and 353-365 (1989)).

In yet another embodiment, the Cyanoiminopiperazine Compounds can be delivered in a controlled-release system or sustained-release system (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). Other controlled- or sustained-release systems discussed in the review by Langer, Science 249:1527-1533 (1990) can be used. In one embodiment, a pump can be used (Langer, Science 249:1527-1533 (1990); Sefton, CRC Crit. Ref Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); and Saudek et al., N. Engl. J. Med. 321:574 (1989)). In another embodiment, polymeric materials can be used (see Medical Applications of Controlled Release (Langer and Wise eds., 1974); Controlled Drug Bioavailability, Drug Product Design and Performance (Smolen and Ball eds., 1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); Levy et al., Science 228:190 (1985); During et al., Ann. Neurol. 25:351 (1989); and Howard et al., J. Neurosurg. 71:105 (1989)). In yet another embodiment, a controlled- or sustained-release system can be placed in proximity of a target of the Cyanoiminopiperazine Compounds, e.g., the spinal column, brain, or gastrointestinal tract, thus requiring only a fraction of the systemic dose.

The present compositions can optionally comprise a suitable amount of a pharmaceutically acceptable excipient so as to provide the form for proper administration to the animal.

Such pharmaceutical excipients can be liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. The pharmaceutical excipients can be saline, gum acacia, gelatin, starch paste, talc, keratin, colloidal silica, urea and the like. In addition, auxiliary, stabilizing, thickening, lubricating, and coloring agents can be used. In one embodiment, the pharmaceutically acceptable excipients are sterile when administered to an animal. Water is a particularly useful excipient when the Cyanoiminopiperazine Compound is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid excipients, particularly for injectable solutions. Suitable pharmaceutical excipients also include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The present compositions, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.

The present compositions can take the form of solutions, suspensions, emulsion, tablets, pills, pellets, capsules, capsules containing liquids, powders, sustained-release formulations, suppositories, emulsions, aerosols, sprays, suspensions, or any other form suitable for use. In one embodiment, the composition is in the form of a capsule (see e.g., U.S. Pat. No. 5,698,155). Other examples of suitable pharmaceutical excipients are described in Remington's Pharmaceutical Sciences 1447-1676 (Alfonso R. Gennaro ed., 19th ed. 1995), incorporated herein by reference.

In one embodiment, the Cyanoiminopiperazine Compounds are formulated in accordance with routine procedures as a composition adapted for oral administration to human beings. Compositions for oral delivery can be in the form of tablets, lozenges, aqueous or oily suspensions, granules, powders, emulsions, capsules, syrups, or elixirs, for example. Orally administered compositions can contain one or more agents, for example, sweetening agents such as fructose, aspartame or saccharin; flavoring agents such as peppermint, oil of wintergreen, or cherry; coloring agents; and preserving agents, to provide a pharmaceutically palatable preparation. Moreover, where in tablet or pill form, the compositions can be coated to delay disintegration and absorption in the gastrointestinal tract thereby providing a sustained action over an extended period of time. Selectively permeable membranes surrounding an osmotically active driving compound are also suitable for orally administered compositions. In these latter platforms, fluid from the environment surrounding the capsule is imbibed by the driving compound, which swells to displace the agent or agent composition through an aperture. These delivery platforms can provide an essentially zero order delivery profile as opposed to the spiked profiles of immediate release formulations. A time-delay material such as glycerol monostearate or glycerol stearate can also be used. Oral compositions can include standard excipients such as mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, and magnesium carbonate. In one embodiment, the excipients are of pharmaceutical grade.

In another embodiment, the Cyanoiminopiperazine Compounds can be formulated for intravenous administration. Typically, compositions for intravenous administration comprise sterile isotonic aqueous buffer. Where necessary, the compositions can also include a solubilizing agent. Compositions for intravenous administration can optionally include a local anesthetic such as lignocaine to lessen pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampule or sachette indicating the quantity of active agent. Where the Cyanoiminopiperazine Compounds are to be administered by infusion, they can be dispensed, for example, with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the Cyanoiminopiperazine Compounds are administered by injection, an ampule of sterile water for injection or saline can be provided so that the ingredients can be mixed prior to administration.

The Cyanoiminopiperazine Compounds can be administered by controlled-release or sustained-release means or by delivery devices that are well known to those of ordinary skill in the art. Examples include, but are not limited to, those described in U.S. Pat. Nos. 3,845,770; 3,916,899; 3,536,809; 3,598,123; 4,008,719; 5,674,533; 5,059,595; 5,591,767; 5,120,548; 5,073,543; 5,639,476; 5,354,556; and 5,733,566, each of which is incorporated herein by reference. Such dosage forms can be used to provide controlled- or sustained-release of one or more active ingredients using, for example, hydropropylmethyl cellulose, other polymer matrices, gels, permeable membranes, osmotic systems, multilayer coatings, microparticles, liposomes, microspheres, or a combination thereof to provide the desired release profile in varying proportions. Suitable controlled- or sustained-release formulations known to those of ordinary skill in the art, including those described herein, can be readily selected for use with the active ingredients of the invention. The invention thus encompasses single unit dosage forms suitable for oral administration such as, but not limited to, tablets, capsules, gelcaps, and caplets that are adapted for controlled- or sustained-release.

Controlled- or sustained-release pharmaceutical compositions can have a common goal of improving drug therapy over that achieved by their non-controlled or non-sustained counterparts. In one embodiment, a controlled- or sustained-release composition comprises a minimal amount of a Cyanoiminopiperazine Compound to cure or control the condition in a minimum amount of time. Advantages of controlled- or sustained-release compositions include extended activity of the drug, reduced dosage frequency, and increased patient compliance. In addition, controlled- or sustained-release compositions can favorably affect the time of onset of action or other characteristics, such as blood levels of the Cyanoiminopiperazine Compound, and can thus reduce the occurrence of adverse side effects.

Controlled- or sustained-release compositions can initially release an amount of a Cyanoiminopiperazine Compound that promptly produces the desired therapeutic or prophylactic effect, and gradually and continually release other amounts of the Cyanoiminopiperazine Compound to maintain this level of therapeutic or prophylactic effect over an extended period of time. To maintain a constant level of the Cyanoiminopiperazine Compound in the body, the Cyanoiminopiperazine Compound can be released from the dosage form at a rate that will replace the amount of Cyanoiminopiperazine Compound being metabolized and excreted from the body. Controlled- or sustained-release of an active ingredient can be stimulated by various conditions, including but not limited to, changes in pH, changes in temperature, concentration or availability of enzymes, concentration or availability of water, or other physiological conditions or compounds.

The amount of the Cyanoiminopiperazine Compound that is effective in the treatment or prevention of pain, UI, an ulcer, IBD, IBS, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression and can be determined by standard clinical techniques. In addition, in vitro or in vivo assays can optionally be employed to help identify optimal dosage ranges. The precise dose to be employed will also depend on the route of administration, and the seriousness of the condition being treated and should be decided according to the judgment of the practitioner and each patient's circumstances in view of, e.g., published clinical studies. Suitable effective dosage amounts, however, range from about 10 micrograms to about 2500 milligrams about every 4 h, although they are typically about 100 mg or less. In one embodiment, the effective dosage amount ranges from about 0.01 milligrams to about 100 milligrams of a Cyanoiminopiperazine Compound about every 4 h, in another embodiment, about 0.020 milligrams to about 50 milligrams about every 4 h, and in another embodiment, about 0.025 milligrams to about 20 milligrams about every 4 h. The effective dosage amounts described herein refer to total amounts administered; that is, if more than one Cyanoiminopiperazine Compound is administered, the effective dosage amounts correspond to the total amount administered.

Where a cell capable of expressing VR1, mGluR5, or mGluR1 is contacted with a Cyanoiminopiperazine Compound in vitro, the amount effective for inhibiting the receptor function in a cell will typically range from about 0.01 μg/L to about 5 mg/L, in one embodiment, from about 0.01 μg/L to about 2.5 mg/L, in another embodiment, from about 0.01 μg/L to about 0.5 mg/L, and in another embodiment, from about 0.01 μg/L to about 0.25 mg/L of a solution or suspension of a pharmaceutically acceptable carrier or excipient. In one embodiment, the volume of solution or suspension is from about 1 μL to about 1 mL. In another embodiment, the volume of solution or suspension is about 200 μL.

Where a cell capable of expressing VR1, mGluR5, or mGluR1 is contacted with a Cyanoiminopiperazine Compound in vivo, the amount effective for inhibiting the receptor function in a cell will typically range from about 0.01 mg to about 100 mg/kg of body weight per day, in one embodiment, from about 0.1 mg to about 50 mg/kg body weight per day, and in another embodiment, from about 1 mg to about 20 mg/kg of body weight per day.

The Cyanoiminopiperazine Compounds can be assayed in vitro or in vivo for the desired therapeutic or prophylactic activity prior to use in humans. Animal model systems can be used to demonstrate safety and efficacy.

The present methods for treating or preventing pain, UI, an ulcer, IBD, IBS, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression in an animal in need thereof can further comprise administering to the animal being administered a Cyanoiminopiperazine Compound another therapeutic agent. In one embodiment, the other therapeutic agent is administered in an effective amount.

The present methods for inhibiting VR1 function in a cell capable of expressing VR1 can further comprise contacting the cell with an effective amount of another therapeutic agent.

The present methods for inhibiting mGluR5 function in a cell capable of expressing mGluR5 can further comprise contacting the cell with an effective amount of another therapeutic agent.

The present methods for inhibiting mGluR1 function in a cell capable of expressing mGluR1 can further comprise contacting the cell with an effective amount of another therapeutic agent.

The other therapeutic agent includes, but is not limited to, an opioid agonist, a non-opioid analgesic, a non-steroid anti-inflammatory agent, an antimigraine agent, a Cox-II inhibitor, an antiemetic, a β-adrenergic blocker, an anticonvulsant, an antidepressant, a Ca2+-channel blocker, an anticancer agent, an agent for treating or preventing UI, an agent for treating or preventing an ulcer, an agent for treating or preventing IBD, an agent for treating or preventing IBS, an agent for treating addictive disorder, an agent for treating Parkinson's disease and parkinsonism, an agent for treating anxiety, an agent for treating epilepsy, an agent for treating a stroke, an agent for treating a seizure, an agent for treating a pruritic condition, an agent for treating psychosis, an agent for treating Huntington's chorea, an agent for treating ALS, an agent for treating a cognitive disorder, an agent for treating a migraine, an agent for treating vomiting, an agent for treating dyskinesia, or an agent for treating depression, and mixtures thereof.

Effective amounts of the other therapeutic agents are well known to those skilled in the art. However, it is well within the skilled artisan's purview to determine the other therapeutic agent's optimal effective-amount range. In one embodiment of the invention, where another therapeutic agent is administered to an animal, the effective amount of the Cyanoiminopiperazine Compound is less than its effective amount would be where the other therapeutic agent is not administered. In this case, without being bound by theory, it is believed that the Cyanoiminopiperazine Compounds and the other therapeutic agent act synergistically to treat or prevent pain, UI, an ulcer, IBD, IBS, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression.

Examples of useful opioid agonists include, but are not limited to, alfentanil, allylprodine, alphaprodine, anileridine, benzylmorphine, bezitramide, buprenorphine, butorphanol, clonitazene, codeine, desomorphine, dextromoramide, dezocine, diampromide, diamorphone, dihydrocodeine, dihydromorphine, dimenoxadol, dimepheptanol, dimethylthiambutene, dioxaphetyl butyrate, dipipanone, eptazocine, ethoheptazine, ethylmethylthiambutene, ethylmorphine, etonitazene fentanyl, heroin, hydrocodone, hydromorphone, hydroxypetbidine, isomethadone, ketobemidone, levorphanol, levophenacylmorphan, lofentanil, meperidine, meptazinol, metazocine, methadone, metopon, morphine, myrophine, nalbuphine, narceine, nicomorphine, norlevorphanol, normethadone, nalorphine, normorphine, norpipanone, opium, oxycodone, oxymorphone, papavereturn, pentazocine, phenadoxone, phenomorphan, phenazocine, phenoperidine, piminodine, piritramide, proheptazine, promedol, properidine, propiram, propoxyphene, sufentanil, tilidine, tramadol, pharmaceutically acceptable salts thereof, and mixtures thereof.

In certain embodiments, the opioid agonist is selected from codeine, hydromorphone, hydrocodone, oxycodone, dihydrocodeine, dihydromorphine, morphine, tramadol, oxymorphone, pharmaceutically acceptable salts thereof, and mixtures thereof.

Examples of useful non-opioid analgesics include non-steroidal anti-inflammatory agents, such as aspirin, ibuprofen, diclofenac, naproxen, benoxaprofen, flurbiprofen, fenoprofen, flubufen, ketoprofen, indoprofen, piroprofen, carprofen, oxaprozin, pramoprofen, muroprofen, trioxaprofen, suprofen, aminoprofen, tiaprofenic acid, fluprofen, bucloxic acid, indomethacin, sulindac, tolmetin, zomepirac, tiopinac, zidometacin, acemetacin, fentiazac, clidanac, oxpinac, mefenamic acid, meclofenamic acid, flufenamic acid, niflumic acid, tolfenamic acid, diflurisal, flufenisal, piroxicam, sudoxicam, isoxicam, and pharmaceutically acceptable salts thereof, and mixtures thereof. Other suitable non-opioid analgesics include the following, non-limiting, chemical classes of analgesic, antipyretic, nonsteroidal anti-inflammatory drugs: salicylic acid derivatives, including aspirin, sodium salicylate, choline magnesium trisalicylate, salsalate, diflunisal, salicylsalicylic acid, sulfasalazine, and olsalazin; para-aminophennol derivatives including acetaminophen and phenacetin; indole and indene acetic acids, including indomethacin, sulindac, and etodolac; heteroaryl acetic acids, including tolmetin, diclofenac, and ketorolac; anthranilic acids (fenamates), including mefenamic acid and meclofenamic acid; enolic acids, including oxicams (piroxicam, tenoxicam), and pyrazolidinediones (phenylbutazone, oxyphenthartazone); and alkanones, including nabumetone. For a more detailed description of the NSAIDs, see Paul A. Insel, Analgesic-Antipyretic and Anti-inflammatory Agents and Drugs Employed in the Treatment of Gout, in Goodman & Gilman's The Pharmacological Basis of Therapeutics 617-57 (Perry B. Molinhoff and Raymond W. Ruddon eds., 9th ed 1996) and Glen R. Hanson, Analgesic, Antipyretic and Anti-Inflammatory Drugs in Remington: The Science and Practice of Pharmacy Vol II 1196-1221 (A. R. Gennaro ed. 19th ed. 1995) which are hereby incorporated by reference in their entireties.

Examples of useful Cox-II inhibitors and 5-lipoxygenase inhibitors, as well as combinations thereof, are described in U.S. Pat. No. 6,136,839, which is hereby incorporated by reference in its entirety. Examples of useful Cox-II inhibitors include, but are not limited to, rofecoxib and celecoxib.

Examples of useful antimigraine agents include, but are not limited to, alpiropride, dihydroergotamine, dolasetron, ergocornine, ergocorninine, ergocryptine, ergot, ergotamine, flumedroxone acetate, fonazine, lisuride, lomerizine, methysergide oxetorone, pizotyline, and mixtures thereof.

The other therapeutic agent can also be an agent useful for reducing any potential side effects of a Cyanoiminopiperazine Compounds. For example, the other therapeutic agent can be an antiemetic agent. Examples of useful antiemetic agents include, but are not limited to, metoclopromide, domperidone, prochlorperazine, promethazine, chlorpromazine, trimethobenzamide, ondansetron, granisetron, hydroxyzine, acetylleucine monoethanolamine, alizapride, azasetron, benzquinamide, bietanautine, bromopride, buclizine, clebopride, cyclizine, dimenhydrinate, diphenidol, dolasetron, meclizine, methallatal, metopimazine, nabilone, oxypemdyl, pipamazine, scopolamine, sulpiride, tetrahydrocannabinol, thiethylperazine, thioproperazine, tropisetron, and mixtures thereof.

Examples of useful β-adrenergic blockers include, but are not limited to, acebutolol, alprenolol, amosulabol, arotinolol, atenolol, befunolol, betaxolol, bevantolol, bisoprolol, bopindolol, bucumolol, bufetolol, bufuralol, bunitrolol, bupranolol, butidrine hydrochloride, butofilolol, carazolol, carteolol, carvedilol, celiprolol, cetamolol, cloranolol, dilevalol, epanolol, esmolol, indenolol, labetalol, levobunolol, mepindolol, metipranolol, metoprolol, moprolol, nadolol, nadoxolol, nebivalol, nifenalol, nipradilol, oxprenolol, penbutolol, pindolol, practolol, pronethalol, propranolol, sotalol, sulfinalol, talinolol, tertatolol, tilisolol, timolol, toliprolol, and xibenolol.

Examples of useful anticonvulsants include, but are not limited to, acetylpheneturide, albutoin, aloxidone, aminoglutethimide, 4-amino-3-hydroxybutyric acid, atrolactamide, beclamide, buramate, calcium bromide, carbamazepine, cinromide, clomethiazole, clonazepam, decimemide, diethadione, dimethadione, doxenitroin, eterobarb, ethadione, ethosuximide, ethotoin, felbamate, fluoresone, gabapentin, 5-hydroxytryptophan, lamotrigine, magnesium bromide, magnesium sulfate, mephenyloin, mephobarbital, metharbital, methetoin, methsuximide, 5-methyl-5-(3-phenanthryl)-hydantoin, 3-methyl-5-phenylhydantoin, narcobarbital, nimetazepam, nitrazepam, oxcarbazepine, paramethadione, phenacemide, phenetharbital, pheneturide, phenobarbital, phensuximide, phenylmethylbarbituric acid, phenyloin, phethenylate sodium, potassium bromide, pregabaline, primidone, progabide, sodium bromide, solanum, strontium bromide, suclofenide, sulthiame, tetrantoin, tiagabine, topiramate, trimethadione, valproic acid, valpromide, vigabatrin, and zonisamide.

Examples of useful antidepressants include, but are not limited to, binedaline, caroxazone, citalopram, dimethazan, fencamine, indalpine, indeloxazine hydrocholoride, nefopam, nomifensine, oxitriptan, oxypertine, paroxetine, sertraline, thiazesim, trazodone, benmoxine, iproclozide, iproniazid, isocarboxazid, nialamide, octamoxin, phenelzine, cotinine, rolicyprine, rolipram, maprotiline, metralindole, mianserin, mirtazepine, adinazolam, amitriptyline, amitriptylinoxide, amoxapine, butriptyline, clomipramine, demexiptiline, desipramine, dibenzepin, dimetacrine, dothiepin, doxepin, fluacizine, imipramine, imipramine N-oxide, iprindole, lofepramine, melitracen, metapramine, nortriptyline, noxiptilin, opipramol, pizotyline, propizepine, protriptyline, quinupramine, tianeptine, trimipramine, adrafinil, benactyzine, bupropion, butacetin, dioxadrol, duloxetine, etoperidone, febarbamate, femoxetine, fenpentadiol, fluoxetine, fluvoxamine, hematoporphyrin, hypericin, levophacetoperane, medifoxamine, milnacipran, minaprine, moclobemide, nefazodone, oxaflozane, piberaline, prolintane, pyrisuccideanol, ritanserin, roxindole, rubidium chloride, sulpiride, tandospirone, thozalinone, tofenacin, toloxatone, tranylcypromine, L-tryptophan, venlafaxine, viloxazine, and zimeldine.

Examples of useful Ca2+-channel blockers include, but are not limited to, bepridil, clentiazem, diltiazem, fendiline, gallopamil, mibefradil, prenylamine, semotiadil, terodiline, verapamil, amlodipine, aranidipine, barnidipine, benidipine, cilnidipine, efonidipine, elgodipine, felodipine, isradipine, lacidipine, lercanidipine, manidipine, nicardipine, nifedipine, nilvadipine, nimodipine, nisoldipine, nitrendipine, cinnarizine, flunarizine, lidoflazine, lomerizine, bencyclane, etafenone, fantofarone, and perhexyline.

Examples of useful anticancer agents include, but are not limited to, acivicin, aclarubicin, acodazole hydrochloride, acronine, adozelesin, aldesleukin, altretamine, ambomycin, ametantrone acetate, aminoglutethimide, amsacrine, anastrozole, anthramycin, asparaginase, asperlin, azacitidine, azetepa, azotomycin, batimastat, benzodepa, bicalutamide, bisantrene hydrochloride, bisnafide dimesylate, bizelesin, bleomycin sulfate, brequinar sodium, bropirimine, busulfan, cactinomycin, calusterone, caracemide, carbetimer, carboplatin, carmustine, carubicin hydrochloride, carzelesin, cedefingol, chlorambucil, cirolemycin, cisplatin, cladribine, crisnatol mesylate, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, daunorubicin hydrochloride, decitabine, dexormaplatin, dezaguanine, dezaguanine mesylate, diaziquone, docetaxel, doxorubicin, doxorubicin hydrochloride, droloxifene, droloxifene citrate, dromostanolone propionate, duazomycin, edatrexate, eflornithine hydrochloride, elsamitrucin, enloplatin, enpromate, epipropidine, epirubicin hydrochloride, erbulozole, esorubicin hydrochloride, estramustine, estramustine phosphate sodium, etanidazole, etoposide, etoposide phosphate, etoprine, fadrozole hydrochloride, fazarabine, fenretinide, floxuridine, fludarabine phosphate, fluorouracil, fluorocitabine, fosquidone, fostriecin sodium, gemcitabine, gemcitabine hydrochloride, hydroxyurea, idarubicin hydrochloride, ifosfamide, ilmofosine, interleukin II (including recombinant interleukin II or rIL2), interferon alfa-2a, interferon alfa-2b, interferon alfa-n1, interferon alfa-n3, interferon beta-I a, interferon gamma-I b, iproplatin, irinotecan hydrochloride, lanreotide acetate, letrozole, leuprolide acetate, liarozole hydrochloride, lometrexol sodium, lomustine, losoxantrone hydrochloride, masoprocol, maytansine, mechlorethamine hydrochloride, megestrol acetate, melengestrol acetate, melphalan, menogaril, mercaptopurine, methotrexate, methotrexate sodium, metoprine, meturedepa, mitindomide, mitocarcin, mitocromin, mitogillin, mitomalcin, mitomycin, mitosper, mitotane, mitoxantrone hydrochloride, mycophenolic acid, nocodazole, nogalamycin, ormaplatin, oxisuran, paclitaxel, pegaspargase, peliomycin, pentamustine, peplomycin sulfate, perfosfamide, pipobroman, piposulfan, piroxantrone hydrochloride, plicamycin, plomestane, porfimer sodium, porfiromycin, prednimustine, procarbazine hydrochloride, puromycin, puromycin hydrochloride, pyrazofurin, riboprine, rogletimide, safingol, safingol hydrochloride, semustine, simtrazene, sparfosate sodium, sparsomycin, spirogermanium hydrochloride, spiromustine, spiroplatin, streptonigrin, streptozocin, sulofenur, talisomycin, tecogalan sodium, tegafur, teloxantrone hydrochloride, temoporfin, teniposide, teroxirone, testolactone, thiamiprine, thioguanine, thiotepa, tiazofurin, tirapazamine, toremifene citrate, trestolone acetate, triciribine phosphate, trimetrexate, trimetrexate glucuronate, triptorelin, tubulozole hydrochloride, uracil mustard, uredepa, vapreotide, verteporfin, vinblastine sulfate, vincristine sulfate, vindesine, vindesine sulfate, vinepidine sulfate, vinglycinate sulfate, vinleurosine sulfate, vinorelbine tartrate, vinrosidine sulfate, vinzolidine sulfate, vorozole, zeniplatin, zinostatin, zorubicin hydrochloride.

Examples of other anti-cancer drugs include, but are not limited to, 20-epi-1,25 dihydroxyvitamin D3; 5-ethynyluracil; abiraterone; aclarubicin; acylfulvene; adecypenol; adozelesin; aldesleukin; ALL-TK antagonists; altretamine; ambamustine; amidox; amifostine; aminolevulinic acid; amrubicin; amsacrine; anagrelide; anastrozole; andrographolide; angiogenesis inhibitors; antagonist D; antagonist G; antarelix; anti-dorsalizing morphogenetic protein-1; antiandrogen, prostatic carcinoma; antiestrogen; antineoplaston; antisense oligonucleotides; aphidicolin glycinate; apoptosis gene modulators; apoptosis regulators; apurinic acid; ara-CDP-DL-PTBA; arginine deaminase; asulacrine; atamestane; atrimustine; axinastatin 1; axinastatin 2; axinastatin 3; azasetron; azatoxin; azatyrosine; baccatin III derivatives; balanol; batimastat; BCR/ABL antagonists; benzochlorins; benzoylstaurosporine; beta lactam derivatives; beta-alethine; betaclamycin B; betulinic acid; bFGF inhibitor; bicalutamide; bisantrene; bisaziridinylspermine; bisnafide; bistratene A; bizelesin; breflate; bropirimine; budotitane; buthionine sulfoximine; calcipotriol; calphostin C; camptothecin derivatives; canarypox IL-2; capecitabine; carboxamide-amino-triazole; carboxyamidotriazole; CaRest M3; CARN 700; cartilage derived inhibitor; carzelesin; casein kinase inhibitors (ICOS); castanospermine; cecropin B; cetrorelix; chlorins; chloroquinoxaline sulfonamide; cicaprost; cis-porphyrin; cladribine; clomifene analogues; clotrimazole; collismycin A; collismycin B; combretastatin A4; combretastatin analogue; conagenin; crambescidin 816; crisnatol; cryptophycin 8; cryptophycin A derivatives; curacin A; cyclopentanthraquinones; cycloplatam; cypemycin; cytarabine ocfosfate; cytolytic factor; cytostatin; dacliximab; decitabine; dehydrodidenmin B; deslorelin; dexamethasone; dexifosfamide; dexrazoxane; dexverapamil; diaziquone; didemnin B; didox; diethylnorspermine; dihydro-5-azacytidine; dihydrotaxol, 9-; dioxamycin; diphenyl spiromustine; docetaxel; docosanol; dolasetron; doxifluridine; droloxifene; dronabinol; duocarmycin SA; ebselen; ecomustine; edelfosine; edrecolomab; eflornithine; elemene; emitefur; epirubicin; epristeride; estramustine analogue; estrogen agonists; estrogen antagonists; etanidazole; etoposide phosphate; exemestane; fadrozole; fazarabine; fenretinide; filgrastim; finasteride; flavopiridol; flezelastine; fluasterone; fludarabine; fluorodaunorunicin hydrochloride; forfenimex; formestane; fostriecin; fotemustine; gadolinium texaphyrin; gallium nitrate; galocitabine; ganirelix; gelatinase inhibitors; gemcitabine; glutathione inhibitors; hepsulfam; heregulin; hexamethylene bisacetamide; hypericin; ibandronic acid; idarubicin; idoxifene; idramantone; ilmofosine; ilomastat; imidazoacridones; imiquimod; immunostimulant peptides; insulin-like growth factor-1 receptor inhibitor; interferon agonists; interferons; interleukins; iobenguane; iododoxorubicin; ipomeanol, 4-; iroplact; irsogladine; isobengazole; isohomohalicondrin B; itasetron; jasplakinolide; kahalalide F; lamellarin-N triacetate; lanreotide; leinamycin; lenograstim; lentinan sulfate; leptolstatin; letrozole; leukemia inhibiting factor; leukocyte alpha interferon; leuprolide+estrogen+progesterone; leuprorelin; levamisole; liarozole; linear polyamine analogue; lipophilic disaccharide peptide; lipophilic platinum compounds; lissoclinamide 7; lobaplatin; lombricine; lometrexol; lonidamine; losoxantrone; lovastatin; loxoribine; lurtotecan; lutetium texaphyrin; lysofylline; lytic peptides; maitansine; mannoitatin A; marimastat; masoprocol; maspin; matrilysin inhibitors; matrix metalloproteinase inhibitors; menogaril; merbarone; meterelin; methioninase; metoclopramide; MIF inhibitor; mifepristone; miltefosine; mirimostim; mismatched double stranded RNA; mitoguazone; mitolactol; mitomycin analogues; mitonafide; mitotoxin fibroblast growth factor-saporin; mitoxantrone; mofarotene; molgramostim; monoclonal antibody, human chorionic gonadotrophin; monophosphoryl lipid A+myobacterium cell wall sk; mopidamol; multiple drug resistance gene inhibitor; multiple tumor suppressor 1-based therapy; mustard anticancer agent; mycaperoxide B; mycobacterial cell wall extract; myriaporone; N-acetyldinaline; N-substituted benzamides; nafarelin; nagrestip; naloxone+pentazocine; napavin; naphterpin; nartograstim; nedaplatin; nemorubicin; neridronic acid; neutral endopeptidase; nilutamide; nisamycin; nitric oxide modulators; nitroxide antioxidant; nitrullyn; O6-benzylguanine; octreotide; okicenone; oligonucleotides; onapristone; ondansetron; ondansetron; oracin; oral cytokine inducer; ormaplatin; osaterone; oxaliplatin; oxaunomycin; paclitaxel; paclitaxel analogues; paclitaxel derivatives; palauamine; palmitoylrhizoxin; pamidronic acid; panaxytriol; panomifene; parabactin; pazelliptine; pegaspargase; peldesine; pentosan polysulfate sodium; pentostatin; pentrozole; perflubron; perfosfamide; perillyl alcohol; phenazinomycin; phenylacetate; phosphatase inhibitors; picibanil; pilocarpine hydrochloride; pirarubicin; piritrexim; placetin A; placetin B; plasminogen activator inhibitor; platinum complex; platinum compounds; platinum-triamine complex; porfimer sodium; porfiromycin; prednisone; propyl bis-acridone; prostaglandin J2; proteasome inhibitors; protein A-based immune modulator; protein kinase C inhibitor; protein kinase C inhibitors, microalgal; protein tyrosine phosphatase inhibitors; purine nucleoside phosphorylase inhibitors; purpurins; pyrazoloacridine; pyridoxylated hemoglobin polyoxyethylene conjugate; raf antagonists; raltitrexed; ramosetron; ras farnesyl protein transferase inhibitors; ras inhibitors; ras-GAP inhibitor; retelliptine demethylated; rhenium Re 186 etidronate; rhizoxin; ribozymes; RII retinamide; rogletimide; rohitukine; romurtide; roquinimex; rubiginone B1; ruboxyl; safingol; saintopin; SarCNU; sarcophytol A; sargramostim; Sdi 1 mimetics; semustine; senescence derived inhibitor 1; sense oligonucleotides; signal transduction inhibitors; signal transduction modulators; single chain antigen binding protein; sizofuran; sobuzoxane; sodium borocaptate; sodium phenylacetate; solverol; somatomedin binding protein; sonermin; sparfosic acid; spicamycin D; spiromustine; splenopentin; spongistatin 1; squalamine; stem cell inhibitor; stem-cell division inhibitors; stipiamide; stromelysin inhibitors; sulfinosine; superactive vasoactive intestinal peptide antagonist; suradista; suramin; swainsonine; synthetic glycosaminoglycans; tallimustine; tamoxifen methiodide; tauromustine; tazarotene; tecogalan sodium; tegafur; tellurapyrylium; telomerase inhibitors; temoporfin; temozolomide; teniposide; tetrachlorodecaoxide; tetrazomine; thaliblastine; thiocoraline; thrombopoietin; thrombopoietin mimetic; thymalfasin; thymopoietin receptor agonist; thymotrinan; thyroid stimulating hormone; tin ethyl etiopurpurin; tirapazamine; titanocene bichloride; topsentin; toremifene; totipotent stem cell factor; translation inhibitors; tretinoin; triacetyluridine; triciribine; trimetrexate; triptorelin; tropisetron; turosteride; tyrosine kinase inhibitors; tyrphostins; UBC inhibitors; ubenimex; urogenital sinus-derived growth inhibitory factor; urokinase receptor antagonists; vapreotide; variolin B; vector system, erythrocyte gene therapy; velaresol; veramine; verdins; verteporfin; vinorelbine; vinxaltine; vitaxin; vorozole; zanoterone; zeniplatin; zilascorb; and zinostatin stimalamer.

Examples of useful therapeutic agents for treating or preventing UT include, but are not limited to, propantheline, imipramine, hyoscyamine, oxybutynin, and dicyclomine.

Examples of useful therapeutic agents for treating or preventing an ulcer include, antacids such as aluminum hydroxide, magnesium hydroxide, sodium bicarbonate, and calcium bicarbonate; sucraflate; bismuth compounds such as bismuth subsalicylate and bismuth subcitrate; H2 antagonists such as cimetidine, ranitidine, famotidine, and nizatidine; H+, K+-ATPase inhibitors such as omeprazole, iansoprazole, and lansoprazole; carbenoxolone; misprostol; and antibiotics such as tetracycline, metronidazole, timidazole, clarithromycin, and amoxicillin.

Examples of useful therapeutic agents for treating or preventing IBD include, but are not limited to, anticholinergic drugs; diphenoxylate; loperamide; deodorized opium tincture; codeine; broad-spectrum antibiotics such as metronidazole; sulfasalazine; olsalazie; mesalamine; prednisone; azathioprine; mercaptopurine; and methotrexate.

Examples of useful therapeutic agents for treating or preventing IBS include, but are not limited to, propantheline; muscarine receptor antogonists such as pirenzapine, methoctramine, ipratropium, tiotropium, scopolamine, methscopolamine, homatropine, homatropine methylbromide, and methantheline; and antidiarrheal drugs such as diphenoxylate and loperamide.

Examples of useful therapeutic agents for treating or preventing an addictive disorder include, but are not limited to, methadone, desipramine, amantadine, fluoxetine, buprenorphine, an opiate agonist, 3-phenoxypyridine, levomethadyl acetate hydrochloride, and serotonin antagonists.

Examples of useful therapeutic agents for treating or preventing Parkinson's disease and parkinsonism include, but are not limited to, carbidopa/levodopa, pergolide, bromocriptine, ropinirole, pramipexole, entacapone, tolcapone, selegiline, amantadine, and trihexyphenidyl hydrochloride.

Examples of useful therapeutic agents for treating or preventing anxiety include, but are not limited to, benzodiazepines, such as alprazolam, brotizolam, chlordiazepoxide, clobazam, clonazepam, clorazepate, demoxepam, diazepam, estazolam, flumazenil, flurazepam, halazepam, lorazepam, midazolam, nitrazepam, nordazepam, oxazepam, prazepam, quazepam, temazepam, and triazolam; non-benzodiazepine agents, such as buspirone, gepirone, ipsaprione, tiospirone, zolpicone, zolpidem, and zaleplon; tranquilizers, such as barbituates, e.g., amobarbital, aprobarbital, butabarbital, butalbital, mephobarbital, methohexital, pentobarbital, phenobarbital, secobarbital, and thiopental; and propanediol carbamates, such as meprobamate and tybamate.

Examples of useful therapeutic agents for treating or preventing epilepsy include, but are not limited to, carbamazepine, ethosuximide, gabapentin, lamotrignine, phenobarbital, phenyloin, primidone, valproic acid, trimethadione, bemzodiaepines, gabapentin, lamotrigine, γ-vinyl GABA, acetazolamide, and felbamate.

Examples of useful therapeutic agents for treating or preventing stroke include, but are not limited to, anticoagulants such as heparin, agents that break up clots such as streptokinase or tissue plasminogen activator, agents that reduce swelling such as mannitol or corticosteroids, and acetylsalicylic acid.

Examples of useful therapeutic agents for treating or preventing a seizure include, but are not limited to, carbamazepine, ethosuximide, gabapentin, lamotrignine, phenobarbital, phenyloin, primidone, valproic acid, trimethadione, bemzodiaepines, gabapentin, lamotrigine, γ-vinyl GABA, acetazolamide, and felbamate.

Examples of useful therapeutic agents for treating or preventing a pruritic condition include, but are not limited to, naltrexone; nalmefene; danazol; tricyclics such as amitriptyline, imipramine, and doxepin; antidepressants such as those given below, menthol; camphor; phenol; pramoxine; capsaicin; tar; steroids; and antihistamines.

Examples of useful therapeutic agents for treating or preventing psychosis include, but are not limited to, phenothiazines such as chlorpromazine hydrochloride, mesoridazine besylate, and thoridazine hydrochloride; thioxanthenes such as chloroprothixene and thiothixene hydrochloride; clozapine; risperidone; olanzapine; quetiapine; quetiapine fumarate; haloperidol; haloperidol decanoate; loxapine succinate; molindone hydrochloride; pimozide; and ziprasidone.

Examples of useful therapeutic agents for treating or preventing Huntington's chorea include, but are not limited to, haloperidol and pimozide.

Examples of useful therapeutic agents for treating or preventing ALS include, but are not limited to, baclofen, neurotrophic factors, riluzole, tizanidine, benzodiazepines such as clonazepan and dantrolene.

Examples of useful therapeutic agents for treating or preventing cognitive disorders include, but are not limited to, agents for treating or preventing dementia such as tacrine; donepezil; ibuprofen; antipsychotic drugs such as thioridazine and haloperidol; and antidepressant drugs such as those given below.

Examples of useful therapeutic agents for treating or preventing a migraine include, but are not limited to, sumatriptan; methysergide; ergotamine; caffeine; and beta-blockers such as propranolol, verapamil, and divalproex.

Examples of useful therapeutic agents for treating or preventing vomiting include, but are not limited to, 5-HT3 receptor antagonists such as ondansetron, dolasetron, granisetron, and tropisetron; dopamine receptor antagonists such as prochlorperazine, thiethylperazine, chlorpromazin, metoclopramide, and domperidone; glucocorticoids such as dexamethasone; and benzodiazepines such as lorazepam and alprazolam.

Examples of useful therapeutic agents for treating or preventing dyskinesia include, but are not limited to, reserpine and tetrabenazine.

Examples of useful therapeutic agents for treating or preventing depression include, but are not limited to, tricyclic antidepressants such as amitryptyline, amoxapine, bupropion, clomipramine, desipramine, doxepin, imipramine, maprotilinr, nefazadone, nortriptyline, protriptyline, trazodone, trimipramine, and venlaflaxine; selective serotonin reuptake inhibitors such as fluoxetine, fluvoxamine, paroxetine, and setraline; monoamine oxidase inhibitors such as isocarboxazid, pargyline, phenelzine, and tranylcypromine; and psychostimulants such as dextroamphetamine and methylphenidate.

A Cyanoiminopiperazine Compound and the other therapeutic agent can act additively or, in one embodiment, synergistically. In one embodiment, a Cyanoiminopiperazine Compound is administered concurrently with another therapeutic agent. In one embodiment, a composition comprising an effective amount of a Cyanoiminopiperazine Compound and an effective amount of another therapeutic agent can be administered. Alternatively, a composition comprising an effective amount of a Cyanoiminopiperazine Compound and a different composition comprising an effective amount of another therapeutic agent can be concurrently administered. In another embodiment, an effective amount of a Cyanoiminopiperazine Compound is administered prior or subsequent to administration of an effective amount of another therapeutic agent. In this embodiment, the Cyanoiminopiperazine Compound is administered while the other therapeutic agent exerts its therapeutic effect, or the other therapeutic agent is administered while the Cyanoiminopiperazine Compound exerts its preventative or therapeutic effect for treating or preventing a Condition.

A composition of the invention is prepared by a method comprising admixing a Cyanoiminopiperazine Compound or a pharmaceutically acceptable salt and a pharmaceutically acceptable carrier or excipient. Admixing can be accomplished using methods well known for admixing a compound (or salt) and a pharmaceutically acceptable carrier or excipient. In one embodiment the Cyanoiminopiperazine Compound or the pharmaceutically acceptable salt of the Compound is present in the composition in an effective amount.

4.19.2 Kits

The invention encompasses kits that can simplify the administration of a Cyanoiminopiperazine Compound to an animal.

A typical kit of the invention comprises a unit dosage form of a Cyanoiminopiperazine Compound. In one embodiment, the unit dosage form is a container, which can be sterile, containing an effective amount of a Cyanoiminopiperazine Compound and a pharmaceutically acceptable carrier or excipient. The kit can further comprise a label or printed instructions instructing the use of the Cyanoiminopiperazine Compound to treat pain, UI, an ulcer, IBD, IBS, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression. The kit can also further comprise a unit dosage form of another therapeutic agent, for example, a container containing an effective amount of the other therapeutic agent. In one embodiment, the kit comprises a container containing an effective amount of a Cyanoiminopiperazine Compound and an effective amount of another therapeutic agent. Examples of other therapeutic agents include, but are not limited to, those listed above.

Kits of the invention can further comprise a device that is useful for administering the unit dosage forms. Examples of such a device includes, but are not limited to, a syringe, a drip bag, a patch, an inhaler, and an enema bag.

The following examples are set forth to assist in understanding the invention and should not, of course, be construed as specifically limiting the invention described and claimed herein. Such variations of the invention, including the substitution of all equivalents now known or later developed, which would be within the purview of those skilled in the art, and changes in formulation or minor changes in experimental design, are to be considered to fall within the scope of the invention incorporated herein.

5. EXAMPLES

Examples 1-3 relate to the synthesis of illustrative Cyanoiminopiperazine Compounds.

5.1. Example 1 Synthesis of Compound AAA

2,3-Dichloropyridine (15.0 g, 101.6 mmol), piperazine (9.78 g, 113.70 mmol), and triethylamine (14.36 g, 141.95 mmol) were dissolved in 300 mL of DMSO and the resulting mixture was heated at about 80° C. for about 24 h. The reaction mixture was then cooled to room temperature and extracted with a saturated aqueous sodium bicarbonate solution. The organic layer was dried, concentrated, and purified using a silica gel column eluted with a gradient elution from ethyl acetate to 2:1 ethyl acetate:methanol to provide N-(3-chloropyridin-2-yl)-piperazine (compound 1) as a yellow liquid.

A solution diphenylcyanocarbodimidate (Commercially available from Sigma-Aldrich, St. Louis, Mo. (www.sigma-aldrich.com)) (0.5 mmol) and 4-tert-butylaniline (0.5 mmol) in 1.5 mL of DCM was stirred at room temperature for about 12 h. The mixture was concentrated under reduced pressure to provide compound 2, which was used directly in the next step without further purification.

A solution of compound 2, prepared as described above, and compound 1 (0.5 mmol), prepared as described above, in 1.5 mL of 2-methoxymethylether was stirred at about 75° C. for about 12 h. The solution was cooled to room temperature and purified using direct flash chromatography on a silica gel column eluted with a gradient elution from 1:10 ethyl acetate:hexane to 1:1 ethyl acetate:hexane to provide Compound AAA (62% yield).

The identity of compound AAA was confirmed using 1H NMR.

Compound AAA: 1H NMR (CDCl3) δ 9.19 (dd, J=1.5, 4.7 Hz, 1H), 6.62 (dd, J=1.5, 7.8 Hz, 1H), 7.38 (d, J=8.5 Hz, 2H), 7.18 (b, 1H), 7.01 (d, J=8.5 Hz, 2H), 6.91 (dd, J=4.7, 7.8 Hz, 1H), 3.58 (m, 4H), 3.34 (m, 4H), 1.33 (s, 9H) ppm.

5.2. Example 2 Synthesis of Compound AAI

Compound AAI was prepared by a procedure analogous to that used to prepare Compound AAA except that 4-trifluoromethoxyaniline was used in place of 4-tert-butylaniline (yield 78%).

The identity of compound AAI was confirmed using 1H NMR.

Compound AAI: 1H NMR (CDCl3) δ 8.19 (dd, J=1.6, 4.7 Hz, 1H), 7.62 (dd, J=1.6, 7.8 Hz, 1H), 7.26 (b, 1H), 7.24 (d, J=9.0 Hz, 2H), 7.12 (d, J=9.0 Hz, 2H), 6.92 (dd, J=4.7 Hz, 1H), 3.59 (m, 4H), 3.35 (m, 4H) ppm.

5.3. Example 3 Synthesis of Compound AAG

Compound AAG was prepared by a procedure analogous to that used to prepare Compound AAA except that 4-trifluoromethylaniline was used in place of 4-tert-butylaniline (yield 61%).

The identity of compound AAG was confirmed using NMR.

Compound AAG: NMR (CDCl3) δ 8.19 (dd, J=1.6, 4.7 Hz, 1H), 7.62 (dd, J=1.6, 7.8 Hz, 1H), 7.26 (b, 1H), 7.24 (d, J=9.0 Hz, 2H), 7.12 (d, J=9.0 Hz, 2H), 6.92 (dd, J=4.7 Hz, 1H), 3.59 (m, 4H), 3.35 (m, 41-1) ppm.

5.4. Example 4 Synthesis of Compound DEY

To a solution of 2-(1-cyclohexenyl)-ethylamine 3 (125.2 mg, 1.0 mmol) in 2-methoxyethyl ether (2.0 mL) was added diphenylcyanocarbodimidate (commercially available from Sigma-Aldrich, St. Louis, Mo. (www.sigma-aldrich.com)) (238.2 mg, 1.0 mmol) at room temperature. The resultant reaction mixture was heated to about 80° C. and allowed to stir at 80° C. for about 5 h. (R)-1-(3-chloro-pyridin-2-yl)-3-methylpiperazine 4 (211.6 mg, 1.0 mmol) was added to the reaction mixture and the reaction mixture was heated to about 140° C. and allowed to stir at about 140° C. for about 12 h. The reaction mixture was then cooled to room temperature and purified using flash chromatography on a silica gel column eluted with ethyl acetate/hexane (10:90 to 50:50) to provide compound DEY as a slightly yellow product.

Compound 4 was prepared by a procedure analogous to that used to prepare Compound 1, as described above in Example 1, except that (R)-3-methylpiperazine (commercially available from Sigma-Aldrich, St. Louis, Mo. (www.sigma-aldrich.com)) was used in place of piperazine.

The identity of compound DEY was confirmed using 1H NMR and mass spectroscopy (MS).

Compound DEY: 1H NMR (CDCl3) δ 8.20 (dd, J=1.8, 4.9 Hz, 1H), 7.63 (dd, J=1.8, 7.8 Hz, 1H), 6.91 (dd, J=4.9, 7.8 Hz, 1H), 5.61 (br, s, 1H), 4.80 (m, 1H), 4.32 (m, 1H), 3.80 (m, 3H), 3.63 (m, 2H), 3.42 (m, 1H), 3.10 (m, 1H), 3.00 (m, 1H), 2.31 (m, 1H), 2.05 (m, 2H), 1.96 (m, 2H), 1.64 (m, 5H), 1.43 (m, 3H) ppm.

MS: m/e 387.6

5.5. Example 5 Binding of Cyanoiminopiperazine Compounds to mGluR5

The following assay can be used to demonstrates Cyanoiminopipereazine Compounds that bind to and modulate the activity of mGluR5.

Cell cultures: Primary glial cultures are prepared from cortices of Sprague-Dawley 18 days old embryos. The cortices are dissected and then dissociated by trituration. The resulting cell homogenate is plated onto poly-D-lysine precoated T175 flasks (BIOCOAT, commercially available from Becton Dickinson and Company Inc. of Franklin Lakes, N.J.) in Dulbelcco's Modified Eagle's Medium (“DMEM,” pH 7.4), buffered with 25 mM HEPES, and supplemented with 15% fetal calf serum (“FCS,” commercially available from Hyclone Laboratories Inc. of Omaha, Nebr.), and incubated at 37° C. and 5% CO2. After 24 hours, FCS supplementation is reduced to 10%. On day six, oligodendrocytes and microglia are removed by strongly tapping the sides of the flasks. One day following this purification step, secondary astrocyte cultures are established by subplating onto 96 poly-D-lysine precoated T175 flasks (BIOCOAT) at a density of 65,000 cells/well in DMEM and 10% FCS. After 24 hours, the astrocytes are washed with serum free medium and then cultured in DMEM, without glutamate, supplemented with 0.5% FCS, 20 mM HEPES, 10 ng/mL epidermal growth factor (“EGF”), 1 mM sodium pyruvate, and 1× penicillin/streptomycin at pH 7.5 for 3 to 5 days at 37° C. and 5% CO2. The procedure allows the expression of the mGluR5 receptor by astrocytes, as demonstrated by S. Miller et al., J. Neuroscience 15(9):6103-6109 (1995).

Assay Protocol: After 3-5 days incubation with EGF, the astrocytes are washed with 127 mM NaCl, 5 mM KCl, 2 mM MgCl2, 700 mM NaH2PO4, 2 mM CaCl2, 5 mM NaHCO3, 8 mM HEPES, 10 mM Glucose at pH 7.4 (“Assay Buffer”) and loaded with the dye Fluo-4 (commercially available from Molecular Probes Inc. of Eugene, Oreg.) using 0.1 mL of Assay Buffer containing Fluo-4 (3 mM final). After 90 minutes of dye loading, the cells are then washed twice with 0.2 mL Assay Buffer and resuspended in 0.1 mL of Assay Buffer. The plates containing the astrocytes are then transferred to a Fluorometric Imaging Plate reader (commercially available from Molecular Devices Corporation of Sunnyvale, Calif.) for the assessment of calcium mobilization flux in the presence of glutamate and in the presence or absence of antagonist. After monitoring fluorescence for 15 seconds to establish a base line, DMSO solutions containing various concentrations of a Cyanoiminopipereazine Compound diluted in Assay Buffer (0.05 mL of 4× dilutions for competition curves) are added to the cell plate and fluorescence is monitored for 2 minutes. 0.05 mL of a 4× glutamate solution (agonist) is then added to each well to provide a final glutamate concentration in each well of 10 mM. Plate fluorescence is then monitored for an additional 60 seconds after agonist addition. The final DMSO concentration in the assay is 1.0%. In each experiment, fluorescence is monitored as a function of time and the data analyzed using Microsoft Excel and GraphPad Prism. Dose-response curves are fit using a non-linear regression to determine IC50 value. In each experiment, each data point is determined two times. The assay results will demonstrate that Cyanoiminopipereazine Compounds bind to and modulate the activity of mGluR5.

5.6 Example 6 Binding of Cyanoiminopiperazine Compounds to mGluR5

Alternatively, the following assay can be used to demonstrate that a Cyanoiminopiperazine Compound binds to and modulates the activity of mGluR5.

40,000 CHO-rat mGluR5 cells/well are plated into 96 well plate (Costar 3409, Black, clear bottom, 96 well, tissue culture treated) for an overnight incubation in Dulbecco's Modified Eagle's Medium (DMEM, pH 7.4) and supplemented with glutamine, 10% FBS, 1% Pen/Strep, and 500 ug/mL Geneticin. CHO-rat mGluR5 cells are washed and treated with Optimem medium and were incubated for 1-4 hours prior to loading cells. Cell plates are washed with loading buffer (127 mM NaCl, 5 mM KCl, 2 mM MgCl2, 700 μM Na H2PO4, 2 mM CaCl2, 5 mM NaHCO3, 8 mM Hepes, and 10 mM glucose, pH 7.4) and incubated with 3 μM Fluo 4 (commercially available from Molecular probes Inc. of Eugene, Oreg.) in 0.1 mL of loading buffer. After 90 minutes of dye loading, the cells are washed twice with 0.2 mL loading buffer and resuspended in 0.1 mL loading buffer.

The plates containing the CHO-rat mGluR5 cells are transferred to a Fluorometric Imaging Plate Reader (FLIPR) (commercially available from Molecular Devices Corporation of Sunnyvale, Calif.) for the assessment of calcium mobilization flux in the presence of glutamate and in the presence or absence of test compounds. After monitoring fluorescence for 15 seconds to establish a baseline, DMSO solutions containing various concentrations of the test compound diluted in loading buffer (0.05 mL of 4× dilutions for the competition curves) are added to the cell plate and fluorescence was monitored for 2 minutes. 0.05 mL of 4× glutamate solution (agonist) is then added to each well to provide a final glutamate concentration in each well of 10 uM. Plate fluorescence is then monitored for an additional 60 seconds after agonist addition. The final DMSO concentration in the assay is 1.0%. In each experiment, fluorescence is monitored as a function of time and the data analyzed using Microsoft Excel and GraphPad Prism. Dose-response curves are fit using a non-linear regression to determine the IC50 value. In each experiment, each data point is determined at least two times.

5.7. Example 7 In Vivo Assays for Prevention or Treatment of Pain

Test Animals Each experiment uses rats weighing between 200-260 g at the start of the experiment. The rats are group-housed and have free access to food and water at all times, except prior to oral administration of a Cyanoiminopiperazine Compound when food is removed for 16 hours before dosing. A control group acts as a comparison to rats treated with a Cyanoiminopiperazine Compound. The control group is administered the carrier for the Cyanoiminopiperazine Compound. The volume of carrier administered to the control group is the same as the volume of carrier and Cyanoiminopiperazine Compound administered to the test group.

Acute Pain To assess the actions of the Cyanoiminopiperazine Compounds for the treatment or prevention of acute pain the rat tail flick test can be used. Rats are gently restrained by hand and the tail exposed to a focused beam of radiant heat at a point 5 cm from the tip using a tail flick unit (Model 7360, commercially available from Ugo Basile of Italy). Tail flick latencies are defined as the interval between the onset of the thermal stimulus and the flick of the tail. Animals not responding within 20 seconds are removed from the tail flick unit and assigned a withdrawal latency of 20 seconds. Tail flick latencies are measured immediately before (pre-treatment) and 1, 3, and 5 hours following administration of a Cyanoiminopiperazine Compound. Data are expressed as tail flick latency(s) and the percentage of the maximal possible effect (% MPE), i.e., 20 seconds, is calculated as follows:

% M P E = [ ( post administration latency ) - ( pre - administration latency ) ] ( 20 s pre - administration latency ) × 100

The rat tail flick test is described in F. E. D'Amour et al., “A Method for Determining Loss of Pain Sensation,” J. Pharmacol. Exp. Ther. 72:74-79 (1941). The results show that Cyanoiminopiperazine Compounds are useful for treating or preventing acute pain.

Acute pain can also be assessed by measuring the animal's response to noxious mechanical stimuli by determining the paw withdrawal threshold (“PWT”), as described below.

Inflammatory Pain: To assess the actions of the Cyanoiminopiperazine Compounds for the treatment or prevention of inflammatory pain the Freund's complete adjuvant (“FCA”) model of inflammatory pain is used. FCA-induced inflammation of the rat hind paw is associated with the development of persistent inflammatory mechanical hyperalgesia and provides reliable prediction of the anti-hyperalgesic action of clinically useful analgesic drugs (L. Bartho et al., “Involvement of Capsaicin-sensitive Neurones in Hyperalgesia and Enhanced Opioid Antinociception in Inflammation,” Naunyn-Schmiedeberg's Archives of Pharmacology 342:666-670 (1990)). The left hind paw of each animal is administered a 50 μL intraplantar injection of 50% FCA. 24 hour post injection, the animal is assessed for response to noxious mechanical stimuli by determining the PWT, as described below. Rats are then administered a single injection of 1, 3, 10 or 30 mg/Kg of either a Cyanoiminopiperazine Compound, 30 mg/Kg of a control selected from indomethacin, Celebrex or naproxen or carrier. Responses to noxious mechanical stimuli are then determined 1, 3, 5, and 24 hours post administration. Percentage reversal of hyperalgesia for each animal is defined as:

% Reversal = [ ( post administration P W T ) - ( pre - administration P W T ) ] [ ( Baseline P W T ) - ( pre - administration P W T ) ] × 100

The results show that the Cyanoiminopiperazine Compounds are useful for treating or preventing inflammatory pain.

Neuropathic Pain: To assess the actions of the Cyanoiminopiperazine Compounds for the treatment or prevention of neuropathic pain either the Seltzer model or the Chung model can be used.

In the Seltzer model, the partial sciatic nerve ligation model of neuropathic pain is used to produce neuropathic hyperalgesia in rats (Z. Seltzer et al., “A Novel Behavioral Model of Neuropathic Pain Disorders Produced in Rats by Partial Sciatic Nerve Injury,” Pain 43:205-218 (1990)). Partial ligation of the left sciatic nerve is performed under isoflurane/O2 inhalation anaesthesia. Following induction of anesthesia, the left thigh of the rat is shaved and the sciatic nerve exposed at high thigh level through a small incision and is carefully cleared of surrounding connective tissues at a site near the trocanther just distal to the point at which the posterior biceps semitendinosus nerve branches off of the common sciatic nerve. A 7-0 silk suture is inserted into the nerve with a ⅜ curved, reversed-cutting mini-needle and tightly ligated so that the dorsal ⅓ to ½ of the nerve thickness is held within the ligature. The wound is closed with a single muscle suture (4-0 nylon (Vicryl)) and a Vetbond surgical glue. Following surgery, the wound area is dusted with antibiotic powder. Sham-treated rats undergo an identical surgical procedure except that the sciatic nerve is not manipulated. Following surgery, animals are weighed and placed on a warm pad until they recover from anesthesia. Animals are then returned to their home cages until behavioral testing begins. The animal is assessed for response to noxious mechanical stimuli by determining PWT, as described below, prior to surgery (baseline), then immediately prior to and 1, 3, and 5 hours after drug administration for the left rear paw of the animal. Percentage reversal of neuropathic hyperalgesia is defined as:

% Reversal = [ ( post administration P W T ) - ( pre - administration P W T ) ] [ ( Baseline P W T ) - ( pre - administration P W T ) ] × 100

In the Chung model, the spinal nerve ligation model of neuropathic pain is used to produce mechanical hyperalgesia, thermal hyperalgesia and tactile allodynia in rats. Surgery is performed under isoflurane/O2 inhalation anaesthesia. Following induction of anaesthesia a 3 cm incision is made and the left paraspinal muscles are separated from the spinous process at the L4-S2 levels. The L6 transverse process is carefully removed with a pair of small rongeurs to identify visually the L4-L6 spinal nerves. The left L5 (or L5 and L6) spinal nerve(s) is isolated and tightly ligated with silk thread. A complete hemostasis is confirmed and the wound is sutured using non-absorbable sutures, such as nylon sutures or stainless steel staples. Sham-treated rats undergo an identical surgical procedure except that the spinal nerve(s) is not manipulated. Following surgery animals are weighed, administered a subcutaneous (s.c.) injection of saline or ringers lactate, the wound area is dusted with antibiotic powder and they are kept on a warm pad until they recover from the anesthesia. Animals are then returned to their home cages until behavioral testing begins. The animals are assessed for response to noxious mechanical stimuli by determining PWT, as described below, prior to surgery (baseline), then immediately prior to and 1, 3, and 5 hours after being administered a Cyanoiminopiperazine Compound for the left rear paw of the animal. The animal can also be assessed for response to noxious thermal stimuli or for tactile allodynia, as described below. The Chung model for neuropathic pain is described in S. H. Kim, “An Experimental Model for Peripheral Neuropathy Produced by Segmental Spinal Nerve Ligation in the Rat,” Pain 50(3):355-363 (1992). The results will show that Cyanoiminopiperazine Compounds are useful for treating or preventing neuropathic pain.

Response to Mechanical Stimuli as an Assessment of Mechanical Hyperalgesia: The paw pressure assay can be used to assess mechanical hyperalgesia. For this assay, hind paw withdrawal thresholds (PWT) to a noxious mechanical stimulus are determined using an analgesymeter (Model 7200, commercially available from Ugo Basile of Italy) as described in C. Stein, “Unilateral Inflammation of the Hindpaw in Rats as a Model of Prolonged Noxious Stimulation: Alterations in Behavior and Nociceptive Thresholds,” Pharmacology Biochemistry and Behavior 31:451-455 (1988). The maximum weight that can be applied to the hind paw is set at 250 g and the end point is taken as complete withdrawal of the paw. PWT is determined once for each rat at each time point and only the affected (ipsilateral) paw is tested.

Response to Thermal Stimuli as an Assessment of Thermal Hyperalgesia: The plantar test can be used to assess thermal hyperalgesia. For this test, hind paw withdrawal latencies to a noxious thermal stimulus are determined using a plantar test apparatus (commercially available from Ugo Basile of Italy) following the technique described by K. Hargreaves et al., “A New and Sensitive Method for Measuring Thermal Nociception in Cutaneous Hyperalgesia,” Pain 32(1):77-88 (1988). The maximum exposure time is set at 32 seconds to avoid tissue damage and any directed paw withdrawal from the heat source is taken as the end point. Three latencies are determined at each time point and averaged. Only the affected (ipsilateral) paw is tested.

Assessment of Tactile Allodynia: To assess tactile allodynia, rats are placed in clear, plexiglass compartments with a wire mesh floor and allowed to habituate for a period of at least 15 minutes. After habituation, a series of von Frey monofilaments are presented to the plantar surface of the left (operated) foot of each rat. The series of von Frey monofilaments consists of six monofilaments of increasing diameter, with the smallest diameter fiber presented first. Five trials are conducted with each filament with each trial separated by approximately 2 minutes. Each presentation lasts for a period of 4-8 seconds or until a nociceptive withdrawal behavior is observed. Flinching, paw withdrawal or licking of the paw are considered nociceptive behavioral responses.

5.8. Example 8 In Vivo Assays for Prevention or Treatment of Anxiety

The elevated plus maze test or the shock-probe burying test can be used to assess the anxiolytic activity of Cyanoiminopipereazine Compounds in rats or mice.

The Elevated Plus Maze Test: The elevated plus maze consists of a platform with 4 arms, two open and two closed (50×10×50 cm enclosed with an open roof). Rats (or mice) are placed in the center of the platform, at the crossroad of the 4 arms, facing one of the closed arms. Time spent in the open arms vs the closed arms and number of open arm entries during the testing period are recorded. This test is conducted prior to drug administration and again after drug administration. Test results are expressed as the mean time spent in open arms and the mean number of entries into open arms. Known anxiolytic drugs increase both the time spent in open arms and number of open arm entries. The elevated plus maze test is described in D. Treit, “Animal Models for the Study of Anti-anxiety Agents: A Review,” Neuroscience & Biobehavioral Reviews 9(2):203-222 (1985).

The Shock-Probe Burying Test: For the shock-probe burying test the testing apparatus consists of a plexiglass box measuring 40×30×40 cm, evenly covered with approximately 5 cm of bedding material (odor absorbent kitty litter) with a small hole in one end through which a shock probe (6.5 cm long and 0.5 cm in diameter) is inserted. The plexiglass shock probe is helically wrapped with two copper wires through which an electric current is administered. The current is set at 2 mA. Rats are habituated to the testing apparatus for 30 min on 4 consecutive days without the shock probe in the box. On test day, rats are placed in one corner of the test chamber following drug administration. The probe is not electrified until the rat touches it with its snout or fore paws, at which point the rat receives a brief 2 mA shock. The 15 min testing period begins once the rat receives its first shock and the probe remains electrified for the remainder of the testing period. The shock elicits burying behavior by the rat. Following the first shock, the duration of time the rat spends spraying bedding material toward or over the probe with its snout or fore paws (burying behavior) is measured as well as the number of contact-induced shocks the rat receives from the probe. Known anxiolytic drugs reduce the amount of burying behavior. In addition, an index of the rat's reactivity to each shock is scored on a 4 point scale. The total time spent immobile during the 15 min testing period is used as an index of general activity. The shock-probe burying test is described in D. Treit, 1985, supra. The results of this test will demonstrate that Cyanoiminopipereazine Compounds are useful for treating or preventing anxiety.

5.9. Example 9 In Vivo Assays for Prevention or Treatment of an Addictive Disorder

The conditioned place preference test or drug self-administration test can be used to assess the ability of Cyanoiminopipereazine Compounds to attenuate the rewarding properties of known drugs of abuse.

The Conditioned Place Preference Test: The apparatus for the conditioned place preference test consists of two large compartments (45×45×30 cm) made of wood with a plexiglass front wall. These two large compartments are distinctly different. Doors at the back of each large compartment lead to a smaller box (36×18×20 cm) box made of wood, painted grey, with a ceiling of wire mesh. The two large compartments differ in terms of shading (white vs black), level of illumination (the plexiglass door of the white compartment is covered with aluminum foil except for a window of 7×7 cm), texture (the white compartment has a 3 cm thick floor board (40×40 cm) with nine equally spaced 5 cm diameter holes and the black has a wire mesh floor), and olfactory cues (saline in the white compartment and 1 mL of 10% acetic acid in the black compartment). On habituation and testing days, the doors to the small box remain open, giving the rat free access to both large compartments.

The first session that a rat is placed in the apparatus is a habituation session and entrances to the smaller grey compartment remain open giving the rat free access to both large compartments. During habituation, rats generally show no preference for either compartment. Following habituation, rats are given 6 conditioning sessions. Rats are divided into 4 groups: carrier pre-treatment+carrier (control group), Cyanoiminopipereazine Compound pre-treatment+carrier, carrier pre-treatment+morphine, Cyanoiminopipereazine Compound pre-treatment+morphine. During each conditioning session the rat is injected with one of the drug combinations and confined to one compartment for 30 min. On the following day, the rat receives a carrier+carrier treatment and is confined to the other large compartment. Each rat receives three conditioning sessions consisting of 3 drug combination-compartment and 3 carrier-compartment pairings. The order of injections and the drug/compartment pairings are counterbalanced within groups. On the test day, rats are injected prior to testing (30 min to 1 hour) with either morphine or carrier and the rat is placed in the apparatus, the doors to the grey compartment remain open and the rat is allowed to explore the entire apparatus for 20 min. The time spent in each compartment is recorded. Known drugs of abuse increase the time spent in the drug-paired compartment during the testing session. If the Cyanoiminopipereazine Compound blocks the acquisition of morphine conditioned place preference (reward), there will be no difference in time spent in each side in rats pre-treated with a Cyanoiminopipereazine Compound and the group will not be different from the group of rats that was given carrier+carrier in both compartments. Data will be analyzed as time spent in each compartment (drug combination-paired vs carrier-paired). Generally, the experiment is repeated with a minimum of 3 doses of a Cyanoiminopipereazine Compound.

The Drug Self-Administration Test: The apparatus for the drug self-administration test is a standard commercially available operant conditioning chamber. Before drug trials begin rats are trained to press a lever for a food reward. After stable lever pressing behavior is acquired, rats are tested for acquisition of lever pressing for drug reward. Rats are implanted with chronically indwelling jugular catheters for i.v. administration of compounds and are allowed to recover for 7 days before training begins. Experimental sessions are conducted daily for 5 days in 3 hour sessions. Rats are trained to self-administer a known drug of abuse, such as morphine. Rats are then presented with two levers, an “active” lever and an “inactive” lever. Pressing of the active lever results in drug infusion on a fixed ratio 1 (FR1) schedule (i.e., one lever press gives an infusion) followed by a 20 second time out period (signaled by illumination of a light above the levers). Pressing of the inactive lever results in infusion of excipient. Training continues until the total number of morphine infusions stabilizes to within ±10% per session. Trained rats are then used to evaluate the effect of Cyanoiminopipereazine Compounds pre-treatment on drug self-administration. On test day, rats are pre-treated with a Cyanoiminopipereazine Compound or excipient and then are allowed to self-administer drug as usual. If the Cyanoiminopipereazine Compound blocks the rewarding effects of morphine, rats pre-treated with the Cyanoiminopipereazine Compound will show a lower rate of responding compared to their previous rate of responding and compared to excipient pre-treated rats. Data is analyzed as the change in number of drug infusions per testing session (number of infusions during test session—number of infusions during training session). The results will demonstrate that Cyanoiminopipereazine Compounds are useful for treating or preventing an addictive disorder.

5.10. Example 10 Functional Assay for Characterizing mGluR1 Antagonistic Properties

Functional assays for the characterization of mGluR1 antagonistic properties are well known in the art. For example, the following procedure can be used.

cDNA encoding rat mGluR1a receptor is obtained from, e.g., Prof. S, Nakanishi (Kyoto, Japan). It is transiently transfected into HEK-EBNA cells using a procedure described by Schlaeger et al., New Dev. New Appl. Anim. Cell Techn., Proc. ESACT Meet., 15th a (1998), 105-112 and 117-120. [Ca2+] measurements are performed on mGluR1a transfected HEK-EBNA cells after incubation of the cells with Fluo-3 AM (0.5 μM final concentration) for 1 hour at 37° C. followed by 4 washes with assay buffer (DMEM supplemented with Hank's salt and 20 mM HEPES. [Ca2+] measurements are done using a fluorometric imaging plate reader, e.g., FLIPR from Molecular Devices Corporation, La Jolla, Calif. 10 μM glutamate as agonist is used to evaluate the potency of the antagonists.

Increasing concentrations of antagonists are applied to the cells 5 minutes prior to application of the agonist. The inhibition (antagonists) curves are fitted with appropriate software, for example, the four-parameter logistic equation giving IC50 and Hill coefficient using the iterative nonlinear curve fitting software Origin from Microcal Software Inc., Northampton, Mass. The results of this assay will demonstrate that Cyanoiminopipereazine Compounds bind to and modulate the activity of mGluR1.

5.11. Example 11 Binding of Cyanoiminopiperazine Compounds to VR1

Methods for assaying compounds capable of inhibiting VR1 are well known to those skilled in the art, for example, those methods disclosed in U.S. Pat. No. 6,239,267 to Duckworth et al.; U.S. Pat. No. 6,406,908 to McIntyre et al.; or U.S. Pat. No. 6,335,180 to Julius et al. The results of these assays will demonstrate that Cyanoiminopiperazine Compounds bind to and modulate the activity of VR1.

Binding of Compound DEY to VR1: Assay Protocol

Human VR1 cloning. Human spinal cord RNA (commercially available from Clontech, Palo Alto, Calif.) was used. Reverse transcription was conducted on 1.0 μg total RNA using Thermoscript Reverse Transcriptase (commercially available from Invitrogen, Carlsbad, Calif.) and oligo dT primers as detailed in its product description. Reverse transcription reactions were incubated at 55° C. for 1 h, heat-inactivated at 85° C. for 5 min, and RNase H-treated at 37° C. for 20 min.

Human VR1 cDNA sequence was obtained by comparison of the human genomic sequence, prior to annotation, to the published rat sequence. Intron sequences were removed and flanking exonic sequences were joined to generate the hypothetical human cDNA. Primers flanking the coding region of human VR1 were designed as follows: forward primer, GAAGATCTTCGCTGGTTGCACACTGGGCCACA; and reverse primer, GAAGATCTTCGGGGACAGTGACGGTTGGATGT.

PCR of VR1 was performed on one tenth of the Reverse transcription reaction mixture using Expand Long Template Polymerase and Expand Buffer 2 in a final volume of 50 μL according to the manufacturer's instructions (Roche Applied Sciences, Indianapolis, Ind.). After denaturation at 94° C. for 2 mM PCR amplification was performed for 25 cycles at 94° C. for 15 sec, 58° C. for 30 sec, and 68° C. for 3 min followed by a final incubation at 72° C. for 7 mM to complete the amplification. A PCR product of ˜2.8 kb was gel-isolated using a 1.0% agarose, Tris-Acetate gel containing 1.6 μg/mL of crystal violet and purified with a S.N.A.P. UV-Free Gel Purification Kit (commercially available from Invitrogen). The VR1 PCR product was cloned into the pIND/V5-His-TOPO vector (commercially available from Invitrogen) according to the manufacturer's instructions. DNA preparations, restriction enzyme digestions, and preliminary DNA sequencing were performed according to standard protocols. Full-length sequencing confirmed the identity of the human VR1.

Generation of inducible cell lines. Unless noted otherwise, cell culture reagents were purchased from Life Technologies of Rockville, Md. HEK293-EcR cells expressing the ecdysone receptor (commercially available from Invitrogen) were cultured in Growth Medium (Dulbecco's Modified Eagles Medium containing 10% fetal bovine serum (commercially available from HYCLONE, Logan, Utah), 1× penicillin/streptomycin, 1× glutamine, 1 mM sodium pyruvate and 400 μg/mL Zeocin (commercially available from Invitrogen)). The VR1-pIND constructs were transfected into the HEK293-EcR cell line using Fugene transfection reagent (commercially available from Roche Applied Sciences, Basel, Switzerland). After 48 h, cells were transferred to Selection Medium (Growth Medium containing 300 μg/mL G418 (commercially available from Invitrogen)). Approximately 3 weeks later individual Zeocin/G418 resistant colonies were isolated and expanded. To identify functional clones, multiple colonies were plated into 96-well plates and expression was induced for 48 h using Selection Medium supplemented with 5 μM ponasterone A (“PonA”) (commercially available from Invitrogen). On the day of assay, cells were loaded with Fluo-4 (a calcium-sensitive dye that is commercially available from Molecular Probes, Eugene, Oreg.) and CAP-mediated calcium influx was measured using a Fluorometric Imaging Plate Reader (“FLIPR”) (commercially available from Molecular Devices Corp., Sunnyvale, Calif.) as described below. Functional clones were re-assayed, expanded, and cryopreserved.

pH-Based Assay. Two days prior to performing this assay, cells were seeded on poly-D-lysine-coated 96-well clear-bottom black plates (commercially available from Becton-Dickinson) at 75,000 cells/well in growth media containing 5 μM PonA (commercially available from Invitrogen) to induce expression. On the day of the assay, the plates were washed with 0.2 mL 1× Hank's Balanced Salt Solution (commercially available from Life Technologies) containing 1.6 mM CaCl2 and 20 mM HEPES, pH 7.4 (“wash buffer”), and loaded using 0.1 mL of wash buffer containing Fluo-4 (3 μM final concentration, commercially available from Molecular Probes). After 1 h, the cells were washed twice with 0.2 mL wash buffer and resuspended in 0.05 mL 1× Hank's Balanced Salt Solution (commercially available from Life Technologies) containing 3.5 mM CaCl2 and 10 mM Citrate, pH 7.4 (“assay buffer”). Plates were then transferred to a FLIPR (commercially available from Molecular Devices) for assay. Compound DEY was diluted in assay buffer, and 50 mL of the resultant solution were added to the cell plates and the solution monitored for two minutes. The final concentration of Compound DEY ranged from about 50 pM to about 3 μM. Agonist buffer (wash buffer titrated with 1N HCl to provide a solution having a pH of 5.5 when mixed 1:1 with assay buffer) (0.1 mL) was then added to each well, and the plates were incubated for 1 additional minute. Data were collected over the entire time course and analyzed using Excel and Graph Pad Prism. Compound DEY when assayed according to this protocol had an IC50 of 196.7±39.8 nM (n+3).

Capsaicin-based Assay. Two days prior to performing this assay, cells were seeded in poly-D-lysine-coated 96-well clear-bottom black plates (50,000 cells/well) in growth media containing 5 μM PonA (commercially available from Invitrogen) to induce expression. On the day of the assay, the plates were washed with 0.2 mL 1× Hank's Balanced Salt Solution (commercially available from Life Technologies) containing 1 mM CaCl2 and 20 mM HEPES, pH 7.4, and cells were loaded using 0.1 mL of wash buffer containing Fluo-4 (3 μM final). After one hour, the cells were washed twice with 0.2 mL of wash buffer and resuspended in 0.1 mL of wash buffer. The plates were transferred to a FLIPR (commercially available from Molecular Devices) for assay. 50 μl of Compound DEY diluted with assay buffer were added to the cell plates and incubated for 2 min. The final concentration of Compound DEY ranged from about 50 pM to about 3 μM. Human VR1 was activated by the addition of 50 μL of capsaicin (400 nM), and the plates were incubated for an additional 3 min. Data were collected over the entire time course and analyzed using Excel and GraphPad Prism. Compound DEY when assayed according to this protocol had an IC50 of 59.4±13.1 nM (n+3).

The results of the pH-based assay and the capsaicin-based assay demonstrate that Compound DEY, an illustrative Cyanoiminopiperazine Compound, binds to and modulates the activity of human VR1.

The present invention is not to be limited in scope by the specific embodiments disclosed in the examples which are intended as illustrations of a few aspects of the invention and any embodiments that are functionally equivalent are within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art and are intended to fall within the scope of the appended claims.

A number of references have been cited, the entire disclosures of which are incorporated herein by reference.

Claims

1. A compound of formula: or a pharmaceutically acceptable salt thereof, wherein:

A is —NR4—, —O—, or —S—;
R1 is —H, -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo);
each R3 is independently: (a) -halo, —CN, —OH, —NO2, or —NH2; (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, —(C3-C7)heterocycle, or —(C7-C10)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or (c) -phenyl, -naphthyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;
R4 is —H, —(C1-C6)alkyl, or —O—(C1-C6)alkyl;
each R5 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;
R6 is -phenyl, -naphthyl, —(C3-C8)cycloalkyl, —(C14)aryl, or —(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R7 groups;
each R7 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), —CH(halo)2, —CN, —OH, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;
each R8 is independently —H, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —(C3-C5)heterocycle, —C(halo)3, —CH2(halo), or —CH(halo)2;
each halo is independently —F, —Cl, —Br, or —I; and
m is an integer ranging from 0 to 2.

2. The compound of claim 1, wherein A is —NH—.

3. The compound of claim 2, wherein:

m is 0; and
R6 is phenyl.

4. The compound of claim 3, wherein the R6 phenyl is unsubstituted.

5. The compound of claim 3, wherein the R6 phenyl is substituted at the 4-position.

6. The compound of claim 5, wherein the R6 phenyl is substituted with a —(C1-C6)alkyl R7 group.

7. The compound of claim 6, wherein the R7—(C1-C6)alkyl is tert-butyl or iso-propyl.

8. The compound of claim 5, wherein the R6 phenyl is substituted with a —CF3 or —OCF3 R7 group.

9. The compound of claim 3, wherein R1 is —Cl or —CH3.

10. The compound of claim 9, wherein the R6 phenyl is unsubstituted.

11. The compound of claim 9, wherein the R6 phenyl is substituted at the 4-position.

12. The compound of claim 11, wherein the R6 phenyl is substituted with a —(C1-C6)alkyl R7 group.

13. The compound of claim 12, wherein the R7—(C1-C6)alkyl is tert-butyl or iso-propyl.

14. The compound of claim 11, wherein the R6 phenyl is substituted with a —CF3 or —OCF3 R7 group.

15. The compound of claim 1, wherein A is —O—.

16. The compound of claim 1, wherein A is —S—.

17. A compound of formula: or a pharmaceutically acceptable salt thereof, wherein:

Ar1 is
Ar2 is
R1 is —H, -halo, —CH3, —NO2, —CN, —OH, —OCH3, —NH2, —C(halo)3, —CH(halo)2, or —CH2(halo);
each R3 is independently: (a) -halo, —CN, —OH, —NO2, or —NH2; (b) —(C1-C10)alkyl, —(C2-C10)alkenyl, —(C2-C10)alkynyl, —(C3-C10)cycloalkyl, —(C8-C14)bicycloalkyl, —(C8-C14)tricycloalkyl, —(C5-C10)cycloalkenyl, —(C8-C14)bicycloalkenyl, —(C8-C14)tricycloalkenyl, -(3- to 7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R5 groups; or (c) -phenyl, -naphthyl, —(C14)aryl, or -(5- to 10-membered)heteroaryl, each of which is unsubstituted or substituted with one or more R6 groups;
each R4 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, -(3- to 5-membered)heterocycle, —C(halo)3, —CH(halo)2, or —CH2(halo);
each R5 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R8)2, —CH═NR8, —NR8OH, —OR8, —COR8, —C(O)OR8, —OC(O)R8, —OC(O)OR8, —SR8, —S(O)R8, or —S(O)2R8;
each R6 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, -(3- to 5-membered)heterocycle, —C(halo)3, —CH(halo)2, —CH2(halo), —CN, —OH, -halo, —N3, —NO2, —CH═NR7, —NR7OH, —OR7, —COR7, —C(O)OR7, —OC(O)R7, —OC(O)OR7, —SR7, —S(O)R7, or —S(O)2R7;
each R7 is independently —H, —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, -(3- to 5-membered)heterocycle, —C(halo)3, —CH(halo)2, or —CH2(halo);
each R8 is independently —(C1-C6)alkyl, —(C2-C6)alkenyl, —(C2-C6)alkynyl, —(C3-C8)cycloalkyl, —(C5-C8)cycloalkenyl, -phenyl, —C(halo)3, —CH(halo)2, —CH2(halo), —CN, —OH, -halo, —N3, —NO2, —CH═NR7, —NR7OH, —OR7, —COR7, —C(O)OR7, —OC(O)R7, —OC(O)OR7, —SR7, —S(O)R7, or —S(O)2R7;
each R11 is independently —CN, —OH, —(C1-C6)alkyl, —(C2-C6)alkenyl, -halo, —N3, —NO2, —N(R7)2, —CH═NR7, —NR7OH, —OR7, —COR7, —C(O)OR7, —OC(O)R7, —OC(O)OR7, —SR7, —S(O)R7, or —S(O)2R7;
each halo is independently —F, —Cl, —Br, or —I;
m is 0 or 1;
o is an integer ranging from 0 to 4;
q is an integer ranging from 0 to 6;
r is an integer ranging from 0 to 5;
s is an integer ranging from 0 to 4;
t is an integer ranging from 0 to 2; and
u is 0 or 1.

18. The compound of claim 17, wherein m is 1, R3 is —CH3, t is 0, and u is 0.

19. The compound of claim 17, wherein m is 1, R3 is —CH3, t is 0, and u is 1.

20. The compound of claim 17, wherein m is 0, t is 0, and u is 0.

21. The compound of claim 17, wherein m is 0, t is 0, and u is 1.

22. The compound of claim 20, wherein Ar2 is phenyl substituted at the 4-position with an R8 group.

23. The compound of claim 22, wherein R8 is —(C1-C6)alkyl.

24. The compound of claim 23, wherein the R8—(C1-C6)alkyl is tert-butyl or iso-butyl.

25. The compound of claim 22, wherein R8 is —CF3 or —OCF3.

26. The compound of claim 22, wherein R1 is —Cl or —CH3.

27. The compound of claim 21, wherein Ar2 is phenyl substituted at the 4-position with an R8 group.

28. The compound of claim 27, wherein R8 is —(C1-C6)alkyl.

29. The compound of claim 28, wherein the R8—(C1-C6)alkyl is tert-butyl or iso-butyl.

30. The compound of claim 27, wherein R8 is —CF3 or —OCF3.

31. The compound of claim 27, wherein R1 is —Cl or —CH3.

32. A composition comprising an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 1 and a pharmaceutically acceptable carrier or excipient.

33. A composition comprising an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 17 and a pharmaceutically acceptable carrier or excipient.

34. A method for preparing a composition, the method comprising admixing a compound or a pharmaceutically acceptable salt of the compound of claim 1 and a pharmaceutically acceptable carrier or excipient.

35. A method for preparing a composition, the method comprising admixing a compound or a pharmaceutically acceptable salt of the compound of claim 17 and a pharmaceutically acceptable carrier or excipient.

36. A method for treating pain in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 1.

37. A method for treating pain in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 17.

38. A method for inhibiting VR1 function in a cell, comprising contacting a cell capable of expressing VR1 with an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 1.

39. A method for inhibiting VR1 function in a cell, comprising contacting a cell capable of expressing VR1 with an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 17.

Patent History
Publication number: 20110281885
Type: Application
Filed: Sep 10, 2010
Publication Date: Nov 17, 2011
Applicant: Purdue Pharma L.P. (Stamford, CT)
Inventors: Donald J. Kyle (Newton, PA), Qun Sun (Princeton, NJ), Laykea Tafesse (Robbinsville, NJ), Chongwu Zhang (Dayton, NJ), Xiaoming Zhou (Plainsboro, NJ)
Application Number: 12/879,885