KALLIKREIN 7 MODULATORS

- NOVARTIS AG

The present invention relates to the crystal structure of the serine protease kallikrein 7 and to the use of this crystal structure in drug discovery. The present invention also relates to compounds binding specifically to this active site of kallikrein 7.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
FIELD OF THE INVENTION

The present invention relates to the crystal structure of the serine protease kallikrein 7 and to the use of this crystal structure in drug discovery. The present invention also relates to compounds binding specifically to this active site of kallikrein 7.

BACKGROUND OF THE INVENTION

Kallikrein 7 is a S1 serine protease of the kallikrein gene family displaying a chymotrypsin like activity. Human kallikrein 7 (hK7, KLK7 or stratum corneum chymotryptic enzyme (SCCE), Swissprot P49862) is mainly expressed in the skin and appears to play an important role in skin physiology (1, 2, 3). hK7 is involved in the degradation of the intercellular cohesive structure in cornified squamous epithelia in the process of desquamation. The desquamation process is well regulated and delicately balanced with the de novo production of corneocytes to maintain a constant thickness of the stratum corneum. In this regard, hK7 is reported to be able to cleave the corneodesmosomal proteins corneodesmosin and desmocollin 1 (4, 5, 6). In addition, recently it has been shown that the two lipid processing enzymes β-glucocerebrosidase and acidic sphingomyelinase can be degraded by hK7 (7). Both lipid processing enzymes are co-secreted with their substrates glucosylceramides and sphingomyelin and process these polar lipid precursors into their more non-polar products e.g. ceramides, which are subsequently incorporated into the extracellular lamellar membranes. The lamellar membrane architecture is critical for a functional skin barrier. Finally, hK7 has been shown to activate the pro-inflammatory cytokine Pro-interleukin-1β (IL-1β) (8) and to (in)activate cathelicidines (hCAP18) which regulate an important defense mechanism to prevent infections against a wide variety of microbial pathogens (34).

Recent studies link an increased activity of hK7 to inflammatory skin diseases like atopic dermatitis, psoriasis or Netherton's syndrome. An increased hK7 activity might lead to an uncontrolled degradation of corneodesmosomes resulting in a miss-regulated desquamation, an enhanced degradation of lipid processing enzymes resulting in a disturbed lamellar membrane architecture or an uncontrolled (in)activation of the pro-inflammatory cytokine IL-1β or the cathilicidin hCAP18. The net result could lead to an impaired skin barrier function and inflammation (see also WO-A-2004/108139).

The hK7 activity is controlled on several levels. Various factors might be responsible for an increased hK7 activity in inflammatory skin diseases. Firstly, the amount of protease being expressed might be influenced by genetic factors. Such a genetic link, a polymorphism in the 3′-UTR in the hK7 gene, was recently described (9). The authors hypothesis that the described 4 base pair insertion in the 3′-UTR of the kallikrein 7 gene stabilizes the hK7 mRNA and results in an overexpression of hK7. Secondly, since hK7 is secreted via lamellar bodies to the stratum corneum extracellular space as zymogen and it is not able to autoactivate, it needs to be activated by another protease e.g. kallikrein 5 (5). Uncontrolled activity of such an activating enzyme might result in an overactivation of hK7. Thirdly, activated hK7 can be inhibited by natural inhibitors like LEKTI, ALP or elafin (10, 11). The decreased expression or the lack of such inhibitors might result in an enhanced activity of hK7. Recently it was found, that mutations in the spink5 gene, coding for LEKTI, are causative for Netherton's syndrome (12) and a single point mutation in the gene is linked to atopic dermatitis (13, 14). Finally, another level of controlling the activity of hK7 is the pH. hK7 has a neutral to slightly alkaline pH optimum (2) and there is a pH gradient from neutral to acidic from the innermost to the outermost layers in the skin. Environmental factors like soap might result in a pH increase in the outermost layers of the stratum corneum towards the pH optimum of hK7 thereby increasing the hK7 activity.

The hypothesis that an increased activity of hK7 is linked to inflammatory skin diseases is supported by the following studies: Firstly, Netherton's syndrome patients show a phenotype dependent increase in serine protease activity, a decrease in corneodesmosomes, a decrease in the lipid processing enzymes (3-glucocerebrosidase and acidic sphingomyelinase, and an impaired barrier function (15, 16). Secondly, a transgenic mice overexpressing human kallikrein 7 shows a skin phenotype similar to that found in patients with atopic dermatitis (17, 18, 19). Thirdly, in the skin of atopic dermatitis and psoriasis patients elevated levels of hK7 were described (17, 20).

Therefore, hK7 is considered to be a potential target for the treatment of inflammatory skin diseases like atopic dermatitis, psoriasis or Netherton's syndrome and there is a need for specific modulators (agonists or inhibitors) thereof.

In order to fulfill this need, the present inventors have developed methods for cloning, expression, purification and crystallization of hK7, and have been able to obtain for the first time the structure of human kallikrein 7 at a very high resolution.

This structure of human kallikrein 7 at a very high resolution has allowed for the identification of the active site of the enzyme, and compounds binding specifically to said active site of kallikrein 7.

SUMMARY OF THE INVENTION

In order to fulfill the needs identified herein-above, the present inventors have developed methods for cloning, expression, purification and crystallization of hK7, and have been able to obtain for the first time the structure of human kallikrein 7 at a very high resolution. The obtained structure of human kallikrein 7 at a very high resolution has allowed to identify the active site of the enzyme and compounds binding specifically to said active site of kallikrein 7. The present inventors have furthermore been able to confirm that these compounds have a modulatory effect on kallikrein 7.

The present invention thus pertains to a crystal of human kallikrein 7 comprising the binding pocket having a three-dimensional structure characterized by the structure coordinates of Table 3 below. This crystal can also comprise a co-crystallised ligand.

The present invention also pertains to a computer readable medium comprising data storage material encoded with computer readable data wherein said data comprises the structure coordinates of a crystal according to the invention, and to the use of this crystal for the generation of crystal structure data.

Another embodiment of the present invention is a method of identifying a ligand that binds to kallikrein 7, this method comprising the steps of (i) using the three dimensional structure data generated according to the invention to select and/or design a potential ligand that binds to kallikrein 7, and (ii) identifying among the potential ligand selected in step (i), those ligands that bind to kallikrein 7 in an in vitro, in vivo or cell-based assay.

Yet another embodiment of the present invention relates to a modulator of kallikrein 7 characterised in that it binds in the binding pocket having a three-dimensional structure characterized by the structure coordinates of Table 3. This modulator of kallikrein 7 can be a compound of formula

wherein

    • R1 is hydrogen, cyano, (C1-8)alkyl, (C2-8)alkenyl, (C2-8)alkynyl, halogen, (C1-8)alkylamino, (C1-8)alkylamino(C1-8)alkyl, (C1-8)alkoxy, halo(C1-8)alkyl,
    • X is CH═CH, NH, N═CH, O or S,
    • Y is a group of formula

    • wherein
      • the N-containing ring system is optionally annelated with (C3-8)cycloalkyl, (C8-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S,
      • n is 1, 2 or 3,
      • R2 is
        • (C1-8)alkyl, (C1-8)alkylamino, (C1-8)alkylamino(C1-8)alkyl, di(C1-8)alkylamino(C1-8)alkyl, halo(C1-8)alkyl, (C1-8)alkoxy, (C1-8)alkoxy(C1-8)alkyl, or
        • (CH2)m-Z, wherein Z is unsubstituted or substituted (C3-8)cycloalkyl, (C6-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S and m is 0, 1 or 2,
      • R3 is hydrogen, (C1-8)alkyl, (C1-8)alkoxy, (C6-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S.

In particular, this modulator can be a compound, wherein

    • R1 is hydrogen, ethynyl, chloro or bromo,
    • X is CH═CH or S,
    • Y is a group of formula (II), wherein
      • the N-containing ring system is optionally annelated with cyclopropyl, cyclopentyl or phenyl,
      • n is 1 or 2,
      • R2 is (C1-8)alkyl, (C1-4)alkylamino, di(C1-4)alkylamino(C1-4)alkyl, (C1-4)alkoxy, (C1-4)alkoxy(C1-4)alkyl or
      • a group (CH2)m-Z, wherein Z is unsubstituted cyclohexyl, unsubstituted phenyl, phenyl substituted by (C1-4)alkoxy, phenyl substituted by heterocyclyl having 6 ring members and 1 or 2 heteroatoms selected from N, O, or
      • unsubstituted or substituted heterocyclyl having 6 ring members and 1 or 2 heteroatoms selected from N, O;
    • m is 1 or 2,
    • R3 is hydrogen or (C1-4)alkoxy.

In another embodiment of such a modulator, Y can be a group of formula (II), wherein

    • the N-containing ring system is optionally annelated with cyclopropyl, cyclopentyl or phenyl,
    • R2 is methyl, dimethylaminoethyl, methoxyethyl, or
    • a group (CH2)m-Z, wherein Z is unsubstituted cyclohexyl, unsubstituted phenyl, phenyl substituted by methoxy, piperazinyl or morpholinyl;
    • pyridinyl, piperidinyl, tetrahydrofuranyl, unsubstituted piperazinyl or piperazinyl substituted by methyl or phenyl,

and m, n, R1, R3 and X are as defined above.

The compounds of the invention can be in the form of a salt and/or for use as a pharmaceutical. The present invention hence also relates to a pharmaceutical composition comprising a compound as described herein-above in association with at least one pharmaceutical excipient, and to a method of treating disorders mediated by kallikrein-7 activity, which treatment comprises administering to a subject in need of such treatment an effective amount of a compound of the invention.

According to the present invention, a disorder which is mediated by kallikrein-7 activity can be selected from the group consisting of inflammatory and/or hyperpoliferative and pruritic skin diseases such as keloids, hypertrophic scars, acne, atopic dermatitis, psoriasis, pustular psoriasis, rosacea, Netherton's syndrome or other pruritic dermatoses such as prurigo nodularis, unspecified itch of the elderly as well as other diseases with epithelial barrier dysfunction such as aged skin, inflammatory bowel disease and Crohn's disease, as well as pancreatitis, or of cancer, in particular ovarian cancer.

DETAILED DESCRIPTION OF THE INVENTION

List of abbreviations Abbreviation Description DMSO dimethylsulfoxide hK7 human kallikrein 7 UTR untranslated region LEKTI lympho-epithelial Kazal-type related inhibitor Spink5 serine protease inhibitor Kazal-type 5 ALP antileukoprotease HPLC high performance liquid chromatography GluHCl glucosamine hydrochloride pro-hK7 pro-human kallikrein 7 PEG polyethylene glycol SDS sodium dodecyl sulfate Tris tris-(hydroxymethyl)-amino methane IPTG isopropyl-β-D-thiogalactoside GSH Glutathion or γ-L-Glutamyl-L-cysteinylglycin GSSH oxidized form of glutathion EDTA ethylenediaminetetraacitic acid DMSO dimethylsulfoxide HCl hydrochloric acid SLS Swiss Light Source a.u. asymmetric unit DTT D,L-dithiothreitol

Kallikrein 7 is a S1 serine protease of the kallikrein gene family displaying a chymotrypsin like activity. Human kallikrein 7 (hK7, KLK7 or stratum corneum chymotryptic enzyme (SCCE), Swissprot P49862) plays an important role in skin physiology (1, 2, 3).

The present invention provides a crystal of human kallikrein 7 comprising the binding pocket having a three-dimensional structure characterized by the structure coordinates of Table 3 below. The present invention also provides to a computer readable medium comprising data storage material encoded with computer readable data wherein said data comprises the structure coordinates of a crystal according to the invention, and the use of this crystal for the generation of crystal structure data. Moreover, the present invention provides a method of identifying a ligand that binds to kallikrein 7, this method comprising the steps of (i) using the three dimensional structure data generated according to the invention to select and/or design a potential ligand that binds to kallikrein 7, and (ii) identifying among the potential ligand selected in step (i), those ligands that bind to kallikrein 7 in an in vitro, in vivo or cell-based assay. Modulator of kallikrein 7 according to the present invention are characterised in that it binds in the binding pocket having a three-dimensional structure characterized by the structure coordinates of Table 3 and can be a compound of formula

wherein

    • R1 is hydrogen, cyano, (C1-8)alkyl, (C2-8)alkenyl, (C2-8)alkynyl, halogen, (C1-8)alkylamino, (C1-8)alkylamino(C1-8)alkyl, (C1-8)alkoxy, halo(C1-8)alkyl,
    • X is CH═CH, NH, N═CH, O or S,
    • Y is a group of formula

    • wherein
      • the N-containing ring system is optionally annelated with (C3-8)cycloalkyl, (C6-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S,
      • n is 1, 2 or 3,
      • R2 is
        • (C1-8)alkyl, (C1-8)alkylamino, (C1-8)alkylamino(C1-8)alkyl, di(C1-8)alkylamino(C1-8)alkyl, halo(C1-8)alkyl, (C1-8)alkoxy, (C1-8)alkoxy(C1-8)alkyl, or
        • (CH2)m-Z, wherein Z is unsubstituted or substituted (C3-8)cycloalkyl, (C8-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S and m is 0, 1 or 2,
      • R3 is hydrogen, (C1-8)alkyl, (C1-8)alkoxy, (C6-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S.

The crystals according to the invention preferably belong to the orthorhombic space group P212121 (triclinic). The crystals have 1 molecule per asymmetric unit.

Depending on the conditions used for crystallization, the parameters characterising the unit cell may vary with a limited range, at least within the range of the resolution. The resolution of the X-ray crystallography is typically≦5 Angstroms and by means of the purification method described therein, it is possible to provide crystals of such high internal order that a resolution of ≦2 Å can be achieved.

The term “unit cell” refers to the basic shape block. The entire volume of a crystal may be constructed by regular assembly of such blocks. Each unit cell comprises a complete representation of the unit of pattern, the repetition of which builds up the crystal.

The term “space group” according to the invention refers to the arrangement of symmetry elements of a crystal.

The term “structure coordinates” or “atomic coordinates” refers to mathematical coordinates derived from the mathematical equations related to the pattern obtained on diffraction of a monochromatic beam of X-rays by the atoms (scattering centers) of a crystal comprising hK7. The diffraction data are used to calculate an electron density map of the repeating unit of the crystal. The electron density maps are used to establish the positions of the individual atoms within the unit cell of the crystal. The structure coordinates of hK7 can be found in Table 3.

A “fragment” of Kallikrein 7 comprises more than 50% consecutive amino acids of the sequence of the Kallikrein 7.

As used herein, a “homologue” of that sequence shares at least 70% identity, preferably 80% identity, more preferably 90%, and even more preferably 95% identity with the corresponding sequence when performing optimal alignment. Optimal alignment of sequences for determining a comparison window may be conducted by the local homology algorithm of Smith and Waterman (J. Theor. Biol., 91 (2) pgs. 370-380 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. Miol. Biol., 48(3) pgs. 443-453 (1972), by the search for similarity via the method of Pearson and Lipman, PNAS, USA, 85(5) pgs. 2444-2448 (1988) or by computerized implementations of these algorithms (GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetic Computer Group, 575, Science Drive, Madison, Wis.).

The best alignment (i.e., resulting in the highest percentage of identity over the comparison window) generated by the various methods is selected for determining percentage identity.

The terms “ligand” or “modulator”, which are used interchangeably herein, refers to a molecule or group of molecules that bind to one or more specific sites of Kallikrein 7. A ligand according to the invention can be an agonist or an antagonist. In addition, ligands according to the invention are preferably low molecular weight molecules.

The term “low molecular weight molecules” according to the invention refers to preferably organic compounds generally having a molecular weight less than about 1000, more preferably less than about 500.

More preferably, said ligand inhibits kallikrein 7 biological activity. A compound is considered as an kallikrein 7 inhibitor if it has an IC50 ranging from 0.001 nM to 1.0 μM.

Preferred modulators are organic compounds, e.g. 1,2-dicarboxylic acid amides of an N-containing ring system, such as e.g. pyrrolidine, e.g. which are antagonists of Kallikrein-7 activity.

In one aspect the present invention is a compound of formula

wherein
R1 is hydrogen, cyano, alkyl, alkenyl, alkynyl, halogen, alkylamino, alkylaminoalkyl, alkoxy, haloalkyl,

X is CH═CH, NH, N═CH, O or S,

Y is a group of formula

wherein

    • the N-containing ring system is optionally annelated with cycloalkyl, aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S,
    • n is 1, 2 or 3,
    • R2 is
      • alkyl, alkylamino, alkylaminoalkyl, dialkylaminoalkyl, haloalkyl, alkoxy, alkoxyalkyl, or
      • (CH2)m-Z, wherein Z is unsubstituted or substituted cycloalkyl, aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S and m is 0, 1 or 2,
    • R3 is hydrogen, alkyl, alkoxy, aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S.

Any group (substituent) defined herein may comprise 1 to 18 carbon atoms, for example

    • alkyl e.g. includes (C1-12)alkyl, such as (C1-4)alkyl, e.g. methyl, ethyl, propyl, isopropyl, n-butyl, tert-butyl, sec-butyl, n-pentyl, neopentyl, n-hexyl;
      • alkenyl e.g. includes (C2-12)alkenyl, such as ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, alkadienes and the like;
      • alkynyl e.g. includes (C2-12)alkynyl, such as ethynyl;
      • cycloalkyl e.g. includes (C3-12)cycloalkyl, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl;
      • alkoxy e.g. includes (C1-12)alkoxy, such as methoxy, ethoxy;
      • aryl includes (C6-18)aryl, e.g. phenyl, naphtyl;
      • aliphatic heterocyclyl and armoatic heterocyclyl;
      • heterocyclyl having 1 to 4 heteroatoms selected from N, O, S; such as heterocyclyl
        having
    • 1 to 2 heteroatoms selected from N, O, e.g. including
    • pyridinyl, e.g. pyridin-3-yl, pyridin-4-yl;
    • piperidinyl, e.g. piperidin-4-yl;
    • piperazinyl, e.g. piperazin-1-yl;
    • morpholinyl, e.g. morpholin-4-yl;
    • tetrahydrofuranyl, e.g. tetrahydrofuran-2-yl;
    • halogen includes F, Cl, Br, I, such as chloro, bromo;

Any group defined herein may be unsubstituted or substituted, e.g. one or morefold.

Substituents include e.g. methyl, methoxy, ethynyl, chloro, bromo.

Alkyl, alkenyl, alkynyl, aryl and heterocyclyl include unsubstituted or substituted alkyl, aryl or heterocyclyl, e.g. substituted by groups which are conventional in organic chemistry.

In one aspect the present invention is a compound of formula (I) as defined above, wherein

R1 is hydrogen, cyano, (C2-8)alkenyl, (C2-8)alkynyl or halogen

X is CH═CH, NH, N═CH, O or S,

Y is a group of formula

wherein

    • the N-containing ring system is optionally annelated with (C3-8)cycloalkyl, (C6-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 2 heteroatoms selected from N, O, S,
    • n is 1, 2 or 3,
    • R2 is
      • (C1-8)alkyl, (C1-8)alkylamino, (C1-8)alkylamino(C1-8)alkyl, di(C1-8)alkylamino(C1-8)alkyl, (C1-8)alkoxy, (C1-8)alkoxy(C1-8)alkyl, or
      • (CH2)m-Z, wherein Z is unsubstituted or substituted (C3-8)cycloalkyl, (C8-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 2 heteroatoms selected from N, O, S and m is 1 or 2,
    • R3 is hydrogen, (C1-8)alkyl or (C1-8)alkoxy.

In one aspect the present invention is a compound of formula (I), wherein

    • R1 is hydrogen, ethynyl, chloro or bromo,
    • X is CH═CH or S,
    • Y is a group of formula (II), wherein
      • the N-containing ring system is optionally annelated with cyclopropyl, cyclopentyl or phenyl,
      • n is 1 or 2,
      • R2 is (C1-8)alkyl, (C1-4)alkylamino, di(C1-4)alkylamino(C1-4)alkyl, (C1-4)alkoxy, (C1-4)alkoxy(C1-4)alkyl or
      • a group (CH2)m-Z, wherein Z is unsubstituted cyclohexyl, unsubstituted phenyl, phenyl substituted by (C1-4)alkoxy, phenyl substituted by heterocyclyl having 6 ring members and 1 or 2 heteroatoms selected from N, O, or unsubstituted or substituted heterocyclyl having 6 ring members and 1 or 2 heteroatoms selected from N, O;
      • m is 1 or 2,
      • R3 is hydrogen or (C1-4)alkoxy.

In one aspect the present invention is a compound of formula (I) and Y is a group of formula (II), wherein

    • the N-containing ring system is optionally annelated with cyclopropyl, cyclopentyl or phenyl,
    • R2 is methyl, dimethylaminoethyl, methoxyethyl, or
    • a group (CH2)m-Z, wherein Z is unsubstituted cyclohexyl, unsubstituted phenyl, phenyl substituted by methoxy, piperazinyl or morpholinyl; pyridinyl, piperidinyl, tetrahydrofuranyl, unsubstituted piperazinyl or piperazinyl substituted by methyl or phenyl,
    • and m, n, R1, R3 and X are as defined above.

In one aspect the present invention is a compound of formula (I), wherein

X is CH═CH,

R1 is ethynyl or chloro,
Y is a group of formula (II), wherein
n is 1,
R3 is hydrogen,
R2 is methyl, methoxyethyl, dimethylaminoethyl, pyridin-3-ylmethyl, pyridin-4-ylmethyl, pyridin-3-yl-ethyl, pyridin-4-yl-ethyl, 6-methoxy-pyridin-3-ylmethyl, (4-methoxy-phenyl)-ethyl, (4-methyl-piperazin-1-yl)-ethyl, (4-benzyl-piperazin-1-yl)-ethyl, 4-(4-methyl-piperazin-1-yl)-benzyl, 1-methyl-piperidin-4-ylmethyl, 2-(4-morpholin-4-ylmethyl)-benzyl.

In one aspect the present invention is a compound of formula (I), wherein

X is CH═CH,

R1 is hydrogen,
Y is a group of formula (II), wherein
The N-containing ring system is optionally annelated with phenyl,
R3 is hydrogen or phenyl,
n is 1 or 2,
R2 is benzyl, phenethyl, cyclohexylmethyl, (4-methoxy-phenyl)-ethyl, 3-methyl-butyl, tetrahydrofuran-2-ylmethyl.

In one aspect the present invention is a compound of formula (I), wherein

X is CH═CH,

R1 is ethynyl,
Y is a group of formula (II), wherein
The N-containing ring system is optionally annelated with cyclopropyl, cyclopentyl, phenyl,
R3 is hydrogen,
n is 1,
R2 is pyridin-3-ylmethyl.

In one aspect the present invention is a compound of formula (I), wherein

X is CH═CH

R1 is ethynyl,
Y is a group of formula (II), wherein
R3 is methoxy,
n is 1,
R2 is pyridin-3-ylmethyl.

In one aspect the present invention is a compound of formula (I), wherein

X is CH═CH

R1 is ethynyl,
Y is a group of formula (II), wherein
R3 is hydrogen,
n is 2,
R2 is pyridin-3-ylmethyl.

In one aspect the present invention is a compound of formula (I), wherein

X is S

R1 is chloro or bromo,
Y is a group of formula (II), wherein
R3 is hydrogen,
n is 1,
R2 is (4-methoxy-phenyl)-ethyl.

In a compound of formula I each single defined substitutent may be a preferred substituent, e.g. independently of each other substitutent defined.

In another aspect the present invention provides a compound of formula I, selected from the group consisting of

  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(2-pyridin-3-yl-ethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 2-[(2-dimethylamino-ethyl)-amide] 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(2-pyridin-4-yl-ethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(6-methoxy-pyridin-3-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(1-methyl-piperidin-4-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[4-(4-methyl-piperazin-1-yl)-benzylamide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-(4-morpholin-4-ylmethyl-benzylamide),
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-methylamide,
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 2-{[2-(4-benzyl-piperazin-1-yl)-ethyl]amide} 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(2-methoxy-ethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(pyridin-3-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(pyridin-4-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-{[2-(4-methyl-piperazin-1-yl)-ethyl]-amide},
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(6-chloro-naphthalen-1-ylmethyl)-amide] 2-{[2-(4-methoxy-phenyl)-ethyl]-amide},
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-chloro-naphthalen-1-ylmethyl)-amide] 2-{[2-(4-methoxy-phenyl)-ethyl]-amide},
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(5-bromo-benzo[b]thiophen-3-ylmethyl)-amide] 2-{[2-(4-methoxy-phenyl)-ethyl]-amide},
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(5-chloro-benzo[b]thiophen-3-ylmethyl)-amide] 2-{[2-(4-methoxy-phenyl)-ethyl]-amide},
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-{[2-(4-methoxy-phenyl)-ethyl]-amide},
  • (2S,4R)-4-Methoxy-pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(pyridin-3-ylmethyl)-amide],
  • (S)-Piperidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(pyridin-3-ylmethyl)-amide],
  • (S)-Hexahydro-cyclopenta[c]pyrrole-1,2-dicarboxylic acid 2-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 1-[(pyridin-3-ylmethyl)-amide],
  • (S)-2,3-Dihydro-indole-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(pyridin-3-ylmethyl)-amide],
  • (S)-1,3-Dihydro-isoindole-1,2-dicarboxylic acid 2-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 1-[(pyridin-3-ylmethyl)-amide],
  • (1R,2S,5S)-3-Aza-bicyclo[3.1.0]hexane-2,3-dicarboxylic acid 3-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(pyridin-3-ylmethyl)-amide],
  • (1S,2S,5R)-3-Aza-bicyclo[3.1.0]hexane-2,3-dicarboxylic acid 3-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(pyridin-3-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(naphthalen-1-ylmethylyamide] 2-(phenethyl-amide),
  • (2S,4S)-4-Phenyl-pyrrolidine-1,2-dicarboxylic acid 1-[(naphthalen-1-ylmethyl)-amide] 2-(phenethyl-amide),
  • (2S,4R)-4-Phenyl-pyrrolidine-1,2-dicarboxylic acid 1-[(naphthalen-1-ylmethyl)-amide] 2-(phenethyl-amide),
  • (S)-3,4-Dihydro-1H-isoquinoline-2,3-dicarboxylic acid 2-[(naphthalen-1-ylmethylyamide] 3-(phenethyl-amide),
  • (S)-Piperidine-1,2-dicarboxylic acid 1-[(naphthalen-1-ylmethyl)-amide] 2-(phenethyl-amide),
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 2-{[2-(4-methoxy-phenyl)-ethyl]-amide} 1-[(naphthalen-1-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 2-benzylamide 1-[(naphthalen-1-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 2-cyclohexylmethyl-amide 1-[(naphthalen-1-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 2-[(3-methyl-butyl)-amide] 1-[(naphthalen-1-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(naphthalen-1-ylmethyl)-amide] 2-[(tetrahydro-furan-2-ylmethyl)-amide],
  • (1S,2S,5R)-3-aza-bicyclo[3.1.0]hexane-2,3-dicarboxylic acid 3-[(7-chloro-naphthalen-1-ylmethyl)-amide] 2-[(pyridin-3-ylmethyl)-amide], and
  • (1S,2S,5R)-3-aza-bicyclo[3.1.0]hexane-2,3-dicarboxylic acid 3-[(7-chloro-naphthalen-1-ylmethyl)-amide] 2-{[2-(4-methoxy-phenyl)-ethyl]-amide}.

The chemical names of the compounds of the present invention as indicated herein are copied from ISIS, version 2.5 (AutoNom 2000 Name).

Compounds provided by the present invention are hereinafter designated as “compound(s) of (according to) the present invention”. A compound of the present invention includes a compound in any form, e.g. in free form, in the form of a salt, in the form of a solvate and in the form of a salt and a solvate.

In another aspect the present invention provides a compound of the present invention in the form of a salt.

Such salts include preferably pharmaceutically acceptable salts, although pharmaceutically unacceptable salts are included, e.g. for preparation/isolation/purification purposes.

A compound of the present invention in free form may be converted into a corresponding compound in the form of a salt; and vice versa. A compound of the present invention in free form or in the form of a salt and in the form of a solvate may be converted into a corresponding compound in free form or in the form of a salt in non-solvated form; and vice versa.

A compound of the present invention may exist in the form of isomers and mixtures thereof; e.g. optical isomers, diastereoisomers, cis/trans conformers. A compound of the present invention may e.g. contain asymmetric carbon atoms and may thus exist in the form of enantiomers or diastereoisomers and mixtures thereof, e.g. racemates. A compound of the present invention may be present in the (R)-, (S)- or (R,S)-configuration preferably in the (R)- or (S)-configuration regarding specified positions in the compound of the present invention.

A compound provided by the present invention may be in the (R)- and in the (S)-configuration, e.g. including mixtures thereof, in a compound of formula I, and is preferably in the (R)- or in the (S)-configuration.

Isomeric mixtures may be separated as appropriate, e.g. according, e.g. analogously, to a method as conventional, to obtain pure isomers. The present invention includes a compound of the present invention in any isomeric form and in any isomeric mixture.

The present invention also includes tautomers of a compound of the present invention, where tautomers can exist.

In another aspect the present invention provides a process for the production of a compound of the present invention, e.g. of formula I, comprising the steps

A. Reacting a Compound of Formula

wherein R1 and R3 are as defined above, with a compound of formula


R2—NH2  (IV)

wherein R2 is as defined above, under appropriate conditions, e.g. in the presence of N-(3-dimethylamino-propyl)-N-carbodiimide-HCl, N,N-diisopropylethylamine, CH2Cl2, trifluoroacetic acid, acetonitril, at appropriate temperatures, e.g. room temperature, for an appropriate time, e.g. over night; OR

B) Reacting a Compound of Formula

wherein R2, R3 and n are as defined above, with a compound of formula

wherein R1 and X are as defined above, under appropriate conditions, e.g. in the presence of 4-nitrophenylchloroformate, pyridine, N,N-diisopropylethylamine, CH2Cl2, at appropriate temperatures, e.g. room temperature, for an appropriate time, e.g. over night; and isolating a compound of formula I obtained from the reaction mixture.

In an intermediate of formulae (III), (IV), (V) or (VI) (starting materials), functional groups, if present, optionally may be in protected form or in the form of a salt, if a salt-forming group is present. Protecting groups, optionally present, may be removed at an appropriate stage, e.g. according, e.g. analogously, to a method as conventional

A compound of formula I thus obtained may be converted into another compound of formula I, e.g. or a compound of formula I obtained in free form may be converted into a salt of a compound of formula I and vice versa.

Intermediates (starting materials) of formulae (III), (IV), (V) or (VI) are known or may be prepared according, e.g. analogously, to a method as conventional or as specified herein.

Any compound described herein, e.g. a compound of the present invention and intermediates of formulae (III), (IV), (V) or (VI) may be prepared as appropriate, e.g. according, e.g. analogously, to a method as conventional, e.g. or as specified herein.

The compounds of the present invention, e.g. including a compound of formula I, exhibit pharmacological activity and are therefore useful as pharmaceuticals. E.g., the compounds of the present invention are found to inhibit Kallikrein-7 activity.

Compounds of the present invention have IC50 values between 1 nM and 10 μM e.g. determined in the following assay:

Materials and Buffers

The fluorescence-quenched substrate Ac-Glu-Asp(EDANS)-Lys-Pro-Ile-Leu-PhêArg-Leu-Gly-Lys(DABCYL)-Glu-NH2 (where ̂ indicates the scissile bond, identified by MS analysis) is purchased from Biosyntan (Berlin, Germany) and kept as a 5 mM stock solution in DMSO at −20° C. All other chemicals are of analytical grade.

Enzymatic reactions are conducted in 50 mM sodium citrate buffer at pH 5.6 containing 150 mM NaCl and 0.05% (w/v) CHAPS.

All protein and peptide containing solutions are handled in siliconized tubes (Life Systems Design, Merenschwand, Switzerland). The compound solutions as well as the enzyme and the substrate solutions are transferred to the 384-well plates (black Cliniplate; cat. no. 95040020 Labsystems Oy, Finland) by means of a CyBi-Well 96-channel pipettor (CyBio AG, Jena, Germany).

Instrumentation for FI measurements

For fluorescence intensity (FI) measurements an Ultra Evolution reader (TECAN, Maennedorf, Switzerland) is used. The instrument is equipped with a combination of a 350 nm (20 nm bandwidth) and a 500 nm (25 nm bandwidth) bandpath filter for fluorescence excitation and emission acquisition, respectively. To increase the signal:background ratio, an appropriate dichroic mirror is employed. The optical filters and the dichroic mirror are purchased from TECAN. The fluorophores in each well are excited by three flashes per measurement.

Determination of IC50 Values

For the determination of IC50 values the assay is performed at room temperature in 384-well plates. All final assay volumes were 30 μl. Test compounds are dissolved in 90% (v/v) DMSO/water and diluted in water (containing 0.05% (w/v) CHAPS) to 3-times the desired assay concentration. The 11 final compound concentrations are: 0.3 nM, 1 nM, 3 nM, 10 nM, 30 nM, 100 nM, 300 nM, 1 μM, 3 μM, 10 μM and 30 μM. For each assay, 10 μl water/CHAPS (±test compound) are added per well, followed by 10 μl protease solution (diluted with 1.5× assay buffer). The protease concentration in final assay solution is 0.2 nM (according to the enzyme concentrations determined by the Bradford method). After 1 hour of incubation at room temperature, the reaction is started by addition of 10 μl substrate solution (substrate dissolved in 1.5× assay buffer, final concentration was 2 μM). The effect of the compound on the enzymatic activity is obtained from the linear progress curves and determined from two readings, the first one taken directly after the addition of substrate and the second one after 1 hour. The IC50 value is calculated from the plot of percentage of inhibition vs. inhibitor concentration using non-linear regression analysis software (XLfit, Vers. 4.0; ID Business Solution Ltd., Guildford, Surrey, UK).

The compounds of the present invention show activity in that ASSAY and are therefore indicated for the treatment of disorders (diseases) mediated by Kallikrein-7 activity. IC50 values for compounds of the present invention are in the range of below 10 μM, preferably below 10 nM, e.g. the compound of example 36 has an IC50 value of 3 nM.

Disorders, e.g. including diseases, mediated by Kallikrein-7 activity and which are prone to be successfully treated with Kallikrein-7 antagonists, e.g. with compounds of the present invention, include disorders, wherein the activity of Kallikrein-7 play a causal or contributory role, e.g. diseases involved with epithelial dysfunction such as inflammatory and/or hyperproliferative and pruritic skin diseases like e.g. atopic dermatitis, psoriasis, Netherton syndrome or other pruritic dermatoses such as prurigo nodularis, unspecified itch as well as other diseases with epithelial barrier dysfunction such as inflammatory bowel disease or Crohn's disease.

In another aspect the present invention provides

    • a compound of the present invention for use as a pharmaceutical,
    • the use of a compound of the present invention as a pharmaceutical,
    • the use of a compound of the present invention for the manufacture of a medicament, e.g. for the treatment of disorders mediated by Kallikrein-7 activity.

For pharmaceutical use one or more compounds of the present invention may be used, e.g. one, or a combination of two or more compounds of the present invention, preferably one compound of the present invention is used.

A compound of the present invention may be used as a pharmaceutical in the form of a pharmaceutical composition.

In another aspect the present invention provides a pharmaceutical composition comprising a compound of the present invention in association with at least one pharmaceutically acceptable excipient, e.g. appropriate carrier and/or diluent, e.g. including fillers, binders, disintegrants, flow conditioners, lubricants, sugars or sweeteners, fragrances, preservatives, stabilizers, wetting agents and/or emulsifiers, solubilizers, salts for regulating osmotic pressure and/or buffers.

In another aspect the present invention provides

    • a pharmaceutical composition of the present invention for use of treating disorders which are mediated by Kallikrein-7 activity.
    • the use of a pharmaceutical composition of the present invention for treating disorders which are mediated by Kallikrein-7 activity.

In a further aspect the present invention provides a method of treating disorders which are mediated by Kallikrein-7 activity, e.g. including disorders as specified above, which treatment comprises administering to a subject in need of such treatment an effective amount of a compound of the present invention; e.g. in the form of a pharmaceutical composition.

In another aspect the present invention provides

    • a compound of the present invention for the manufacture of a medicament,
    • the use of a compound of the present invention for the manufacture of a medicament, e.g. a pharmaceutical composition, for the treatment of disorders, which are mediated by Kallikrein-7 activity, e.g. for the treatment of skin diseases like e.g. atopic dermatitis, psoriasis, Netherton syndrome or other pruritic dermatoses such as prurigo nodularis, unspecified itch.

Treatment includes treatment and prophylaxis (prevention). Treatment can be by local or systemic application such as e.g. creams, ointments or suppositories or by oral, sc or iv application, respecitvely.

For such treatment, the appropriate dosage will, of course, vary depending upon, for example, the chemical nature and the pharmakokinetic data of a compound of the present invention used, the individual host, the mode of administration and the nature and severity of the conditions being treated. However, in general, for satisfactory results in larger mammals, for example humans, an indicated daily dosage includes a range

    • from about 0.001 g to about 1.5 g, such as 0.001 g to 1.5 g;
    • from about 0.01 mg/kg body weight to about 20 mg/kg body weight, such as 0.01 mg/kg body weight to 20 mg/kg body weight,
      for example administered in divided doses up to four times a day.

A compound of the present invention may be administered to larger mammals, for example humans, by similar modes of administration than conventionally used with other mediators, e.g. low molecular weight inhibitors, of Kallikrein-7 activity.

A compound of the present invention may be administered by any conventional route, for example enterally, e.g. including nasal, buccal, rectal, oral, administration; parenterally, e.g. including intravenous, intraarterial, intramuscular, intracardiac, subcutanous, intraosseous infusion, transdermal (diffusion through the intact skin), transmucosal (diffusion through a mucous membrane), inhalational administration; topically; e.g. including epicutaneous, intranasal, intratracheal administration; intraperitoneal (infusion or injection into the peritoneal cavity); epidural (peridural) (injection or infusion into the epidural space); intrathecal (injection or infusion into the cerebrospinal fluid); intravitreal (administration via the eye); e.g. in form of coated or uncoated tablets, capsules, (injectable) solutions, infusion solutions, solid solutions, suspensions, dispersions, solid dispersions; e.g. in the form of ampoules, vials, in the form of creams, gels, pastes, inhaler powder, foams, tinctures, lip sticks, drops, sprays, or in the form of suppositories. Preferably a compound of the present invention is applied topically.

For topical use, e.g. including administration to the eye, satisfactory results may be obtained with local administration of a 0.5-10%, such as 1-3% concentration of active substance several times daily, e.g. 2 to 5 times daily.

The compounds of the present invention may be administered in the form of a pharmaceutically acceptable salt, or in free form; optionally in the form of a solvate. A compound of the present invention in the form of a salt and/or in the form of a solvate exhibit the same order of activity as a compound of the present invention in free form.

A compound of the present invention may be used for any method or use as described herein alone or in combination with one or more, at least one, other, second drug substance.

In another aspect the present invention provides

    • A combination of a compound of the present invention with at least one second drug substance;
    • A pharmaceutical combination comprising a compound of the present invention in combination with at least one second drug substance;
    • A pharmaceutical composition comprising a compound of the present invention in combination with at least one second drug substance and one or more pharmaceutically acceptable excipient(s);
    • A compound of the present invention in combination with at least one second drug substance, e.g. in the form of a pharmaceutical combination or composition, for use in any method as defined herein, e.g.
      • A combination, a pharmaceutical combination or a pharmaceutical composition, comprising a compound of the present invention and at least one second drug substance for use as a pharmaceutical;
    • The use as a pharmaceutical of a compound of the present invention in combination with at least one second drug substance, e.g. in the form of a pharmaceutical combination or composition;
    • The use of a compound of the present invention for the manufacture of a medicament for use in combination with a second drug substance
    • A method for treating disorders mediated by Kallikrein-7 activity in a subject in need thereof, comprising co-administering, concomitantly or in sequence, a therapeutically effective amount of a compound of the present invention and at least one second drug substance, e.g. in the form of a pharmaceutical combination or composition;
    • A compound of the present invention in combination with at least one second drug substance, e.g. in the form of a pharmaceutical combination or composition, for use in the preparation of a medicament for use in disorders mediated by Kallikrein-7 activity.

Combinations include fixed combinations, in which a compound of the present invention and at least one second drug substance are in the same formulation; kits, in which a compound of the present invention and at least one second drug substance in separate formulations are provided in the same package, e.g. with instruction for co-administration; and free combinations in which a compound of the present invention and at least one second drug substance are packaged separately, but instruction for concomitant or sequential administration are given.

In another aspect the present invention provides

    • A pharmaceutical package comprising a first drug substance which is a compound of the present invention and at least one second drug substance, beside instructions for combined administration;
    • A pharmaceutical package comprising a compound of the present invention beside instructions for combined administration with at least one second drug substance;
    • A pharmaceutical package comprising at least one second drug substance beside instructions for combined administration with a compound of the present invention.

Treatment with combinations according to the present invention may provide improvements compared with single treatment.

In another aspect the present invention provides

    • A pharmaceutical combination comprising an amount of a compound of the present invention and an amount of a second drug substance, wherein the amounts are appropriate to produce a synergistic therapeutic effect;
    • A method for improving the therapeutic utility of a compound of the present invention comprising co-administering, e.g. concomitantly or in sequence, of a therapeutically effective amount of a compound of the present invention and a second drug substance.
    • A method for improving the therapeutic utility of a second drug substance comprising co-administering, e.g. concomitantly or in sequence, of a therapeutically effective amount of a compound of the present invention and a second drug substance.

A combination of the present invention and a second drug substance as a combination partner may be administered by any conventional route, for example as set out above for a compound of the present invention. A second drug may be administered in dosages as appropriate, e.g. in dosage ranges which are similar to those used for single treatment, or, e.g. in case of synergy, even below conventional dosage ranges.

Pharmaceutical compositions according to the present invention may be manufactured according, e.g. analogously, to a method as conventional, e.g. by mixing, granulating, coating, dissolving or lyophilizing processes. Unit dosage forms may contain, for example, from about 0.1 mg to about 1500 mg, such as 1 mg to about 1000 mg.

Pharmaceutical compositions comprising a combination of the present invention and pharmaceutical compositions comprising a second drug as described herein, may be provided as appropriate, e.g. according, e.g. analogously, to a method as conventional, or as described herein for a pharmaceutical composition of the present invention.

By the term “second drug substance” is meant an anti-inflammatory, immunomodulatory drug, anticancer drug, anesthetic drug or chemotherapeutic drug. A “second drug substance” can also be a compound having Kallikrein-7 activity, but not being a compound of the present invention.

If the compounds of the present invention are administered in combination with other drugs dosages of the co-administered second drug will of course vary depending on the type of co-drug employed, on the specific drug employed, on the condition being treated, as in case of a compound of the present invention. In general dosages similar than those as provided by the second drug supplier may be appropriate

In the following Examples all temperatures indicated are in degree Celsius (°).

The following abbreviations are also used:

  • aq. aqueous
  • Ac2O acetic anhydride
  • AcOH acetic acid
  • CH2Cl2 dichloromethane
  • DCE 1,2-dichloroethane
  • DIPEA N,N-diisopropylethylamine
  • DMA N,N-dimethylacetamide
  • EtOAc ethylacetate
  • HATU O-(7-azabenzotriazol-1-yl)-N,N,N′,N′-tetramethyluronium hexafluorophosphate
  • NMP N-methylpyrrolidinone
  • rt room temperature
  • TFA trifluoroacetic acid
  • THF tetrahydrofuran
  • TLC thin layer chromatography
  • TMOF trimethylorthoformate

A kallikrein 7 inhibitor can also be a “peptide” or a “peptide derivative”, which terms are intended to embrace a “peptidomimetic” or “peptide analogue” which complement the three-dimensional structure of the binding pocket of kallikrein 7 or can be designed with improved physical or chemical properties to bind with the three-dimensional binding pocket of the kallikrein 7 as provided in the present invention.

The term “mutant” refers to a mutated sequence by deletion, insertion or preferably replacement of one or more selected amino acids, provided that such mutant sequence shares at least 90% identity, more preferably 95%, and even more preferably 99% identity with the corresponding fragment sequence when performing optimal alignment. Methods for the preparation of protein mutants are commonly known in the art. For example, kallikrein 7 mutants may be prepared by expression of kallikrein 7 DNA previously modified in its coding region by oligonucleotide directed mutagenesis.

As used herein, the term “binding pocket” refers to the region of kallikrein 7 that, as a result of its shape and physico-chemical properties favorably associates with another chemical entity or compound and is defined in by the coordinates of Table 3.

The kallikrein 7 protein to be used for crystallization may be biologically active or inactive. Such ability may be determined by morphological, biochemical or viability analysis well-known in the art.

Expression of recombinant kallikrein 7 or fragment thereof is achievable in eukaryotic or prokaryotic systems or in vitro expression systems.

According to a preferred embodiment, kallikrein 7 is bound to at least one ligand at any step prior to crystallization.

Kallikrein 7 may be expressed as a fusion protein, e.g. a glutathione-5-transferase (GST) or histidine-tagged fusion protein. If desired, the fusion partner is removed before crystallization.

For carrying out the step of crystallization of the method for making a crystal, various methods can be used including vapour diffusion, dialysis or batch crystallization according to methods known in the art (“Crystallization of Biological Macromolecules”, A. McPherson, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA).

In vapour diffusion crystallization, a small volume (i.e., a few microliters) of protein solution is mixed with a solution containing a precipitant. This mixed volume is suspended over a well containing a small amount, i.e. about 1 ml, of precipitant. Vapour diffusion from the drop to the well will result in crystal formation in the drop.

The dialysis method of crystallization utilizes a semipermeable size-exclusion membrane that retains the protein but allows small molecules (i.e. buffers and precipitants) to diffuse in and out. In dialysis, rather than concentrating the protein and the precipitant by evaporation, the precipitant is allowed to slowly diffuse through the membrane and reduce the solubility of the protein while keeping the protein concentration fixed.

The batch method generally involves the slow addition of a precipitant to an aqueous solution of protein until the solution just becomes turbid, at this point the container can be sealed and left undisturbed for a period of time until crystallization occurs. In the batch technique the precipitant and the target molecule solution are simply mixed. Supersaturation is achieved directly rather than by diffusion. Often the batch technique is performed under oil. The oil prevents evaporation and extremely small drops can be used. For this, the term “microbatch” is used. A modification of this technique is not to use paraffin oil (which prevents evaporation completely) but rather use silicone oil or a mixture of silicone and paraffin oils so that a slow evaporation is possible.

The claimed invention can encompass any and all methods of crystallization. One skilled in the art can choose any of such methods and vary the parameters such that the chosen method results in the desired crystals.

One preferred method of crystallization of kallikrein 7 involves mixing a kallikrein 7 solution with a “reservoir buffer”. For crystal formation, the concentration of the precipitating agent in the mixture has to be increased, e.g. by addition of precipitating agent, for example by titration, or by allowing the concentration of precipitating agent to balance by diffusion between the crystallization buffer and a reservoir buffer (not necessarily the same as the original reservoir buffer). Under suitable conditions such diffusion of precipitating agent occurs along the gradient of precipitating agent, e.g. from the reservoir buffer having a higher concentration of precipitating agent into the crystallization buffer having a lower concentration of precipitating agent. Diffusion may be achieved e.g. by vapour diffusion techniques allowing diffusion of water in the common gas phase. Known techniques are e.g. vapour diffusion methods, such as the “hanging drop” or the “sitting drop” method. In the vapour diffusion method a drop of crystallization buffer containing the protein is hanging above or sitting beside a much larger pool of reservoir buffer. Alternatively, the balancing of the precipitating agent can be achieved through a semipermeable membrane that separates the crystallization buffer from the reservoir buffer and prevents dilution of the protein into the reservoir buffer.

Formation of kallikrein 7 can be achieved under various conditions which are essentially determined by the following parameters: pH, presence of salts and additives, precipitating agent, protein concentration and temperature. The pH may range, for example, from about 4.0 to 9.0.

In another specific embodiment, the invention relates to a method for making a co-crystal of kallikrein 7 in complex with a ligand.

The crystal form of kallikrein 7 crystal may also be used for exchanging the ligand by soaking compounds of interest, for example, for compound optimization, or for the discovery of novel scaffolds in fragment based screening approaches.

Structure coordinates of a crystalline composition of this invention may be stored in a machine-readable form on a machine-readable storage medium, e.g. a computer hard drive, diskette, DAT tape, etc., for display as a three-dimensional shape or for other uses involving computer-assisted manipulation of, or computation based on, the structural coordinates or the three-dimensional structures they define. For example, data defining the three dimensional structure of a protein of the kallikrein family, or portions or structurally similar homologues of such proteins, may be stored in a machine-readable storage medium, and may be displayed as a graphical three-dimensional representation of the protein structure, typically using a computer capable of reading the data from said storage medium and programmed with instructions for creating the representation from such data.

According to the present invention, a three-dimensional kallikrein 7 model is obtainable from a kallikrein 7 crystal comprising the kallikrein 7, fragment or homologue thereof.

The present invention also relates to a computer readable medium having stored a model of the kallikrein 7 crystal structure. In a preferred embodiment, said model is built from all or a selected portion of it, of the atomic coordinates of Table 3 derived from the X-ray diffraction data.

By “selected portion”, it is meant the structure coordinates of at least 10 consecutive amino acids shown in Table 3 and preferably at least 50 amino acids, and more preferably at least 100 consecutive amino acids.

The knowledge obtained from the three-dimensional model of kallikrein 7 can be used in various ways. For example, it can be used to identify chemical entities, for example, small organic and bioorganic molecules such as peptidomimetics and synthetic organic molecules that bind to kallikrein 7 and preferably block or prevent a kallikrein 7-mediated or associated process or event, or that act as kallikrein δ agonists. Furthermore, this information can be used to design and prepare kallikrein 7 mutants, e.g. mutants with altered catalytic activity, model the three-dimensional structure and solve the crystal structure of proteins, such as kallikrein 7 homologues, kallikrein 7 mutants or kallikrein 7 co-complexes, involving e.g. molecular replacement or homology modeling.

The term “molecular replacement” refers to a method that involves generating a preliminary structural model of a crystal whose structural coordinates are unknown, by orienting and positioning a molecule whose structural coordinates are known, e.g., the kallikrein 7 coordinates within the unit cell of the unknown crystal, so as to best account for the observed diffraction pattern of the unknown crystal. Phases can then be calculated from this model, and combined with the observed amplitudes to give an approximated Fourier synthesis of the structure whose coordinates are unknown. This in turn can be subject to any of the several forms of refinement to provide a final accurate structure of the unknown crystal. Using the structural coordinates provided by this invention, molecular replacement may be used to determine the structural coordinates of a crystalline co complex, unknown ligand, mutant, or homolog, or of a different crystalline form of kallikrein 7. Additionally, the claimed crystal and its coordinates may be used to determine the structural coordinates of a chemical entity that associates with kallikrein 7.

“Homology modeling” according to the invention involves constructing a model of an unknown structure using structural coordinates of one or more related proteins, protein domains and/or one subdomains such as kallikrein 7. Homology modeling may be conducted by fitting common or homologous portions of the protein or peptide whose three dimensional structure is to be solved to the three dimensional structure of homologous structural elements. Homology modeling can include rebuilding part or all of a three dimensional structure with replace of amino acids or other components by those of the related structure to be solved.

Based on the three-dimensional structure of kallikrein 7 as provided in the present invention and using the atomic coordinates of Table 3, or a selected portion of it, the effects of site-specific mutations can be predicted. More specifically, the structural information provided herein permits the identification of desirable sites for amino acid modification, particularly amino acid mutation resulting in substitutional, insertional or deletional variants. Such variants may be designed to have special properties, particularly properties distinct from wild-type kallikrein 7, such as altered catalytic activity. Substitutions, deletions and insertions may be combined to arrive at a desired variant. Such variants can be prepared by methods well-known in the art, e.g. starting from wild-type kallikrein 7 or by de novo synthesis.

The kallikrein 7 structural information provided herein is useful for the design of ligands which are capable of selectively interacting with kallikrein 7, but not other proteases other than Kallikrein 7, and thereby specifically modulating the biological activity of kallikrein 7 and not other kallikrein 7 proteases.

Chemical entities that have a surface that mimics the accessible surface of the binding pocket of kallikrein 7 can be constructed by those skilled in the art. By way of example, the skilled artisan can screen three-dimensional structural databases of compounds to identify those compounds that position appropriate functional groups in similar three dimensional structural arrangement, then build combinatorial chemistry libraries around such chemical entities to identify those with high affinity to the binding pocket of kallikrein 7.

In a specific embodiment of the invention, a cell-based assay is designed to identify ligands which inhibit the biological activity of kallikrein 7.

Ligands, such as small molecular weight compounds can be identified from screening compound databases or libraries and using a computational means to form a fitting operation to a binding site on the kallikrein 7. The three dimensional structure of kallikrein 7 as provided in the present invention by the structure coordinates of Table 3 or a selected portion of it, can be used together with various docking programs.

The potential inhibitory or binding effect of a chemical entity on kallikrein 7 may be analyzed prior to its actual synthesis and testing by the use of computer-modeling techniques. If the theoretical structure of the given chemical entity suggests insufficient interaction and association between it and Kallikrein 7, the need for synthesis and testing of the chemical entity is obviated. However, if computer modeling indicates a strong interaction, the molecule may then be synthesized and tested for its ability to bind to kallikrein 7. Thus, expensive and time-consuming synthesis of inoperative compounds may be avoided.

This “in silico” analysis may begin by visual inspection of, for example, the binding pocket on a computer screen based on the structural coordinates of Table 3 in whole or in part. Selected fragments or chemical entities may then be positioned in a variety of orientations, or “docked,” within the binding pocket of kallikrein 7. Docking may be accomplished using software such as Quanta and SYBYL, followed by energy minimization and molecular dynamics with standard molecular mechanics force fields, such as CHARMM and AMBER. Specialized computer programs may be of use for selecting interesting fragments or chemical entities. These programs include, for example, GRID, available from Oxford University, Oxford, UK; 5 MCSS or CATALYST, available from Molecular Simulations, Burlington, Mass.; AUTODOCK, available from Scripps Research Institute, La Jolla, Calif.; DOCK, available from University of California, San Francisco, Calif., and XSITE, available from University College of London, UK.

Preferred is a method for designing a kallikrein 7 inhibitor which interacts at the substrate binding site of kallikrein 7 or any other binding sites. One approach enabled by this invention is the use of the structure coordinates of kallikrein 7 to design chemical entities that bind to or associate with Kallikrein 7 and alter the physical properties of the chemical entities in different ways. Thus, properties such as, for example, solubility, affinity, specificity, potency, on/off rates, or other binding characteristics may all be altered and/or maximized. One may design desired chemical entities by probing a kallikrein 7 comprising the binding pocket of the invention with a library of different entities to determine optimal sites for interaction between candidate chemical entities and kallikrein 7. For example, high-resolution X-ray diffraction data collected from crystals saturated with solvent allows the determination of where each type of solvent molecule adheres. Small molecules that bind tightly to those sites can then be designed and synthesized and tested for the desired activity. Once the desired activity is obtained, the molecules can be further altered to maximize desirable properties.

Once a compound has been designed or selected by the above methods, the efficiency with which that compound may bind to kallikrein 7 may be tested and modified for the maximum desired characteristic(s) using computational or experimental evaluation. Various parameters can be maximized depending on the desired result. These include, but are not limited to, specificity, affinity, on/off rates, hydrophobicity, solubility, and other characteristics readily identifiable by the skilled artisan.

In a preferred embodiment, the structure coordinates of Table 3 of kallikrein 7 is used in the above computer-based design step.

The invention further relates to a method for selecting a ligand that binds to kallikrein 7, comprising:

a. co-crystallizing or incubating a candidate compound or mix of compounds with kallikrein 7 under appropriate conditions,
b. determining by X-ray or NMR methods the amino acids of kallikrein 7 which interacts with the candidate compound,
c. selecting the compound which interacts at least with one or more amino acids of the binding pocket.

For carrying out step b., mapping of the binding site of ligand is usually performed by recording NMR spectra with and without the candidate compound, and identifying those resonances of the protein that are affected by ligand binding. This requires assignment of the protein resonance prior to the analysis, or comparison with the pattern of chemical shift changes that occur upon binding of ligands with known binding sites. Alternatively, competition experiments using said ligands with known binding sites can yield equivalent information.

The present invention further provides methods to design novel ligands of kallikrein 7, using fragment linking approaches. Compounds binding to different binding regions of Kallikrein 7 are first selected. The ligands are linked together based on the spatial orientation, so that the designed novel compounds fits within the two binding sites.

The invention thus relates to a method to design ligands to kallikrein 7, wherein said method comprises:

a. providing a first ligand that binds to one or more amino acids of a first binding region of kallikrein 7,

b. providing a second ligand that binds to one or more amino acids of a second binding region of Kallikrein 7, and,

c. linking said first ligand to said second ligand to design a ligand that binds to the first and second binding pockets of kallikrein 7.

The selection of an appropriate linking group is made by maintaining the spatial orientation of the ligands to one another and to kallikrein 7 based upon principles of bond angle and bond length information well known in the organic chemical art.

In addition, antagonists of kallikrein 7 can be used to treat patients, or for the manufacture of a medicament to treat, for inflammatory and/or hyperpoliferative and pruritic skin diseases such as keloids, hypertrophic scars, acne, atopic dermatitis, psoriasis, pustular psoriasis, rosacea, Netherton's syndrome or other pruritic dermatoses such as prurigo nodularis, unspecified itch of the elderly as well as other diseases with epithelial barrier dysfunction such as aged skin, inflammatory bowel disease and Crohn's disease, as well as pancreatitis, or of cancer, in particular ovarian cancer.

The following examples serve to illustrate the present invention but should not be construed as a limitation thereof. The invention particularly relates to the specific embodiments described in these examples.

EXAMPLES Cloning

To prevent autocleavage of hK7, the autocleavage site at position Tyr180 (numbering according to Swiss-Prot entry P49862) has been mutated to Arg by site-directed mutagenesis according to the standard protocol using pET24_His-Pro-EK-KLK7(aa37-253) as template (QuickChange site-directed mutagenesis kit; Stratagene; mutagenesis primer: 5′ GACTGCACGAAGGTTCGCAAGGACTTACTGGAAAATTCCATGC). Cloning of vector pET24_His-Pro-EK-KLK7(aa37-253) has been in a manner usual in the art. The final vector was named pET24c-His-ProKLK7-Enterok-KLK7(aa37-253)_Y180R.

Expression and Purification

E. coli strain BL21(DE3) harboring the expression plasmid for pro-hK7 was cultivated at 37 C in LB medium containing 34 μg/ml chloramphenicol and 30 μg/ml kanamycin. Induction was started with 0.4 mM IPTG at an OD600 of 1.0 for 4 hours at 37° C. Subsequently, the cells were harvested by centrifugation. All purification steps were done at 4 C, unless stated otherwise. Cells from 10 liter E. coli cell culture (25 g cell pellet) were resuspended in 200 ml 50 mM Tris/HCl buffer, pH 8.0 containing 1 mM MgCl2 and stored at −20° C. overnight. After thawing, 1 μl Benzonase (ROCHE) was added and the sample was incubated for 10 min at 37° C. The cells were ruptured by sonication (4 times 20 seconds at 70% amplitude; Branson Digital Sonifier W-450D) and the homogenate was centrifuged at 7000 g for 15 min. The inclusion body-containing pellet was washed three times with 50 mM Tris pH 8.0 buffer containing 25% sucrose, 1% Triton 100 and 1 μl Benzonase and finally two times with H2O containing 1 mM MgCl2. The inclusion bodies were further purified by HPLC using a reverse phase column. For this, the inclusion bodies were dissolved in 6 M GuHCl (10 mg/ml) and 100 mM DTT and applied to a GE Source RPC column (Fine line 35S) equilibrated with 0.1% TFA and 10% acetonitrile. The protein was eluted by an increasing acetonitrile concentration from 10-100%. Fractions containing the protease were pooled and lyophilized. The dried protein was diluted to a final concentration of 50 μg/ml in 50 mM Tris/HCl pH 8.0 buffer (10° C. cold) containing 2 M urea, 500 mM NaCl, 10 mM CaCl2, 0.1 M NH4Cl, 1 mM EDTA, 1.25 mM GSH and 0.5 mM GSSG. Subsequently, the sample was dialyzed against 10 mM Tris pH 8.0 buffer and loaded on a Q-sepharose column (50 ml). The protein was eluted by an increasing salt concentration from 0-0.5 M NaCl and fractions containing pro-hK7 were pooled and concentrated to approx. 5 ml. Subsequently, the sample was activated by the addition of enterokinase (1:100) for 24 h at 8° C. Finally, hK7 was applied to a size exclusion chromatography column (Superdex 75, HiLoad 26/60, Amersham) equilibrated with 50 mM Tris, 100 mM NaCl, pH 8 at a flow rate of 2.5 ml/min. For crystallization trials the protein buffer was exchanged by dialysis against 50 mM sodium acetate at pH 5.6 and 100 mM sodium chloride and the protein was stored at 4° C.

Crystallization

hK7 was concentrated to 24.6 mg/ml and crystallized at 20° C. by the vapor diffusion method in hanging drops. 0.5 μl protein solution containing 50 mM sodium acetate at pH 5.6, 100 mM sodium chloride, 2 mM inhibitor and 1.8% (v/v) DMSO was mixed with 0.5 μl reservoir solution composed of 35% (w/v) PEG 3350, 200 mM calcium chloride and 100 mM sodium acetate at pH 4.8. The drops were equilibrated against 1 ml of the reservoir solution. Diffracting quality crystals appeared within 1-3 days.

Data Collection

For X-ray data collection a crystal was flash frozen in liquid nitrogen without additional cryo-protectant. The X-ray diffraction data were collected from a single crystal for the hK7-inhibitor complex at 95 K at the beamline X10SA of the Swiss Light Source with a MAR225 mosaic CCD detector at a wavelength of 0.9799 Å. For the crystals of hK7 in complex with inhibitors, 299 or 300 images were collected, with 0.5° oscillation each. The exposure time was between 0.5 s and 1 s per image. The crystal-to-detector distance was between 100 mm and 120 mm. The raw diffraction data were processed and scaled with the HKL program suite version 1.98.0 (21) or with XDS/XSCALE (22) using the APRV (23) interface. The crystal data and data collection statistics are summarized in Table 1.

TABLE 1 Data collection statistics Modulator Compound 1 X-ray source SLS/X10SA date of data collection 23.03.2006 Wavelength (Å) 0.979908 Detector MARCCD 225 Temperature (K) 100 Number of crystals 1 Space group P212121 Unit cell dimensions: a, b, c (Å) 42.61, 60.34, 80.63 Number of monomers/a.u. 1 Packing coefficient (Å 3/Da) 2.1 Solvent content (%) 41.5 Resolution range (Å) 33.5-1.1 Number of observations 312326 Number of unique reflections 81660 Overall Data redundancy 3.8 Data completeness (%) 96.0% <   /σ (I)> 34.7 Rmerge 0.087 Highest resolution shell Resolution range 1.14-1.10 Å Completeness for shell 73.9% <   /σ (I)> 2.2 Rmerge for shell 0.334 Rmerge = Σ|Io − <I>|/Σ<I>

Structure Determination and Structure Refinement

The hK7 structure in complex with compound 1 was solved by molecular replacement with the program MOLREP version 9.2.10 (24), using the coordinates of human kallikrein 1 (pdb code 1SPJ, refined to 1.7 Å resolution (25)) as a search model. With a high resolution data cut-off of 4.0 Å an unambiguous solution was found in space group P212121 with one protein-modulator complex in the asymmetric unit (correlation coefficient of 0.34, R-factor of 0.48). An initial refinement cycle was applied using the rigid-body, simulated-annealing and bindividual refinement protocols of the program CNX version 2005 (26) and a high resolution data cut-off of 1.5 Å. The hK7 structure was build and refined by alternating cycles of manual model (re)building using the program O version 9 (27) and automated refinement using the minimize and bindividual protocols of the program CNX version 2005. Subsequently, the resolution was extended to 1.2 Å, 209 water molecules were added using the water-pick protocol of the program CNX version 2005 and finally the modulator was added. Anisotropic displacement parameters were included for the final refinement cylces at 1.2 Å resolution using the adp protocol of CNX 2005. The refinement target was the maximum likelihood function with the parameters described by Engh and Huber (28) using amplitudes. Cross validation was used throughout the refinement process, using 9.8% of the reflections which were excluded from the refinement. The quality of the final model was assessed with the programs CNX 2005 and PROCHECK (29). The refinement statistics are summarized in Table 2.

TABLE 2 Refinement statistics Inhibitor Compound 1 Data used in refinement resolution range 33.5-1.2 intensity cutoff (Sigma(F)) 0.0  number of reflections (working/test set) 58820/6415 completeness (working + test set) 89.5% test set  9.8% Fit to data used in refinement overall Rcryst 0.181 overall Rfree 0.197 Fit in the highest resolution bin resolution range 1.28-1.20 bin completeness (working + test set) 99.5% bin Rcryst 0.182 bin Rfree 0.195 Number of non-hydrogen atoms protein atoms 1785 inhibitor atoms  32 waters  209 Overall B value from Wilson plot 12.5 2 Overall mean B value 16.4 2 protein atoms 17.5 2 inhibitor atoms 14.8 2 water molecules 27.9 2 Cross-validated estimated coordinate error from Luzzati plot 0.13 from σA 0.01 Rms deviations from ideal values bond lengths 0.018 bond angles  1.7° dihedral angles 21.5° improper angles  1.3° Ramachandran plot residues in most favorable regions 90.6% residues in additional allowed regions  9.4% Rcryst = Σ|Fo − Fc|/ΣFo

219 of the 224 amino acids could be traced in the high quality electron density map. Amino acids 166RKDLL170 (amino acid numbering according to the chymotrypsinogen numbering scheme (30) is used throughout the document unless stated otherwise) lack electron density and were not included into the final structures. The arginine residue of this disordered loop is mutated in the construct used for crystallization (according to Swiss-Prot numbering entry P49862 this residue is Tyr180). The wild type tyrosine residue was prone to autocatalytic cleavage, which is not the case for the arginine mutant as was demonstrated by MS analysis.

As expected, six disulfide bonds were found between residues Cys22-Cys157, Cys42-Cys58, Cys129-Cys232, Cys136-Cys201, Cys168-Cys182 and Cys191-Cys220 and cis-peptide bonds were build for amino acids Pro147 and Pro219. Due to the high resolution of the structure the side chains of amino acids 30, 38, 39, 49, 50, 84, 90, 110, 138, 153, 161, 164, 187, 192 and 200 were build in two conformations

Structure of hK7

The structure of hK7 resembles the overall architecture of hK1, hK6 and hK8 (25, 31, 32) and follows the classical chymotrypsin like fold, composed of two β-barrels and a C-terminal α-helix. The active site, including the catalytic triad composed of His57, Asp102 and Ser195 is located at the interface of the two 6-barrels.

Similar to hK5 and hK6 and in contrast to hK1, hK7 lacks the so called kallikrein loop. The kallikrein loop is an insertion of up to 11 amino acid residues between Thr96 and Gln97 characteristic for some of the kallikreins, especially the classical ones. It protrudes over the non-primed binding site like a lid. hK7 has no amino acid insertion in this region and is indistinguishable in length compared to trypsin or chymotrypsin.

Despite the overall structural similarity to other kallikreins, the S1 pocket of hK7 differs from the trypsin-like specificity of e.g. hK1, hK5, hK6 and hK8 in that the polar Asn189 replaces the negatively charged Asp at the bottom of the pocket and the hydrophobic Ala190 substitutes the polar Ser/Thr residues. These specific structural features of the S1 pocket are well in agreement with the observed chymotrypsin-like specificity of hK7 with a preference for medium to large sized S1 residues with a polar tip. hK7 has a preferred specificity for Tyr over Ala, Met and Phe in P1 (1, 33).

A disordered loop is located at the far end of the S3/S4 substrate binding pocket. In other S1 serine proteases complexed with inhibitors binding from S1 to S3, the homologous loop is ordered and folds back forming part of the S3/S4 binding pocket, thereby contributing to inhibitor binding. Therefore, it might be possible that this part of the kallikrein 7 structure gets ordered upon binding of inhibitors that occupy the S3/S4 pockets. In addition, due to the autocleavage after the tyrosine residue of this loop during purification, this tyrosine has been replaced by an arginine residue, which might also influence the conformation of this loop.

Our modulators bind to the active site of kallikrein 7 adopting an unexpected binding mode spanning from S1 towards the primed binding site.

For compound 1 the naphthyl and methoxyphenyl moieties bind to the S1 and S2′ pockets, respectively. The central pyrrolidine ring binds to the S1′ pocket and induces a conformational change of the His57 side chain, thereby disturbing the catalytic triad composed of His57, Asp102 and Ser195. Upon inhibitor binding, the His57 side chain swings towards the S2 pocket (rotation around chi1 by 120° and around chi2 by 90° compared to the structure of hK6 pdb code 1 L2E) and forms together with the disulfide bond between Cys42 and Cys58 a hydrophobic pocket occupied by the pyrrolidine ring of the inhibitor. The carbonyl oxygen atom of the inhibitor's urea moiety occupies the oxyanion hole and is in H-bonding distance to the backbone nitrogen atoms of Gly193 and Ser195. One urea nitrogen atom makes water mediated interactions to the side chain of His57 and the backbone carbonyl group of Ser214. The inhibitor amide nitrogen atom interacts with the backbone carbonyl oxygen atom of His41. The methoxyphenyl moiety is in Van-der-Waals distance to Val149 and Phe151 with the phenyl ring making an edge-to-face interaction to the side chain of Phe151.

Within the crystal environment a symmetry related hK7 molecule packs in close proximity to the active site of hK7. As previously mentioned, the modulator binding induces a movement of the catalytic His57 side chain. One nitrogen atom of this displaced His57 side chain is in H-bonding distance to the backbone carbonyl group of Phe151 of the symmetry related molecule. In addition, the primed site moieties of the modulators are in contact with the side chains of Pro21 and Asp154 of the same symmetry related molecule. Therefore, an influence on the binding modes of the modulators by the crystal contacts cannot be totally excluded. However, the crystal contact does not prevent binding of different prime site scaffolds in different prime site pockets.

TABLE 3 Three-dimensional structure of the new binding pocket of kallikrein 7 CRYST1 42.611 60.343 80.633 90.00 90.00 90.00 P 21 21 21 4 ORIGX1 1.000000 0.000000 0.000000 0.00000 ORIGX2 0.000000 1.000000 0.000000 0.00000 ORIGX3 0.000000 0.000000 1.000000 0.00000 SCALE1 0.023468 0.000000 0.000000 0.00000 SCALE2 0.000000 0.016572 0.000000 0.00000 SCALE3 0.000000 0.000000 0.012402 0.00000 ATOM 1 CB ILE A  16 5.077 12.746 32.116 1.00 10.74 A C ANISOU 1 CB ILE A  16 1357 1177 1385 9 1 0 A C SIGUIJ 1 CB ILE A  16 22 18 18 999999 999999 999999 A C ATOM 2 CG2 ILE A  16 4.414 12.703 30.717 1.00 11.43 A C ANISOU 2 CG2 ILE A  16 1373 1474 1390 7 −2 0 A C SIGUIJ 2 CG2 ILE A  16 22 13 13 999999 852 999999 A C ATOM 3 CG1 ILE A  16 5.646 11.351 32.538 1.00 10.15 A C ANISOU 3 CG1 ILE A  16 1298 1167 1395 −13 −4 0 A C SIGUIJ 3 CG1 ILE A  16 15 11 11 999999 999999 999999 A C ATOM 4 CD1 ILE A  16 6.590 10.689 31.560 1.00 10.76 A C ANISOU 4 CD1 ILE A  16 1346 1238 1417 29 5 −1 A C SIGUIJ 4 CD1 ILE A  16 15 22 10 999999 999999 999999 A C ATOM 5 C ILE A  16 5.552 15.206 31.787 1.00 10.91 A C ANISOU 5 C ILE A  16 1183 1092 1440 4 −108 −3 A C SIGUIJ 5 C ILE A  16 12 15 9 999999 999999 999999 A C ATOM 6 O ILE A  16 4.774 15.767 32.532 1.00 10.79 A O ANISOU 6 O ILE A  16 1286 1171 1507 63 −57 −6 A O SIGUIJ 6 O ILE A  16 1 0 0 221 57 289 A O ATOM 7 N ILE A  16 6.698 13.966 33.589 1.00 9.90 A N ANISOU 7 N ILE A  16 1283 1064 1282 59 0 1 A N SIGUIJ 7 N ILE A  16 1 0 0 221 66 290 A N ATOM 8 CA ILE A  16 6.169 13.847 32.184 1.00 10.55 A C ANISOU 8 CA ILE A  16 1283 1114 1281 81 0 −1 A C SIGUIJ 8 CA ILE A  16 14 13 21 0 265989 999999 A C ATOM 9 N ILE A  17 5.926 15.671 30.585 1.00 11.18 A N ANISOU 9 N ILE A  17 1446 1153 1477 56 2 −2 A N SIGUIJ 9 N ILE A  17 1 0 0 221 66 290 A N ATOM 10 CA ILE A  17 5.417 16.952 30.064 1.00 12.10 A C ANISOU 10 CA ILE A  17 1450 1172 1618 57 −64 8 A C SIGUIJ 10 CA ILE A  17 8 9 12 156 1511 999999 A C ATOM 11 CB ILE A  17 6.529 17.735 29.350 1.00 12.26 A C ANISOU 11 CB ILE A  17 1537 1234 1787 48 55 9 A C SIGUIJ 11 CB ILE A  17 8 8 10 180 6 999999 A C ATOM 12 CG2 ILE A  17 5.941 19.119 28.872 1.00 12.53 A C ANISOU 12 CG2 ILE A  17 1893 1304 1900 189 2 15 A C SIGUIJ 12 CG2 ILE A  17 8 8 8 191 617 999999 A C ATOM 13 CG1 ILE A  17 7.750 17.957 30.263 1.00 12.96 A C ANISOU 13 CG1 ILE A  17 1634 1643 1921 0 −58 −1 A C SIGUIJ 13 CG1 ILE A  17 8 7 7 197 676 999999 A C ATOM 14 CD1 ILE A  17 7.426 18.712 31.538 1.00 13.60 A C ANISOU 14 CD1 ILE A  17 1963 1656 1929 44 2 1 A C SIGUIJ 14 CD1 ILE A  17 8 7 6 201 676 999999 A C ATOM 15 C ILE A  17 4.313 16.687 29.037 1.00 12.56 A C ANISOU 15 C ILE A  17 1402 1257 1586 32 −21 0 A C SIGUIJ 15 C ILE A  17 8 7 5 204 659 988023 A C ATOM 16 O ILE A  17 4.516 15.889 28.122 1.00 12.36 A O ANISOU 16 O ILE A  17 1497 1275 1591 49 −5 1 A O SIGUIJ 16 O ILE A  17 1 0 0 221 57 289 A O ATOM 17 N ASP A  18 3.150 17.343 29.232 1.00 13.27 A N ANISOU 17 N ASP A  18 1416 1360 1685 89 −34 −3 A N SIGUIJ 17 N ASP A  18 1 0 0 221 66 290 A N ATOM 18 CA ASP A  18 2.007 17.349 28.291 1.00 14.05 A C ANISOU 18 CA ASP A  18 1544 1613 1897 46 −212 60 A C SIGUIJ 18 CA ASP A  18 7 7 4 206 638 855653 A C ATOM 19 CB ASP A  18 2.386 17.918 26.913 1.00 15.58 A C ANISOU 19 CB ASP A  18 2263 1479 1926 68 −18 −3 A C SIGUIJ 19 CB ASP A  18 7 7 4 208 617 754615 A C ATOM 20 CG ASP A  18 1.151 18.251 26.055 1.00 16.60 A C ANISOU 20 CG ASP A  18 2333 1838 1991 172 −63 −25 A C SIGUIJ 20 CG ASP A  18 7 7 3 209 596 674948 A C ATOM 21 OD1 ASP A  18 0.112 18.577 26.628 1.00 18.23 A O ANISOU 21 OD1 ASP A  18 2635 4119 2133 945 30 51 A O SIGUIJ 21 OD1 ASP A  18 1 0 0 221 57 289 A O ATOM 22 OD2 ASP A  18 1.233 18.185 24.829 1.00 17.67 A O ANISOU 22 OD2 ASP A  18 2389 3156 1991 483 −53 −40 A O SIGUIJ 22 OD2 ASP A  18 1 0 0 221 57 289 A O ATOM 23 C ASP A  18 1.403 15.964 28.130 1.00 14.19 A C ANISOU 23 C ASP A  18 1588 1641 1795 −3 −25 −1 A C SIGUIJ 23 C ASP A  18 7 7 3 210 576 610513 A C ATOM 24 O ASP A  18 0.895 15.606 27.045 1.00 14.18 A O ANISOU 24 O ASP A  18 1730 1957 1807 −162 −32 −33 A O SIGUIJ 24 O ASP A  18 1 0 0 221 57 289 A O ATOM 25 N GLY A  19 1.416 15.209 29.232 1.00 14.20 A N ANISOU 25 N GLY A  19 1512 1612 1803 −41 −23 −6 A N SIGUIJ 25 N GLY A  19 1 0 0 221 66 290 A N ATOM 26 CA GLY A  19 0.676 13.954 29.260 1.00 14.43 A C ANISOU 26 CA GLY A  19 1470 1590 2177 −13 −3 0 A C SIGUIJ 26 CA GLY A  19 7 7 2 16 2131 13262 A C ATOM 27 C GLY A  19 −0.615 14.053 30.048 1.00 14.46 A C ANISOU 27 C GLY A  19 1325 1580 1798 −38 −240 −26 A C SIGUIJ 27 C GLY A  19 7 8 2 156 1509 13262 A C ATOM 28 O GLY A  19 −1.228 15.140 30.140 1.00 15.36 A O ANISOU 28 O GLY A  19 1457 1603 3368 13 40 −1 A O SIGUIJ 28 O GLY A  19 1 0 0 221 57 289 A O ATOM 29 N ALA A  20 −1.039 12.931 30.604 1.00 14.61 A N ANISOU 29 N ALA A  20 1411 1582 1989 6 −73 2 A N SIGUIJ 29 N ALA A  20 1 0 0 221 66 290 A N ATOM 30 CA ALA A  20 −2.330 12.843 31.298 1.00 14.42 A C ANISOU 30 CA ALA A  20 1426 1559 2026 28 −54 5 A C SIGUIJ 30 CA ALA A  20 7 8 2 180 1232 13262 A C ATOM 31 CB ALA A  20 −3.444 12.549 30.291 1.00 15.24 A C ANISOU 31 CB ALA A  20 1603 2578 2199 −195 −182 −43 A C SIGUIJ 31 CB ALA A  20 7 9 1 191 1068 13262 A C ATOM 32 C ALA A  20 −2.215 11.693 32.256 1.00 14.43 A C ANISOU 32 C ALA A  20 1227 1549 1982 77 13 −2 A C SIGUIJ 32 C ALA A  20 6 9 1 197 955 13262 A C ATOM 33 O ALA A  20 −1.402 10.791 32.055 1.00 13.98 A O ANISOU 33 O ALA A  20 1331 1642 1760 183 −31 14 A O SIGUIJ 33 O ALA A  20 1 0 0 221 57 289 A O ATOM 34 N PRO A  21 −3.043 11.661 33.301 1.00 14.48 A N ANISOU 34 N PRO A  21 1288 1632 2007 39 59 −5 A N SIGUIJ 34 N PRO A  21 1 0 0 221 66 290 A N ATOM 35 CD PRO A  21 −4.048 12.644 33.756 1.00 14.83 A C ANISOU 35 CD PRO A  21 1541 1800 2794 175 325 −92 A C SIGUIJ 35 CD PRO A  21 7 11 1 201 872 13263 A C ATOM 36 CA PRO A  21 −2.941 10.505 34.219 1.00 14.80 A C ANISOU 36 CA PRO A  21 1375 1626 1987 3 4 0 A C SIGUIJ 36 CA PRO A  21 7 13 1 204 807 13263 A C ATOM 37 CB PRO A  21 −4.067 10.765 35.243 1.00 14.78 A C ANISOU 37 CB PRO A  21 1626 2137 2270 87 260 −36 A C SIGUIJ 37 CB PRO A  21 9 20 0 206 755 13263 A C ATOM 38 CG PRO A  21 −4.249 12.306 35.208 1.00 15.02 A C ANISOU 38 CG PRO A  21 1710 2137 2810 95 340 −30 A C SIGUIJ 38 CG PRO A  21 5 0 0 208 712 13264 A C ATOM 39 C PRO A  21 −3.124 9.168 33.462 1.00 15.07 A C ANISOU 39 C PRO A  21 1444 1620 1929 −40 41 6 A C SIGUIJ 39 C PRO A  21 5 1 1 209 675 13264 A C ATOM 40 O PRO A  21 −4.000 9.040 32.592 1.00 15.55 A O ANISOU 40 O PRO A  21 1692 2259 2177 −91 −215 −34 A O SIGUIJ 40 O PRO A  21 1 0 0 221 57 289 A O ATOM 41 N CYS A  22 −2.296 8.185 33.761 1.00 15.39 A N ANISOU 41 N CYS A  22 1549 1659 2056 23 −11 1 A N SIGUIJ 41 N CYS A  22 1 0 0 221 66 290 A N ATOM 42 CA CYS A  22 −2.418 6.865 33.130 1.00 15.88 A C ANISOU 42 CA CYS A  22 1853 1653 2100 10 −75 −3 A C SIGUIJ 42 CA CYS A  22 5 1 1 210 644 13265 A C ATOM 43 C CYS A  22 −3.697 6.228 33.607 1.00 16.58 A C ANISOU 43 C CYS A  22 1864 1719 2307 −16 −27 0 A C SIGUIJ 43 C CYS A  22 5 1 1 211 617 13265 A C ATOM 44 O CYS A  22 −4.105 6.448 34.723 1.00 16.62 A O ANISOU 44 O CYS A  22 2051 1809 2331 −14 49 −2 A O SIGUIJ 44 O CYS A  22 1 0 0 221 57 289 A O ATOM 45 CB CYS A  22 −1.259 5.925 33.523 1.00 15.41 A C ANISOU 45 CB CYS A  22 1802 1480 2278 −117 −147 4 A C SIGUIJ 45 CB CYS A  22 5 1 1 212 592 13266 A C ATOM 46 SG CYS A  22 0.421 6.523 33.162 1.00 14.69 A S ANISOU 46 SG CYS A  22 1822 1696 1955 −194 −224 61 A S SIGUIJ 46 SG CYS A  22 1 0 0 221 49 289 A S ATOM 47 N ALA A  23 −4.321 5.433 32.759 1.00 17.74 A N ANISOU 47 N ALA A  23 2277 1732 2634 5 −394 −34 A N SIGUIJ 47 N ALA A  23 1 0 0 221 66 290 A N ATOM 48 CA ALA A  23 −5.508 4.669 33.194 1.00 18.55 A C ANISOU 48 CA ALA A  23 2391 1809 3463 −41 −135 −3 A C SIGUIJ 48 CA ALA A  23 5 1 1 213 571 13267 A C ATOM 49 CB ALA A  23 −6.037 3.781 32.042 1.00 18.86 A C ANISOU 49 CB ALA A  23 2965 2068 3487 −401 −128 −35 A C SIGUIJ 49 CB ALA A  23 5 1 1 213 552 13268 A C ATOM 50 C ALA A  23 −5.166 3.804 34.407 1.00 19.23 A C ANISOU 50 C ALA A  23 1845 1832 3427 1 37 1 A C SIGUIJ 50 C ALA A  23 5 1 1 214 534 13269 A C ATOM 51 O ALA A  23 −4.112 3.144 34.461 1.00 18.85 A O ANISOU 51 O ALA A  23 1841 1831 3120 0 48 1 A O SIGUIJ 51 O ALA A  23 1 0 0 221 57 289 A O ATOM 52 N ARG A  24 −6.032 3.816 35.411 1.00 20.08 A N ANISOU 52 N ARG A  24 1882 2804 3472 5 75 −1 A N SIGUIJ 52 N ARG A  24 1 0 0 221 65 290 A N ATOM 53 CA ARG A  24 −5.697 3.207 36.691 1.00 20.80 A C ANISOU 53 CA ARG A  24 1855 2815 3452 129 140 −15 A C SIGUIJ 53 CA ARG A  24 5 1 1 214 518 13269 A C ATOM 54 CB ARG A  24 −6.822 3.458 37.694 1.00 22.17 A C ANISOU 54 CB ARG A  24 3555 4746 5612 306 2004 −298 A C SIGUIJ 54 CB ARG A  24 5 1 1 214 504 13270 A C ATOM 55 CG ARG A  24 −6.871 4.917 38.104 1.00 24.04 A C ANISOU 55 CG ARG A  24 7566 4653 3991 894 390 104 A C SIGUIJ 55 CG ARG A  24 5 1 1 215 490 13271 A C ATOM 56 CD ARG A  24 −5.651 5.348 38.911 1.00 25.58 A C ANISOU 56 CD ARG A  24 8395 7383 5215 −3 −385 2 A C SIGUIJ 56 CD ARG A  24 5 1 1 215 478 13273 A C ATOM 57 NE ARG A  24 −6.074 5.585 40.291 1.00 27.17 A N ANISOU 57 NE ARG A  24 10414 8862 5354 905 77 25 A N SIGUIJ 57 NE ARG A  24 1 0 0 221 65 290 A N ATOM 58 CZ ARG A  24 −6.285 6.793 40.812 1.00 27.52 A C ANISOU 58 CZ ARG A  24 6679 8752 5430 224 147 4 A C SIGUIJ 58 CZ ARG A  24 5 1 1 215 466 13274 A C ATOM 59 NH1 ARG A  24 −6.098 7.887 40.064 1.00 28.32 A N ANISOU 59 NH1 ARG A  24 6831 8764 5428 172 118 4 A N SIGUIJ 59 NH1 ARG A  24 1 0 0 221 65 290 A N ATOM 60 NH2 ARG A  24 −6.731 6.923 42.060 1.00 28.06 A N ANISOU 60 NH2 ARG A  24 5890 11495 5319 752 −191 −109 A N SIGUIJ 60 NH2 ARG A  24 1 0 0 221 65 290 A N ATOM 61 C ARG A  24 −5.476 1.724 36.489 1.00 20.46 A C ANISOU 61 C ARG A  24 1964 2810 3539 158 110 −16 A C SIGUIJ 61 C ARG A  24 5 1 1 216 455 13275 A C ATOM 62 O ARG A  24 −6.252 1.056 35.774 1.00 21.02 A O ANISOU 62 O ARG A  24 2562 3150 3998 −121 −294 −37 A O SIGUIJ 62 O ARG A  24 1 0 0 221 57 289 A O ATOM 63 N GLY A  25 −4.405 1.185 37.066 1.00 19.77 A N ANISOU 63 N GLY A  25 1694 2152 3266 −187 298 55 A N SIGUIJ 63 N GLY A  25 1 0 0 221 65 290 A N ATOM 64 CA GLY A  25 −4.142 −0.252 36.960 1.00 19.02 A C ANISOU 64 CA GLY A  25 2494 2178 3788 −31 221 −4 A C SIGUIJ 64 CA GLY A  25 5 1 1 216 445 13276 A C ATOM 65 C GLY A  25 −3.455 −0.704 35.691 1.00 18.44 A C ANISOU 65 C GLY A  25 1599 2043 3543 −102 −238 −3 A C SIGUIJ 65 C GLY A  25 5 1 1 216 436 13277 A C ATOM 66 O GLY A  25 −3.197 −1.879 35.566 1.00 18.78 A O ANISOU 66 O GLY A  25 2182 2069 3909 1 −69 −1 A O SIGUIJ 66 O GLY A  25 1 0 0 221 57 289 A O ATOM 67 N SER A  26 −3.101 0.199 34.775 1.00 17.58 A N ANISOU 67 N SER A  26 1637 1926 3293 −297 −416 −184 A N SIGUIJ 67 N SER A  26 1 0 0 221 65 290 A N ATOM 68 CA SER A  26 −2.521 −0.204 33.539 1.00 16.76 A C ANISOU 68 CA SER A  26 1639 1828 3224 −141 −487 −92 A C SIGUIJ 68 CA SER A  26 5 1 1 216 427 13279 A C ATOM 69 CB SER A  26 −2.959 0.744 32.420 1.00 17.50 A C ANISOU 69 CB SER A  26 2341 1960 3304 23 −634 −58 A C SIGUIJ 69 CB SER A  26 5 1 1 216 419 13280 A C ATOM 70 OG SER A  26 −2.523 2.081 32.633 1.00 17.84 A O ANISOU 70 OG SER A  26 2705 1973 2835 −62 −851 69 A O SIGUIJ 70 OG SER A  26 1 0 0 221 57 289 A O ATOM 71 C SER A  26 −0.983 −0.267 33.562 1.00 15.79 A C ANISOU 71 C SER A  26 1642 1901 2649 −132 −475 −100 A C SIGUIJ 71 C SER A  26 4 1 1 216 411 13282 A C ATOM 72 O SER A  26 −0.388 −0.642 32.569 1.00 15.91 A O ANISOU 72 O SER A  26 1789 1923 2633 5 −449 −18 A O SIGUIJ 72 O SER A  26 1 0 0 221 57 289 A O ATOM 73 N HIS A  27 −0.404 0.093 34.705 1.00 14.85 A N ANISOU 73 N HIS A  27 1597 1233 2583 −97 −450 88 A N SIGUIJ 73 N HIS A  27 1 0 0 221 65 290 A N ATOM 74 CA HIS A  27 1.073 0.045 34.891 1.00 14.13 A C ANISOU 74 CA HIS A  27 1596 1182 2242 −107 −396 104 A C SIGUIJ 74 CA HIS A  27 4 1 1 217 404 13283 A C ATOM 75 CB HIS A  27 1.648 1.471 34.961 1.00 14.38 A C ANISOU 75 CB HIS A  27 1622 1194 2354 −125 −156 −12 A C SIGUIJ 75 CB HIS A  27 4 1 1 217 397 13285 A C ATOM 76 CG HIS A  27 1.495 2.179 33.679 1.00 15.00 A C ANISOU 76 CG HIS A  27 1758 1278 2360 −48 −128 −2 A C SIGUIJ 76 CG HIS A  27 4 1 1 217 390 13286 A C ATOM 77 CD2 HIS A  27 2.337 2.364 32.656 1.00 15.85 A C ANISOU 77 CD2 HIS A  27 2142 1369 2619 15 183 34 A C SIGUIJ 77 CD2 HIS A  27 4 1 1 217 384 13288 A C ATOM 78 ND1 HIS A  27 0.259 2.638 33.259 1.00 15.70 A N ANISOU 78 ND1 HIS A  27 1802 1462 2672 0 −210 2 A N SIGUIJ 78 ND1 HIS A  27 1 0 0 221 65 290 A N ATOM 79 CE1 HIS A  27 0.339 3.050 32.017 1.00 15.87 A C ANISOU 79 CE1 HIS A  27 2573 1650 2706 234 −53 63 A C SIGUIJ 79 CE1 HIS A  27 4 1 1 217 378 13290 A C ATOM 80 NE2 HIS A  27 1.584 2.889 31.613 1.00 15.97 A N ANISOU 80 NE2 HIS A  27 2579 1630 2756 223 −27 16 A N SIGUIJ 80 NE2 HIS A  27 1 0 0 221 65 290 A N ATOM 81 C HIS A  27 1.499 −0.711 36.103 1.00 13.41 A C ANISOU 81 C HIS A  27 1335 1030 2120 −38 −247 −16 A C SIGUIJ 81 C HIS A  27 4 1 1 217 372 13292 A C ATOM 82 O HIS A  27 2.230 −0.213 36.943 1.00 12.83 A O ANISOU 82 O HIS A  27 1319 1289 1972 −233 −109 9 A O SIGUIJ 82 O HIS A  27 1 0 0 221 57 289 A O ATOM 83 N PRO A  28 1.059 −1.976 36.227 1.00 12.88 A N ANISOU 83 N PRO A  28 1587 1063 2237 −143 −402 36 A N SIGUIJ 83 N PRO A  28 1 0 0 221 65 290 A N ATOM 84 CD PRO A  28 0.178 −2.764 35.323 1.00 13.22 A C ANISOU 84 CD PRO A  28 1835 1215 2589 −167 −633 −88 A C SIGUIJ 84 CD PRO A  28 4 1 1 217 366 13294 A C ATOM 85 CA PRO A  28 1.373 −2.734 37.452 1.00 12.51 A C ANISOU 85 CA PRO A  28 1385 1110 2197 −28 −278 24 A C SIGUIJ 85 CA PRO A  28 4 1 1 217 361 13296 A C ATOM 86 CB PRO A  28 0.454 −3.952 37.370 1.00 13.00 A C ANISOU 86 CB PRO A  28 1841 1359 2863 −369 −419 98 A C SIGUIJ 86 CB PRO A  28 4 1 1 218 356 13298 A C ATOM 87 CG PRO A  28 0.220 −4.146 35.990 1.00 13.60 A C ANISOU 87 CG PRO A  28 1975 1284 2883 −96 −481 53 A C SIGUIJ 87 CG PRO A  28 4 1 1 218 351 13300 A C ATOM 88 C PRO A  28 2.842 −3.139 37.575 1.00 12.04 A C ANISOU 88 C PRO A  28 1377 1099 1824 −36 −239 19 A C SIGUIJ 88 C PRO A  28 4 1 1 218 347 13302 A C ATOM 89 O PRO A  28 3.260 −3.581 38.616 1.00 11.68 A O ANISOU 89 O PRO A  28 1326 1114 1831 −80 −229 36 A O SIGUIJ 89 O PRO A  28 1 0 0 221 57 289 A O ATOM 90 N TRP A  29 3.566 −2.991 36.501 1.00 11.90 A N ANISOU 90 N TRP A  29 1528 1241 1911 −72 −107 −4 A N SIGUIJ 90 N TRP A  29 1 0 0 221 65 290 A N ATOM 91 CA TRP A  29 4.996 −3.300 36.496 1.00 12.18 A C ANISOU 91 CA TRP A  29 1523 1332 1800 −64 −101 15 A C SIGUIJ 91 CA TRP A  29 4 1 1 218 342 13304 A C ATOM 92 CB TRP A  29 5.462 −3.949 35.170 1.00 13.13 A C ANISOU 92 CB TRP A  29 2014 1545 1850 145 −35 −22 A C SIGUIJ 92 CB TRP A  29 4 1 1 218 338 13306 A C ATOM 93 CG TRP A  29 4.557 −3.677 34.063 1.00 14.19 A C ANISOU 93 CG TRP A  29 1935 1421 1840 59 5 2 A C SIGUIJ 93 CG TRP A  29 4 1 1 218 334 13309 A C ATOM 94 CD2 TRP A  29 4.456 −2.468 33.269 1.00 14.61 A C ANISOU 94 CD2 TRP A  29 1678 1431 1845 15 −7 0 A C SIGUIJ 94 CD2 TRP A  29 4 1 1 218 330 13311 A C ATOM 95 CE2 TRP A  29 3.367 −2.647 32.397 1.00 14.65 A C ANISOU 95 CE2 TRP A  29 1668 2320 1813 −130 26 14 A C SIGUIJ 95 CE2 TRP A  29 4 1 1 218 326 13313 A C ATOM 96 CE3 TRP A  29 5.164 −1.260 33.223 1.00 14.33 A C ANISOU 96 CE3 TRP A  29 1697 1435 1778 16 3 0 A C SIGUIJ 96 CE3 TRP A  29 4 1 1 218 322 13316 A C ATOM 97 CD1 TRP A  29 3.550 −4.500 33.613 1.00 15.11 A C ANISOU 97 CD1 TRP A  29 2761 2440 1961 −856 −156 143 A C SIGUIJ 97 CD1 TRP A  29 4 1 1 218 319 13318 A C ATOM 98 NE1 TRP A  29 2.846 −3.888 32.651 1.00 15.86 A N ANISOU 98 NE1 TRP A  29 2881 2580 1940 −698 −148 114 A N SIGUIJ 98 NE1 TRP A  29 1 0 0 221 65 290 A N ATOM 99 CZ2 TRP A  29 2.979 −1.691 31.498 1.00 15.40 A C ANISOU 99 CZ2 TRP A  29 2058 2335 1811 −28 17 0 A C SIGUIJ 99 CZ2 TRP A  29 4 1 1 218 315 13321 A C ATOM 100 CZ3 TRP A  29 4.756 −0.305 32.310 1.00 14.89 A C ANISOU 100 CZ3 TRP A  29 1979 1524 1775 179 30 17 A C SIGUIJ 100 CZ3 TRP A  29 4 1 1 218 312 13324 A C ATOM 101 CH2 TRP A  29 3.670 −0.537 31.460 1.00 14.79 A C ANISOU 101 CH2 TRP A  29 2012 2299 1774 13 28 0 A C SIGUIJ 101 CH2 TRP A  29 4 1 1 218 308 13326 A C ATOM 102 C TRP A  29 5.828 −2.043 36.737 1.00 12.02 A C ANISOU 102 C TRP A  29 1359 1288 1518 12 23 1 A C SIGUIJ 102 C TRP A  29 3 1 1 218 305 13329 A C ATOM 103 O TRP A  29 7.069 −2.125 36.796 1.00 12.59 A O ANISOU 103 O TRP A  29 1355 1715 2100 60 1 0 A O SIGUIJ 103 O TRP A  29 1 0 0 221 57 289 A O ATOM 104 N AGLN A  30 5.205 −0.863 36.830 0.50 11.35 A N ANISOU 104 N AGLN A  30 1329 1275 1273 −2 −1 0 A N SIGUIJ 104 N AGLN A  30 1 0 0 221 65 290 A N ATOM 105 N BGLN A  30 5.203 −0.881 36.850 0.50 13.54 A N ANISOU 105 N BGLN A  30 1323 1291 1407 0 0 0 A N SIGUIJ 105 N BGLN A  30 1 0 0 221 65 290 A N ATOM 106 CA AGLN A  30 5.894 0.403 37.181 0.50 11.36 A C ANISOU 106 CA AGLN A  30 1320 1267 1269 0 −2 0 A C SIGUIJ 106 CA AGLN A  30 3 1 1 218 302 13332 A C ATOM 107 CA BGLN A  30 5.970 0.313 37.155 0.50 13.55 A C ANISOU 107 CA BGLN A  30 1312 1301 1399 0 −2 0 A C SIGUIJ 107 CA BGLN A  30 3 1 1 218 299 13335 A C ATOM 108 CB AGLN A  30 5.001 1.609 36.822 0.50 12.26 A C ANISOU 108 CB AGLN A  30 1333 1253 1305 −2 0 0 A C SIGUIJ 108 CB AGLN A  30 3 1 1 218 296 13338 A C ATOM 109 CB BGLN A  30 5.267 1.540 36.592 0.50 14.45 A C ANISOU 109 CB BGLN A  30 1335 1312 1452 0 −6 0 A C SIGUIJ 109 CB BGLN A  30 3 1 2 219 294 13341 A C ATOM 110 CG AGLN A  30 5.508 3.025 37.334 0.50 14.52 A C ANISOU 110 CG AGLN A  30 1371 1241 1278 −7 1 0 A C SIGUIJ 110 CG AGLN A  30 3 1 2 219 291 13344 A C ATOM 111 CG BGLN A  30 6.161 2.794 36.722 0.50 16.71 A C ANISOU 111 CG BGLN A  30 1348 1315 1580 0 −35 0 A C SIGUIJ 111 CG BGLN A  30 3 1 2 219 288 13347 A C ATOM 112 CD AGLN A  30 6.288 3.795 36.261 0.50 14.95 A C ANISOU 112 CD AGLN A  30 1351 1153 1282 37 5 2 A C SIGUIJ 112 CD AGLN A  30 3 1 1 219 286 13350 A C ATOM 113 CD BGLN A  30 6.013 3.746 35.560 0.50 17.14 A C ANISOU 113 CD BGLN A  30 2113 1379 1582 255 76 29 A C SIGUIJ 113 CD BGLN A  30 3 1 1 35 2109 290 A C ATOM 114 OE1 AGLN A  30 5.876 3.821 35.118 0.50 16.06 A O ANISOU 114 OE1 AGLN A  30 1451 2071 1288 196 −24 −17 A O SIGUIJ 114 OE1 AGLN A  30 1 0 0 221 57 289 A O ATOM 115 OE1 BGLN A  30 5.231 3.488 34.662 0.50 18.25 A O ANISOU 115 OE1 BGLN A  30 2203 1420 1669 292 −14 −6 A O SIGUIJ 115 OE1 BGLN A  30 1 0 0 221 57 289 A O ATOM 116 NE2 AGLN A  30 7.403 4.428 36.640 0.50 16.36 A N ANISOU 116 NE2 AGLN A  30 1381 1242 1350 −6 0 0 A N SIGUIJ 116 NE2 AGLN A  30 1 0 0 221 65 289 A N ATOM 117 NE2 BGLN A  30 6.748 4.850 35.586 0.50 18.55 A N ANISOU 117 NE2 BGLN A  30 1820 1249 1612 450 53 57 A N SIGUIJ 117 NE2 BGLN A  30 1 0 0 221 65 289 A N ATOM 118 C AGLN A  30 6.208 0.473 38.664 0.50 10.74 A C ANISOU 118 C AGLN A  30 1091 1125 1264 −1 15 0 A C SIGUIJ 118 C AGLN A  30 3 1 1 157 1501 290 A C ATOM 119 C BGLN A  30 6.210 0.474 38.651 0.50 12.93 A C ANISOU 119 C BGLN A  30 1098 1088 1390 0 1 0 A C SIGUIJ 119 C BGLN A  30 3 1 1 181 1228 290 A C ATOM 120 O AGLN A  30 5.337 0.147 39.489 0.50 10.87 A O ANISOU 120 O AGLN A  30 1106 1331 1279 −50 25 6 A O SIGUIJ 120 O AGLN A  30 1 0 0 221 57 289 A O ATOM 121 O BGLN A  30 5.317 0.188 39.463 0.50 13.06 A O ANISOU 121 O BGLN A  30 1169 1313 1472 −63 66 19 A O SIGUIJ 121 O BGLN A  30 1 0 0 221 57 289 A O ATOM 122 N VAL A  31 7.422 0.905 39.005 1.00 9.60 A N ANISOU 122 N VAL A  31 1089 1057 1213 5 14 1 A N SIGUIJ 122 N VAL A  31 1 0 0 221 65 289 A N ATOM 123 CA VAL A  31 7.763 1.199 40.367 1.00 9.54 A C ANISOU 123 CA VAL A  31 1166 1082 1207 −8 1 0 A C SIGUIJ 123 CA VAL A  31 3 1 1 191 1065 290 A C ATOM 124 CB VAL A  31 8.754 0.156 40.963 1.00 9.53 A C ANISOU 124 CB VAL A  31 1198 1106 1235 11 −1 0 A C SIGUIJ 124 CB VAL A  31 3 1 1 197 953 290 A C ATOM 125 CG1 VAL A  31 8.192 −1.238 40.888 1.00 10.19 A C ANISOU 125 CG1 VAL A  31 1457 1140 1524 −82 −5 −3 A C SIGUIJ 125 CG1 VAL A  31 3 1 1 201 870 290 A C ATOM 126 CG2 VAL A  31 10.134 0.266 40.296 1.00 9.91 A C ANISOU 126 CG2 VAL A  31 1206 1164 1260 3 4 0 A C SIGUIJ 126 CG2 VAL A  31 3 1 1 204 806 290 A C ATOM 127 C VAL A  31 8.337 2.615 40.423 1.00 9.25 A C ANISOU 127 C VAL A  31 1145 1079 1094 12 1 0 A C SIGUIJ 127 C VAL A  31 3 1 1 206 754 290 A C ATOM 128 O VAL A  31 8.676 3.230 39.417 1.00 9.42 A O ANISOU 128 O VAL A  31 1235 1123 1098 8 18 1 A O SIGUIJ 128 O VAL A  31 1 0 0 221 57 289 A O ATOM 129 N ALA A  32 8.436 3.153 41.652 1.00 9.37 A N ANISOU 129 N ALA A  32 1272 1099 1098 −23 16 −2 A N SIGUIJ 129 N ALA A  32 1 0 0 221 65 289 A N ATOM 130 CA ALA A  32 9.210 4.366 41.898 1.00 9.78 A C ANISOU 130 CA ALA A  32 1249 1094 1197 −13 −1 0 A C SIGUIJ 130 CA ALA A  32 3 1 0 208 711 290 A C ATOM 131 CB ALA A  32 8.351 5.460 42.481 1.00 9.76 A C ANISOU 131 CB ALA A  32 1359 1149 1201 66 10 3 A C SIGUIJ 131 CB ALA A  32 3 1 0 209 675 290 A C ATOM 132 C ALA A  32 10.330 4.050 42.873 1.00 10.12 A C ANISOU 132 C ALA A  32 1242 1129 1199 −11 −1 0 A C SIGUIJ 132 C ALA A  32 3 1 0 210 643 290 A C ATOM 133 O ALA A  32 10.139 3.271 43.844 1.00 10.36 A O ANISOU 133 O ALA A  32 1456 1231 1233 −165 −69 41 A O SIGUIJ 133 O ALA A  32 1 0 0 221 57 289 A O ATOM 134 N LEU A  33 11.476 4.682 42.664 1.00 10.54 A N ANISOU 134 N LEU A  33 1224 1112 1226 3 0 0 A N SIGUIJ 134 N LEU A  33 1 0 0 221 65 289 A N ATOM 135 CA LEU A  33 12.560 4.613 43.607 1.00 11.11 A C ANISOU 135 CA LEU A  33 1222 1142 1244 7 −3 0 A C SIGUIJ 135 CA LEU A  33 3 1 0 211 616 290 A C ATOM 136 CB LEU A  33 13.898 4.466 42.877 1.00 12.76 A C ANISOU 136 CB LEU A  33 1307 1723 1534 78 145 −32 A C SIGUIJ 136 CB LEU A  33 3 1 0 212 592 290 A C ATOM 137 CG LEU A  33 14.013 3.133 42.096 1.00 13.82 A C ANISOU 137 CG LEU A  33 2005 1782 1606 316 −131 −94 A C SIGUIJ 137 CG LEU A  33 3 1 0 213 570 290 A C ATOM 138 CD1 LEU A  33 15.339 3.077 41.298 1.00 15.26 A C ANISOU 138 CD1 LEU A  33 2152 3310 1943 551 89 191 A C SIGUIJ 138 CD1 LEU A  33 3 1 0 213 551 290 A C ATOM 139 CD2 LEU A  33 13.824 1.976 43.017 1.00 14.92 A C ANISOU 139 CD2 LEU A  33 3327 1868 1759 214 9 1 A C SIGUIJ 139 CD2 LEU A  33 3 1 0 214 534 290 A C ATOM 140 C LEU A  33 12.540 5.910 44.392 1.00 11.52 A C ANISOU 140 C LEU A  33 1208 1140 1249 −7 −1 0 A C SIGUIJ 140 C LEU A  33 3 1 0 214 518 290 A C ATOM 141 O LEU A  33 12.664 7.004 43.780 1.00 10.87 A O ANISOU 141 O LEU A  33 1395 1137 1241 −18 13 −1 A O SIGUIJ 141 O LEU A  33 1 0 0 221 57 289 A O ATOM 142 N LEU A  34 12.396 5.788 45.715 1.00 11.68 A N ANISOU 142 N LEU A  34 1170 1376 1248 15 3 0 A N SIGUIJ 142 N LEU A  34 1 0 0 221 65 289 A N ATOM 143 CA LEU A  34 12.314 6.943 46.604 1.00 12.60 A C ANISOU 143 CA LEU A  34 1479 1370 1243 7 73 3 A C SIGUIJ 143 CA LEU A  34 3 1 0 214 503 290 A C ATOM 144 CB LEU A  34 11.081 6.842 47.541 1.00 12.95 A C ANISOU 144 CB LEU A  34 1514 1734 1296 −17 119 10 A C SIGUIJ 144 CB LEU A  34 3 1 0 215 490 290 A C ATOM 145 CG LEU A  34 9.777 6.385 46.830 1.00 12.96 A C ANISOU 145 CG LEU A  34 1607 1906 1508 −69 −3 1 A C SIGUIJ 145 CG LEU A  34 3 1 0 215 477 290 A C ATOM 146 CD1 LEU A  34 8.650 6.238 47.872 1.00 13.74 A C ANISOU 146 CD1 LEU A  34 1687 2206 1548 −130 51 −19 A C SIGUIJ 146 CD1 LEU A  34 3 1 0 215 466 290 A C ATOM 147 CD2 LEU A  34 9.357 7.365 45.767 1.00 13.15 A C ANISOU 147 CD2 LEU A  34 1786 1933 1514 11 −1 0 A C SIGUIJ 147 CD2 LEU A  34 3 1 0 216 455 290 A C ATOM 148 C LEU A  34 13.565 7.002 47.468 1.00 13.57 A C ANISOU 148 C LEU A  34 1511 1624 1306 −12 30 1 A C SIGUIJ 148 C LEU A  34 3 1 0 216 445 290 A C ATOM 149 O LEU A  34 14.159 5.987 47.850 1.00 13.68 A O ANISOU 149 O LEU A  34 1564 1637 1416 2 −11 0 A O SIGUIJ 149 O LEU A  34 1 0 0 221 57 289 A O ATOM 150 N SER A  35 13.936 8.232 47.793 1.00 14.73 A N ANISOU 150 N SER A  35 1898 1654 1350 −116 −70 21 A N SIGUIJ 150 N SER A  35 1 0 0 221 65 289 A N ATOM 151 CA SER A  35 14.881 8.464 48.857 1.00 16.41 A C ANISOU 151 CA SER A  35 2180 2469 1578 −157 −305 −116 A C SIGUIJ 151 CA SER A  35 3 1 0 216 436 290 A C ATOM 152 CB SER A  35 15.753 9.660 48.459 1.00 17.26 A C ANISOU 152 CB SER A  35 2216 2459 2653 −95 0 0 A C SIGUIJ 152 CB SER A  35 3 1 0 216 427 290 A C ATOM 153 OG SER A  35 16.663 9.949 49.532 1.00 19.50 A O ANISOU 153 OG SER A  35 2541 5015 2800 −738 −110 −149 A O SIGUIJ 153 OG SER A  35 1 0 0 221 57 289 A O ATOM 154 C SER A  35 14.032 8.785 50.083 1.00 16.90 A C ANISOU 154 C SER A  35 2398 2366 1625 −6 −193 2 A C SIGUIJ 154 C SER A  35 3 1 0 216 419 290 A C ATOM 155 O SER A  35 13.521 9.891 50.175 1.00 16.99 A O ANISOU 155 O SER A  35 2400 2365 1781 0 −161 −2 A O SIGUIJ 155 O SER A  35 1 0 0 221 57 289 A O ATOM 156 N GLY A  36 13.870 7.816 50.996 1.00 17.66 A N ANISOU 156 N GLY A  36 2457 2401 1660 −24 −183 29 A N SIGUIJ 156 N GLY A  36 1 0 0 221 65 289 A N ATOM 157 CA GLY A  36 12.902 7.996 52.076 1.00 18.35 A C ANISOU 157 CA GLY A  36 2983 2300 2129 −149 320 −62 A C SIGUIJ 157 CA GLY A  36 3 1 0 217 411 290 A C ATOM 158 C GLY A  36 11.499 8.004 51.475 1.00 18.74 A C ANISOU 158 C GLY A  36 2927 2453 1870 −152 436 −76 A C SIGUIJ 158 C GLY A  36 3 1 0 217 404 290 A C ATOM 159 O GLY A  36 11.031 6.959 50.980 1.00 19.36 A O ANISOU 159 O GLY A  36 3305 2782 2182 −526 835 −406 A O SIGUIJ 159 O GLY A  36 1 0 0 221 57 289 A O ATOM 160 N AASN A  38 10.841 9.156 51.477 0.50 19.21 A N ANISOU 160 N AASN A  38 2998 2481 1260 −106 463 −60 A N SIGUIJ 160 N AASN A  38 1 0 0 221 65 289 A N ATOM 161 N BASN A  38 10.837 9.161 51.484 0.50 21.40 A N ANISOU 161 N BASN A  38 2935 2451 1681 −163 415 −91 A N SIGUIJ 161 N BASN A  38 1 0 0 221 65 289 A N ATOM 162 CA AASN A  38 9.525 9.292 50.867 0.50 19.45 A C ANISOU 162 CA AASN A  38 3071 2625 1630 −86 299 −37 A C SIGUIJ 162 CA AASN A  38 3 1 0 217 397 290 A C ATOM 163 CA BASN A  38 9.584 9.336 50.746 0.50 21.64 A C ANISOU 163 CA BASN A  38 3238 2455 2604 −245 −109 36 A C SIGUIJ 163 CA BASN A  38 3 1 0 217 390 290 A C ATOM 164 CB AASN A  38 8.565 9.931 51.867 0.50 21.32 A C ANISOU 164 CB AASN A  38 3969 3097 1906 520 779 254 A C SIGUIJ 164 CB AASN A  38 3 1 0 217 384 290 A C ATOM 165 CB BASN A  38 8.446 9.760 51.678 0.50 23.51 A C ANISOU 165 CB BASN A  38 3600 3504 2904 159 143 64 A C SIGUIJ 165 CB BASN A  38 3 1 0 217 378 290 A C ATOM 166 CG AASN A  38 9.047 11.305 52.305 0.50 22.29 A C ANISOU 166 CG AASN A  38 4334 3158 2340 437 629 163 A C SIGUIJ 166 CG AASN A  38 3 1 0 217 372 290 A C ATOM 167 CG BASN A  38 7.797 8.601 52.331 0.50 24.48 A C ANISOU 167 CG BASN A  38 3999 3561 3006 25 316 14 A C SIGUIJ 167 CG BASN A  38 3 1 0 217 366 290 A C ATOM 168 OD1 AASN A  38 9.518 11.483 53.418 0.50 23.94 A O ANISOU 168 OD1 AASN A  38 13642 4902 4099 786 −3366 −264 A O SIGUIJ 168 OD1 AASN A  38 1 0 0 221 57 289 A O ATOM 169 OD1 BASN A  38 7.643 8.557 53.549 0.50 26.13 A O ANISOU 169 OD1 BASN A  38 4651 7786 3014 −907 366 32 A O SIGUIJ 169 OD1 BASN A  38 1 0 0 221 57 289 A O ATOM 170 ND2 AASN A  38 8.954 12.272 51.420 0.50 23.58 A N ANISOU 170 ND2 AASN A  38 3506 2961 2202 −23 218 −6 A N SIGUIJ 170 ND2 AASN A  38 1 0 0 221 65 289 A N ATOM 171 ND2 BASN A  38 7.399 7.631 51.525 0.50 25.77 A N ANISOU 171 ND2 BASN A  38 5305 3691 3182 −249 −8 1 A N SIGUIJ 171 ND2 BASN A  38 1 0 0 221 65 289 A N ATOM 172 C AASN A  38 9.587 10.171 49.609 0.50 18.94 A C ANISOU 172 C AASN A  38 2703 2575 1608 −86 266 −69 A C SIGUIJ 172 C AASN A  38 3 1 0 217 361 290 A C ATOM 173 C BASN A  38 9.640 10.322 49.580 0.50 21.13 A C ANISOU 173 C BASN A  38 2703 2394 2572 −42 49 −10 A C SIGUIJ 173 C BASN A  38 3 1 0 218 356 290 A C ATOM 174 O AASN A  38 8.557 10.475 49.008 0.50 19.09 A O ANISOU 174 O AASN A  38 2944 2973 2298 −1 −114 −3 A O SIGUIJ 174 O AASN A  38 1 0 0 221 57 289 A O ATOM 175 O BASN A  38 8.597 10.687 49.032 0.50 21.28 A O ANISOU 175 O BASN A  38 2746 2555 2688 7 −5 0 A O SIGUIJ 175 O BASN A  38 1 0 0 221 57 289 A O ATOM 176 N AGLN A  39 10.789 10.602 49.221 0.50 17.84 A N ANISOU 176 N AGLN A  39 2564 1698 1697 277 233 69 A N SIGUIJ 176 N AGLN A  39 1 0 0 221 65 289 A N ATOM 177 N BGLN A  39 10.842 10.756 49.195 0.50 20.03 A N ANISOU 177 N BGLN A  39 2585 2227 1629 17 −247 −9 A N SIGUIJ 177 N BGLN A  39 1 0 0 221 65 289 A N ATOM 178 CA AGLN A  39 10.911 11.552 48.118 0.50 16.87 A C ANISOU 178 CA AGLN A  39 2168 1642 1636 149 59 16 A C SIGUIJ 178 CA AGLN A  39 3 1 0 218 351 290 A C ATOM 179 CA BGLN A  39 10.968 11.684 48.078 0.50 19.06 A C ANISOU 179 CA BGLN A  39 2140 2182 1656 365 −2 −1 A C SIGUIJ 179 CA BGLN A  39 3 1 0 218 346 290 A C ATOM 180 CB AGLN A  39 12.010 12.556 48.439 0.50 18.21 A C ANISOU 180 CB AGLN A  39 2485 2055 1554 −214 134 −43 A C SIGUIJ 180 CB AGLN A  39 3 1 0 218 342 290 A C ATOM 181 CB BGLN A  39 12.119 12.679 48.323 0.50 20.40 A C ANISOU 181 CB BGLN A  39 2467 2609 1793 −4 −34 2 A C SIGUIJ 181 CB BGLN A  39 3 1 0 218 338 290 A C ATOM 182 CG AGLN A  39 11.590 13.519 49.543 0.50 20.94 A C ANISOU 182 CG AGLN A  39 4813 2247 1558 498 400 67 A C SIGUIJ 182 CG AGLN A  39 3 1 0 218 334 290 A C ATOM 183 CG BGLN A  39 12.162 13.856 47.333 0.50 23.13 A C ANISOU 183 CG BGLN A  39 6609 2671 1942 540 793 97 A C SIGUIJ 183 CG BGLN A  39 3 1 0 218 330 290 A C ATOM 184 CD AGLN A  39 10.530 14.487 49.057 0.50 22.09 A C ANISOU 184 CD AGLN A  39 4844 1804 3110 132 −396 −23 A C SIGUIJ 184 CD AGLN A  39 3 1 0 218 326 290 A C ATOM 185 CD BGLN A  39 13.249 14.884 47.642 0.50 24.28 A C ANISOU 185 CD BGLN A  39 7887 3880 5011 −575 13 −2 A C SIGUIJ 185 CD BGLN A  39 3 1 0 218 322 290 A C ATOM 186 OE1 AGLN A  39 10.757 15.244 48.122 0.50 23.85 A O ANISOU 186 OE1 AGLN A  39 7952 1817 3362 285 481 26 A O SIGUIJ 186 OE1 AGLN A  39 1 0 0 221 57 289 A O ATOM 187 OE1 BGLN A  39 14.098 14.668 48.508 0.50 26.04 A O ANISOU 187 OE1 BGLN A  39 9118 6539 6004 151 −1012 −51 A O SIGUIJ 187 OE1 BGLN A  39 1 0 0 221 57 289 A O ATOM 188 NE2 AGLN A  39 9.365 14.454 49.682 0.50 23.39 A N ANISOU 188 NE2 AGLN A  39 5096 5212 3983 41 71 −10 A N SIGUIJ 188 NE2 AGLN A  39 1 0 0 221 65 289 A N ATOM 189 NE2 BGLN A  39 13.221 16.010 46.939 0.50 25.58 A N ANISOU 189 NE2 BGLN A  39 6178 3851 4926 −526 159 −50 A N SIGUIJ 189 NE2 BGLN A  39 1 0 0 221 65 289 A N ATOM 190 C AGLN A  39 11.215 10.869 46.777 0.50 15.25 A C ANISOU 190 C AGLN A  39 1586 1583 1636 0 0 0 A C SIGUIJ 190 C AGLN A  39 3 1 0 218 318 290 A C ATOM 191 C BGLN A  39 11.231 10.914 46.773 0.50 17.44 A C ANISOU 191 C BGLN A  39 1636 2081 1649 161 −1 3 A C SIGUIJ 191 C BGLN A  39 3 1 0 218 315 290 A C ATOM 192 O AGLN A  39 12.145 10.050 46.676 0.50 14.48 A O ANISOU 192 O AGLN A  39 1594 1581 1457 0 −14 0 A O SIGUIJ 192 O AGLN A  39 1 0 0 221 57 289 A O ATOM 193 O BGLN A  39 12.138 10.069 46.696 0.50 16.67 A O ANISOU 193 O BGLN A  39 1674 2111 1542 191 −4 −4 A O SIGUIJ 193 O BGLN A  39 1 0 0 221 57 289 A O ATOM 194 N LEU A  40 10.460 11.236 45.742 1.00 13.93 A N ANISOU 194 N LEU A  40 1491 1582 1598 −2 66 1 A N SIGUIJ 194 N LEU A  40 1 0 0 221 65 289 A N ATOM 195 CA LEU A  40 10.683 10.606 44.410 1.00 12.92 A C ANISOU 195 CA LEU A  40 1356 1524 1597 −31 53 8 A C SIGUIJ 195 CA LEU A  40 3 1 0 218 312 290 A C ATOM 196 CB LEU A  40 9.769 11.223 43.394 1.00 12.72 A C ANISOU 196 CB LEU A  40 1493 1494 1694 −1 −55 −8 A C SIGUIJ 196 CB LEU A  40 3 1 0 218 308 290 A C ATOM 197 CG LEU A  40 10.039 10.715 41.963 1.00 12.55 A C ANISOU 197 CG LEU A  40 1722 1387 1706 −5 0 0 A C SIGUIJ 197 CG LEU A  40 3 1 0 218 305 290 A C ATOM 198 CD1 LEU A  40 9.679 9.246 41.850 1.00 12.53 A C ANISOU 198 CD1 LEU A  40 1609 1377 1747 14 2 0 A C SIGUIJ 198 CD1 LEU A  40 3 1 0 218 302 290 A C ATOM 199 CD2 LEU A  40 9.166 11.497 40.989 1.00 12.87 A C ANISOU 199 CD2 LEU A  40 2090 1780 1721 377 −27 −22 A C SIGUIJ 199 CD2 LEU A  40 3 1 0 218 299 290 A C ATOM 200 C LEU A  40 12.119 10.859 43.997 1.00 12.46 A C ANISOU 200 C LEU A  40 1335 1197 1424 25 5 0 A C SIGUIJ 200 C LEU A  40 3 1 0 218 296 290 A C ATOM 201 O LEU A  40 12.604 12.013 44.012 1.00 12.88 A O ANISOU 201 O LEU A  40 1625 1248 1672 −94 3 3 A O SIGUIJ 201 O LEU A  40 1 0 0 221 57 289 A O ATOM 202 N HIS A  41 12.788 9.810 43.565 1.00 11.50 A N ANISOU 202 N HIS A  41 1248 1160 1302 −24 1 0 A N SIGUIJ 202 N HIS A  41 1 0 0 221 65 289 A N ATOM 203 CA HIS A  41 14.095 9.947 42.933 1.00 10.71 A C ANISOU 203 CA HIS A  41 1249 1155 1274 −28 0 0 A C SIGUIJ 203 CA HIS A  41 3 1 0 219 293 290 A C ATOM 204 CB HIS A  41 15.128 9.142 43.722 1.00 10.98 A C ANISOU 204 CB HIS A  41 1266 1209 1307 −4 −1 0 A C SIGUIJ 204 CB HIS A  41 3 1 0 219 291 290 A C ATOM 205 CG HIS A  41 16.523 9.500 43.347 1.00 10.96 A C ANISOU 205 CG HIS A  41 1281 1429 1279 −91 2 6 A C SIGUIJ 205 CG HIS A  41 2 1 0 219 288 290 A C ATOM 206 CD2 HIS A  41 17.517 8.800 42.755 1.00 10.94 A C ANISOU 206 CD2 HIS A  41 1306 1513 1249 −42 −1 0 A C SIGUIJ 206 CD2 HIS A  41 2 1 0 219 285 290 A C ATOM 207 ND1 HIS A  41 17.048 10.749 43.618 1.00 11.76 A N ANISOU 207 ND1 HIS A  41 1482 1474 1696 −178 −65 −59 A N SIGUIJ 207 ND1 HIS A  41 1 0 0 221 65 289 A N ATOM 208 CE1 HIS A  41 18.293 10.801 43.195 1.00 11.42 A C ANISOU 208 CE1 HIS A  41 1480 1707 1745 −159 −40 −22 A C SIGUIJ 208 CE1 HIS A  41 2 1 0 219 283 290 A C ATOM 209 NE2 HIS A  41 18.614 9.642 42.680 1.00 11.19 A N ANISOU 209 NE2 HIS A  41 1406 1687 1633 −183 13 8 A N SIGUIJ 209 NE2 HIS A  41 1 0 0 221 65 289 A N ATOM 210 C HIS A  41 14.067 9.523 41.444 1.00 10.29 A C ANISOU 210 C HIS A  41 1182 1050 1269 −7 −3 0 A C SIGUIJ 210 C HIS A  41 2 1 0 219 280 290 A C ATOM 211 O HIS A  41 14.590 10.273 40.588 1.00 10.52 A O ANISOU 211 O HIS A  41 1447 1068 1291 −92 77 −27 A O SIGUIJ 211 O HIS A  41 1 0 0 221 57 289 A O ATOM 212 N CYS A  42 13.481 8.354 41.138 1.00 9.76 A N ANISOU 212 N CYS A  42 1233 1063 1149 −34 10 −3 A N SIGUIJ 212 N CYS A  42 1 0 0 221 64 289 A N ATOM 213 CA CYS A  42 13.458 7.885 39.760 1.00 9.65 A C ANISOU 213 CA CYS A  42 1222 1113 1149 −30 1 0 A C SIGUIJ 213 CA CYS A  42 2 1 0 219 278 290 A C ATOM 214 C CYS A  42 12.287 6.932 39.567 1.00 9.15 A C ANISOU 214 C CYS A  42 1079 897 1150 151 1 −2 A C SIGUIJ 214 C CYS A  42 2 1 0 219 276 290 A C ATOM 215 O CYS A  42 11.652 6.457 40.545 1.00 9.16 A O ANISOU 215 O CYS A  42 1210 1144 1141 −8 3 0 A O SIGUIJ 215 O CYS A  42 1 0 0 221 57 289 A O ATOM 216 CB CYS A  42 14.705 7.106 39.423 1.00 10.11 A C ANISOU 216 CB CYS A  42 1254 1211 1236 16 1 1 A C SIGUIJ 216 CB CYS A  42 2 1 0 219 273 290 A C ATOM 217 SG CYS A  42 16.187 8.081 39.076 1.00 10.44 A S ANISOU 217 SG CYS A  42 1259 1262 1221 0 5 0 A S SIGUIJ 217 SG CYS A  42 1 0 0 221 49 289 A S ATOM 218 N GLY A  43 11.981 6.644 38.326 1.00 9.41 A N ANISOU 218 N GLY A  43 1123 916 1162 72 2 −2 A N SIGUIJ 218 N GLY A  43 1 0 0 221 64 289 A N ATOM 219 CA GLY A  43 11.122 5.525 38.028 1.00 9.14 A C ANISOU 219 CA GLY A  43 1184 946 1182 23 0 0 A C SIGUIJ 219 CA GLY A  43 2 1 0 219 271 290 A C ATOM 220 C GLY A  43 11.888 4.246 37.848 1.00 9.24 A C ANISOU 220 C GLY A  43 1222 956 1143 35 7 2 A C SIGUIJ 220 C GLY A  43 2 1 0 219 269 290 A C ATOM 221 O GLY A  43 13.118 4.214 37.889 1.00 9.94 A O ANISOU 221 O GLY A  43 1219 1071 1587 27 5 0 A O SIGUIJ 221 O GLY A  43 1 0 0 221 56 289 A O ATOM 222 N GLY A  44 11.154 3.165 37.568 1.00 9.21 A N ANISOU 222 N GLY A  44 1227 951 1241 46 0 0 A N SIGUIJ 222 N GLY A  44 1 0 0 221 64 289 A N ATOM 223 CA GLY A  44 11.759 1.840 37.297 1.00 9.38 A C ANISOU 223 CA GLY A  44 1195 949 1269 42 −2 0 A C SIGUIJ 223 CA GLY A  44 2 1 0 219 267 290 A C ATOM 224 C GLY A  44 10.670 0.881 36.925 1.00 9.47 A C ANISOU 224 C GLY A  44 1167 935 1090 60 8 4 A C SIGUIJ 224 C GLY A  44 2 1 0 219 265 290 A C ATOM 225 O GLY A  44 9.475 1.226 36.894 1.00 9.28 A O ANISOU 225 O GLY A  44 1154 1005 1272 64 11 −2 A O SIGUIJ 225 O GLY A  44 1 0 0 221 56 289 A O ATOM 226 N VAL A  45 11.109 −0.343 36.641 1.00 9.57 A N ANISOU 226 N VAL A  45 1228 939 1165 63 9 5 A N SIGUIJ 226 N VAL A  45 1 0 0 221 64 289 A N ATOM 227 CA VAL A  45 10.162 −1.428 36.379 1.00 10.47 A C ANISOU 227 CA VAL A  45 1349 1042 1480 −33 −43 −3 A C SIGUIJ 227 CA VAL A  45 2 1 0 219 263 290 A C ATOM 228 CB VAL A  45 10.067 −1.867 34.895 1.00 11.25 A C ANISOU 228 CB VAL A  45 1934 1227 1484 57 −100 −12 A C SIGUIJ 228 CB VAL A  45 2 1 0 219 261 290 A C ATOM 229 CG1 VAL A  45 9.505 −0.699 34.079 1.00 12.17 A C ANISOU 229 CG1 VAL A  45 2443 1284 1519 201 −199 −37 A C SIGUIJ 229 CG1 VAL A  45 2 1 0 219 259 290 A C ATOM 230 CG2 VAL A  45 11.426 −2.314 34.385 1.00 11.84 A C ANISOU 230 CG2 VAL A  45 1964 1327 1651 79 −23 −4 A C SIGUIJ 230 CG2 VAL A  45 2 1 0 219 257 290 A C ATOM 231 C VAL A  45 10.536 −2.640 37.193 1.00 10.59 A C ANISOU 231 C VAL A  45 1193 1043 1477 −72 −27 1 A C SIGUIJ 231 C VAL A  45 2 1 0 219 255 290 A C ATOM 232 O VAL A  45 11.695 −2.926 37.505 1.00 10.74 A O ANISOU 232 O VAL A  45 1202 1061 1805 −105 −120 41 A O SIGUIJ 232 O VAL A  45 1 0 0 221 56 289 A O ATOM 233 N LEU A  46 9.494 −3.408 37.539 1.00 10.71 A N ANISOU 233 N LEU A  46 1168 973 1575 −10 4 0 A N SIGUIJ 233 N LEU A  46 1 0 0 221 64 289 A N ATOM 234 CA LEU A  46 9.719 −4.660 38.256 1.00 10.83 A C ANISOU 234 CA LEU A  46 1417 991 1583 23 7 0 A C SIGUIJ 234 CA LEU A  46 2 1 0 219 253 290 A C ATOM 235 CB LEU A  46 8.469 −5.021 39.052 1.00 11.09 A C ANISOU 235 CB LEU A  46 1450 1269 1572 −64 6 1 A C SIGUIJ 235 CB LEU A  46 2 1 0 219 252 290 A C ATOM 236 CG LEU A  46 8.600 −6.228 39.986 1.00 11.03 A C ANISOU 236 CG LEU A  46 1562 1272 1562 −60 0 −2 A C SIGUIJ 236 CG LEU A  46 2 1 0 219 250 290 A C ATOM 237 CD1 LEU A  46 9.556 −5.869 41.099 1.00 11.37 A C ANISOU 237 CD1 LEU A  46 1540 1181 1562 −1 0 0 A C SIGUIJ 237 CD1 LEU A  46 2 1 0 219 248 290 A C ATOM 238 CD2 LEU A  46 7.237 −6.661 40.502 1.00 12.42 A C ANISOU 238 CD2 LEU A  46 1663 1418 2039 −113 194 −12 A C SIGUIJ 238 CD2 LEU A  46 2 1 0 219 247 290 A C ATOM 239 C LEU A  46 10.037 −5.762 37.279 1.00 11.25 A C ANISOU 239 C LEU A  46 1508 1024 1604 63 4 −1 A C SIGUIJ 239 C LEU A  46 2 1 0 219 245 290 A C ATOM 240 O LEU A  46 9.172 −6.116 36.443 1.00 11.54 A O ANISOU 240 O LEU A  46 1554 1295 1635 −16 −8 −1 A O SIGUIJ 240 O LEU A  46 1 0 0 221 56 289 A O ATOM 241 N VAL A  47 11.218 −6.360 37.374 1.00 11.33 A N ANISOU 241 N VAL A  47 1473 917 1721 −1 −8 0 A N SIGUIJ 241 N VAL A  47 1 0 0 221 64 289 A N ATOM 242 CA VAL A  47 11.617 −7.457 36.456 1.00 12.20 A C ANISOU 242 CA VAL A  47 1589 944 1749 22 8 0 A C SIGUIJ 242 CA VAL A  47 2 1 0 219 243 290 A C ATOM 243 CB VAL A  47 13.132 −7.531 36.319 1.00 11.95 A C ANISOU 243 CB VAL A  47 1588 1116 2027 27 27 −1 A C SIGUIJ 243 CB VAL A  47 2 1 0 219 242 290 A C ATOM 244 CG1 VAL A  47 13.524 −8.722 35.459 1.00 12.53 A C ANISOU 244 CG1 VAL A  47 1881 1165 2043 135 24 −11 A C SIGUIJ 244 CG1 VAL A  47 2 1 0 219 240 290 A C ATOM 245 CG2 VAL A  47 13.676 −6.210 35.700 1.00 12.70 A C ANISOU 245 CG2 VAL A  47 1707 1139 2103 −9 56 3 A C SIGUIJ 245 CG2 VAL A  47 2 1 0 219 239 290 A C ATOM 246 C VAL A  47 11.094 −8.792 37.019 1.00 12.39 A C ANISOU 246 C VAL A  47 1511 945 1769 46 17 −1 A C SIGUIJ 246 C VAL A  47 2 1 0 219 237 290 A C ATOM 247 O VAL A  47 10.525 −9.641 36.298 1.00 13.11 A O ANISOU 247 O VAL A  47 1875 1153 1846 −200 9 −29 A O SIGUIJ 247 O VAL A  47 1 0 0 221 56 289 A O ATOM 248 N ASN A  48 11.274 −8.986 38.310 1.00 12.97 A N ANISOU 248 N ASN A  48 1610 1093 1767 10 −9 1 A N SIGUIJ 248 N ASN A  48 1 0 0 221 64 289 A N ATOM 249 CA ASN A  48 10.692 −10.197 38.940 1.00 13.56 A C ANISOU 249 CA ASN A  48 1881 1184 1765 −143 −30 21 A C SIGUIJ 249 CA ASN A  48 2 1 0 219 236 290 A C ATOM 250 CB ASN A  48 11.514 −11.465 38.691 1.00 13.95 A C ANISOU 250 CB ASN A  48 1980 1232 1875 −85 −22 3 A C SIGUIJ 250 CB ASN A  48 2 1 0 219 234 290 A C ATOM 251 CG ASN A  48 12.949 −11.323 39.128 1.00 14.48 A C ANISOU 251 CG ASN A  48 2032 1624 2353 −125 −178 8 A C SIGUIJ 251 CG ASN A  48 2 1 0 219 233 290 A C ATOM 252 OD1 ASN A  48 13.236 −10.802 40.234 1.00 14.80 A O ANISOU 252 OD1 ASN A  48 1744 1578 2355 13 −166 −9 A O SIGUIJ 252 OD1 ASN A  48 1 0 0 221 56 289 A O ATOM 253 ND2 ASN A  48 13.863 −11.736 38.267 1.00 15.49 A N ANISOU 253 ND2 ASN A  48 2331 2029 2614 46 56 −4 A N SIGUIJ 253 ND2 ASN A  48 1 0 0 221 64 289 A N ATOM 254 C ASN A  48 10.591 −9.863 40.432 1.00 14.01 A C ANISOU 254 C ASN A  48 1938 1259 1777 −307 26 −25 A C SIGUIJ 254 C ASN A  48 2 1 0 219 232 290 A C ATOM 255 O ASN A  48 10.777 −8.674 40.833 1.00 13.61 A O ANISOU 255 O ASN A  48 1850 1230 1641 −252 −44 32 A O SIGUIJ 255 O ASN A  48 1 0 0 221 56 289 A O ATOM 256 N AGLU A  49 10.232 −10.835 41.275 0.50 14.78 A N ANISOU 256 N AGLU A  49 1993 1342 1824 −383 −31 33 A N SIGUIJ 256 N AGLU A  49 1 0 0 221 64 289 A N ATOM 257 N BGLU A  49 10.279 −10.868 41.259 0.50 16.97 A N ANISOU 257 N BGLU A  49 2692 1451 1833 −668 −125 73 A N SIGUIJ 257 N BGLU A  49 1 0 0 221 64 289 A N ATOM 258 CA AGLU A  49 9.895 −10.519 42.670 0.50 15.14 A C ANISOU 258 CA AGLU A  49 1953 1282 1836 −526 −10 14 A C SIGUIJ 258 CA AGLU A  49 2 1 0 219 230 290 A C ATOM 259 CA BGLU A  49 9.970 −10.660 42.680 0.50 17.33 A C ANISOU 259 CA BGLU A  49 2140 2923 1801 −131 −322 −14 A C SIGUIJ 259 CA BGLU A  49 2 1 0 219 229 290 A C ATOM 260 CB AGLU A  49 9.299 −11.753 43.388 0.50 16.48 A C ANISOU 260 CB AGLU A  49 2320 1346 1820 −689 41 −34 A C SIGUIJ 260 CB AGLU A  49 2 1 0 219 228 290 A C ATOM 261 CB BGLU A  49 9.618 −12.009 43.367 0.50 18.67 A C ANISOU 261 CB BGLU A  49 5735 2899 2972 33 1843 23 A C SIGUIJ 261 CB BGLU A  49 2 1 0 219 226 290 A C ATOM 262 CG AGLU A  49 8.105 −12.394 42.692 0.50 18.70 A C ANISOU 262 CG AGLU A  49 2626 2154 1929 −1165 −48 54 A C SIGUIJ 262 CG AGLU A  49 2 1 0 219 225 290 A C ATOM 263 CG BGLU A  49 8.504 −12.838 42.715 0.50 20.89 A C ANISOU 263 CG BGLU A  49 6858 2850 6466 104 −162 −36 A C SIGUIJ 263 CG BGLU A  49 2 1 0 219 224 290 A C ATOM 264 CD AGLU A  49 8.468 −13.544 41.739 0.50 19.66 A C ANISOU 264 CD AGLU A  49 3022 2158 1755 −883 −230 149 A C SIGUIJ 264 CD AGLU A  49 2 1 0 219 223 290 A C ATOM 265 CD BGLU A  49 7.906 −13.862 43.655 0.50 21.85 A C ANISOU 265 CD BGLU A  49 6242 2697 6614 528 −98 69 A C SIGUIJ 265 CD BGLU A  49 2 1 0 219 222 290 A C ATOM 266 OE1 AGLU A  49 9.352 −13.404 40.878 0.50 20.29 A O ANISOU 266 OE1 AGLU A  49 3300 1254 2020 −905 54 −28 A O SIGUIJ 266 OE1 AGLU A  49 1 0 0 221 56 289 A O ATOM 267 OE1 BGLU A  49 8.685 −14.452 44.415 0.50 22.48 A O ANISOU 267 OE1 BGLU A  49 5760 1973 6434 47 22 0 A O SIGUIJ 267 OE1 BGLU A  49 1 0 0 221 56 289 A O ATOM 268 OE2 AGLU A  49 7.836 −14.615 41.842 0.50 21.02 A O ANISOU 268 OE2 AGLU A  49 2538 1944 1986 −562 −21 16 A O SIGUIJ 268 OE2 AGLU A  49 1 0 0 221 56 289 A O ATOM 269 OE2 BGLU A  49 6.671 −14.055 43.646 0.50 23.21 A O ANISOU 269 OE2 BGLU A  49 6326 6186 4560 −14 −65 3 A O SIGUIJ 269 OE2 BGLU A  49 1 0 0 221 56 289 A O ATOM 270 C AGLU A  49 11.092 −9.977 43.471 0.50 14.59 A C ANISOU 270 C AGLU A  49 1877 959 1825 −364 −1 3 A C SIGUIJ 270 C AGLU A  49 2 1 0 219 220 290 A C ATOM 271 C BGLU A  49 11.117 −10.003 43.452 0.50 16.78 A C ANISOU 271 C BGLU A  49 1898 2721 1417 −13 −68 2 A C SIGUIJ 271 C BGLU A  49 2 1 0 219 219 290 A C ATOM 272 O AGLU A  49 10.911 −9.406 44.538 0.50 14.43 A O ANISOU 272 O AGLU A  49 1617 968 1833 −452 −2 −5 A O SIGUIJ 272 O AGLU A  49 1 0 0 221 56 289 A O ATOM 273 O BGLU A  49 10.903 −9.403 44.497 0.50 16.62 A O ANISOU 273 O BGLU A  49 2607 2738 1454 3 81 −1 A O SIGUIJ 273 O BGLU A  49 1 0 0 221 56 289 A O ATOM 274 N AARG A  50 12.298 −10.150 42.935 0.50 14.49 A N ANISOU 274 N AARG A  50 1891 1588 1752 −249 −23 23 A N SIGUIJ 274 N AARG A  50 1 0 0 221 64 289 A N ATOM 275 N BARG A  50 12.324 −10.137 42.917 0.50 16.68 A N ANISOU 275 N BARG A  50 1933 1479 1657 −163 39 −17 A N SIGUIJ 275 N BARG A  50 1 0 0 221 64 289 A N ATOM 276 CA AARG A  50 13.500 −9.681 43.606 0.50 14.49 A C ANISOU 276 CA AARG A  50 1818 1271 1701 −88 17 −7 A C SIGUIJ 276 CA AARG A  50 2 1 0 219 218 290 A C ATOM 277 CA BARG A  50 13.521 −9.691 43.604 0.50 16.68 A C ANISOU 277 CA BARG A  50 1925 1261 1694 −78 21 −5 A C SIGUIJ 277 CA BARG A  50 2 1 0 219 217 290 A C ATOM 278 CB AARG A  50 14.485 −10.854 43.733 0.50 16.52 A C ANISOU 278 CB AARG A  50 2045 1410 2763 76 −144 −3 A C SIGUIJ 278 CB AARG A  50 2 1 0 219 216 290 A C ATOM 279 CB BARG A  50 14.511 −10.863 43.682 0.50 18.71 A C ANISOU 279 CB BARG A  50 2233 1459 2243 166 0 15 A C SIGUIJ 279 CB BARG A  50 2 1 0 220 215 290 A C ATOM 280 CG AARG A  50 14.078 −11.827 44.830 0.50 19.27 A C ANISOU 280 CG AARG A  50 2668 1491 2900 48 68 56 A C SIGUIJ 280 CG AARG A  50 2 1 0 220 214 290 A C ATOM 281 CG BARG A  50 15.776 −10.563 44.436 0.50 21.46 A C ANISOU 281 CG BARG A  50 2299 2636 2258 −105 5 −9 A C SIGUIJ 281 CG BARG A  50 2 1 0 220 213 290 A C ATOM 282 CD AARG A  50 14.453 −11.226 46.145 0.50 21.50 A C ANISOU 282 CD AARG A  50 4009 2861 2974 −1194 251 −214 A C SIGUIJ 282 CD AARG A  50 2 1 0 220 212 290 A C ATOM 283 CD BARG A  50 15.496 −10.244 45.904 0.50 23.69 A C ANISOU 283 CD BARG A  50 1961 2702 2258 −105 −36 −9 A C SIGUIJ 283 CD BARG A  50 2 1 0 220 210 290 A C ATOM 284 NE AARG A  50 14.330 −12.163 47.243 0.50 23.77 A N ANISOU 284 NE AARG A  50 10900 2957 3100 −1335 899 −149 A N SIGUIJ 284 NE AARG A  50 1 0 0 221 64 289 A N ATOM 285 NE BARG A  50 15.178 −11.468 46.633 0.50 25.96 A N ANISOU 285 NE BARG A  50 3268 2753 2278 −366 95 −42 A N SIGUIJ 285 NE BARG A  50 1 0 0 221 64 289 A N ATOM 286 CZ AARG A  50 14.812 −11.933 48.455 0.50 24.33 A C ANISOU 286 CZ AARG A  50 13002 3449 3369 −1870 159 −30 A C SIGUIJ 286 CZ AARG A  50 2 1 0 220 209 290 A C ATOM 287 CZ BARG A  50 14.845 −11.524 47.916 0.50 26.52 A C ANISOU 287 CZ BARG A  50 6401 1896 2492 −303 909 −62 A C SIGUIJ 287 CZ BARG A  50 2 1 0 220 208 290 A C ATOM 288 NH1 AARG A  50 15.452 −10.794 48.688 0.50 24.98 A N ANISOU 288 NH1 AARG A  50 7444 1672 5139 1342 −320 −124 A N SIGUIJ 288 NH1 AARG A  50 1 0 0 221 64 289 A N ATOM 289 NH1 BARG A  50 14.778 −10.419 48.644 0.50 27.17 A N ANISOU 289 NH1 BARG A  50 2982 1878 2323 88 −2 0 A N SIGUIJ 289 NH1 BARG A  50 1 0 0 221 64 289 A N ATOM 290 NH2 AARG A  50 14.635 −12.813 49.432 0.50 25.28 A N ANISOU 290 NH2 AARG A  50 10903 3280 3376 −1231 350 −56 A N SIGUIJ 290 NH2 AARG A  50 1 0 0 221 64 289 A N ATOM 291 NH2 BARG A  50 14.585 −12.699 48.471 0.50 27.47 A N ANISOU 291 NH2 BARG A  50 5043 1978 2193 −488 −128 21 A N SIGUIJ 291 NH2 BARG A  50 1 0 0 221 64 289 A N ATOM 292 C AARG A  50 14.230 −8.472 42.996 0.50 13.60 A C ANISOU 292 C AARG A  50 1610 1207 1674 40 4 −1 A C SIGUIJ 292 C AARG A  50 2 1 0 220 207 290 A C ATOM 293 C BARG A  50 14.234 −8.472 42.995 0.50 15.79 A C ANISOU 293 C BARG A  50 1663 1187 1666 69 0 −8 A C SIGUIJ 293 C BARG A  50 2 1 0 220 207 290 A C ATOM 294 O AARG A  50 15.150 −7.938 43.635 0.50 13.67 A O ANISOU 294 O AARG A  50 1658 1339 1681 −26 1 1 A O SIGUIJ 294 O AARG A  50 1 0 0 221 56 289 A O ATOM 295 O BARG A  50 15.147 −7.928 43.630 0.50 15.86 A O ANISOU 295 O BARG A  50 1742 1370 1670 −36 −9 3 A O SIGUIJ 295 O BARG A  50 1 0 0 221 56 289 A O ATOM 296 N TRP A  51 13.850 −8.067 41.779 1.00 12.29 A N ANISOU 296 N TRP A  51 1505 1152 1666 −23 12 1 A N SIGUIJ 296 N TRP A  51 1 0 0 221 64 289 A N ATOM 297 CA TRP A  51 14.687 −7.155 41.015 1.00 11.48 A C ANISOU 297 CA TRP A  51 1322 1088 1578 80 −57 4 A C SIGUIJ 297 CA TRP A  51 2 1 0 220 206 290 A C ATOM 298 CB TRP A  51 15.438 −7.960 39.942 1.00 11.69 A C ANISOU 298 CB TRP A  51 1512 1196 1650 156 29 −17 A C SIGUIJ 298 CB TRP A  51 2 1 0 220 205 290 A C ATOM 299 CG TRP A  51 16.522 −8.845 40.509 1.00 12.06 A C ANISOU 299 CG TRP A  51 1546 1244 1789 172 −23 4 A C SIGUIJ 299 CG TRP A  51 2 1 0 220 204 290 A C ATOM 300 CD2 TRP A  51 17.836 −8.423 40.881 1.00 12.06 A C ANISOU 300 CD2 TRP A  51 1547 1134 2005 202 −63 2 A C SIGUIJ 300 CD2 TRP A  51 2 1 0 220 203 290 A C ATOM 301 CE2 TRP A  51 18.523 −9.572 41.358 1.00 12.45 A C ANISOU 301 CE2 TRP A  51 1614 1123 2069 211 −80 5 A C SIGUIJ 301 CE2 TRP A  51 2 1 0 220 202 290 A C ATOM 302 CE3 TRP A  51 18.514 −7.191 40.859 1.00 12.45 A C ANISOU 302 CE3 TRP A  51 1580 1160 2082 175 −53 −2 A C SIGUIJ 302 CE3 TRP A  51 2 1 0 220 201 290 A C ATOM 303 CD1 TRP A  51 16.465 −10.197 40.765 1.00 12.45 A C ANISOU 303 CD1 TRP A  51 1555 1255 2117 201 136 36 A C SIGUIJ 303 CD1 TRP A  51 2 1 0 220 200 290 A C ATOM 304 NE1 TRP A  51 17.655 −10.617 41.271 1.00 12.82 A N ANISOU 304 NE1 TRP A  51 1665 1140 2779 176 −147 22 A N SIGUIJ 304 NE1 TRP A  51 1 0 0 221 64 289 A N ATOM 305 CZ2 TRP A  51 19.835 −9.530 41.785 1.00 12.49 A C ANISOU 305 CZ2 TRP A  51 1611 1163 2023 200 −56 7 A C SIGUIJ 305 CZ2 TRP A  51 2 1 0 220 199 290 A C ATOM 306 CZ3 TRP A  51 19.811 −7.153 41.280 1.00 12.11 A C ANISOU 306 CZ3 TRP A  51 1560 1152 1987 177 −12 1 A C SIGUIJ 306 CZ3 TRP A  51 2 1 0 220 198 290 A C ATOM 307 CH2 TRP A  51 20.475 −8.318 41.738 1.00 12.39 A C ANISOU 307 CH2 TRP A  51 1622 1161 2100 192 −45 3 A C SIGUIJ 307 CH2 TRP A  51 2 1 0 220 197 290 A C ATOM 308 C TRP A  51 13.891 −6.072 40.335 1.00 10.92 A C ANISOU 308 C TRP A  51 1176 1024 1481 −8 7 0 A C SIGUIJ 308 C TRP A  51 2 1 0 220 197 290 A C ATOM 309 O TRP A  51 12.875 −6.331 39.672 1.00 10.75 A O ANISOU 309 O TRP A  51 1253 1057 1624 −29 −90 2 A O SIGUIJ 309 O TRP A  51 1 0 0 221 56 289 A O ATOM 310 N VAL A  52 14.461 −4.863 40.420 1.00 9.93 A N ANISOU 310 N VAL A  52 1180 1012 1381 3 5 0 A N SIGUIJ 310 N VAL A  52 1 0 0 221 64 289 A N ATOM 311 CA VAL A  52 13.946 −3.683 39.687 1.00 10.04 A C ANISOU 311 CA VAL A  52 1260 1029 1401 35 −8 1 A C SIGUIJ 311 CA VAL A  52 2 1 0 220 196 290 A C ATOM 312 CB VAL A  52 13.646 −2.570 40.742 1.00 10.01 A C ANISOU 312 CB VAL A  52 1267 1028 1421 8 5 0 A C SIGUIJ 312 CB VAL A  52 2 1 0 220 195 290 A C ATOM 313 CG1 VAL A  52 13.540 −1.174 40.086 1.00 10.49 A C ANISOU 313 CG1 VAL A  52 1519 1027 1429 22 8 1 A C SIGUIJ 313 CG1 VAL A  52 2 1 0 220 194 290 A C ATOM 314 CG2 VAL A  52 12.358 −2.904 41.442 1.00 10.41 A C ANISOU 314 CG2 VAL A  52 1315 1176 1577 −25 66 −2 A C SIGUIJ 314 CG2 VAL A  52 2 1 0 220 193 290 A C ATOM 315 C VAL A  52 14.986 −3.249 38.695 1.00 9.93 A C ANISOU 315 C VAL A  52 1213 950 1395 98 −18 3 A C SIGUIJ 315 C VAL A  52 2 1 0 220 193 290 A C ATOM 316 O VAL A  52 16.193 −3.210 39.022 1.00 10.38 A O ANISOU 316 O VAL A  52 1200 1474 1279 89 3 −2 A O SIGUIJ 316 O VAL A  52 1 0 0 221 56 289 A O ATOM 317 N LEU A  53 14.537 −2.834 37.532 1.00 9.71 A N ANISOU 317 N LEU A  53 1220 933 1395 84 −2 0 A N SIGUIJ 317 N LEU A  53 1 0 0 221 64 289 A N ATOM 318 CA LEU A  53 15.414 −2.262 36.504 1.00 9.85 A C ANISOU 318 CA LEU A  53 1255 969 1420 69 14 0 A C SIGUIJ 318 CA LEU A  53 2 1 0 220 192 290 A C ATOM 319 CB LEU A  53 15.126 −2.913 35.149 1.00 10.62 A C ANISOU 319 CB LEU A  53 1407 1063 1430 18 3 −3 A C SIGUIJ 319 CB LEU A  53 2 1 0 220 191 290 A C ATOM 320 CG LEU A  53 15.952 −2.426 33.945 1.00 11.41 A C ANISOU 320 CG LEU A  53 1564 1285 1460 −109 58 −30 A C SIGUIJ 320 CG LEU A  53 2 1 0 220 190 290 A C ATOM 321 CD1 LEU A  53 17.413 −2.811 34.144 1.00 11.99 A C ANISOU 321 CD1 LEU A  53 1598 1740 1791 0 14 0 A C SIGUIJ 321 CD1 LEU A  53 2 1 0 220 190 290 A C ATOM 322 CD2 LEU A  53 15.368 −3.099 32.683 1.00 12.17 A C ANISOU 322 CD2 LEU A  53 1834 1300 1485 −176 −27 11 A C SIGUIJ 322 CD2 LEU A  53 2 1 0 220 189 290 A C ATOM 323 C LEU A  53 15.139 −0.749 36.447 1.00 9.78 A C ANISOU 323 C LEU A  53 1161 957 1161 42 0 0 A C SIGUIJ 323 C LEU A  53 2 1 0 220 188 290 A C ATOM 324 O LEU A  53 13.987 −0.283 36.434 1.00 9.80 A O ANISOU 324 O LEU A  53 1161 1023 1414 59 −19 −2 A O SIGUIJ 324 O LEU A  53 1 0 0 221 56 289 A O ATOM 325 N THR A  54 16.206 0.054 36.393 1.00 9.36 A N ANISOU 325 N THR A  54 1186 980 1366 15 5 0 A N SIGUIJ 325 N THR A  54 1 0 0 221 64 289 A N ATOM 326 CA THR A  54 16.127 1.504 36.372 1.00 8.84 A C ANISOU 326 CA THR A  54 1075 983 1311 1 13 0 A C SIGUIJ 326 CA THR A  54 2 1 0 220 187 290 A C ATOM 327 CB THR A  54 16.005 2.003 37.822 1.00 9.07 A C ANISOU 327 CB THR A  54 1303 1023 1315 63 0 0 A C SIGUIJ 327 CB THR A  54 2 1 0 220 187 290 A C ATOM 328 OG1 THR A  54 15.735 3.395 37.800 1.00 9.46 A O ANISOU 328 OG1 THR A  54 1233 1021 1316 33 2 0 A O SIGUIJ 328 OG1 THR A  54 1 0 0 221 56 289 A O ATOM 329 CG2 THR A  54 17.246 1.746 38.680 1.00 9.74 A C ANISOU 329 CG2 THR A  54 1317 1192 1327 102 0 2 A C SIGUIJ 329 CG2 THR A  54 2 1 0 220 186 290 A C ATOM 330 C THR A  54 17.386 2.042 35.672 1.00 8.45 A C ANISOU 330 C THR A  54 1059 1008 1241 0 −14 0 A C SIGUIJ 330 C THR A  54 2 1 0 220 185 290 A C ATOM 331 O THR A  54 18.135 1.279 35.019 1.00 8.67 A O ANISOU 331 O THR A  54 1116 1041 1232 19 11 0 A O SIGUIJ 331 O THR A  54 1 0 0 221 56 289 A O ATOM 332 N ALA A  55 17.617 3.347 35.762 1.00 7.93 A N ANISOU 332 N ALA A  55 1049 1005 1170 −2 −7 0 A N SIGUIJ 332 N ALA A  55 1 0 0 221 64 289 A N ATOM 333 CA ALA A  55 18.795 3.977 35.147 1.00 8.32 A C ANISOU 333 CA ALA A  55 1069 1011 1176 −7 12 0 A C SIGUIJ 333 CA ALA A  55 2 1 0 220 185 290 A C ATOM 334 CB ALA A  55 18.411 5.409 34.690 1.00 8.36 A C ANISOU 334 CB ALA A  55 1358 1036 1190 63 5 1 A C SIGUIJ 334 CB ALA A  55 2 1 0 220 184 290 A C ATOM 335 C ALA A  55 19.957 4.000 36.103 1.00 8.62 A C ANISOU 335 C ALA A  55 1091 1008 1198 −13 −14 0 A C SIGUIJ 335 C ALA A  55 2 0 0 220 183 290 A C ATOM 336 O ALA A  55 19.779 4.158 37.313 1.00 9.17 A O ANISOU 336 O ALA A  55 1214 1103 1202 −8 0 0 A O SIGUIJ 336 O ALA A  55 1 0 0 221 56 289 A O ATOM 337 N ALA A  56 21.161 3.886 35.553 1.00 8.88 A N ANISOU 337 N ALA A  56 1095 1072 1255 2 0 0 A N SIGUIJ 337 N ALA A  56 1 0 0 221 64 289 A N ATOM 338 CA ALA A  56 22.391 4.022 36.349 1.00 9.13 A C ANISOU 338 CA ALA A  56 1104 1100 1268 0 −8 0 A C SIGUIJ 338 CA ALA A  56 2 0 0 220 183 290 A C ATOM 339 CB ALA A  56 23.610 3.713 35.508 1.00 9.18 A C ANISOU 339 CB ALA A  56 1170 1355 1368 54 68 −18 A C SIGUIJ 339 CB ALA A  56 2 0 0 220 182 290 A C ATOM 340 C ALA A  56 22.554 5.400 37.029 1.00 9.29 A C ANISOU 340 C ALA A  56 1031 1098 1243 −5 28 1 A C SIGUIJ 340 C ALA A  56 2 0 0 220 181 290 A C ATOM 341 O ALA A  56 23.143 5.504 38.109 1.00 9.43 A O ANISOU 341 O ALA A  56 1154 1208 1275 1 −41 0 A O SIGUIJ 341 O ALA A  56 1 0 0 221 56 289 A O ATOM 342 N HIS A  57 21.994 6.440 36.418 1.00 9.29 A N ANISOU 342 N HIS A  57 957 1083 1231 −43 84 18 A N SIGUIJ 342 N HIS A  57 1 0 0 221 64 289 A N ATOM 343 CA HIS A  57 22.040 7.794 36.980 1.00 9.88 A C ANISOU 343 CA HIS A  57 1219 1096 1260 −30 0 0 A C SIGUIJ 343 CA HIS A  57 2 0 0 220 181 290 A C ATOM 344 CB HIS A  57 21.411 8.781 35.963 1.00 10.96 A C ANISOU 344 CB HIS A  57 1419 1251 1271 138 58 39 A C SIGUIJ 344 CB HIS A  57 2 0 0 220 180 290 A C ATOM 345 CG HIS A  57 21.862 10.199 36.174 1.00 12.51 A C ANISOU 345 CG HIS A  57 1737 1288 1898 38 −5 0 A C SIGUIJ 345 CG HIS A  57 2 0 0 220 179 290 A C ATOM 346 CD2 HIS A  57 22.606 10.741 37.162 1.00 13.42 A C ANISOU 346 CD2 HIS A  57 1862 1514 1884 −127 0 3 A C SIGUIJ 346 CD2 HIS A  57 2 0 0 220 179 290 A C ATOM 347 ND1 HIS A  57 21.560 11.229 35.324 1.00 14.09 A N ANISOU 347 ND1 HIS A  57 2608 1322 1981 155 −147 −10 A N SIGUIJ 347 ND1 HIS A  57 1 0 0 221 64 289 A N ATOM 348 CE1 HIS A  57 22.111 12.339 35.771 1.00 13.23 A C ANISOU 348 CE1 HIS A  57 2744 1480 1458 −159 453 −54 A C SIGUIJ 348 CE1 HIS A  57 2 0 0 220 178 290 A C ATOM 349 NE2 HIS A  57 22.758 12.076 36.880 1.00 14.35 A N ANISOU 349 NE2 HIS A  57 3163 1518 1641 −219 192 −26 A N SIGUIJ 349 NE2 HIS A  57 1 0 0 221 64 289 A N ATOM 350 C HIS A  57 21.270 7.859 38.294 1.00 9.53 A C ANISOU 350 C HIS A  57 1189 1089 1252 −5 1 0 A C SIGUIJ 350 C HIS A  57 2 0 0 220 177 290 A C ATOM 351 O HIS A  57 21.458 8.814 39.087 1.00 10.26 A O ANISOU 351 O HIS A  57 1338 1104 1272 −37 1 0 A O SIGUIJ 351 O HIS A  57 1 0 0 221 56 289 A O ATOM 352 N CYS A  58 20.425 6.851 38.554 1.00 9.49 A N ANISOU 352 N CYS A  58 1141 1056 1135 30 0 0 A N SIGUIJ 352 N CYS A  58 1 0 0 221 64 289 A N ATOM 353 CA CYS A  58 19.571 6.827 39.746 1.00 9.52 A C ANISOU 353 CA CYS A  58 1135 1174 1134 1 0 0 A C SIGUIJ 353 CA CYS A  58 2 0 0 220 177 290 A C ATOM 354 C CYS A  58 20.272 6.262 40.960 1.00 9.45 A C ANISOU 354 C CYS A  58 1145 1141 1148 0 0 0 A C SIGUIJ 354 C CYS A  58 2 0 0 220 176 290 A C ATOM 355 O CYS A  58 19.644 6.126 42.034 1.00 9.93 A O ANISOU 355 O CYS A  58 1175 1346 1160 −85 0 −2 A O SIGUIJ 355 O CYS A  58 1 0 0 221 56 289 A O ATOM 356 CB CYS A  58 18.255 6.019 39.504 1.00 9.74 A C ANISOU 356 CB CYS A  58 1142 1223 1171 −10 −1 0 A C SIGUIJ 356 CB CYS A  58 2 0 0 220 176 290 A C ATOM 357 SG CYS A  58 17.343 6.738 38.109 1.00 10.15 A S ANISOU 357 SG CYS A  58 1255 1365 1167 73 −21 −8 A S SIGUIJ 357 SG CYS A  58 1 0 0 221 49 289 A S ATOM 358 N LYS A  59 21.545 5.879 40.830 1.00 9.63 A N ANISOU 358 N LYS A  59 1153 1158 1143 0 0 0 A N SIGUIJ 358 N LYS A  59 1 0 0 221 64 289 A N ATOM 359 CA LYS A  59 22.295 5.248 41.932 1.00 10.30 A C ANISOU 359 CA LYS A  59 1207 1213 1158 0 −5 0 A C SIGUIJ 359 CA LYS A  59 2 0 0 220 175 290 A C ATOM 360 CB LYS A  59 23.780 5.188 41.566 1.00 10.96 A C ANISOU 360 CB LYS A  59 1230 1351 1404 13 59 −5 A C SIGUIJ 360 CB LYS A  59 2 0 0 220 174 290 A C ATOM 361 CG LYS A  59 24.660 4.440 42.551 1.00 11.83 A C ANISOU 361 CG LYS A  59 1373 1413 1556 26 −75 22 A C SIGUIJ 361 CG LYS A  59 2 0 0 220 174 290 A C ATOM 362 CD LYS A  59 24.533 2.938 42.481 1.00 12.32 A C ANISOU 362 CD LYS A  59 1496 1416 1989 5 −20 0 A C SIGUIJ 362 CD LYS A  59 2 0 0 220 173 290 A C ATOM 363 CE LYS A  59 25.438 2.259 43.495 1.00 13.78 A C ANISOU 363 CE LYS A  59 1943 1448 2351 32 −400 22 A C SIGUIJ 363 CE LYS A  59 2 0 0 220 173 290 A C ATOM 364 NZ LYS A  59 25.395 0.771 43.306 1.00 14.23 A N ANISOU 364 NZ LYS A  59 1869 1446 2495 2 −88 −1 A N SIGUIJ 364 NZ LYS A  59 1 0 0 221 64 289 A N ATOM 365 C LYS A  59 22.162 5.994 43.235 1.00 10.26 A C ANISOU 365 C LYS A  59 1250 1239 1163 0 −3 0 A C SIGUIJ 365 C LYS A  59 2 0 0 220 172 290 A C ATOM 366 O LYS A  59 22.388 7.236 43.300 1.00 10.37 A O ANISOU 366 O LYS A  59 1272 1239 1294 −6 0 0 A O SIGUIJ 366 O LYS A  59 1 0 0 221 56 289 A O ATOM 367 N MET A  60 21.881 5.232 44.286 1.00 10.70 A N ANISOU 367 N MET A  60 1336 1275 1175 −9 −15 2 A N SIGUIJ 367 N MET A  60 1 0 0 221 64 289 A N ATOM 368 CA MET A  60 21.897 5.745 45.657 1.00 11.34 A C ANISOU 368 CA MET A  60 1248 1409 1190 −70 5 −4 A C SIGUIJ 368 CA MET A  60 2 0 0 220 172 290 A C ATOM 369 CB MET A  60 20.485 6.153 46.160 1.00 11.40 A C ANISOU 369 CB MET A  60 1260 1508 1141 −54 5 −1 A C SIGUIJ 369 CB MET A  60 2 0 0 220 171 290 A C ATOM 370 CG MET A  60 19.864 7.316 45.370 1.00 11.47 A C ANISOU 370 CG MET A  60 1539 1552 1210 0 −88 1 A C SIGUIJ 370 CG MET A  60 2 0 0 220 170 290 A C ATOM 371 SD MET A  60 18.429 8.017 46.154 1.00 12.13 A S ANISOU 371 SD MET A  60 1617 1619 1416 0 32 −4 A S SIGUIJ 371 SD MET A  60 1 0 0 221 49 289 A S ATOM 372 CE MET A  60 17.335 6.674 45.953 1.00 12.68 A C ANISOU 372 CE MET A  60 1631 1618 1685 0 −1 0 A C SIGUIJ 372 CE MET A  60 2 0 0 220 170 290 A C ATOM 373 C MET A  60 22.473 4.642 46.538 1.00 11.97 A C ANISOU 373 C MET A  60 1349 1454 1244 −22 −15 1 A C SIGUIJ 373 C MET A  60 2 0 0 220 169 290 A C ATOM 374 O MET A  60 22.558 3.468 46.135 1.00 11.95 A O ANISOU 374 O MET A  60 1622 1458 1361 6 −42 −1 A O SIGUIJ 374 O MET A  60 1 0 0 221 56 289 A O ATOM 375 N ASN A  61 22.845 5.046 47.770 1.00 12.35 A N ANISOU 375 N ASN A  61 1484 1681 1245 −258 9 −7 A N SIGUIJ 375 N ASN A  61 1 0 0 221 64 289 A N ATOM 376 CA ASN A  61 23.360 4.027 48.734 1.00 13.41 A C ANISOU 376 CA ASN A  61 1617 1771 1319 −213 −53 15 A C SIGUIJ 376 CA ASN A  61 2 0 0 220 169 290 A C ATOM 377 CB ASN A  61 23.892 4.694 50.038 1.00 14.86 A C ANISOU 377 CB ASN A  61 3266 1779 1457 −502 −580 159 A C SIGUIJ 377 CB ASN A  61 2 0 0 220 168 290 A C ATOM 378 CG ASN A  61 22.813 5.445 50.823 1.00 16.38 A C ANISOU 378 CG ASN A  61 3335 1441 1982 −792 −221 101 A C SIGUIJ 378 CG ASN A  61 2 0 0 220 168 290 A C ATOM 379 OD1 ASN A  61 22.045 6.213 50.270 1.00 18.80 A O ANISOU 379 OD1 ASN A  61 4072 2068 1933 −106 −272 14 A O SIGUIJ 379 OD1 ASN A  61 1 0 0 221 56 289 A O ATOM 380 ND2 ASN A  61 22.736 5.213 52.150 1.00 16.96 A N ANISOU 380 ND2 ASN A  61 3563 3835 2029 −1706 −396 422 A N SIGUIJ 380 ND2 ASN A  61 1 0 0 221 64 289 A N ATOM 381 C ASN A  61 22.285 3.003 49.077 1.00 13.01 A C ANISOU 381 C ASN A  61 1424 1571 1372 −3 −7 0 A C SIGUIJ 381 C ASN A  61 2 0 0 220 167 290 A C ATOM 382 O ASN A  61 22.608 1.872 49.349 1.00 13.50 A O ANISOU 382 O ASN A  61 1675 1609 1932 9 −255 91 A O SIGUIJ 382 O ASN A  61 1 0 0 221 56 289 A O ATOM 383 N GLU A  63 21.023 3.431 49.090 1.00 12.53 A N ANISOU 383 N GLU A  63 1385 1471 1537 −62 −3 −1 A N SIGUIJ 383 N GLU A  63 1 0 0 221 63 289 A N ATOM 384 CA GLU A  63 19.913 2.513 49.306 1.00 12.71 A C ANISOU 384 CA GLU A  63 1326 1471 1544 −29 −20 −3 A C SIGUIJ 384 CA GLU A  63 2 0 0 220 167 290 A C ATOM 385 CB GLU A  63 19.736 2.165 50.795 1.00 14.43 A C ANISOU 385 CB GLU A  63 2200 1709 1562 −81 64 −8 A C SIGUIJ 385 CB GLU A  63 2 0 0 220 166 290 A C ATOM 386 CG GLU A  63 19.298 3.358 51.617 1.00 16.54 A C ANISOU 386 CG GLU A  63 2343 1765 1556 27 −22 −1 A C SIGUIJ 386 CG GLU A  63 2 0 0 220 166 290 A C ATOM 387 CD GLU A  63 19.201 3.109 53.132 1.00 18.20 A C ANISOU 387 CD GLU A  63 2750 3194 1587 −794 −150 148 A C SIGUIJ 387 CD GLU A  63 2 0 0 220 165 290 A C ATOM 388 OE1 GLU A  63 19.523 1.977 53.567 1.00 19.99 A O ANISOU 388 OE1 GLU A  63 4498 3286 1741 −416 −449 110 A O SIGUIJ 388 OE1 GLU A  63 1 0 0 221 56 289 A O ATOM 389 OE2 GLU A  63 18.818 4.060 53.865 1.00 19.97 A O ANISOU 389 OE2 GLU A  63 4058 3563 1631 −98 −368 37 A O SIGUIJ 389 OE2 GLU A  63 1 0 0 221 56 289 A O ATOM 390 C GLU A  63 18.664 3.191 48.763 1.00 12.29 A C ANISOU 390 C GLU A  63 1309 1487 1482 −25 −4 −1 A C SIGUIJ 390 C GLU A  63 2 0 0 220 165 290 A C ATOM 391 O GLU A  63 18.691 4.408 48.431 1.00 11.91 A O ANISOU 391 O GLU A  63 1594 1484 1449 −48 −8 3 A O SIGUIJ 391 O GLU A  63 1 0 0 221 56 289 A O ATOM 392 N TYR A  64 17.566 2.423 48.707 1.00 11.40 A N ANISOU 392 N TYR A  64 1302 1504 1269 −33 0 0 A N SIGUIJ 392 N TYR A  64 1 0 0 221 63 289 A N ATOM 393 CA TYR A  64 16.342 2.920 48.090 1.00 11.01 A C ANISOU 393 CA TYR A  64 1304 1529 1246 −17 2 0 A C SIGUIJ 393 CA TYR A  64 2 0 0 220 164 290 A C ATOM 394 CB TYR A  64 16.171 2.369 46.649 1.00 11.12 A C ANISOU 394 CB TYR A  64 1399 1577 1236 −31 12 0 A C SIGUIJ 394 CB TYR A  64 2 0 0 220 164 290 A C ATOM 395 CG TYR A  64 17.429 2.395 45.795 1.00 10.88 A C ANISOU 395 CG TYR A  64 1406 1299 1206 −27 9 −2 A C SIGUIJ 395 CG TYR A  64 2 0 0 220 163 290 A C ATOM 396 CD1 TYR A  64 17.623 3.388 44.817 1.00 10.36 A C ANISOU 396 CD1 TYR A  64 1236 1307 1181 −10 −2 0 A C SIGUIJ 396 CD1 TYR A  64 2 0 0 220 163 290 A C ATOM 397 CE1 TYR A  64 18.785 3.425 44.042 1.00 11.12 A C ANISOU 397 CE1 TYR A  64 1251 1400 1198 −52 3 −1 A C SIGUIJ 397 CE1 TYR A  64 2 0 0 220 162 290 A C ATOM 398 CD2 TYR A  64 18.418 1.456 45.983 1.00 10.39 A C ANISOU 398 CD2 TYR A  64 1401 1279 1269 −37 18 −5 A C SIGUIJ 398 CD2 TYR A  64 2 0 0 220 162 290 A C ATOM 399 CE2 TYR A  64 19.572 1.461 45.226 1.00 11.07 A C ANISOU 399 CE2 TYR A  64 1382 1442 1213 −5 −6 0 A C SIGUIJ 399 CE2 TYR A  64 2 0 0 220 161 290 A C ATOM 400 CZ TYR A  64 19.744 2.465 44.251 1.00 10.47 A C ANISOU 400 CZ TYR A  64 1314 1434 1196 −10 −10 0 A C SIGUIJ 400 CZ TYR A  64 2 0 0 220 161 290 A C ATOM 401 OH TYR A  64 20.920 2.531 43.518 1.00 10.97 A O ANISOU 401 OH TYR A  64 1338 1250 1217 −13 11 −1 A O SIGUIJ 401 OH TYR A  64 1 0 0 221 56 289 A O ATOM 402 C TYR A  64 15.140 2.452 48.882 1.00 10.76 A C ANISOU 402 C TYR A  64 1295 1450 1252 −5 1 0 A C SIGUIJ 402 C TYR A  64 2 0 0 220 161 290 A C ATOM 403 O TYR A  64 15.215 1.388 49.500 1.00 11.00 A O ANISOU 403 O TYR A  64 1447 1447 1285 0 5 0 A O SIGUIJ 403 O TYR A  64 1 0 0 221 56 289 A O ATOM 404 N THR A  65 14.050 3.184 48.808 1.00 10.90 A N ANISOU 404 N THR A  65 1263 1414 1312 −42 2 1 A N SIGUIJ 404 N THR A  65 1 0 0 221 63 289 A N ATOM 405 CA THR A  65 12.729 2.613 49.160 1.00 10.94 A C ANISOU 405 CA THR A  65 1275 1602 1189 −104 −15 10 A C SIGUIJ 405 CA THR A  65 2 0 0 220 160 290 A C ATOM 406 CB THR A  65 12.010 3.507 50.169 1.00 11.44 A C ANISOU 406 CB THR A  65 1538 1758 1222 54 28 −1 A C SIGUIJ 406 CB THR A  65 2 0 0 220 160 290 A C ATOM 407 OG1 THR A  65 12.804 3.542 51.378 1.00 12.76 A O ANISOU 407 OG1 THR A  65 1686 2183 1274 26 −63 −3 A O SIGUIJ 407 OG1 THR A  65 1 0 0 221 56 289 A O ATOM 408 CG2 THR A  65 10.601 2.977 50.484 1.00 12.54 A C ANISOU 408 CG2 THR A  65 1620 2247 1409 −129 71 −9 A C SIGUIJ 408 CG2 THR A  65 2 0 0 220 159 290 A C ATOM 409 C THR A  65 11.968 2.489 47.860 1.00 10.48 A C ANISOU 409 C THR A  65 1234 1247 1178 1 4 0 A C SIGUIJ 409 C THR A  65 2 0 0 220 159 290 A C ATOM 410 O THR A  65 11.754 3.485 47.143 1.00 10.45 A O ANISOU 410 O THR A  65 1626 1261 1260 −28 −151 11 A O SIGUIJ 410 O THR A  65 1 0 0 221 56 289 A O ATOM 411 N VAL A  66 11.531 1.285 47.556 1.00 10.31 A N ANISOU 411 N VAL A  66 1269 1245 1202 −1 5 0 A N SIGUIJ 411 N VAL A  66 1 0 0 221 63 289 A N ATOM 412 CA VAL A  66 10.826 1.050 46.318 1.00 10.41 A C ANISOU 412 CA VAL A  66 1283 1255 1218 0 0 0 A C SIGUIJ 412 CA VAL A  66 2 0 0 220 158 290 A C ATOM 413 CB VAL A  66 11.278 −0.305 45.707 1.00 10.27 A C ANISOU 413 CB VAL A  66 1308 1252 1283 4 2 0 A C SIGUIJ 413 CB VAL A  66 2 0 0 220 158 290 A C ATOM 414 CG1 VAL A  66 10.536 −0.512 44.365 1.00 11.03 A C ANISOU 414 CG1 VAL A  66 1336 1294 1294 −1 −2 0 A C SIGUIJ 414 CG1 VAL A  66 2 0 0 220 157 290 A C ATOM 415 CG2 VAL A  66 12.791 −0.328 45.524 1.00 11.29 A C ANISOU 415 CG2 VAL A  66 1317 1501 2141 14 95 −6 A C SIGUIJ 415 CG2 VAL A  66 2 0 0 220 157 290 A C ATOM 416 C VAL A  66 9.323 1.056 46.549 1.00 10.46 A C ANISOU 416 C VAL A  66 1281 1388 1207 29 −3 0 A C SIGUIJ 416 C VAL A  66 2 0 0 220 157 290 A C ATOM 417 O VAL A  66 8.809 0.338 47.437 1.00 10.81 A O ANISOU 417 O VAL A  66 1451 1425 1233 4 54 6 A O SIGUIJ 417 O VAL A  66 1 0 0 221 56 289 A O ATOM 418 N HIS A  67 8.607 1.884 45.793 1.00 10.18 A N ANISOU 418 N HIS A  67 1194 1341 1212 −9 0 0 A N SIGUIJ 418 N HIS A  67 1 0 0 221 63 289 A N ATOM 419 CA HIS A  67 7.143 1.919 45.767 1.00 10.17 A C ANISOU 419 CA HIS A  67 1196 1244 1298 −1 −5 0 A C SIGUIJ 419 CA HIS A  67 2 0 0 220 156 290 A C ATOM 420 CB HIS A  67 6.708 3.371 45.496 1.00 10.26 A C ANISOU 420 CB HIS A  67 1232 1246 1435 0 2 0 A C SIGUIJ 420 CB HIS A  67 2 0 0 220 156 290 A C ATOM 421 CG HIS A  67 5.308 3.503 44.984 1.00 10.76 A C ANISOU 421 CG HIS A  67 1245 1194 1533 −2 −28 1 A C SIGUIJ 421 CG HIS A  67 2 0 0 220 155 290 A C ATOM 422 CD2 HIS A  67 4.768 3.234 43.783 1.00 10.31 A C ANISOU 422 CD2 HIS A  67 1216 1250 1538 −1 −17 0 A C SIGUIJ 422 CD2 HIS A  67 2 0 0 220 155 290 A C ATOM 423 ND1 HIS A  67 4.294 4.012 45.769 1.00 11.12 A N ANISOU 423 ND1 HIS A  67 1360 1233 1686 3 107 3 A N SIGUIJ 423 ND1 HIS A  67 1 0 0 221 63 289 A N ATOM 424 CE1 HIS A  67 3.182 4.034 45.061 1.00 10.85 A C ANISOU 424 CE1 HIS A  67 1383 1465 1735 17 71 −9 A C SIGUIJ 424 CE1 HIS A  67 2 0 0 220 155 290 A C ATOM 425 NE2 HIS A  67 3.436 3.561 43.858 1.00 10.92 A N ANISOU 425 NE2 HIS A  67 1229 1417 1718 61 2 0 A N SIGUIJ 425 NE2 HIS A  67 1 0 0 221 63 289 A N ATOM 426 C HIS A  67 6.627 1.015 44.664 1.00 10.07 A C ANISOU 426 C HIS A  67 1158 1224 1269 1 3 0 A C SIGUIJ 426 C HIS A  67 2 0 0 220 154 290 A C ATOM 427 O HIS A  67 7.046 1.167 43.504 1.00 10.01 A O ANISOU 427 O HIS A  67 1205 1245 1268 0 7 0 A O SIGUIJ 427 O HIS A  67 1 0 0 221 56 289 A O ATOM 428 N LEU A  68 5.689 0.115 45.004 1.00 9.85 A N ANISOU 428 N LEU A  68 1174 1220 1400 0 48 0 A N SIGUIJ 428 N LEU A  68 1 0 0 221 63 289 A N ATOM 429 CA LEU A  68 5.041 −0.761 44.009 1.00 10.06 A C ANISOU 429 CA LEU A  68 1254 1218 1423 −5 8 0 A C SIGUIJ 429 CA LEU A  68 2 0 0 220 154 290 A C ATOM 430 CB LEU A  68 5.539 −2.229 44.129 1.00 11.11 A C ANISOU 430 CB LEU A  68 1414 1239 1632 55 −12 0 A C SIGUIJ 430 CB LEU A  68 2 0 0 220 153 290 A C ATOM 431 CG LEU A  68 7.056 −2.399 44.241 1.00 10.33 A C ANISOU 431 CG LEU A  68 1408 1250 1460 60 1 −1 A C SIGUIJ 431 CG LEU A  68 2 0 0 220 153 290 A C ATOM 432 CD1 LEU A  68 7.481 −2.431 45.695 1.00 11.37 A C ANISOU 432 CD1 LEU A  68 1457 1613 1458 −5 0 0 A C SIGUIJ 432 CD1 LEU A  68 2 0 0 220 153 290 A C ATOM 433 CD2 LEU A  68 7.459 −3.723 43.526 1.00 11.32 A C ANISOU 433 CD2 LEU A  68 1607 1255 1485 112 4 2 A C SIGUIJ 433 CD2 LEU A  68 2 0 0 220 152 290 A C ATOM 434 C LEU A  68 3.539 −0.772 44.264 1.00 10.57 A C ANISOU 434 C LEU A  68 1264 1284 1304 0 −2 0 A C SIGUIJ 434 C LEU A  68 2 0 0 220 152 290 A C ATOM 435 O LEU A  68 3.091 −0.494 45.394 1.00 10.51 A O ANISOU 435 O LEU A  68 1309 1276 1306 3 0 0 A O SIGUIJ 435 O LEU A  68 1 0 0 221 56 289 A O ATOM 436 N GLY A  69 2.783 −1.092 43.229 1.00 10.50 A N ANISOU 436 N GLY A  69 1270 1244 1298 0 0 0 A N SIGUIJ 436 N GLY A  69 1 0 0 221 63 289 A N ATOM 437 CA GLY A  69 1.403 −1.483 43.461 1.00 10.99 A C ANISOU 437 CA GLY A  69 1293 1231 1709 0 86 1 A C SIGUIJ 437 CA GLY A  69 1 0 0 220 151 290 A C ATOM 438 C GLY A  69 0.398 −0.368 43.576 1.00 11.51 A C ANISOU 438 C GLY A  69 1328 1234 1649 2 110 4 A C SIGUIJ 438 C GLY A  69 1 0 0 220 151 290 A C ATOM 439 O GLY A  69 −0.713 −0.611 44.076 1.00 12.48 A O ANISOU 439 O GLY A  69 1428 1370 2142 27 322 166 A O SIGUIJ 439 O GLY A  69 1 0 0 221 56 289 A O ATOM 440 N SER A  70 0.747 0.848 43.134 1.00 11.57 A N ANISOU 440 N SER A  70 1235 1236 1574 0 24 0 A N SIGUIJ 440 N SER A  70 1 0 0 221 63 289 A N ATOM 441 CA SER A  70 −0.237 1.925 43.056 1.00 11.55 A C ANISOU 441 CA SER A  70 1239 1251 1429 0 21 0 A C SIGUIJ 441 CA SER A  70 1 0 0 220 151 290 A C ATOM 442 CB SER A  70 −0.441 2.619 44.423 1.00 11.96 A C ANISOU 442 CB SER A  70 1738 1285 1450 −46 94 −11 A C SIGUIJ 442 CB SER A  70 1 0 0 220 150 290 A C ATOM 443 OG SER A  70 −1.443 3.618 44.270 1.00 12.98 A O ANISOU 443 OG SER A  70 1764 1288 1593 −48 22 −4 A O SIGUIJ 443 OG SER A  70 1 0 0 221 56 289 A O ATOM 444 C SER A  70 0.204 2.965 42.058 1.00 11.53 A C ANISOU 444 C SER A  70 1228 1259 1420 3 43 −2 A C SIGUIJ 444 C SER A  70 1 0 0 220 150 290 A C ATOM 445 O SER A  70 1.350 3.343 41.990 1.00 11.37 A O ANISOU 445 O SER A  70 1239 1366 1663 −21 49 5 A O SIGUIJ 445 O SER A  70 1 0 0 221 56 289 A O ATOM 446 N ASP A  71 −0.770 3.521 41.354 1.00 11.71 A N ANISOU 446 N ASP A  71 1281 1265 1534 0 −31 0 A N SIGUIJ 446 N ASP A  71 1 0 0 221 63 289 A N ATOM 447 CA ASP A  71 −0.489 4.711 40.534 1.00 12.03 A C ANISOU 447 CA ASP A  71 1427 1275 1596 9 48 6 A C SIGUIJ 447 CA ASP A  71 1 0 0 220 150 290 A C ATOM 448 CB ASP A  71 −1.604 4.894 39.509 1.00 13.40 A C ANISOU 448 CB ASP A  71 1546 1920 1725 110 −53 22 A C SIGUIJ 448 CB ASP A  71 1 0 0 220 149 290 A C ATOM 449 CG ASP A  71 −1.791 3.679 38.665 1.00 14.52 A C ANISOU 449 CG ASP A  71 1903 1952 1767 18 12 −1 A C SIGUIJ 449 CG ASP A  71 1 0 0 220 149 290 A C ATOM 450 OD1 ASP A  71 −0.769 3.147 38.164 1.00 14.88 A O ANISOU 450 OD1 ASP A  71 1891 1928 1789 −5 18 1 A O SIGUIJ 450 OD1 ASP A  71 1 0 0 221 56 289 A O ATOM 451 OD2 ASP A  71 −2.933 3.147 38.541 1.00 16.44 A O ANISOU 451 OD2 ASP A  71 2055 2638 2741 −297 −69 −29 A O SIGUIJ 451 OD2 ASP A  71 1 0 0 221 56 289 A O ATOM 452 C ASP A  71 −0.334 5.983 41.366 1.00 12.00 A C ANISOU 452 C ASP A  71 1593 1286 1589 18 0 0 A C SIGUIJ 452 C ASP A  71 1 0 0 220 148 290 A C ATOM 453 O ASP A  71 0.092 7.014 40.822 1.00 11.57 A O ANISOU 453 O ASP A  71 1416 1223 1748 205 222 23 A O SIGUIJ 453 O ASP A  71 1 0 0 221 56 289 A O ATOM 454 N THR A  72 −0.589 5.932 42.678 1.00 11.84 A N ANISOU 454 N THR A  72 1627 1334 1591 167 1 2 A N SIGUIJ 454 N THR A  72 1 0 0 221 63 289 A N ATOM 455 CA THR A  72 −0.466 7.136 43.527 1.00 11.99 A C ANISOU 455 CA THR A  72 1268 1356 1575 −7 322 0 A C SIGUIJ 455 CA THR A  72 1 0 0 220 148 290 A C ATOM 456 CB THR A  72 −1.802 7.379 44.280 1.00 12.04 A C ANISOU 456 CB THR A  72 1289 1617 1621 29 345 −17 A C SIGUIJ 456 CB THR A  72 1 0 0 220 148 290 A C ATOM 457 OG1 THR A  72 −2.851 7.509 43.306 1.00 12.69 A O ANISOU 457 OG1 THR A  72 1472 1832 1826 116 159 −45 A O SIGUIJ 457 OG1 THR A  72 1 0 0 221 56 289 A O ATOM 458 CG2 THR A  72 −1.690 8.607 45.139 1.00 12.47 A C ANISOU 458 CG2 THR A  72 1869 1575 1577 163 78 38 A C SIGUIJ 458 CG2 THR A  72 1 0 0 220 147 290 A C ATOM 459 C THR A  72 0.680 6.999 44.523 1.00 12.26 A C ANISOU 459 C THR A  72 1391 1326 1778 0 167 −1 A C SIGUIJ 459 C THR A  72 1 0 0 220 147 290 A C ATOM 460 O THR A  72 0.670 6.113 45.375 1.00 12.26 A O ANISOU 460 O THR A  72 1528 1340 1812 14 190 14 A O SIGUIJ 460 O THR A  72 1 0 0 221 56 289 A O ATOM 461 N LEU A  73 1.680 7.883 44.462 1.00 12.60 A N ANISOU 461 N LEU A  73 1402 1339 1916 −10 225 −38 A N SIGUIJ 461 N LEU A  73 1 0 0 221 63 289 A N ATOM 462 CA LEU A  73 2.735 7.884 45.504 1.00 13.57 A C ANISOU 462 CA LEU A  73 1418 1628 1928 −59 214 36 A C SIGUIJ 462 CA LEU A  73 1 0 0 220 147 290 A C ATOM 463 CB LEU A  73 3.846 8.880 45.130 1.00 14.14 A C ANISOU 463 CB LEU A  73 1465 1597 2415 −28 407 22 A C SIGUIJ 463 CB LEU A  73 1 0 0 220 146 290 A C ATOM 464 CG LEU A  73 4.664 8.540 43.867 1.00 13.84 A C ANISOU 464 CG LEU A  73 1301 1722 2343 0 289 3 A C SIGUIJ 464 CG LEU A  73 1 0 0 220 146 290 A C ATOM 465 CD1 LEU A  73 5.730 9.650 43.616 1.00 14.45 A C ANISOU 465 CD1 LEU A  73 1792 2224 2208 −505 131 111 A C SIGUIJ 465 CD1 LEU A  73 1 0 0 220 146 290 A C ATOM 466 CD2 LEU A  73 5.275 7.165 43.926 1.00 13.66 A C ANISOU 466 CD2 LEU A  73 1572 1774 1998 116 193 −65 A C SIGUIJ 466 CD2 LEU A  73 1 0 0 220 145 290 A C ATOM 467 C LEU A  73 2.146 8.248 46.864 1.00 14.07 A C ANISOU 467 C LEU A  73 1415 1764 1928 −28 196 10 A C SIGUIJ 467 C LEU A  73 1 0 0 220 145 290 A C ATOM 468 O LEU A  73 1.291 9.145 46.949 1.00 14.84 A O ANISOU 468 O LEU A  73 1604 1916 2178 129 180 −51 A O SIGUIJ 468 O LEU A  73 1 0 0 221 56 289 A O ATOM 469 N GLY A  76 2.573 7.558 47.894 1.00 14.43 A N ANISOU 469 N GLY A  76 1813 1793 1988 0 31 0 A N SIGUIJ 469 N GLY A  76 1 0 0 221 63 289 A N ATOM 470 CA GLY A  76 2.029 7.757 49.227 1.00 14.66 A C ANISOU 470 CA GLY A  76 1744 1834 1985 −30 8 2 A C SIGUIJ 470 CA GLY A  76 1 0 0 220 145 290 A C ATOM 471 C GLY A  76 0.747 6.990 49.509 1.00 14.25 A C ANISOU 471 C GLY A  76 1721 1756 1856 −5 −26 −3 A C SIGUIJ 471 C GLY A  76 1 0 0 220 144 290 A C ATOM 472 O GLY A  76 0.269 7.028 50.633 1.00 14.94 A O ANISOU 472 O GLY A  76 1824 2245 1875 36 13 −5 A O SIGUIJ 472 O GLY A  76 1 0 0 221 56 289 A O ATOM 473 N ASP A  77 0.159 6.340 48.523 1.00 13.69 A N ANISOU 473 N ASP A  77 1317 1637 1787 112 135 −36 A N SIGUIJ 473 N ASP A  77 1 0 0 221 63 289 A N ATOM 474 CA ASP A  77 −1.065 5.558 48.748 1.00 13.68 A C ANISOU 474 CA ASP A  77 1253 1499 1497 188 60 −38 A C SIGUIJ 474 CA ASP A  77 1 0 0 220 144 290 A C ATOM 475 CB ASP A  77 −1.328 4.788 47.449 1.00 13.39 A C ANISOU 475 CB ASP A  77 1275 1491 1499 144 77 −42 A C SIGUIJ 475 CB ASP A  77 1 0 0 220 144 290 A C ATOM 476 CG ASP A  77 −2.624 3.983 47.429 1.00 13.49 A C ANISOU 476 CG ASP A  77 1298 1594 1652 81 69 −17 A C SIGUIJ 476 CG ASP A  77 1 0 0 220 143 290 A C ATOM 477 OD1 ASP A  77 −3.249 3.763 48.497 1.00 13.62 A O ANISOU 477 OD1 ASP A  77 1608 1673 1756 27 252 −26 A O SIGUIJ 477 OD1 ASP A  77 1 0 0 221 56 289 A O ATOM 478 OD2 ASP A  77 −3.016 3.557 46.318 1.00 14.34 A O ANISOU 478 OD2 ASP A  77 1858 1927 1673 −312 −4 14 A O SIGUIJ 478 OD2 ASP A  77 1 0 0 221 56 289 A O ATOM 479 C ASP A  77 −0.798 4.565 49.902 1.00 14.30 A C ANISOU 479 C ASP A  77 1373 1544 1509 164 23 −19 A C SIGUIJ 479 C ASP A  77 1 0 0 220 143 290 A C ATOM 480 O ASP A  77 0.222 3.792 49.856 1.00 14.35 A O ANISOU 480 O ASP A  77 1562 1823 1918 397 35 −31 A O SIGUIJ 480 O ASP A  77 1 0 0 221 56 289 A O ATOM 481 N ARG A  78 −1.655 4.557 50.920 1.00 14.71 A N ANISOU 481 N ARG A  78 1452 1639 1527 128 77 −58 A N SIGUIJ 481 N ARG A  78 1 0 0 221 63 289 A N ATOM 482 CA ARG A  78 −1.464 3.618 52.022 1.00 16.17 A C ANISOU 482 CA ARG A  78 2269 1750 1601 287 65 28 A C SIGUIJ 482 CA ARG A  78 1 0 0 220 143 290 A C ATOM 483 CB ARG A  78 −2.529 3.871 53.099 1.00 17.47 A C ANISOU 483 CB ARG A  78 2312 2487 1606 464 61 16 A C SIGUIJ 483 CB ARG A  78 1 0 0 220 142 290 A C ATOM 484 CG ARG A  78 −2.395 5.237 53.737 1.00 19.88 A C ANISOU 484 CG ARG A  78 4181 2508 1646 282 71 10 A C SIGUIJ 484 CG ARG A  78 1 0 0 220 142 290 A C ATOM 485 CD ARG A  78 −2.622 5.235 55.222 1.00 22.19 A C ANISOU 485 CD ARG A  78 9298 12495 1770 143 854 5 A C SIGUIJ 485 CD ARG A  78 1 0 0 220 142 290 A C ATOM 486 NE ARG A  78 −2.002 6.444 55.777 1.00 24.36 A N ANISOU 486 NE ARG A  78 12217 12616 5189 −25 −2043 −76 A N SIGUIJ 486 NE ARG A  78 1 0 0 221 63 289 A N ATOM 487 CZ ARG A  78 −2.465 7.108 56.841 1.00 24.83 A C ANISOU 487 CZ ARG A  78 12396 12449 5150 1 −1980 33 A C SIGUIJ 487 CZ ARG A  78 1 0 0 220 141 290 A C ATOM 488 NH1 ARG A  78 −3.552 6.670 57.451 1.00 25.75 A N ANISOU 488 NH1 ARG A  78 13703 12469 9248 −20 334 −1 A N SIGUIJ 488 NH1 ARG A  78 1 0 0 221 63 289 A N ATOM 489 NH2 ARG A  78 −1.838 8.192 57.300 1.00 25.77 A N ANISOU 489 NH2 ARG A  78 10587 12383 2300 134 175 −3 A N SIGUIJ 489 NH2 ARG A  78 1 0 0 221 63 289 A N ATOM 490 C ARG A  78 −1.544 2.178 51.552 1.00 16.15 A C ANISOU 490 C ARG A  78 1423 1795 2007 264 272 −124 A C SIGUIJ 490 C ARG A  78 1 0 0 220 141 290 A C ATOM 491 O ARG A  78 −1.031 1.267 52.269 1.00 16.98 A O ANISOU 491 O ARG A  78 2446 2180 2451 659 47 112 A O SIGUIJ 491 O ARG A  78 1 0 0 221 56 289 A O ATOM 492 N ARG A  79 −2.172 1.901 50.414 1.00 16.20 A N ANISOU 492 N ARG A  79 1402 1810 1951 −7 327 19 A N SIGUIJ 492 N ARG A  79 1 0 0 221 63 289 A N ATOM 493 CA ARG A  79 −2.289 0.528 49.913 1.00 16.42 A C ANISOU 493 CA ARG A  79 1569 1827 2088 26 234 −31 A C SIGUIJ 493 CA ARG A  79 1 0 0 220 141 290 A C ATOM 494 CB ARG A  79 −3.446 0.379 48.938 1.00 17.75 A C ANISOU 494 CB ARG A  79 2015 2016 2694 −8 −291 −5 A C SIGUIJ 494 CB ARG A  79 1 0 0 220 141 290 A C ATOM 495 CG ARG A  79 −4.772 0.900 49.454 1.00 19.73 A C ANISOU 495 CG ARG A  79 2352 2502 4693 128 447 −122 A C SIGUIJ 495 CG ARG A  79 1 0 0 220 140 290 A C ATOM 496 CD ARG A  79 −5.852 0.878 48.382 1.00 21.61 A C ANISOU 496 CD ARG A  79 2995 3034 5338 −6 −194 −6 A C SIGUIJ 496 CD ARG A  79 1 0 0 220 140 290 A C ATOM 497 NE ARG A  79 −5.728 1.918 47.348 1.00 23.13 A N ANISOU 497 NE ARG A  79 2535 3036 5331 −8 −269 −3 A N SIGUIJ 497 NE ARG A  79 1 0 0 221 63 289 A N ATOM 498 CZ ARG A  79 −5.263 1.690 46.132 1.00 22.93 A C ANISOU 498 CZ ARG A  79 3535 2972 5475 −31 109 −1 A C SIGUIJ 498 CZ ARG A  79 1 0 0 220 140 290 A C ATOM 499 NH1 ARG A  79 −4.840 0.456 45.833 1.00 24.17 A N ANISOU 499 NH1 ARG A  79 13175 4146 5369 3344 −187 −71 A N SIGUIJ 499 NH1 ARG A  79 1 0 0 221 63 289 A N ATOM 500 NH2 ARG A  79 −5.275 2.636 45.196 1.00 23.78 A N ANISOU 500 NH2 ARG A  79 2347 2953 5443 101 254 −27 A N SIGUIJ 500 NH2 ARG A  79 1 0 0 221 63 289 A N ATOM 501 C ARG A  79 −1.034 0.098 49.130 1.00 15.58 A C ANISOU 501 C ARG A  79 1606 1618 2236 0 327 12 A C SIGUIJ 501 C ARG A  79 1 0 0 220 139 290 A C ATOM 502 O ARG A  79 −0.912 −1.087 48.742 1.00 15.65 A O ANISOU 502 O ARG A  79 1870 1615 2332 2 464 5 A O SIGUIJ 502 O ARG A  79 1 0 0 221 55 289 A O ATOM 503 N ALA A  80 −0.142 1.027 48.813 1.00 14.69 A N ANISOU 503 N ALA A  80 1528 1554 1949 42 261 −52 A N SIGUIJ 503 N ALA A  80 1 0 0 221 63 289 A N ATOM 504 CA ALA A  80 1.055 0.671 48.028 1.00 13.83 A C ANISOU 504 CA ALA A  80 1362 1539 1466 101 −41 26 A C SIGUIJ 504 CA ALA A  80 1 0 0 220 139 290 A C ATOM 505 CB ALA A  80 1.820 1.914 47.622 1.00 14.11 A C ANISOU 505 CB ALA A  80 1648 1594 1901 3 210 16 A C SIGUIJ 505 CB ALA A  80 1 0 0 220 139 290 A C ATOM 506 C ALA A  80 1.967 −0.207 48.880 1.00 13.53 A C ANISOU 506 C ALA A  80 1254 1447 1366 57 32 −12 A C SIGUIJ 506 C ALA A  80 1 0 0 220 138 290 A C ATOM 507 O ALA A  80 1.945 −0.152 50.133 1.00 14.15 A O ANISOU 507 O ALA A  80 1894 2156 1364 533 24 17 A O SIGUIJ 507 O ALA A  80 1 0 0 221 55 289 A O ATOM 508 N GLN A  81 2.777 −1.007 48.211 1.00 12.88 A N ANISOU 508 N GLN A  81 1164 1353 1355 −3 17 0 A N SIGUIJ 508 N GLN A  81 1 0 0 221 63 289 A N ATOM 509 CA GLN A  81 3.903 −1.702 48.858 1.00 12.88 A C ANISOU 509 CA GLN A  81 1258 1538 1457 117 −31 15 A C SIGUIJ 509 CA GLN A  81 1 0 0 220 138 290 A C ATOM 510 CB GLN A  81 4.243 −2.974 48.113 1.00 13.68 A C ANISOU 510 CB GLN A  81 1628 1557 1580 178 −15 −23 A C SIGUIJ 510 CB GLN A  81 1 0 0 220 138 290 A C ATOM 511 CG GLN A  81 3.280 −4.094 48.365 1.00 14.30 A C ANISOU 511 CG GLN A  81 2118 1938 1820 −259 12 −9 A C SIGUIJ 511 CG GLN A  81 1 0 0 220 138 290 A C ATOM 512 CD GLN A  81 3.665 −5.304 47.553 1.00 14.78 A C ANISOU 512 CD GLN A  81 2410 1963 1852 −203 54 −20 A C SIGUIJ 512 CD GLN A  81 1 0 0 220 137 290 A C ATOM 513 OE1 GLN A  81 4.755 −5.840 47.685 1.00 14.65 A O ANISOU 513 OE1 GLN A  81 2285 1532 1692 −435 53 −31 A O SIGUIJ 513 OE1 GLN A  81 1 0 0 221 55 289 A O ATOM 514 NE2 GLN A  81 2.772 −5.731 46.694 1.00 15.20 A N ANISOU 514 NE2 GLN A  81 2594 1610 2068 −72 −186 19 A N SIGUIJ 514 NE2 GLN A  81 1 0 0 221 63 289 A N ATOM 515 C GLN A  81 5.107 −0.798 48.860 1.00 12.83 A C ANISOU 515 C GLN A  81 1272 1621 1317 87 1 −1 A C SIGUIJ 515 C GLN A  81 1 0 0 220 137 290 A C ATOM 516 O GLN A  81 5.399 −0.130 47.854 1.00 13.03 A O ANISOU 516 O GLN A  81 1658 1744 1347 −33 49 8 A O SIGUIJ 516 O GLN A  81 1 0 0 221 55 289 A O ATOM 517 N ARG A  82 5.822 −0.751 49.982 1.00 12.82 A N ANISOU 517 N ARG A  82 1266 1962 1310 69 0 0 A N SIGUIJ 517 N ARG A  82 1 0 0 221 63 289 A N ATOM 518 CA ARG A  82 7.114 −0.102 50.076 1.00 13.15 A C ANISOU 518 CA ARG A  82 1298 2122 1292 −4 1 19 A C SIGUIJ 518 CA ARG A  82 1 0 0 220 137 290 A C ATOM 519 CB ARG A  82 7.102 1.055 51.076 1.00 13.97 A C ANISOU 519 CB ARG A  82 1542 2195 1404 −74 89 −71 A C SIGUIJ 519 CB ARG A  82 1 0 0 220 136 290 A C ATOM 520 CG ARG A  82 6.258 2.217 50.605 1.00 15.61 A C ANISOU 520 CG ARG A  82 1860 2364 1795 128 −3 −4 A C SIGUIJ 520 CG ARG A  82 1 0 0 220 136 290 A C ATOM 521 CD ARG A  82 5.972 3.220 51.759 1.00 17.78 A C ANISOU 521 CD ARG A  82 3912 2325 1887 147 488 37 A C SIGUIJ 521 CD ARG A  82 1 0 0 220 136 290 A C ATOM 522 NE ARG A  82 7.152 3.801 52.439 1.00 20.13 A N ANISOU 522 NE ARG A  82 4477 3200 2961 −273 −130 25 A N SIGUIJ 522 NE ARG A  82 1 0 0 221 63 289 A N ATOM 523 CZ ARG A  82 7.612 3.635 53.704 1.00 20.42 A C ANISOU 523 CZ ARG A  82 3283 3539 2778 21 351 −15 A C SIGUIJ 523 CZ ARG A  82 1 0 0 220 136 290 A C ATOM 524 NH1 ARG A  82 7.071 2.836 54.659 1.00 21.72 A N ANISOU 524 NH1 ARG A  82 2666 3558 2587 15 −6 0 A N SIGUIJ 524 NH1 ARG A  82 1 0 0 221 63 289 A N ATOM 525 NH2 ARG A  82 8.667 4.345 54.040 1.00 21.55 A N ANISOU 525 NH2 ARG A  82 3396 3567 3679 −3 60 1 A N SIGUIJ 525 NH2 ARG A  82 1 0 0 221 63 289 A N ATOM 526 C ARG A  82 8.125 −1.142 50.520 1.00 12.58 A C ANISOU 526 C ARG A  82 1406 2256 1072 133 74 4 A C SIGUIJ 526 C ARG A  82 1 0 0 220 135 290 A C ATOM 527 O ARG A  82 7.855 −1.914 51.507 1.00 13.16 A O ANISOU 527 O ARG A  82 1450 2400 1172 188 134 113 A O SIGUIJ 527 O ARG A  82 1 0 0 221 55 289 A O ATOM 528 N ILE A  83 9.274 −1.267 49.827 1.00 11.91 A N ANISOU 528 N ILE A  83 1409 1711 1104 68 86 1 A N SIGUIJ 528 N ILE A  83 1 0 0 221 63 289 A N ATOM 529 CA ILE A  83 10.267 −2.294 50.147 1.00 11.49 A C ANISOU 529 CA ILE A  83 1349 1609 1387 −26 0 0 A C SIGUIJ 529 CA ILE A  83 1 0 0 220 135 290 A C ATOM 530 CB ILE A  83 10.238 −3.458 49.116 1.00 11.87 A C ANISOU 530 CB ILE A  83 1459 1615 1407 −37 7 −2 A C SIGUIJ 530 CB ILE A  83 1 0 0 220 135 290 A C ATOM 531 CG2 ILE A  83 11.302 −4.507 49.456 1.00 12.03 A C ANISOU 531 CG2 ILE A  83 1493 1636 1501 −11 0 0 A C SIGUIJ 531 CG2 ILE A  83 1 0 0 220 135 290 A C ATOM 532 CG1 ILE A  83 8.827 −4.068 49.036 1.00 11.90 A C ANISOU 532 CG1 ILE A  83 1477 1764 1850 −95 21 6 A C SIGUIJ 532 CG1 ILE A  83 1 0 0 220 134 290 A C ATOM 533 CD1 ILE A  83 8.669 −5.109 47.983 1.00 12.03 A C ANISOU 533 CD1 ILE A  83 1593 1763 1886 −7 −62 −2 A C SIGUIJ 533 CD1 ILE A  83 1 0 0 220 134 290 A C ATOM 534 C ILE A  83 11.635 −1.625 50.099 1.00 11.35 A C ANISOU 534 C ILE A  83 1318 1448 1310 49 0 0 A C SIGUIJ 534 C ILE A  83 1 0 0 220 134 290 A C ATOM 535 O ILE A  83 12.039 −0.953 49.109 1.00 11.54 A O ANISOU 535 O ILE A  83 1387 1486 1327 7 6 0 A O SIGUIJ 535 O ILE A  83 1 0 0 221 55 289 A O ATOM 536 N ALYS A  84 12.412 −1.875 51.155 0.50 11.01 A N ANISOU 536 N ALYS A  84 1311 1305 1306 0 0 0 A N SIGUIJ 536 N ALYS A  84 1 0 0 221 63 289 A N ATOM 537 N BLYS A  84 12.408 −1.860 51.162 0.50 13.20 A N ANISOU 537 N BLYS A  84 1313 1284 1307 0 0 0 A N SIGUIJ 537 N BLYS A  84 1 0 0 221 63 289 A N ATOM 538 CA ALYS A  84 13.788 −1.375 51.216 0.50 11.28 A C ANISOU 538 CA ALYS A  84 1318 1319 1231 0 2 0 A C SIGUIJ 538 CA ALYS A  84 1 0 0 220 134 290 A C ATOM 539 CA BLYS A  84 13.787 −1.365 51.222 0.50 13.47 A C ANISOU 539 CA BLYS A  84 1322 1300 1256 −1 3 0 A C SIGUIJ 539 CA BLYS A  84 1 0 0 220 133 290 A C ATOM 540 CB ALYS A  84 14.322 −1.576 52.631 0.50 12.09 A C ANISOU 540 CB ALYS A  84 1460 1737 1232 119 −21 −2 A C SIGUIJ 540 CB ALYS A  84 1 0 0 220 133 290 A C ATOM 541 CB BLYS A  84 14.312 −1.526 52.654 0.50 14.28 A C ANISOU 541 CB BLYS A  84 1368 1464 1254 25 4 0 A C SIGUIJ 541 CB BLYS A  84 1 0 0 220 133 290 A C ATOM 542 CG ALYS A  84 15.582 −0.808 52.931 0.50 13.81 A C ANISOU 542 CG ALYS A  84 1596 2052 1371 −78 −71 18 A C SIGUIJ 542 CG ALYS A  84 1 0 0 220 132 290 A C ATOM 543 CG BLYS A  84 15.719 −0.993 52.907 0.50 16.00 A C ANISOU 543 CG BLYS A  84 1422 1806 1303 −104 3 −1 A C SIGUIJ 543 CG BLYS A  84 1 0 0 220 132 290 A C ATOM 544 CD ALYS A  84 15.272 0.692 53.048 0.50 15.76 A C ANISOU 544 CD ALYS A  84 1770 2063 1729 −42 −5 2 A C SIGUIJ 544 CD ALYS A  84 1 0 0 220 132 290 A C ATOM 545 CD BLYS A  84 15.824 0.519 52.707 0.50 17.95 A C ANISOU 545 CD BLYS A  84 2138 1820 1735 −173 −167 68 A C SIGUIJ 545 CD BLYS A  84 1 0 0 220 132 290 A C ATOM 546 CE ALYS A  84 16.490 1.520 53.380 0.50 17.29 A C ANISOU 546 CE ALYS A  84 1795 1956 2589 26 −257 21 A C SIGUIJ 546 CE ALYS A  84 1 0 0 220 131 290 A C ATOM 547 CE BLYS A  84 14.820 1.325 53.515 0.50 19.48 A C ANISOU 547 CE BLYS A  84 2552 2209 2096 105 75 19 A C SIGUIJ 547 CE BLYS A  84 1 0 0 220 131 290 A C ATOM 548 NZ ALYS A  84 16.029 2.817 53.936 0.50 18.71 A N ANISOU 548 NZ ALYS A  84 2335 1993 2853 103 11 0 A N SIGUIJ 548 NZ ALYS A  84 1 0 0 221 63 289 A N ATOM 549 NZ BLYS A  84 15.068 1.396 54.997 0.50 20.90 A N ANISOU 549 NZ BLYS A  84 3179 3141 2119 1 −31 −1 A N SIGUIJ 549 NZ BLYS A  84 1 0 0 221 63 289 A N ATOM 550 C ALYS A  84 14.654 −2.177 50.232 0.50 10.91 A C ANISOU 550 C ALYS A  84 1313 1314 1240 0 −1 0 A C SIGUIJ 550 C ALYS A  84 1 0 0 220 131 290 A C ATOM 551 C BLYS A  84 14.659 −2.175 50.245 0.50 13.10 A C ANISOU 551 C BLYS A  84 1316 1304 1255 0 0 0 A C SIGUIJ 551 C BLYS A  84 1 0 0 220 131 290 A C ATOM 552 O ALYS A  84 14.506 −3.403 50.098 0.50 11.25 A O ANISOU 552 O ALYS A  84 1365 1314 1304 −1 2 0 A O SIGUIJ 552 O ALYS A  84 1 0 0 221 55 289 A O ATOM 553 O BLYS A  84 14.502 −3.395 50.108 0.50 13.44 A O ANISOU 553 O BLYS A  84 1409 1305 1320 −4 2 0 A O SIGUIJ 553 O BLYS A  84 1 0 0 221 55 289 A O ATOM 554 N ALA A  85 15.588 −1.496 49.575 1.00 10.86 A N ANISOU 554 N ALA A  85 1309 1307 1236 0 −6 0 A N SIGUIJ 554 N ALA A  85 1 0 0 221 63 289 A N ATOM 555 CA ALA A  85 16.554 −2.127 48.697 1.00 10.85 A C ANISOU 555 CA ALA A  85 1332 1285 1263 −5 20 −2 A C SIGUIJ 555 CA ALA A  85 1 0 0 220 130 290 A C ATOM 556 CB ALA A  85 16.188 −1.868 47.212 1.00 10.61 A C ANISOU 556 CB ALA A  85 1545 1376 1277 −32 −40 6 A C SIGUIJ 556 CB ALA A  85 1 0 0 220 130 290 A C ATOM 557 C ALA A  85 17.920 −1.574 49.010 1.00 11.52 A C ANISOU 557 C ALA A  85 1340 1278 1472 −15 −6 0 A C SIGUIJ 557 C ALA A  85 1 0 0 220 130 290 A C ATOM 558 O ALA A  85 18.180 −0.367 48.811 1.00 11.81 A O ANISOU 558 O ALA A  85 1423 1289 1607 −36 8 0 A O SIGUIJ 558 O ALA A  85 1 0 0 221 55 289 A O ATOM 559 N SER A  86 18.835 −2.432 49.461 1.00 11.89 A N ANISOU 559 N SER A  86 1430 1388 1488 81 −1 1 A N SIGUIJ 559 N SER A  86 1 0 0 221 63 289 A N ATOM 560 CA SER A  86 20.157 −1.979 49.872 1.00 12.90 A C ANISOU 560 CA SER A  86 1476 1777 1455 −50 1 −1 A C SIGUIJ 560 CA SER A  86 1 0 0 220 130 290 A C ATOM 561 CB SER A  86 20.636 −2.820 51.051 1.00 13.15 A C ANISOU 561 CB SER A  86 1981 1880 1582 −59 −228 63 A C SIGUIJ 561 CB SER A  86 1 0 0 220 130 290 A C ATOM 562 OG SER A  86 19.800 −2.651 52.157 1.00 14.64 A O ANISOU 562 OG SER A  86 2186 2107 1678 −37 −97 22 A O SIGUIJ 562 OG SER A  86 1 0 0 221 55 289 A O ATOM 563 C SER A  86 21.190 −2.062 48.745 1.00 13.37 A C ANISOU 563 C SER A  86 1473 1707 1453 −43 0 0 A C SIGUIJ 563 C SER A  86 1 0 0 220 129 290 A C ATOM 564 O SER A  86 22.076 −1.207 48.664 1.00 14.89 A O ANISOU 564 O SER A  86 1823 2110 2787 −408 86 46 A O SIGUIJ 564 O SER A  86 1 0 0 221 55 289 A O ATOM 565 N LYS A  87 21.103 −3.048 47.876 1.00 13.17 A N ANISOU 565 N LYS A  87 1507 1678 1442 −30 0 0 A N SIGUIJ 565 N LYS A  87 1 0 0 221 62 289 A N ATOM 566 CA LYS A  87 22.134 −3.292 46.848 1.00 13.39 A C ANISOU 566 CA LYS A  87 1513 1739 1433 22 −3 0 A C SIGUIJ 566 CA LYS A  87 1 0 0 220 129 290 A C ATOM 567 CB LYS A  87 22.532 −4.783 46.793 1.00 15.31 A C ANISOU 567 CB LYS A  87 1588 1756 1988 34 46 −8 A C SIGUIJ 567 CB LYS A  87 1 0 0 220 129 290 A C ATOM 568 CG LYS A  87 23.052 −5.301 48.119 1.00 16.98 A C ANISOU 568 CG LYS A  87 1980 2174 2064 209 −66 66 A C SIGUIJ 568 CG LYS A  87 1 0 0 220 129 290 A C ATOM 569 CD LYS A  87 23.352 −6.794 47.948 1.00 19.00 A C ANISOU 569 CD LYS A  87 3261 2229 2866 465 −27 −20 A C SIGUIJ 569 CD LYS A  87 1 0 0 220 128 290 A C ATOM 570 CE LYS A  87 23.903 −7.405 49.195 1.00 20.42 A C ANISOU 570 CE LYS A  87 3382 3215 2904 1007 191 243 A C SIGUIJ 570 CE LYS A  87 1 0 0 220 128 290 A C ATOM 571 NZ LYS A  87 23.646 −8.865 49.145 1.00 22.25 A N ANISOU 571 NZ LYS A  87 8485 3389 5651 92 1139 −70 A N SIGUIJ 571 NZ LYS A  87 1 0 0 221 62 289 A N ATOM 572 C LYS A  87 21.668 −2.897 45.446 1.00 12.69 A C ANISOU 572 C LYS A  87 1309 1533 1428 −82 19 9 A C SIGUIJ 572 C LYS A  87 1 0 0 220 128 290 A C ATOM 573 O LYS A  87 20.487 −3.076 45.072 1.00 12.42 A O ANISOU 573 O LYS A  87 1335 1510 1674 −77 −56 −16 A O SIGUIJ 573 O LYS A  87 1 0 0 221 55 289 A O ATOM 574 N SER A  88 22.603 −2.427 44.641 1.00 11.85 A N ANISOU 574 N SER A  88 1231 1293 1400 33 5 −2 A N SIGUIJ 574 N SER A  88 1 0 0 221 62 289 A N ATOM 575 CA SER A  88 22.302 −2.157 43.242 1.00 11.82 A C ANISOU 575 CA SER A  88 1310 1266 1405 0 −4 0 A C SIGUIJ 575 CA SER A  88 1 0 0 220 128 290 A C ATOM 576 CB SER A  88 21.699 −0.751 43.109 1.00 11.87 A C ANISOU 576 CB SER A  88 1411 1273 1611 29 −17 0 A C SIGUIJ 576 CB SER A  88 1 0 0 220 127 290 A C ATOM 577 OG SER A  88 22.490 0.270 43.706 1.00 11.43 A O ANISOU 577 OG SER A  88 1456 1288 1576 −5 −6 0 A O SIGUIJ 577 OG SER A  88 1 0 0 221 55 289 A O ATOM 578 C SER A  88 23.561 −2.295 42.397 1.00 11.83 A C ANISOU 578 C SER A  88 1310 1405 1435 14 5 −1 A C SIGUIJ 578 C SER A  88 1 0 0 220 127 290 A C ATOM 579 O SER A  88 24.684 −2.165 42.928 1.00 11.99 A O ANISOU 579 O SER A  88 1354 1687 1594 −27 −86 −8 A O SIGUIJ 579 O SER A  88 1 0 0 221 55 289 A O ATOM 580 N PHE A  89 23.369 −2.558 41.108 1.00 11.41 A N ANISOU 580 N PHE A  89 1224 1344 1444 31 8 −2 A N SIGUIJ 580 N PHE A  89 1 0 0 221 62 289 A N ATOM 581 CA PHE A  89 24.457 −2.972 40.208 1.00 11.41 A C ANISOU 581 CA PHE A  89 1236 1359 1516 51 26 −7 A C SIGUIJ 581 CA PHE A  89 1 0 0 220 127 290 A C ATOM 582 CB PHE A  89 24.433 −4.489 40.002 1.00 12.08 A C ANISOU 582 CB PHE A  89 1854 1348 1848 58 0 −2 A C SIGUIJ 582 CB PHE A  89 1 0 0 220 127 290 A C ATOM 583 CG PHE A  89 24.452 −5.264 41.298 1.00 12.41 A C ANISOU 583 CG PHE A  89 1977 1324 1856 87 −10 −4 A C SIGUIJ 583 CG PHE A  89 1 0 0 220 127 290 A C ATOM 584 CD1 PHE A  89 23.290 −5.587 41.963 1.00 13.24 A C ANISOU 584 CD1 PHE A  89 2000 1457 1919 49 4 1 A C SIGUIJ 584 CD1 PHE A  89 1 0 0 220 126 290 A C ATOM 585 CD2 PHE A  89 25.664 −5.585 41.911 1.00 13.13 A C ANISOU 585 CD2 PHE A  89 2036 1910 1891 269 −31 −35 A C SIGUIJ 585 CD2 PHE A  89 1 0 0 220 126 290 A C ATOM 586 CE1 PHE A  89 23.316 −6.181 43.191 1.00 13.82 A C ANISOU 586 CE1 PHE A  89 2540 1477 1932 170 45 10 A C SIGUIJ 586 CE1 PHE A  89 1 0 0 220 126 290 A C ATOM 587 CE2 PHE A  89 25.653 −6.191 43.178 1.00 13.75 A C ANISOU 587 CE2 PHE A  89 2563 1950 1900 194 −63 −18 A C SIGUIJ 587 CE2 PHE A  89 1 0 0 220 126 290 A C ATOM 588 CZ PHE A  89 24.517 −6.464 43.779 1.00 13.84 A C ANISOU 588 CZ PHE A  89 2582 1757 2030 251 1 0 A C SIGUIJ 588 CZ PHE A  89 1 0 0 220 125 290 A C ATOM 589 C PHE A  89 24.226 −2.252 38.903 1.00 11.62 A C ANISOU 589 C PHE A  89 1222 1245 1445 252 138 −127 A C SIGUIJ 589 C PHE A  89 1 0 0 220 125 290 A C ATOM 590 O PHE A  89 23.326 −2.590 38.108 1.00 11.21 A O ANISOU 590 O PHE A  89 1301 1248 1491 213 85 −90 A O SIGUIJ 590 O PHE A  89 1 0 0 221 55 289 A O ATOM 591 N AARG A  90 25.105 −1.294 38.630 0.50 12.01 A N ANISOU 591 N AARG A  90 1452 1515 1438 −8 0 0 A N SIGUIJ 591 N AARG A  90 1 0 0 221 62 289 A N ATOM 592 N BARG A  90 25.097 −1.280 38.633 0.50 14.20 A N ANISOU 592 N BARG A  90 1474 1529 1451 −17 1 0 A N SIGUIJ 592 N BARG A  90 1 0 0 221 62 289 A N ATOM 593 CA AARG A  90 25.103 −0.574 37.349 0.50 13.07 A C ANISOU 593 CA AARG A  90 1337 1515 1436 −7 2 0 A C SIGUIJ 593 CA AARG A  90 1 0 0 220 125 290 A C ATOM 594 CA BARG A  90 25.092 −0.536 37.359 0.50 15.26 A C ANISOU 594 CA BARG A  90 1311 1551 1448 4 4 0 A C SIGUIJ 594 CA BARG A  90 1 0 0 220 125 290 A C ATOM 595 CB AARG A  90 25.964 0.653 37.398 0.50 13.27 A C ANISOU 595 CB AARG A  90 1359 1530 1493 −22 0 0 A C SIGUIJ 595 CB AARG A  90 1 0 0 220 125 290 A C ATOM 596 CB BARG A  90 25.879 0.766 37.474 0.50 15.46 A C ANISOU 596 CB BARG A  90 1415 1599 3073 −44 −208 −23 A C SIGUIJ 596 CB BARG A  90 1 0 0 220 124 290 A C ATOM 597 CG AARG A  90 25.363 1.765 38.207 0.50 14.09 A C ANISOU 597 CG AARG A  90 1315 1506 1503 −57 3 1 A C SIGUIJ 597 CG AARG A  90 1 0 0 220 124 290 A C ATOM 598 CG BARG A  90 25.238 1.764 38.451 0.50 16.28 A C ANISOU 598 CG BARG A  90 1597 1623 3101 −3 −141 −7 A C SIGUIJ 598 CG BARG A  90 1 0 0 220 124 290 A C ATOM 599 CD AARG A  90 26.399 2.861 38.297 0.50 15.12 A C ANISOU 599 CD AARG A  90 1180 1377 1504 72 7 −2 A C SIGUIJ 599 CD AARG A  90 1 0 0 220 124 290 A C ATOM 600 CD BARG A  90 26.049 3.043 38.668 0.50 17.31 A C ANISOU 600 CD BARG A  90 1713 1622 4341 −7 −565 48 A C SIGUIJ 600 CD BARG A  90 1 0 0 220 124 290 A C ATOM 601 NE AARG A  90 25.790 4.161 38.571 0.50 15.48 A N ANISOU 601 NE AARG A  90 1129 1362 1352 52 −16 3 A N SIGUIJ 601 NE AARG A  90 1 0 0 221 62 289 A N ATOM 602 NE BARG A  90 27.405 2.748 39.094 0.50 17.67 A N ANISOU 602 NE BARG A  90 1618 2442 3049 156 −166 24 A N SIGUIJ 602 NE BARG A  90 1 0 0 221 62 289 A N ATOM 603 CZ AARG A  90 26.464 5.249 38.929 0.50 15.12 A C ANISOU 603 CZ AARG A  90 1156 1371 1291 30 21 −4 A C SIGUIJ 603 CZ AARG A  90 1 0 0 220 123 290 A C ATOM 604 CZ BARG A  90 28.397 3.628 39.073 0.50 17.31 A C ANISOU 604 CZ BARG A  90 1654 2495 3133 110 −154 16 A C SIGUIJ 604 CZ BARG A  90 1 0 0 220 123 290 A C ATOM 605 NH1 AARG A  90 27.789 5.187 39.088 0.50 15.97 A N ANISOU 605 NH1 AARG A  90 1171 1391 2259 29 −89 6 A N SIGUIJ 605 NH1 AARG A  90 1 0 0 221 62 289 A N ATOM 606 NH1 BARG A  90 28.185 4.878 38.667 0.50 18.16 A N ANISOU 606 NH1 BARG A  90 1573 2490 3114 82 −178 12 A N SIGUIJ 606 NH1 BARG A  90 1 0 0 221 62 289 A N ATOM 607 NH2 AARG A  90 25.818 6.401 39.026 0.50 14.36 A N ANISOU 607 NH2 AARG A  90 780 1244 886 −183 9 8 A N SIGUIJ 607 NH2 AARG A  90 1 0 0 221 62 289 A N ATOM 608 NH2 BARG A  90 29.620 3.219 39.394 0.50 16.55 A N ANISOU 608 NH2 BARG A  90 1599 2618 2127 159 98 −22 A N SIGUIJ 608 NH2 BARG A  90 1 0 0 221 62 289 A N ATOM 609 C AARG A  90 25.703 −1.419 36.246 0.50 13.71 A C ANISOU 609 C AARG A  90 1376 1535 1437 19 13 −3 A C SIGUIJ 609 C AARG A  90 1 0 0 220 123 290 A C ATOM 610 C BARG A  90 25.739 −1.352 36.246 0.50 15.90 A C ANISOU 610 C BARG A  90 1375 1581 1444 51 8 −4 A C SIGUIJ 610 C BARG A  90 1 0 0 220 123 290 A C ATOM 611 O AARG A  90 26.568 −2.275 36.492 0.50 13.91 A O ANISOU 611 O AARG A  90 1717 1882 1575 358 3 36 A O SIGUIJ 611 O AARG A  90 1 0 0 221 55 289 A O ATOM 612 O BARG A  90 26.653 −2.145 36.490 0.50 16.10 A O ANISOU 612 O BARG A  90 1656 1911 2112 331 −111 76 A O SIGUIJ 612 O BARG A  90 1 0 0 221 55 289 A O ATOM 613 N HIS A  91 25.256 −1.184 35.020 1.00 14.41 A N ANISOU 613 N HIS A  91 1453 1903 1440 182 −1 5 A N SIGUIJ 613 N HIS A  91 1 0 0 221 62 289 A N ATOM 614 CA HIS A  91 25.955 −1.767 33.871 1.00 15.48 A C ANISOU 614 CA HIS A  91 1577 2114 1439 328 2 8 A C SIGUIJ 614 CA HIS A  91 1 0 0 220 123 290 A C ATOM 615 CB HIS A  91 25.243 −1.342 32.609 1.00 15.53 A C ANISOU 615 CB HIS A  91 1692 2116 1439 400 −21 −23 A C SIGUIJ 615 CB HIS A  91 1 0 0 220 122 290 A C ATOM 616 CG HIS A  91 25.732 −2.054 31.364 1.00 16.17 A C ANISOU 616 CG HIS A  91 2080 2039 1478 403 112 14 A C SIGUIJ 616 CG HIS A  91 1 0 0 220 122 290 A C ATOM 617 CD2 HIS A  91 25.170 −3.049 30.632 1.00 16.53 A C ANISOU 617 CD2 HIS A  91 2575 2179 1489 112 120 22 A C SIGUIJ 617 CD2 HIS A  91 1 0 0 220 122 290 A C ATOM 618 ND1 HIS A  91 26.940 −1.752 30.760 1.00 16.33 A N ANISOU 618 ND1 HIS A  91 2208 2709 1805 237 296 −14 A N SIGUIJ 618 ND1 HIS A  91 1 0 0 221 62 289 A N ATOM 619 CE1 HIS A  91 27.098 −2.551 29.707 1.00 16.71 A C ANISOU 619 CE1 HIS A  91 3168 2580 1781 149 530 68 A C SIGUIJ 619 CE1 HIS A  91 1 0 0 220 122 290 A C ATOM 620 NE2 HIS A  91 26.049 −3.343 29.609 1.00 16.79 A N ANISOU 620 NE2 HIS A  91 3036 2323 1757 343 466 148 A N SIGUIJ 620 NE2 HIS A  91 1 0 0 221 62 289 A N ATOM 621 C HIS A  91 27.399 −1.213 33.878 1.00 16.12 A C ANISOU 621 C HIS A  91 1549 1980 1755 379 51 −52 A C SIGUIJ 621 C HIS A  91 1 0 0 220 122 290 A C ATOM 622 O HIS A  91 27.633 −0.033 34.149 1.00 15.90 A O ANISOU 622 O HIS A  91 1630 2027 2064 291 356 −175 A O SIGUIJ 622 O HIS A  91 1 0 0 221 55 289 A O ATOM 623 N PRO A  92 28.377 −2.096 33.568 1.00 17.08 A N ANISOU 623 N PRO A  92 1599 1960 2747 346 307 −122 A N SIGUIJ 623 N PRO A  92 1 0 0 221 62 289 A N ATOM 624 CD PRO A  92 28.200 −3.528 33.228 1.00 17.34 A C ANISOU 624 CD PRO A  92 1555 1964 2959 352 421 −171 A C SIGUIJ 624 CD PRO A  92 1 0 0 220 121 290 A C ATOM 625 CA PRO A  92 29.789 −1.732 33.662 1.00 18.05 A C ANISOU 625 CA PRO A  92 1637 2575 3230 178 267 −45 A C SIGUIJ 625 CA PRO A  92 1 0 0 220 121 290 A C ATOM 626 CB PRO A  92 30.523 −3.039 33.352 1.00 18.03 A C ANISOU 626 CB PRO A  92 2147 2595 5347 238 1218 −26 A C SIGUIJ 626 CB PRO A  92 1 0 0 220 121 290 A C ATOM 627 CG PRO A  92 29.595 −3.943 32.745 1.00 17.85 A C ANISOU 627 CG PRO A  92 1886 2564 5684 469 1307 −351 A C SIGUIJ 627 CG PRO A  92 1 0 0 220 121 290 A C ATOM 628 C PRO A  92 30.261 −0.614 32.741 1.00 18.73 A C ANISOU 628 C PRO A  92 2870 2518 3323 60 795 −195 A C SIGUIJ 628 C PRO A  92 1 0 0 220 121 290 A C ATOM 629 O PRO A  92 31.335 0.019 32.997 1.00 19.68 A O ANISOU 629 O PRO A  92 3289 3223 3753 −484 378 338 A O SIGUIJ 629 O PRO A  92 1 0 0 221 55 289 A O ATOM 630 N GLY A  93 29.503 −0.367 31.687 1.00 19.18 A N ANISOU 630 N GLY A  93 2405 2455 3056 209 1157 −308 A N SIGUIJ 630 N GLY A  93 1 0 0 221 62 289 A N ATOM 631 CA GLY A  93 29.954 0.623 30.716 1.00 19.61 A C ANISOU 631 CA GLY A  93 2978 2883 3679 249 1468 152 A C SIGUIJ 631 CA GLY A  93 1 0 0 220 120 290 A C ATOM 632 C GLY A  93 29.473 2.046 30.978 1.00 19.41 A C ANISOU 632 C GLY A  93 2053 2902 1983 215 −4 −11 A C SIGUIJ 632 C GLY A  93 1 0 0 220 120 290 A C ATOM 633 O GLY A  93 29.597 2.921 30.112 1.00 19.30 A O ANISOU 633 O GLY A  93 1718 2790 1916 404 188 −106 A O SIGUIJ 633 O GLY A  93 1 0 0 221 55 289 A O ATOM 634 N TYR A  94 28.871 2.295 32.157 1.00 19.65 A N ANISOU 634 N TYR A  94 2158 3387 1987 465 −3 −8 A N SIGUIJ 634 N TYR A  94 1 0 0 221 62 289 A N ATOM 635 CA TYR A  94 28.106 3.547 32.315 1.00 19.52 A C ANISOU 635 CA TYR A  94 1425 3106 1812 5 30 4 A C SIGUIJ 635 CA TYR A  94 1 0 0 220 120 290 A C ATOM 636 CB TYR A  94 27.215 3.525 33.587 1.00 18.03 A C ANISOU 636 CB TYR A  94 1488 2218 1833 0 63 0 A C SIGUIJ 636 CB TYR A  94 1 0 0 220 120 290 A C ATOM 637 CG TYR A  94 26.540 4.842 33.886 1.00 16.64 A C ANISOU 637 CG TYR A  94 1190 2118 1697 −176 81 21 A C SIGUIJ 637 CG TYR A  94 1 0 0 220 120 290 A C ATOM 638 CD1 TYR A  94 25.670 5.431 32.967 1.00 16.20 A C ANISOU 638 CD1 TYR A  94 1200 1798 1785 −351 −38 −20 A C SIGUIJ 638 CD1 TYR A  94 1 0 0 220 119 290 A C ATOM 639 CE1 TYR A  94 25.003 6.633 33.222 1.00 15.88 A C ANISOU 639 CE1 TYR A  94 1296 1798 1741 −327 89 53 A C SIGUIJ 639 CE1 TYR A  94 1 0 0 220 119 290 A C ATOM 640 CD2 TYR A  94 26.765 5.484 35.089 1.00 16.08 A C ANISOU 640 CD2 TYR A  94 1683 2145 1718 −218 4 7 A C SIGUIJ 640 CD2 TYR A  94 1 0 0 220 119 290 A C ATOM 641 CE2 TYR A  94 26.156 6.678 35.380 1.00 15.75 A C ANISOU 641 CE2 TYR A  94 1824 2177 1776 −145 0 0 A C SIGUIJ 641 CE2 TYR A  94 1 0 0 220 119 290 A C ATOM 642 CZ TYR A  94 25.269 7.255 34.455 1.00 15.56 A C ANISOU 642 CZ TYR A  94 1649 1854 1770 −374 23 31 A C SIGUIJ 642 CZ TYR A  94 1 0 0 220 119 290 A C ATOM 643 OH TYR A  94 24.616 8.431 34.713 1.00 16.26 A O ANISOU 643 OH TYR A  94 2237 2035 1910 −48 22 −4 A O SIGUIJ 643 OH TYR A  94 1 0 0 221 55 289 A O ATOM 644 C TYR A  94 28.994 4.752 32.342 1.00 20.49 A C ANISOU 644 C TYR A  94 1698 3273 2675 −205 15 2 A C SIGUIJ 644 C TYR A  94 1 0 0 220 119 290 A C ATOM 645 O TYR A  94 29.967 4.779 33.096 1.00 20.98 A O ANISOU 645 O TYR A  94 1824 4079 2897 −213 −149 −19 A O SIGUIJ 645 O TYR A  94 1 0 0 221 55 289 A O ATOM 646 N SER A  95 28.623 5.734 31.536 1.00 21.52 A N ANISOU 646 N SER A  95 1637 3332 2624 −119 145 13 A N SIGUIJ 646 N SER A  95 1 0 0 221 62 289 A N ATOM 647 CA SER A  95 29.362 6.989 31.443 1.00 22.67 A C ANISOU 647 CA SER A  95 2089 3501 3158 −388 156 47 A C SIGUIJ 647 CA SER A  95 1 0 0 220 118 290 A C ATOM 648 CB SER A  95 29.691 7.323 29.984 1.00 22.92 A C ANISOU 648 CB SER A  95 2562 2915 3189 −9 350 −2 A C SIGUIJ 648 CB SER A  95 1 0 0 220 118 290 A C ATOM 649 OG SER A  95 30.349 8.587 29.868 1.00 23.39 A O ANISOU 649 OG SER A  95 2664 2945 3663 −58 370 36 A O SIGUIJ 649 OG SER A  95 1 0 0 221 55 289 A O ATOM 650 C SER A  95 28.503 8.103 31.972 1.00 23.35 A C ANISOU 650 C SER A  95 2613 3917 2845 123 −66 22 A C SIGUIJ 650 C SER A  95 1 0 0 220 118 290 A C ATOM 651 O SER A  95 27.447 8.418 31.383 1.00 23.22 A O ANISOU 651 O SER A  95 2406 2721 2567 −271 111 96 A O SIGUIJ 651 O SER A  95 1 0 0 221 55 289 A O ATOM 652 N THR A  96 28.986 8.760 33.015 1.00 24.40 A N ANISOU 652 N THR A  96 2502 3902 2847 184 −57 18 A N SIGUIJ 652 N THR A  96 1 0 0 221 62 289 A N ATOM 653 CA THR A  96 28.311 9.981 33.445 1.00 25.35 A C ANISOU 653 CA THR A  96 3199 4099 4076 423 382 −155 A C SIGUIJ 653 CA THR A  96 1 0 0 220 118 290 A C ATOM 654 CB THR A  96 28.954 10.613 34.718 1.00 25.49 A C ANISOU 654 CB THR A  96 4324 4243 4194 7 9 1 A C SIGUIJ 654 CB THR A  96 1 0 0 220 118 290 A C ATOM 655 OG1 THR A  96 30.207 11.246 34.389 1.00 26.34 A O ANISOU 655 OG1 THR A  96 4383 4266 5130 8 242 12 A O SIGUIJ 655 OG1 THR A  96 1 0 0 221 55 289 A O ATOM 656 CG2 THR A  96 29.150 9.564 35.786 1.00 25.75 A C ANISOU 656 CG2 THR A  96 4300 4244 4201 5 −6 0 A C SIGUIJ 656 CG2 THR A  96 1 0 0 220 117 290 A C ATOM 657 C THR A  96 28.271 11.064 32.364 1.00 25.73 A C ANISOU 657 C THR A  96 3284 4232 4245 −37 −73 −3 A C SIGUIJ 657 C THR A  96 1 0 0 220 117 290 A C ATOM 658 O THR A  96 27.348 11.863 32.334 1.00 26.22 A O ANISOU 658 O THR A  96 3374 4343 5847 63 −110 5 A O SIGUIJ 658 O THR A  96 1 0 0 221 55 289 A O ATOM 659 N GLN A  97 29.223 11.086 31.438 1.00 25.95 A N ANISOU 659 N GLN A  97 3446 2803 4422 −4 98 0 A N SIGUIJ 659 N GLN A  97 1 0 0 221 62 289 A N ATOM 660 CA GLN A  97 29.316 12.202 30.515 1.00 26.11 A C ANISOU 660 CA GLN A  97 4352 2818 4419 −155 4 5 A C SIGUIJ 660 CA GLN A  97 1 0 0 220 117 290 A C ATOM 661 CB GLN A  97 30.759 12.402 30.099 1.00 26.98 A C ANISOU 661 CB GLN A  97 4370 3746 4402 −291 2 −12 A C SIGUIJ 661 CB GLN A  97 1 0 0 220 117 290 A C ATOM 662 CG GLN A  97 30.868 13.209 28.809 1.00 28.30 A C ANISOU 662 CG GLN A  97 7564 3747 4466 113 518 18 A C SIGUIJ 662 CG GLN A  97 1 0 0 220 117 290 A C ATOM 663 CD GLN A  97 32.287 13.304 28.275 1.00 28.85 A C ANISOU 663 CD GLN A  97 7752 12170 5505 −481 913 −68 A C SIGUIJ 663 CD GLN A  97 1 0 0 220 117 290 A C ATOM 664 OE1 GLN A  97 33.062 12.322 28.317 1.00 29.55 A O ANISOU 664 OE1 GLN A  97 7610 12063 21148 −623 173 18 A O SIGUIJ 664 OE1 GLN A  97 1 0 0 221 55 289 A O ATOM 665 NE2 GLN A  97 32.643 14.484 27.760 1.00 29.45 A N ANISOU 665 NE2 GLN A  97 8173 12295 5335 −805 457 −5 A N SIGUIJ 665 NE2 GLN A  97 1 0 0 221 62 289 A N ATOM 666 C GLN A  97 28.464 11.981 29.254 1.00 25.48 A C ANISOU 666 C GLN A  97 4377 3209 4425 −221 −1 −4 A C SIGUIJ 666 C GLN A  97 1 0 0 220 116 290 A C ATOM 667 O GLN A  97 27.764 12.899 28.770 1.00 25.97 A O ANISOU 667 O GLN A  97 4438 3244 4429 −178 0 −1 A O SIGUIJ 667 O GLN A  97 1 0 0 221 55 289 A O ATOM 668 N THR A  98 28.517 10.768 28.709 1.00 24.71 A N ANISOU 668 N THR A  98 2139 3129 4134 −535 501 154 A N SIGUIJ 668 N THR A  98 1 0 0 221 62 289 A N ATOM 669 CA THR A  98 27.845 10.474 27.448 1.00 23.55 A C ANISOU 669 CA THR A  98 2234 2397 4212 −131 363 126 A C SIGUIJ 669 CA THR A  98 1 0 0 220 116 290 A C ATOM 670 CB THR A  98 28.672 9.553 26.535 1.00 24.14 A C ANISOU 670 CB THR A  98 2923 2652 4789 8 855 −11 A C SIGUIJ 670 CB THR A  98 1 0 0 220 116 290 A C ATOM 671 OG1 THR A  98 28.693 8.242 27.090 1.00 25.41 A O ANISOU 671 OG1 THR A  98 2682 2630 4677 18 885 −60 A O SIGUIJ 671 OG1 THR A  98 1 0 0 221 55 289 A O ATOM 672 CG2 THR A  98 30.139 10.013 26.443 1.00 24.07 A C ANISOU 672 CG2 THR A  98 2936 2641 10007 22 1164 50 A C SIGUIJ 672 CG2 THR A  98 1 0 0 220 116 290 A C ATOM 673 C THR A  98 26.474 9.803 27.646 1.00 22.30 A C ANISOU 673 C THR A  98 2155 2072 2681 3 206 9 A C SIGUIJ 673 C THR A  98 1 0 0 220 116 290 A C ATOM 674 O THR A  98 25.704 9.655 26.689 1.00 22.13 A O ANISOU 674 O THR A  98 2401 3340 2810 −247 48 20 A O SIGUIJ 674 O THR A  98 1 0 0 221 55 289 A O ATOM 675 N HIS A  99 26.193 9.360 28.868 1.00 20.81 A N ANISOU 675 N HIS A  99 1992 1996 2663 1 155 −3 A N SIGUIJ 675 N HIS A  99 1 0 0 221 62 289 A N ATOM 676 CA HIS A  99 24.951 8.634 29.168 1.00 19.34 A C ANISOU 676 CA HIS A  99 1983 1987 2190 −2 56 0 A C SIGUIJ 676 CA HIS A  99 1 0 0 220 116 290 A C ATOM 677 CB HIS A  99 23.715 9.438 28.729 1.00 19.79 A C ANISOU 677 CB HIS A  99 2185 2005 3747 4 −484 19 A C SIGUIJ 677 CB HIS A  99 1 0 0 220 115 290 A C ATOM 678 CG HIS A  99 23.728 10.846 29.213 1.00 20.14 A C ANISOU 678 CG HIS A  99 2351 2015 3830 −96 −197 −2 A C SIGUIJ 678 CG HIS A  99 1 0 0 220 115 290 A C ATOM 679 CD2 HIS A  99 24.036 11.996 28.581 1.00 20.41 A C ANISOU 679 CD2 HIS A  99 2203 2017 3899 −57 −203 33 A C SIGUIJ 679 CD2 HIS A  99 1 0 0 220 115 290 A C ATOM 680 ND1 HIS A  99 23.382 11.190 30.501 1.00 20.50 A N ANISOU 680 ND1 HIS A  99 2303 1993 3822 −68 −213 25 A N SIGUIJ 680 ND1 HIS A  99 1 0 0 221 62 289 A N ATOM 681 CE1 HIS A  99 23.466 12.501 30.641 1.00 20.81 A C ANISOU 681 CE1 HIS A  99 3146 2005 4017 −152 95 −5 A C SIGUIJ 681 CE1 HIS A  99 1 0 0 220 115 290 A C ATOM 682 NE2 HIS A  99 23.862 13.012 29.487 1.00 20.46 A N ANISOU 682 NE2 HIS A  99 2633 2027 3964 −118 −62 3 A N SIGUIJ 682 NE2 HIS A  99 1 0 0 221 62 289 A N ATOM 683 C HIS A  99 24.866 7.234 28.583 1.00 18.13 A C ANISOU 683 C HIS A  99 1816 1980 2160 34 45 −7 A C SIGUIJ 683 C HIS A  99 1 0 0 220 115 290 A C ATOM 684 O HIS A  99 23.823 6.602 28.685 1.00 17.56 A O ANISOU 684 O HIS A  99 1823 2014 1995 16 39 −3 A O SIGUIJ 684 O HIS A  99 1 0 0 221 55 289 A O ATOM 685 N VAL A 100 25.945 6.723 27.986 1.00 16.94 A N ANISOU 685 N VAL A 100 1769 1861 2023 −14 −8 −1 A N SIGUIJ 685 N VAL A 100 1 0 0 221 62 289 A N ATOM 686 CA VAL A 100 25.868 5.369 27.479 1.00 15.87 A C ANISOU 686 CA VAL A 100 2252 1850 1935 −47 6 −1 A C SIGUIJ 686 CA VAL A 100 1 0 0 220 115 290 A C ATOM 687 CB VAL A 100 27.067 5.027 26.514 1.00 16.42 A C ANISOU 687 CB VAL A 100 2363 2101 2040 27 102 9 A C SIGUIJ 687 CB VAL A 100 1 0 0 220 114 290 A C ATOM 688 CG1 VAL A 100 27.048 5.936 25.329 1.00 17.26 A C ANISOU 688 CG1 VAL A 100 5438 3054 2562 1740 1368 709 A C SIGUIJ 688 CG1 VAL A 100 1 0 0 220 114 290 A C ATOM 689 CG2 VAL A 100 28.328 5.041 27.227 1.00 17.69 A C ANISOU 689 CG2 VAL A 100 2424 2757 2236 10 −1 0 A C SIGUIJ 689 CG2 VAL A 100 1 0 0 220 114 290 A C ATOM 690 C VAL A 100 25.769 4.380 28.619 1.00 14.72 A C ANISOU 690 C VAL A 100 1790 1813 1929 −4 3 0 A C SIGUIJ 690 C VAL A 100 1 0 0 220 114 290 A C ATOM 691 O VAL A 100 26.243 4.597 29.731 1.00 13.86 A O ANISOU 691 O VAL A 100 1438 1838 1841 −123 192 52 A O SIGUIJ 691 O VAL A 100 1 0 0 221 55 289 A O ATOM 692 N ASN A 101 25.088 3.291 28.328 1.00 14.10 A N ANISOU 692 N ASN A 101 1521 1758 1671 104 276 −91 A N SIGUIJ 692 N ASN A 101 1 0 0 221 62 289 A N ATOM 693 CA ASN A 101 24.902 2.223 29.310 1.00 13.56 A C ANISOU 693 CA ASN A 101 1559 1763 1689 87 245 −77 A C SIGUIJ 693 CA ASN A 101 1 0 0 220 114 290 A C ATOM 694 CB ASN A 101 26.234 1.525 29.592 1.00 14.79 A C ANISOU 694 CB ASN A 101 1609 1960 2094 186 184 −71 A C SIGUIJ 694 CB ASN A 101 1 0 0 220 114 290 A C ATOM 695 CG ASN A 101 26.820 0.963 28.306 1.00 15.68 A C ANISOU 695 CG ASN A 101 1696 2225 2125 340 181 −106 A C SIGUIJ 695 CG ASN A 101 1 0 0 220 113 290 A C ATOM 696 OD1 ASN A 101 26.100 0.323 27.515 1.00 16.85 A O ANISOU 696 OD1 ASN A 101 1850 2274 2189 254 114 −66 A O SIGUIJ 696 OD1 ASN A 101 1 0 0 221 55 289 A O ATOM 697 ND2 ASN A 101 28.091 1.260 28.064 1.00 17.12 A N ANISOU 697 ND2 ASN A 101 1754 3141 2634 138 263 −32 A N SIGUIJ 697 ND2 ASN A 101 1 0 0 221 62 289 A N ATOM 698 C ASN A 101 24.208 2.657 30.602 1.00 12.67 A C ANISOU 698 C ASN A 101 1176 1390 1549 −9 34 1 A C SIGUIJ 698 C ASN A 101 1 0 0 220 113 290 A C ATOM 699 O ASN A 101 24.582 2.223 31.707 1.00 12.12 A O ANISOU 699 O ASN A 101 1255 1474 1494 236 113 −82 A O SIGUIJ 699 O ASN A 101 1 0 0 221 55 289 A O ATOM 700 N ASP A 102 23.206 3.509 30.439 1.00 11.51 A N ANISOU 700 N ASP A 102 1197 1369 1286 −5 3 0 A N SIGUIJ 700 N ASP A 102 1 0 0 221 62 289 A N ATOM 701 CA ASP A 102 22.522 4.095 31.589 1.00 11.50 A C ANISOU 701 CA ASP A 102 1226 1317 1276 −19 0 0 A C SIGUIJ 701 CA ASP A 102 1 0 0 220 113 290 A C ATOM 702 CB ASP A 102 21.924 5.449 31.192 1.00 11.19 A C ANISOU 702 CB ASP A 102 1327 1329 1286 0 −1 0 A C SIGUIJ 702 CB ASP A 102 1 0 0 220 113 290 A C ATOM 703 CG ASP A 102 21.442 6.269 32.400 1.00 11.45 A C ANISOU 703 CG ASP A 102 1369 1344 1283 0 −2 0 A C SIGUIJ 703 CG ASP A 102 1 0 0 220 113 290 A C ATOM 704 OD1 ASP A 102 21.673 5.856 33.563 1.00 11.51 A O ANISOU 704 OD1 ASP A 102 1251 1347 1283 −10 2 0 A O SIGUIJ 704 OD1 ASP A 102 1 0 0 221 55 289 A O ATOM 705 OD2 ASP A 102 20.801 7.313 32.169 1.00 11.08 A O ANISOU 705 OD2 ASP A 102 1421 1354 1220 9 8 1 A O SIGUIJ 705 OD2 ASP A 102 1 0 0 221 55 289 A O ATOM 706 C ASP A 102 21.455 3.144 32.131 1.00 11.59 A C ANISOU 706 C ASP A 102 1223 1280 1252 2 0 0 A C SIGUIJ 706 C ASP A 102 1 0 0 220 113 290 A C ATOM 707 O ASP A 102 20.245 3.459 32.084 1.00 12.68 A O ANISOU 707 O ASP A 102 1258 1687 1990 120 −29 6 A O SIGUIJ 707 O ASP A 102 1 0 0 221 55 289 A O ATOM 708 N LEU A 103 21.891 2.007 32.676 1.00 11.50 A N ANISOU 708 N LEU A 103 1270 1269 1266 0 0 0 A N SIGUIJ 708 N LEU A 103 1 0 0 221 62 289 A N ATOM 709 CA LEU A 103 20.952 1.083 33.286 1.00 11.53 A C ANISOU 709 CA LEU A 103 1278 1263 1325 3 4 0 A C SIGUIJ 709 CA LEU A 103 1 0 0 220 112 290 A C ATOM 710 CB LEU A 103 20.328 0.088 32.300 1.00 13.13 A C ANISOU 710 CB LEU A 103 1965 1515 1359 −384 −11 7 A C SIGUIJ 710 CB LEU A 103 1 0 0 220 112 290 A C ATOM 711 CG LEU A 103 21.231 −1.005 31.756 1.00 13.55 A C ANISOU 711 CG LEU A 103 2312 1741 1668 −140 116 −26 A C SIGUIJ 711 CG LEU A 103 1 0 0 220 112 290 A C ATOM 712 CD1 LEU A 103 20.335 −2.057 30.957 1.00 14.38 A C ANISOU 712 CD1 LEU A 103 2180 1679 1605 −68 167 −20 A C SIGUIJ 712 CD1 LEU A 103 1 0 0 220 112 290 A C ATOM 713 CD2 LEU A 103 22.241 −0.489 30.744 1.00 14.48 A C ANISOU 713 CD2 LEU A 103 2282 1609 1715 −26 149 −6 A C SIGUIJ 713 CD2 LEU A 103 1 0 0 220 112 290 A C ATOM 714 C LEU A 103 21.563 0.405 34.495 1.00 10.75 A C ANISOU 714 C LEU A 103 1217 1210 1320 −1 9 −1 A C SIGUIJ 714 C LEU A 103 1 0 0 220 112 290 A C ATOM 715 O LEU A 103 22.807 0.317 34.647 1.00 10.74 A O ANISOU 715 O LEU A 103 1212 1289 1464 5 0 0 A O SIGUIJ 715 O LEU A 103 1 0 0 221 55 289 A O ATOM 716 N MET A 104 20.688 −0.027 35.400 1.00 10.28 A N ANISOU 716 N MET A 104 1183 1062 1306 86 12 −3 A N SIGUIJ 716 N MET A 104 1 0 0 221 62 289 A N ATOM 717 CA MET A 104 21.074 −0.508 36.711 1.00 9.73 A C ANISOU 717 CA MET A 104 1188 1015 1310 2 −12 0 A C SIGUIJ 717 CA MET A 104 1 0 0 220 112 290 A C ATOM 718 CB MET A 104 21.242 0.689 37.670 1.00 9.60 A C ANISOU 718 CB MET A 104 1156 1018 1297 −47 20 0 A C SIGUIJ 718 CB MET A 104 1 0 0 220 111 290 A C ATOM 719 CG MET A 104 21.621 0.322 39.100 1.00 9.22 A C ANISOU 719 CG MET A 104 1309 1117 1294 25 1 0 A C SIGUIJ 719 CG MET A 104 1 0 0 220 111 290 A C ATOM 720 SD MET A 104 21.934 1.769 40.144 1.00 10.10 A S ANISOU 720 SD MET A 104 1365 1162 1408 92 −113 −79 A S SIGUIJ 720 SD MET A 104 1 0 0 221 48 289 A S ATOM 721 CE MET A 104 20.275 2.461 40.318 1.00 9.48 A C ANISOU 721 CE MET A 104 1365 1153 1527 95 −27 5 A C SIGUIJ 721 CE MET A 104 1 0 0 220 111 290 A C ATOM 722 C MET A 104 19.992 −1.444 37.231 1.00 9.69 A C ANISOU 722 C MET A 104 1168 965 1359 60 28 −1 A C SIGUIJ 722 C MET A 104 1 0 0 220 111 290 A C ATOM 723 O MET A 104 18.798 −1.172 37.066 1.00 10.37 A O ANISOU 723 O MET A 104 1184 1080 1646 87 4 1 A O SIGUIJ 723 O MET A 104 1 0 0 221 55 289 A O ATOM 724 N LEU A 105 20.411 −2.514 37.907 1.00 9.28 A N ANISOU 724 N LEU A 105 1116 966 1347 39 1 0 A N SIGUIJ 724 N LEU A 105 1 0 0 221 62 289 A N ATOM 725 CA LEU A 105 19.499 −3.414 38.580 1.00 9.44 A C ANISOU 725 CA LEU A 105 1032 926 1390 124 14 1 A C SIGUIJ 725 CA LEU A 105 1 0 0 220 111 290 A C ATOM 726 CB LEU A 105 19.892 −4.877 38.263 1.00 10.10 A C ANISOU 726 CB LEU A 105 1389 953 1640 202 53 −30 A C SIGUIJ 726 CB LEU A 105 1 0 0 220 111 290 A C ATOM 727 CG LEU A 105 19.402 −5.290 36.891 1.00 10.37 A C ANISOU 727 CG LEU A 105 1620 1043 1658 20 −1 0 A C SIGUIJ 727 CG LEU A 105 1 0 0 220 110 290 A C ATOM 728 CD1 LEU A 105 20.243 −6.494 36.416 1.00 11.78 A C ANISOU 728 CD1 LEU A 105 2116 1331 1753 403 −62 −49 A C SIGUIJ 728 CD1 LEU A 105 1 0 0 220 110 290 A C ATOM 729 CD2 LEU A 105 17.882 −5.623 36.914 1.00 11.41 A C ANISOU 729 CD2 LEU A 105 1642 1495 1676 −87 0 −1 A C SIGUIJ 729 CD2 LEU A 105 1 0 0 220 110 290 A C ATOM 730 C LEU A 105 19.553 −3.168 40.074 1.00 9.78 A C ANISOU 730 C LEU A 105 1222 1045 1390 44 19 −1 A C SIGUIJ 730 C LEU A 105 1 0 0 220 110 290 A C ATOM 731 O LEU A 105 20.639 −3.056 40.668 1.00 10.06 A O ANISOU 731 O LEU A 105 1251 1567 1485 −8 −34 −1 A O SIGUIJ 731 O LEU A 105 1 0 0 221 55 289 A O ATOM 732 N VAL A 106 18.376 −3.053 40.700 1.00 9.72 A N ANISOU 732 N VAL A 106 1211 1073 1326 60 −6 1 A N SIGUIJ 732 N VAL A 106 1 0 0 221 62 289 A N ATOM 733 CA VAL A 106 18.253 −2.806 42.118 1.00 9.98 A C ANISOU 733 CA VAL A 106 1165 997 1333 −15 −2 0 A C SIGUIJ 733 CA VAL A 106 1 0 0 220 110 290 A C ATOM 734 CB VAL A 106 17.319 −1.592 42.401 1.00 9.38 A C ANISOU 734 CB VAL A 106 1195 1027 1322 18 −11 0 A C SIGUIJ 734 CB VAL A 106 1 0 0 220 110 290 A C ATOM 735 CG1 VAL A 106 17.014 −1.470 43.855 1.00 10.46 A C ANISOU 735 CG1 VAL A 106 1714 1079 1335 127 79 19 A C SIGUIJ 735 CG1 VAL A 106 1 0 0 220 110 290 A C ATOM 736 CG2 VAL A 106 17.961 −0.326 41.839 1.00 10.19 A C ANISOU 736 CG2 VAL A 106 1372 1081 1382 −80 0 3 A C SIGUIJ 736 CG2 VAL A 106 1 0 0 220 109 290 A C ATOM 737 C VAL A 106 17.652 −4.046 42.767 1.00 9.99 A C ANISOU 737 C VAL A 106 1187 973 1384 17 69 0 A C SIGUIJ 737 C VAL A 106 1 0 0 220 109 290 A C ATOM 738 O VAL A 106 16.621 −4.558 42.315 1.00 10.40 A O ANISOU 738 O VAL A 106 1257 1052 1559 −27 −37 2 A O SIGUIJ 738 O VAL A 106 1 0 0 221 55 289 A O ATOM 739 N LYS A 107 18.348 −4.591 43.770 1.00 10.39 A N ANISOU 739 N LYS A 107 1370 1019 1447 76 −6 3 A N SIGUIJ 739 N LYS A 107 1 0 0 221 62 289 A N ATOM 740 CA LYS A 107 17.914 −5.842 44.388 1.00 10.98 A C ANISOU 740 CA LYS A 107 1397 1005 1459 101 3 −2 A C SIGUIJ 740 CA LYS A 107 1 0 0 220 109 290 A C ATOM 741 CB LYS A 107 19.106 −6.668 44.803 1.00 11.90 A C ANISOU 741 CB LYS A 107 1601 1250 1934 297 −164 11 A C SIGUIJ 741 CB LYS A 107 1 0 0 220 109 290 A C ATOM 742 CG LYS A 107 18.732 −8.049 45.245 1.00 13.32 A C ANISOU 742 CG LYS A 107 1830 1239 2066 316 18 −9 A C SIGUIJ 742 CG LYS A 107 1 0 0 220 109 290 A C ATOM 743 CD LYS A 107 19.993 −8.863 45.608 1.00 14.98 A C ANISOU 743 CD LYS A 107 2079 1905 2194 715 85 171 A C SIGUIJ 743 CD LYS A 107 1 0 0 220 109 290 A C ATOM 744 CE LYS A 107 19.721 −10.362 45.772 1.00 16.42 A C ANISOU 744 CE LYS A 107 2713 1921 3605 647 435 263 A C SIGUIJ 744 CE LYS A 107 1 0 0 220 109 290 A C ATOM 745 NZ LYS A 107 21.008 −11.032 46.297 1.00 17.72 A N ANISOU 745 NZ LYS A 107 3026 2306 4028 981 93 −57 A N SIGUIJ 745 NZ LYS A 107 1 0 0 221 62 289 A N ATOM 746 C LYS A 107 17.065 −5.531 45.604 1.00 11.00 A C ANISOU 746 C LYS A 107 1395 1032 1450 71 −1 1 A C SIGUIJ 746 C LYS A 107 1 0 0 220 108 290 A C ATOM 747 O LYS A 107 17.547 −4.887 46.553 1.00 11.19 A O ANISOU 747 O LYS A 107 1567 1170 1442 −78 5 −2 A O SIGUIJ 747 O LYS A 107 1 0 0 221 55 289 A O ATOM 748 N LEU A 108 15.802 −5.981 45.603 1.00 11.24 A N ANISOU 748 N LEU A 108 1422 1231 1342 2 0 0 A N SIGUIJ 748 N LEU A 108 1 0 0 221 62 289 A N ATOM 749 CA LEU A 108 14.907 −5.711 46.740 1.00 11.85 A C ANISOU 749 CA LEU A 108 1465 1277 1352 9 22 1 A C SIGUIJ 749 CA LEU A 108 1 0 0 220 108 290 A C ATOM 750 CB LEU A 108 13.474 −6.132 46.387 1.00 12.01 A C ANISOU 750 CB LEU A 108 1478 1343 1502 −20 −1 0 A C SIGUIJ 750 CB LEU A 108 1 0 0 220 108 290 A C ATOM 751 CG LEU A 108 12.919 −5.418 45.167 1.00 11.86 A C ANISOU 751 CG LEU A 108 1536 1382 1505 24 −4 −2 A C SIGUIJ 751 CG LEU A 108 1 0 0 220 108 290 A C ATOM 752 CD1 LEU A 108 11.513 −5.984 44.837 1.00 12.58 A C ANISOU 752 CD1 LEU A 108 1614 1501 2352 −35 −229 51 A C SIGUIJ 752 CD1 LEU A 108 1 0 0 220 108 290 A C ATOM 753 CD2 LEU A 108 12.846 −3.926 45.399 1.00 12.88 A C ANISOU 753 CD2 LEU A 108 2113 1389 1608 57 −30 −3 A C SIGUIJ 753 CD2 LEU A 108 1 0 0 220 108 290 A C ATOM 754 C LEU A 108 15.392 −6.546 47.952 1.00 12.20 A C ANISOU 754 C LEU A 108 1519 1267 1374 −32 −25 5 A C SIGUIJ 754 C LEU A 108 1 0 0 220 108 290 A C ATOM 755 O LEU A 108 15.854 −7.685 47.786 1.00 12.60 A O ANISOU 755 O LEU A 108 1852 1313 1599 91 70 18 A O SIGUIJ 755 O LEU A 108 1 0 0 221 55 289 A O ATOM 756 N ASN A 109 15.259 −6.006 49.139 1.00 12.92 A N ANISOU 756 N ASN A 109 1573 1345 1374 −40 −4 1 A N SIGUIJ 756 N ASN A 109 1 0 0 221 62 289 A N ATOM 757 CA ASN A 109 15.681 −6.757 50.345 1.00 13.41 A C ANISOU 757 CA ASN A 109 1847 1426 1378 46 −54 −5 A C SIGUIJ 757 CA ASN A 109 1 0 0 220 107 290 A C ATOM 758 CB ASN A 109 15.811 −5.836 51.542 1.00 13.05 A C ANISOU 758 CB ASN A 109 1687 1456 1376 40 −37 −5 A C SIGUIJ 758 CB ASN A 109 1 0 0 220 107 290 A C ATOM 759 CG ASN A 109 17.005 −4.891 51.431 1.00 12.98 A C ANISOU 759 CG ASN A 109 1680 1476 1525 43 −12 −3 A C SIGUIJ 759 CG ASN A 109 1 0 0 220 107 290 A C ATOM 760 OD1 ASN A 109 17.785 −4.886 50.442 1.00 12.94 A O ANISOU 760 OD1 ASN A 109 1730 1565 1552 32 28 5 A O SIGUIJ 760 OD1 ASN A 109 1 0 0 221 55 289 A O ATOM 761 ND2 ASN A 109 17.173 −4.096 52.470 1.00 13.30 A N ANISOU 761 ND2 ASN A 109 1687 1502 1533 28 −5 −1 A N SIGUIJ 761 ND2 ASN A 109 1 0 0 221 61 289 A N ATOM 762 C ASN A 109 14.724 −7.859 50.719 1.00 14.69 A C ANISOU 762 C ASN A 109 2099 1588 1559 −140 26 −7 A C SIGUIJ 762 C ASN A 109 1 0 0 220 107 290 A C ATOM 763 O ASN A 109 15.098 −8.816 51.433 1.00 14.91 A O ANISOU 763 O ASN A 109 2374 1641 1909 −293 −314 134 A O SIGUIJ 763 O ASN A 109 1 0 0 221 55 289 A O ATOM 764 N ASER A 110 13.476 −7.736 50.267 0.50 15.29 A N ANISOU 764 N ASER A 110 2135 1762 1816 −127 −63 22 A N SIGUIJ 764 N ASER A 110 1 0 0 221 61 289 A N ATOM 765 N BSER A 110 13.510 −7.789 50.203 0.50 17.48 A N ANISOU 765 N BSER A 110 2143 1640 1822 −165 −84 33 A N SIGUIJ 765 N BSER A 110 1 0 0 221 61 289 A N ATOM 766 CA ASER A 110 12.395 −8.696 50.529 0.50 16.79 A C ANISOU 766 CA ASER A 110 2341 2020 1933 −347 −38 28 A C SIGUIJ 766 CA ASER A 110 1 0 0 220 107 290 A C ATOM 767 CA BSER A 110 12.531 −8.835 50.409 0.50 18.98 A C ANISOU 767 CA BSER A 110 2251 1710 2035 −244 −20 14 A C SIGUIJ 767 CA BSER A 110 1 0 0 220 107 290 A C ATOM 768 CB ASER A 110 11.484 −8.210 51.703 0.50 17.69 A C ANISOU 768 CB ASER A 110 2668 2689 2019 −1 64 1 A C SIGUIJ 768 CB ASER A 110 1 0 0 220 107 290 A C ATOM 769 CB BSER A 110 11.640 −8.504 51.614 0.50 19.88 A C ANISOU 769 CB BSER A 110 2409 2429 2071 2 24 −1 A C SIGUIJ 769 CB BSER A 110 1 0 0 220 107 290 A C ATOM 770 OG ASER A 110 10.860 −6.950 51.498 0.50 19.99 A O ANISOU 770 OG ASER A 110 2698 2686 2036 1 23 1 A O SIGUIJ 770 OG ASER A 110 1 0 0 221 55 289 A O ATOM 771 OG BSER A 110 12.411 −8.427 52.800 0.50 22.18 A O ANISOU 771 OG BSER A 110 2462 2576 2090 −34 −7 −1 A O SIGUIJ 771 OG BSER A 110 1 0 0 221 55 289 A O ATOM 772 C ASER A 110 11.603 −8.807 49.216 0.50 17.01 A C ANISOU 772 C ASER A 110 2432 1844 1956 −290 −74 37 A C SIGUIJ 772 C ASER A 110 1 0 0 220 106 290 A C ATOM 773 C BSER A 110 11.713 −8.885 49.138 0.50 19.20 A C ANISOU 773 C BSER A 110 2224 1826 2022 −206 −2 1 A C SIGUIJ 773 C BSER A 110 1 0 0 220 106 290 A C ATOM 774 O ASER A 110 11.619 −7.866 48.392 0.50 16.63 A O ANISOU 774 O ASER A 110 1439 1829 1952 −117 96 24 A O SIGUIJ 774 O ASER A 110 1 0 0 221 55 289 A O ATOM 775 O BSER A 110 11.771 −7.974 48.291 0.50 18.82 A O ANISOU 775 O BSER A 110 2693 1817 2024 −219 −7 2 A O SIGUIJ 775 O BSER A 110 1 0 0 221 55 289 A O ATOM 776 N GLN A 111 10.933 −9.932 48.996 1.00 17.12 A N ANISOU 776 N GLN A 111 1988 1698 1958 −28 0 0 A N SIGUIJ 776 N GLN A 111 1 0 0 221 61 289 A N ATOM 777 CA GLN A 111 10.229 −10.117 47.737 1.00 18.12 A C ANISOU 777 CA GLN A 111 2166 1970 1991 −137 −72 43 A C SIGUIJ 777 CA GLN A 111 1 0 0 220 106 290 A C ATOM 778 CB GLN A 111 9.766 −11.557 47.579 1.00 19.48 A C ANISOU 778 CB GLN A 111 2371 1998 2746 −187 −160 −30 A C SIGUIJ 778 CB GLN A 111 1 0 0 220 106 290 A C ATOM 779 CG GLN A 111 10.845 −12.568 47.392 1.00 22.14 A C ANISOU 779 CG GLN A 111 2793 2264 7919 80 852 92 A C SIGUIJ 779 CG GLN A 111 1 0 0 220 106 290 A C ATOM 780 CD GLN A 111 10.308 −13.819 46.758 1.00 23.28 A C ANISOU 780 CD GLN A 111 6731 2748 9230 −935 −488 −3 A C SIGUIJ 780 CD GLN A 111 1 0 0 220 106 290 A C ATOM 781 OE1 GLN A 111 10.959 −14.434 45.907 1.00 24.92 A O ANISOU 781 OE1 GLN A 111 9238 4863 9655 1005 29 −45 A O SIGUIJ 781 OE1 GLN A 111 1 0 0 221 55 289 A O ATOM 782 NE2 GLN A 111 9.103 −14.201 47.157 1.00 24.43 A N ANISOU 782 NE2 GLN A 111 6765 2621 9593 −908 −357 −33 A N SIGUIJ 782 NE2 GLN A 111 1 0 0 221 61 289 A N ATOM 783 C GLN A 111 9.019 −9.201 47.593 1.00 17.61 A C ANISOU 783 C GLN A 111 2163 1938 1772 −146 −57 24 A C SIGUIJ 783 C GLN A 111 1 0 0 220 106 290 A C ATOM 784 O GLN A 111 8.280 −8.956 48.526 1.00 18.10 A O ANISOU 784 O GLN A 111 2463 2452 1934 2 144 9 A O SIGUIJ 784 O GLN A 111 1 0 0 221 55 289 A O ATOM 785 N ALA A 112 8.811 −8.718 46.377 1.00 17.05 A N ANISOU 785 N ALA A 112 2003 1853 1753 −48 14 −4 A N SIGUIJ 785 N ALA A 112 1 0 0 221 61 289 A N ATOM 786 CA ALA A 112 7.570 −8.041 46.057 1.00 16.69 A C ANISOU 786 CA ALA A 112 1968 1731 1752 −118 9 −4 A C SIGUIJ 786 CA ALA A 112 1 0 0 220 106 290 A C ATOM 787 CB ALA A 112 7.670 −7.434 44.679 1.00 16.65 A C ANISOU 787 CB ALA A 112 2000 1744 1751 −188 −5 3 A C SIGUIJ 787 CB ALA A 112 1 0 0 220 105 290 A C ATOM 788 C ALA A 112 6.462 −9.070 46.059 1.00 16.29 A C ANISOU 788 C ALA A 112 1843 1588 2130 17 8 0 A C SIGUIJ 788 C ALA A 112 1 0 0 220 105 290 A C ATOM 789 O ALA A 112 6.640 −10.181 45.548 1.00 16.84 A O ANISOU 789 O ALA A 112 1983 1611 2562 −162 436 −121 A O SIGUIJ 789 O ALA A 112 1 0 0 221 55 289 A O ATOM 790 N ARG A 113 5.317 −8.648 46.555 1.00 15.89 A N ANISOU 790 N ARG A 113 1770 1310 2014 −103 −46 3 A N SIGUIJ 790 N ARG A 113 1 0 0 221 61 289 A N ATOM 791 CA ARG A 113 4.134 −9.498 46.561 1.00 16.10 A C ANISOU 791 CA ARG A 113 1809 1395 2123 −170 −36 −3 A C SIGUIJ 791 CA ARG A 113 1 0 0 220 105 290 A C ATOM 792 CB ARG A 113 3.307 −9.105 47.789 1.00 16.85 A C ANISOU 792 CB ARG A 113 1921 1804 2139 10 −9 0 A C SIGUIJ 792 CB ARG A 113 1 0 0 220 105 290 A C ATOM 793 CG ARG A 113 2.029 −9.912 47.973 1.00 18.15 A C ANISOU 793 CG ARG A 113 2179 2462 2531 −397 25 63 A C SIGUIJ 793 CG ARG A 113 1 0 0 220 105 290 A C ATOM 794 CD ARG A 113 1.363 −9.577 49.279 1.00 19.35 A C ANISOU 794 CD ARG A 113 2480 3481 2568 4 76 9 A C SIGUIJ 794 CD ARG A 113 1 0 0 220 105 290 A C ATOM 795 NE ARG A 113 0.698 −8.280 49.188 1.00 21.35 A N ANISOU 795 NE ARG A 113 3765 3821 3177 658 33 35 A N SIGUIJ 795 NE ARG A 113 1 0 0 221 61 289 A N ATOM 796 CZ ARG A 113 1.124 −7.145 49.720 1.00 21.76 A C ANISOU 796 CZ ARG A 113 4752 4010 2907 147 339 40 A C SIGUIJ 796 CZ ARG A 113 1 0 0 220 105 290 A C ATOM 797 NH1 ARG A 113 2.263 −7.116 50.403 1.00 22.87 A N ANISOU 797 NH1 ARG A 113 4831 9256 3113 35 215 4 A N SIGUIJ 797 NH1 ARG A 113 1 0 0 221 61 289 A N ATOM 798 NH2 ARG A 113 0.407 −6.033 49.560 1.00 22.28 A N ANISOU 798 NH2 ARG A 113 4317 3819 2073 −127 387 −52 A N SIGUIJ 798 NH2 ARG A 113 1 0 0 221 61 289 A N ATOM 799 C ARG A 113 3.379 −9.243 45.280 1.00 16.20 A C ANISOU 799 C ARG A 113 1605 1249 2069 −215 83 13 A C SIGUIJ 799 C ARG A 113 1 0 0 220 104 290 A C ATOM 800 O ARG A 113 2.898 −8.126 45.043 1.00 15.52 A O ANISOU 800 O ARG A 113 1821 1271 2200 −140 −20 −2 A O SIGUIJ 800 O ARG A 113 1 0 0 221 55 289 A O ATOM 801 N LEU A 114 3.248 −10.255 44.430 1.00 16.44 A N ANISOU 801 N LEU A 114 1747 1247 2127 −113 −55 1 A N SIGUIJ 801 N LEU A 114 1 0 0 221 61 289 A N ATOM 802 CA LEU A 114 2.613 −10.095 43.145 1.00 17.11 A C ANISOU 802 CA LEU A 114 1733 1504 2137 −27 −60 −2 A C SIGUIJ 802 CA LEU A 114 1 0 0 220 104 290 A C ATOM 803 CB LEU A 114 3.090 −11.177 42.160 1.00 16.77 A C ANISOU 803 CB LEU A 114 1677 1500 2110 −15 −116 2 A C SIGUIJ 803 CB LEU A 114 1 0 0 220 104 290 A C ATOM 804 CG LEU A 114 4.604 −11.244 41.936 1.00 16.57 A C ANISOU 804 CG LEU A 114 1686 1414 2554 −26 −58 2 A C SIGUIJ 804 CG LEU A 114 1 0 0 220 104 290 A C ATOM 805 CD1 LEU A 114 4.934 −12.344 40.931 1.00 16.95 A C ANISOU 805 CD1 LEU A 114 2302 1465 2569 124 −15 2 A C SIGUIJ 805 CD1 LEU A 114 1 0 0 220 104 290 A C ATOM 806 CD2 LEU A 114 5.114 −9.909 41.432 1.00 17.11 A C ANISOU 806 CD2 LEU A 114 2276 1462 3081 −108 329 44 A C SIGUIJ 806 CD2 LEU A 114 1 0 0 220 104 290 A C ATOM 807 C LEU A 114 1.097 −10.149 43.285 1.00 18.00 A C ANISOU 807 C LEU A 114 1728 1573 2995 −6 15 0 A C SIGUIJ 807 C LEU A 114 1 0 0 220 104 290 A C ATOM 808 O LEU A 114 0.577 −10.827 44.215 1.00 18.24 A O ANISOU 808 O LEU A 114 2536 1872 3167 −325 254 55 A O SIGUIJ 808 O LEU A 114 1 0 0 221 55 289 A O ATOM 809 N SER A 115 0.408 −9.482 42.337 1.00 18.77 A N ANISOU 809 N SER A 115 1763 1552 3043 −36 −49 4 A N SIGUIJ 809 N SER A 115 1 0 0 221 61 289 A N ATOM 810 CA SER A 115 −1.055 −9.364 42.358 1.00 19.64 A C ANISOU 810 CA SER A 115 1766 2476 3337 46 −53 3 A C SIGUIJ 810 CA SER A 115 1 0 0 220 104 290 A C ATOM 811 CB SER A 115 −1.452 −8.523 43.539 1.00 20.16 A C ANISOU 811 CB SER A 115 2626 2474 3445 12 261 −3 A C SIGUIJ 811 CB SER A 115 1 0 0 220 104 290 A C ATOM 812 OG SER A 115 −1.140 −7.162 43.223 1.00 21.32 A O ANISOU 812 OG SER A 115 3340 2498 4640 27 979 112 A O SIGUIJ 812 OG SER A 115 1 0 0 221 55 289 A O ATOM 813 C SER A 115 −1.528 −8.645 41.083 1.00 19.90 A C ANISOU 813 C SER A 115 1763 2272 3371 −161 −175 −32 A C SIGUIJ 813 C SER A 115 1 0 0 220 103 290 A C ATOM 814 O SER A 115 −0.753 −8.325 40.227 1.00 20.05 A O ANISOU 814 O SER A 115 1816 1909 3486 9 −71 3 A O SIGUIJ 814 O SER A 115 1 0 0 221 54 289 A O ATOM 815 N SER A 116 −2.838 −8.428 40.931 1.00 20.69 A N ANISOU 815 N SER A 116 1795 2418 5718 −141 −452 −36 A N SIGUIJ 815 N SER A 116 1 0 0 221 61 289 A N ATOM 816 CA SER A 116 −3.329 −7.557 39.857 1.00 20.69 A C ANISOU 816 CA SER A 116 1953 2455 5706 −48 −455 −54 A C SIGUIJ 816 CA SER A 116 1 0 0 220 103 290 A C ATOM 817 CB SER A 116 −4.865 −7.371 39.972 1.00 21.19 A C ANISOU 817 CB SER A 116 1986 3668 8877 97 −207 8 A C SIGUIJ 817 CB SER A 116 1 0 0 220 103 290 A C ATOM 818 OG SER A 116 −5.215 −6.768 41.202 1.00 22.45 A O ANISOU 818 OG SER A 116 2138 3815 8778 623 −419 88 A O SIGUIJ 818 OG SER A 116 1 0 0 221 54 289 A O ATOM 819 C SER A 116 −2.644 −6.171 39.784 1.00 20.42 A C ANISOU 819 C SER A 116 2214 2521 4640 −172 −509 −96 A C SIGUIJ 819 C SER A 116 1 0 0 220 103 290 A C ATOM 820 O SER A 116 −2.550 −5.610 38.697 1.00 21.05 A O ANISOU 820 O SER A 116 2131 2640 4675 −95 −490 −34 A O SIGUIJ 820 O SER A 116 1 0 0 221 54 289 A O ATOM 821 N MET A 117 −2.153 −5.667 40.921 1.00 19.82 A N ANISOU 821 N MET A 117 1407 1770 4466 182 −306 96 A N SIGUIJ 821 N MET A 117 1 0 0 221 61 289 A N ATOM 822 CA MET A 117 −1.520 −4.350 40.929 1.00 19.03 A C ANISOU 822 CA MET A 117 1729 1849 3850 32 −57 7 A C SIGUIJ 822 CA MET A 117 1 0 0 220 103 290 A C ATOM 823 CB MET A 117 −1.943 −3.547 42.132 1.00 20.66 A C ANISOU 823 CB MET A 117 2266 1946 3895 138 61 7 A C SIGUIJ 823 CB MET A 117 1 0 0 220 103 290 A C ATOM 824 CG MET A 117 −3.379 −2.897 41.980 1.00 22.36 A C ANISOU 824 CG MET A 117 2554 3281 5392 737 −96 42 A C SIGUIJ 824 CG MET A 117 1 0 0 220 103 290 A C ATOM 825 SD MET A 117 −3.694 −2.019 40.387 1.00 24.64 A S ANISOU 825 SD MET A 117 2679 3265 5461 451 −289 102 A S SIGUIJ 825 SD MET A 117 1 0 0 221 48 289 A S ATOM 826 CE MET A 117 −3.179 −0.412 40.861 1.00 23.83 A C ANISOU 826 CE MET A 117 3978 3438 5677 −2 −189 3 A C SIGUIJ 826 CE MET A 117 1 0 0 220 103 290 A C ATOM 827 C MET A 117 0.001 −4.376 40.899 1.00 17.74 A C ANISOU 827 C MET A 117 1732 1355 2342 25 −74 1 A C SIGUIJ 827 C MET A 117 1 0 0 220 102 290 A C ATOM 828 O MET A 117 0.612 −3.307 40.805 1.00 17.16 A O ANISOU 828 O MET A 117 1737 1336 2063 38 −73 −2 A O SIGUIJ 828 O MET A 117 1 0 0 221 54 289 A O ATOM 829 N VAL A 118 0.611 −5.574 41.004 1.00 16.28 A N ANISOU 829 N VAL A 118 1624 1330 2554 −26 −76 3 A N SIGUIJ 829 N VAL A 118 1 0 0 221 61 289 A N ATOM 830 CA VAL A 118 2.095 −5.723 40.950 1.00 15.27 A C ANISOU 830 CA VAL A 118 1629 1193 2104 −36 −94 1 A C SIGUIJ 830 CA VAL A 118 1 0 0 220 102 290 A C ATOM 831 CB VAL A 118 2.649 −5.931 42.377 1.00 14.08 A C ANISOU 831 CB VAL A 118 1405 1263 2061 3 12 0 A C SIGUIJ 831 CB VAL A 118 1 0 0 220 102 290 A C ATOM 832 CG1 VAL A 118 4.176 −6.145 42.338 1.00 13.42 A C ANISOU 832 CG1 VAL A 118 1408 1247 2297 −1 22 0 A C SIGUIJ 832 CG1 VAL A 118 1 0 0 220 102 290 A C ATOM 833 CG2 VAL A 118 2.304 −4.722 43.232 1.00 14.26 A C ANISOU 833 CG2 VAL A 118 1562 1269 2099 11 76 1 A C SIGUIJ 833 CG2 VAL A 118 1 0 0 220 102 290 A C ATOM 834 C VAL A 118 2.414 −6.890 40.055 1.00 15.11 A C ANISOU 834 C VAL A 118 1434 1161 2121 −131 −60 1 A C SIGUIJ 834 C VAL A 118 1 0 0 220 102 290 A C ATOM 835 O VAL A 118 2.127 −8.060 40.396 1.00 14.71 A O ANISOU 835 O VAL A 118 1814 1179 2218 −232 −43 −2 A O SIGUIJ 835 O VAL A 118 1 0 0 221 54 289 A O ATOM 836 N LYS A 119 2.949 −6.593 38.882 1.00 15.20 A N ANISOU 836 N LYS A 119 1746 1300 2172 −183 63 7 A N SIGUIJ 836 N LYS A 119 1 0 0 221 61 289 A N ATOM 837 CA LYS A 119 3.202 −7.592 37.838 1.00 15.90 A C ANISOU 837 CA LYS A 119 1689 1303 2175 −188 65 3 A C SIGUIJ 837 CA LYS A 119 1 0 0 220 102 290 A C ATOM 838 CB LYS A 119 2.212 −7.325 36.693 1.00 17.02 A C ANISOU 838 CB LYS A 119 2159 1934 2519 −57 −311 59 A C SIGUIJ 838 CB LYS A 119 1 0 0 220 102 290 A C ATOM 839 CG LYS A 119 2.221 −8.230 35.431 1.00 18.86 A C ANISOU 839 CG LYS A 119 2605 2223 2673 −541 42 −144 A C SIGUIJ 839 CG LYS A 119 1 0 0 220 102 290 A C ATOM 840 CD LYS A 119 1.015 −7.886 34.493 1.00 20.61 A C ANISOU 840 CD LYS A 119 2753 4116 2776 −120 4 9 A C SIGUIJ 840 CD LYS A 119 1 0 0 220 101 290 A C ATOM 841 CE LYS A 119 1.219 −6.625 33.566 1.00 21.72 A C ANISOU 841 CE LYS A 119 12388 4128 2918 −702 1335 −104 A C SIGUIJ 841 CE LYS A 119 1 0 0 220 101 290 A C ATOM 842 NZ LYS A 119 0.012 −6.188 32.720 1.00 22.83 A N ANISOU 842 NZ LYS A 119 15093 9430 6830 1341 −1471 −282 A N SIGUIJ 842 NZ LYS A 119 1 0 0 221 61 289 A N ATOM 843 C LYS A 119 4.607 −7.439 37.305 1.00 15.59 A C ANISOU 843 C LYS A 119 1648 1253 1821 −207 −51 −38 A C SIGUIJ 843 C LYS A 119 1 0 0 220 101 290 A C ATOM 844 O LYS A 119 5.169 −6.306 37.257 1.00 15.70 A O ANISOU 844 O LYS A 119 1822 1301 2500 −310 −73 −4 A O SIGUIJ 844 O LYS A 119 1 0 0 221 54 289 A O ATOM 845 N LYS A 120 5.202 −8.532 36.877 1.00 14.95 A N ANISOU 845 N LYS A 120 1615 1235 1756 −241 −16 −21 A N SIGUIJ 845 N LYS A 120 1 0 0 221 61 289 A N ATOM 846 CA LYS A 120 6.481 −8.482 36.187 1.00 15.06 A C ANISOU 846 CA LYS A 120 1640 1387 1823 −226 23 20 A C SIGUIJ 846 CA LYS A 120 1 0 0 220 101 290 A C ATOM 847 CB LYS A 120 7.023 −9.919 36.034 1.00 15.87 A C ANISOU 847 CB LYS A 120 2003 1450 2116 −80 13 −2 A C SIGUIJ 847 CB LYS A 120 1 0 0 220 101 290 A C ATOM 848 CG LYS A 120 7.214 −10.634 37.396 1.00 17.11 A C ANISOU 848 CG LYS A 120 2185 1579 2148 −69 −15 47 A C SIGUIJ 848 CG LYS A 120 1 0 0 220 101 290 A C ATOM 849 CD LYS A 120 7.903 −12.032 37.231 1.00 19.27 A C ANISOU 849 CD LYS A 120 2483 1637 3342 40 265 32 A C SIGUIJ 849 CD LYS A 120 1 0 0 220 101 290 A C ATOM 850 CE LYS A 120 7.005 −13.100 36.616 1.00 20.80 A C ANISOU 850 CE LYS A 120 3181 2025 3841 −384 −22 −5 A C SIGUIJ 850 CE LYS A 120 1 0 0 220 101 290 A C ATOM 851 NZ LYS A 120 7.677 −14.431 36.757 1.00 22.64 A N ANISOU 851 NZ LYS A 120 4052 2242 5342 35 −275 13 A N SIGUIJ 851 NZ LYS A 120 1 0 0 221 61 289 A N ATOM 852 C LYS A 120 6.322 −7.836 34.835 1.00 14.75 A C ANISOU 852 C LYS A 120 1766 1360 1821 −282 −1 14 A C SIGUIJ 852 C LYS A 120 1 0 0 220 100 290 A C ATOM 853 O LYS A 120 5.385 −8.141 34.071 1.00 14.75 A O ANISOU 853 O LYS A 120 1794 1689 1830 −381 1 −4 A O SIGUIJ 853 O LYS A 120 1 0 0 221 54 289 A O ATOM 854 N VAL A 121 7.278 −6.993 34.497 1.00 13.48 A N ANISOU 854 N VAL A 121 1616 1143 1653 −106 −1 −3 A N SIGUIJ 854 N VAL A 121 1 0 0 221 61 289 A N ATOM 855 CA VAL A 121 7.253 −6.364 33.174 1.00 13.91 A C ANISOU 855 CA VAL A 121 1816 1210 1670 −227 −55 38 A C SIGUIJ 855 CA VAL A 121 1 0 0 220 100 290 A C ATOM 856 CB VAL A 121 8.314 −5.209 33.126 1.00 13.56 A C ANISOU 856 CB VAL A 121 1770 1166 1874 −183 −1 −1 A C SIGUIJ 856 CB VAL A 121 1 0 0 220 100 290 A C ATOM 857 CG1 VAL A 121 9.753 −5.773 32.994 1.00 13.96 A C ANISOU 857 CG1 VAL A 121 1784 1184 2409 −164 50 1 A C SIGUIJ 857 CG1 VAL A 121 1 0 0 220 100 290 A C ATOM 858 CG2 VAL A 121 7.983 −4.239 32.010 1.00 13.81 A C ANISOU 858 CG2 VAL A 121 1908 1183 1879 −146 −1 3 A C SIGUIJ 858 CG2 VAL A 121 1 0 0 220 100 290 A C ATOM 859 C VAL A 121 7.593 −7.395 32.072 1.00 14.19 A C ANISOU 859 C VAL A 121 1805 1241 1751 −314 16 −26 A C SIGUIJ 859 C VAL A 121 1 0 0 220 100 290 A C ATOM 860 O VAL A 121 8.297 −8.355 32.317 1.00 14.22 A O ANISOU 860 O VAL A 121 1970 1332 1922 −204 −9 12 A O SIGUIJ 860 O VAL A 121 1 0 0 221 54 289 A O ATOM 861 N ARG A 122 7.115 −7.145 30.859 1.00 15.04 A N ANISOU 861 N ARG A 122 1902 1439 1781 −380 −36 47 A N SIGUIJ 861 N ARG A 122 1 0 0 221 61 289 A N ATOM 862 CA ARG A 122 7.471 −7.987 29.718 1.00 16.06 A C ANISOU 862 CA ARG A 122 2015 1586 1913 −475 71 −103 A C SIGUIJ 862 CA ARG A 122 1 0 0 220 100 290 A C ATOM 863 CB ARG A 122 6.305 −8.073 28.739 1.00 17.68 A C ANISOU 863 CB ARG A 122 2071 2635 1977 −651 6 24 A C SIGUIJ 863 CB ARG A 122 1 0 0 220 100 290 A C ATOM 864 CG ARG A 122 6.544 −9.094 27.666 1.00 20.19 A C ANISOU 864 CG ARG A 122 3512 2743 2006 −306 3 −1 A C SIGUIJ 864 CG ARG A 122 1 0 0 220 100 290 A C ATOM 865 CD ARG A 122 5.253 −9.413 26.867 1.00 22.38 A C ANISOU 865 CD ARG A 122 4419 9397 2928 −2250 −689 483 A C SIGUIJ 865 CD ARG A 122 1 0 0 220 99 290 A C ATOM 866 NE ARG A 122 5.370 −10.389 25.762 1.00 24.54 A N ANISOU 866 NE ARG A 122 16521 10017 3336 −1114 −402 52 A N SIGUIJ 866 NE ARG A 122 1 0 0 221 61 289 A N ATOM 867 CZ ARG A 122 5.921 −11.604 25.812 1.00 25.24 A C ANISOU 867 CZ ARG A 122 19802 10702 6450 339 −866 −27 A C SIGUIJ 867 CZ ARG A 122 1 0 0 220 99 290 A C ATOM 868 NH1 ARG A 122 6.484 −12.073 26.931 1.00 26.18 A N ANISOU 868 NH1 ARG A 122 14276 11218 5120 412 1934 164 A N SIGUIJ 868 NH1 ARG A 122 1 0 0 221 61 289 A N ATOM 869 NH2 ARG A 122 5.850 −12.387 24.728 1.00 25.97 A N ANISOU 869 NH2 ARG A 122 5520 10676 6376 380 43 −11 A N SIGUIJ 869 NH2 ARG A 122 1 0 0 221 61 289 A N ATOM 870 C ARG A 122 8.683 −7.361 29.040 1.00 15.84 A C ANISOU 870 C ARG A 122 1947 1450 1847 −377 11 −15 A C SIGUIJ 870 C ARG A 122 1 0 0 220 99 290 A C ATOM 871 O ARG A 122 8.602 −6.251 28.425 1.00 15.65 A O ANISOU 871 O ARG A 122 2349 1468 1918 −374 −36 21 A O SIGUIJ 871 O ARG A 122 1 0 0 221 54 289 A O ATOM 872 N LEU A 123 9.801 −8.051 29.159 1.00 15.39 A N ANISOU 872 N LEU A 123 2119 1866 1765 −115 15 −5 A N SIGUIJ 872 N LEU A 123 1 0 0 221 61 289 A N ATOM 873 CA LEU A 123 11.038 −7.618 28.518 1.00 15.70 A C ANISOU 873 CA LEU A 123 2100 1663 1771 −34 16 −1 A C SIGUIJ 873 CA LEU A 123 1 0 0 220 99 290 A C ATOM 874 CB LEU A 123 12.221 −8.340 29.185 1.00 15.74 A C ANISOU 874 CB LEU A 123 2196 1845 1826 79 −20 −4 A C SIGUIJ 874 CB LEU A 123 1 0 0 220 99 290 A C ATOM 875 CG LEU A 123 12.488 −7.891 30.640 1.00 15.65 A C ANISOU 875 CG LEU A 123 2233 1901 1819 −18 −3 0 A C SIGUIJ 875 CG LEU A 123 1 0 0 220 99 290 A C ATOM 876 CD1 LEU A 123 13.577 −8.783 31.226 1.00 16.72 A C ANISOU 876 CD1 LEU A 123 3489 3126 2116 1193 −488 −401 A C SIGUIJ 876 CD1 LEU A 123 1 0 0 220 99 290 A C ATOM 877 CD2 LEU A 123 12.911 −6.437 30.715 1.00 16.26 A C ANISOU 877 CD2 LEU A 123 2186 1902 2056 −19 −2 0 A C SIGUIJ 877 CD2 LEU A 123 1 0 0 220 99 290 A C ATOM 878 C LEU A 123 10.950 −7.937 27.023 1.00 16.09 A C ANISOU 878 C LEU A 123 1925 1611 1775 59 8 2 A C SIGUIJ 878 C LEU A 123 1 0 0 220 99 290 A C ATOM 879 O LEU A 123 10.185 −8.833 26.592 1.00 16.40 A O ANISOU 879 O LEU A 123 2612 2183 1779 −574 96 −66 A O SIGUIJ 879 O LEU A 123 1 0 0 221 54 289 A O ATOM 880 N PRO A 124 11.700 −7.220 26.206 1.00 16.35 A N ANISOU 880 N PRO A 124 1978 1672 1766 −4 −4 0 A N SIGUIJ 880 N PRO A 124 1 0 0 221 61 289 A N ATOM 881 CD PRO A 124 12.624 −6.128 26.560 1.00 15.91 A C ANISOU 881 CD PRO A 124 2031 1734 1615 −73 78 −16 A C SIGUIJ 881 CD PRO A 124 1 0 0 220 99 290 A C ATOM 882 CA PRO A 124 11.586 −7.385 24.754 1.00 17.20 A C ANISOU 882 CA PRO A 124 2443 1676 1767 −42 −34 2 A C SIGUIJ 882 CA PRO A 124 1 0 0 220 98 290 A C ATOM 883 CB PRO A 124 12.208 −6.094 24.205 1.00 16.17 A C ANISOU 883 CB PRO A 124 2152 1605 1773 101 −16 −4 A C SIGUIJ 883 CB PRO A 124 1 0 0 220 98 290 A C ATOM 884 CG PRO A 124 13.248 −5.750 25.256 1.00 15.99 A C ANISOU 884 CG PRO A 124 2019 1617 1641 84 110 22 A C SIGUIJ 884 CG PRO A 124 1 0 0 220 98 290 A C ATOM 885 C PRO A 124 12.337 −8.618 24.267 1.00 18.28 A C ANISOU 885 C PRO A 124 3163 1858 1998 300 192 45 A C SIGUIJ 885 C PRO A 124 1 0 0 220 98 290 A C ATOM 886 O PRO A 124 13.386 −8.981 24.829 1.00 18.87 A O ANISOU 886 O PRO A 124 3346 1649 2602 279 −159 −43 A O SIGUIJ 886 O PRO A 124 1 0 0 221 54 289 A O ATOM 887 N SER A 125 11.791 −9.243 23.222 1.00 19.66 A N ANISOU 887 N SER A 125 3843 2018 2171 175 −77 −8 A N SIGUIJ 887 N SER A 125 1 0 0 221 61 289 A N ATOM 888 CA SER A 125 12.571 −10.203 22.419 1.00 20.69 A C ANISOU 888 CA SER A 125 4056 1869 2511 35 286 9 A C SIGUIJ 888 CA SER A 125 1 0 0 220 98 290 A C ATOM 889 CB SER A 125 11.778 −11.476 22.152 1.00 21.47 A C ANISOU 889 CB SER A 125 5812 2535 3271 −1022 117 −40 A C SIGUIJ 889 CB SER A 125 1 0 0 220 98 290 A C ATOM 890 OG SER A 125 10.598 −11.193 21.456 1.00 23.27 A O ANISOU 890 OG SER A 125 6259 3583 4621 −942 −609 247 A O SIGUIJ 890 OG SER A 125 1 0 0 221 54 289 A O ATOM 891 C SER A 125 13.076 −9.643 21.077 1.00 20.70 A C ANISOU 891 C SER A 125 4813 1956 2566 −188 474 −34 A C SIGUIJ 891 C SER A 125 1 0 0 220 98 290 A C ATOM 892 O SER A 125 13.944 −10.244 20.430 1.00 21.30 A O ANISOU 892 O SER A 125 4931 1911 2914 −268 699 −84 A O SIGUIJ 892 O SER A 125 1 0 0 221 54 289 A O ATOM 893 N ARG A 128 12.552 −8.492 20.667 1.00 20.62 A N ANISOU 893 N ARG A 128 4284 1853 2191 −355 662 −99 A N SIGUIJ 893 N ARG A 128 1 0 0 221 61 289 A N ATOM 894 CA ARG A 128 13.031 −7.806 19.477 1.00 20.32 A C ANISOU 894 CA ARG A 128 3194 1797 2110 −112 365 −34 A C SIGUIJ 894 CA ARG A 128 1 0 0 220 98 290 A C ATOM 895 CB ARG A 128 12.083 −8.091 18.318 1.00 21.53 A C ANISOU 895 CB ARG A 128 4473 2586 2833 −575 −573 171 A C SIGUIJ 895 CB ARG A 128 1 0 0 220 98 290 A C ATOM 896 CG ARG A 128 11.995 −9.586 17.993 1.00 23.54 A C ANISOU 896 CG ARG A 128 15334 2629 3423 −1034 −1494 123 A C SIGUIJ 896 CG ARG A 128 1 0 0 220 98 290 A C ATOM 897 CD ARG A 128 10.802 −9.845 17.097 1.00 24.98 A C ANISOU 897 CD ARG A 128 18087 12399 6545 −4248 −4147 1621 A C SIGUIJ 897 CD ARG A 128 1 0 0 220 97 290 A C ATOM 898 NE ARG A 128 10.637 −8.686 16.229 1.00 26.43 A N ANISOU 898 NE ARG A 128 19357 11868 3343 286 1652 51 A N SIGUIJ 898 NE ARG A 128 1 0 0 221 61 289 A N ATOM 899 CZ ARG A 128 11.441 −8.423 15.203 1.00 26.81 A C ANISOU 899 CZ ARG A 128 16526 8558 1782 1274 −336 −33 A C SIGUIJ 899 CZ ARG A 128 1 0 0 220 97 290 A C ATOM 900 NH1 ARG A 128 12.441 −9.269 14.965 1.00 27.32 A N ANISOU 900 NH1 ARG A 128 16054 7639 4806 508 437 23 A N SIGUIJ 900 NH1 ARG A 128 1 0 0 221 61 289 A N ATOM 901 NH2 ARG A 128 11.249 −7.338 14.434 1.00 26.86 A N ANISOU 901 NH2 ARG A 128 4057 8229 1749 −729 −40 3 A N SIGUIJ 901 NH2 ARG A 128 1 0 0 221 61 289 A N ATOM 902 C ARG A 128 13.053 −6.304 19.747 1.00 19.30 A C ANISOU 902 C ARG A 128 2695 1789 1719 −36 33 −1 A C SIGUIJ 902 C ARG A 128 1 0 0 220 97 290 A C ATOM 903 O ARG A 128 12.416 −5.831 20.708 1.00 19.07 A O ANISOU 903 O ARG A 128 2890 2004 1722 150 62 9 A O SIGUIJ 903 O ARG A 128 1 0 0 221 54 289 A O ATOM 904 N CYS A 129 13.757 −5.588 18.894 1.00 18.42 A N ANISOU 904 N CYS A 129 2557 1768 1672 7 −39 0 A N SIGUIJ 904 N CYS A 129 1 0 0 221 61 289 A N ATOM 905 CA CYS A 129 13.825 −4.124 18.956 1.00 17.61 A C ANISOU 905 CA CYS A 129 2220 1775 1665 23 −62 −3 A C SIGUIJ 905 CA CYS A 129 1 0 0 220 97 290 A C ATOM 906 C CYS A 129 12.751 −3.513 18.078 1.00 17.14 A C ANISOU 906 C CYS A 129 2128 1964 1479 75 88 28 A C SIGUIJ 906 C CYS A 129 1 0 0 220 97 290 A C ATOM 907 O CYS A 129 12.690 −3.773 16.860 1.00 17.35 A O ANISOU 907 O CYS A 129 2814 2211 1492 197 16 3 A O SIGUIJ 907 O CYS A 129 1 0 0 221 54 289 A O ATOM 908 CB CYS A 129 15.170 −3.684 18.428 1.00 17.49 A C ANISOU 908 CB CYS A 129 2202 1672 1772 57 −59 −7 A C SIGUIJ 908 CB CYS A 129 1 0 0 220 97 290 A C ATOM 909 SG CYS A 129 16.567 −4.357 19.370 1.00 17.33 A S ANISOU 909 SG CYS A 129 2527 2258 1937 480 −253 −185 A S SIGUIJ 909 SG CYS A 129 1 0 0 221 48 289 A S ATOM 910 N GLU A 130 11.875 −2.719 18.655 1.00 16.42 A N ANISOU 910 N GLU A 130 1991 1922 1399 −6 22 −1 A N SIGUIJ 910 N GLU A 130 1 0 0 221 61 289 A N ATOM 911 CA GLU A 130 10.879 −2.008 17.822 1.00 16.19 A C ANISOU 911 CA GLU A 130 2000 1988 1415 −1 −3 0 A C SIGUIJ 911 CA GLU A 130 1 0 0 220 97 290 A C ATOM 912 CB GLU A 130 9.741 −1.429 18.687 1.00 16.86 A C ANISOU 912 CB GLU A 130 2205 2773 1438 392 14 2 A C SIGUIJ 912 CB GLU A 130 1 0 0 220 97 290 A C ATOM 913 CG GLU A 130 8.808 −2.483 19.317 1.00 19.01 A C ANISOU 913 CG GLU A 130 2557 3102 1342 33 −56 −6 A C SIGUIJ 913 CG GLU A 130 1 0 0 220 97 290 A C ATOM 914 CD GLU A 130 7.994 −3.328 18.339 1.00 19.91 A C ANISOU 914 CD GLU A 130 3068 3337 1719 −65 −404 −104 A C SIGUIJ 914 CD GLU A 130 1 0 0 220 97 290 A C ATOM 915 OE1 GLU A 130 7.833 −2.865 17.179 1.00 20.94 A O ANISOU 915 OE1 GLU A 130 2710 3803 1799 −221 −414 82 A O SIGUIJ 915 OE1 GLU A 130 1 0 0 221 54 289 A O ATOM 916 OE2 GLU A 130 7.530 −4.438 18.743 1.00 21.75 A O ANISOU 916 OE2 GLU A 130 4740 3706 2415 −733 −335 139 A O SIGUIJ 916 OE2 GLU A 130 1 0 0 221 54 289 A O ATOM 917 C GLU A 130 11.549 −0.890 17.037 1.00 15.24 A C ANISOU 917 C GLU A 130 1918 1991 1348 10 −50 3 A C SIGUIJ 917 C GLU A 130 1 0 0 220 96 290 A C ATOM 918 O GLU A 130 12.429 −0.227 17.555 1.00 15.46 A O ANISOU 918 O GLU A 130 1999 2010 1554 0 −184 11 A O SIGUIJ 918 O GLU A 130 1 0 0 221 54 289 A O ATOM 919 N PRO A 131 11.143 −0.677 15.749 1.00 14.49 A N ANISOU 919 N PRO A 131 1826 2049 1323 37 −4 0 A N SIGUIJ 919 N PRO A 131 1 0 0 221 61 289 A N ATOM 920 CD PRO A 131 10.218 −1.515 14.966 1.00 14.56 A C ANISOU 920 CD PRO A 131 1943 2110 1393 −15 −84 −2 A C SIGUIJ 920 CD PRO A 131 1 0 0 220 96 290 A C ATOM 921 CA PRO A 131 11.842 0.294 14.898 1.00 13.90 A C ANISOU 921 CA PRO A 131 1928 2069 1341 14 47 −3 A C SIGUIJ 921 CA PRO A 131 1 0 0 220 96 290 A C ATOM 922 CB PRO A 131 11.461 −0.116 13.495 1.00 14.54 A C ANISOU 922 CB PRO A 131 2366 1951 1375 130 −87 −18 A C SIGUIJ 922 CB PRO A 131 1 0 0 220 96 290 A C ATOM 923 CG PRO A 131 10.119 −0.726 13.664 1.00 14.36 A C ANISOU 923 CG PRO A 131 2401 2105 1378 58 −81 −11 A C SIGUIJ 923 CG PRO A 131 1 0 0 220 96 290 A C ATOM 924 C PRO A 131 11.405 1.728 15.135 1.00 13.68 A C ANISOU 924 C PRO A 131 1793 2075 1235 7 −59 −1 A C SIGUIJ 924 C PRO A 131 1 0 0 220 96 290 A C ATOM 925 O PRO A 131 10.293 1.971 15.604 1.00 13.49 A O ANISOU 925 O PRO A 131 1786 2141 1185 17 −73 −7 A O SIGUIJ 925 O PRO A 131 1 0 0 221 54 289 A O ATOM 926 N PRO A 132 12.236 2.678 14.727 1.00 13.65 A N ANISOU 926 N PRO A 132 1761 2065 1241 31 −62 1 A N SIGUIJ 926 N PRO A 132 1 0 0 221 61 289 A N ATOM 927 CD PRO A 132 13.662 2.507 14.308 1.00 13.98 A C ANISOU 927 CD PRO A 132 1800 2434 1629 75 49 2 A C SIGUIJ 927 CD PRO A 132 1 0 0 220 96 290 A C ATOM 928 CA PRO A 132 11.820 4.055 14.586 1.00 13.24 A C ANISOU 928 CA PRO A 132 1713 2054 1338 9 −165 −9 A C SIGUIJ 928 CA PRO A 132 1 0 0 220 96 290 A C ATOM 929 CB PRO A 132 12.975 4.692 13.777 1.00 13.98 A C ANISOU 929 CB PRO A 132 1910 2297 1630 −115 22 −1 A C SIGUIJ 929 CB PRO A 132 1 0 0 220 96 290 A C ATOM 930 CG PRO A 132 14.175 3.851 14.183 1.00 13.59 A C ANISOU 930 CG PRO A 132 1983 2462 1533 0 47 −1 A C SIGUIJ 930 CG PRO A 132 1 0 0 220 96 290 A C ATOM 931 C PRO A 132 10.480 4.149 13.876 1.00 13.22 A C ANISOU 931 C PRO A 132 1672 1663 1185 0 −83 −1 A C SIGUIJ 931 C PRO A 132 1 0 0 220 95 290 A C ATOM 932 O PRO A 132 10.202 3.377 12.911 1.00 12.65 A O ANISOU 932 O PRO A 132 1839 1675 1185 −16 −117 3 A O SIGUIJ 932 O PRO A 132 1 0 0 221 54 289 A O ATOM 933 N GLY A 133 9.649 5.097 14.310 1.00 12.65 A N ANISOU 933 N GLY A 133 1647 1646 1150 0 −123 −6 A N SIGUIJ 933 N GLY A 133 1 0 0 221 61 289 A N ATOM 934 CA GLY A 133 8.320 5.258 13.755 1.00 12.67 A C ANISOU 934 CA GLY A 133 1649 1779 1108 20 −106 8 A C SIGUIJ 934 CA GLY A 133 1 0 0 220 95 290 A C ATOM 935 C GLY A 133 7.225 4.581 14.547 1.00 12.73 A C ANISOU 935 C GLY A 133 1724 1811 1198 −9 −33 −1 A C SIGUIJ 935 C GLY A 133 1 0 0 220 95 290 A C ATOM 936 O GLY A 133 6.042 4.877 14.319 1.00 13.38 A O ANISOU 936 O GLY A 133 1756 2135 1334 80 −53 −1 A O SIGUIJ 936 O GLY A 133 1 0 0 221 54 289 A O ATOM 937 N THR A 134 7.600 3.704 15.477 1.00 13.30 A N ANISOU 937 N THR A 134 1756 1820 1198 −2 −27 −1 A N SIGUIJ 937 N THR A 134 1 0 0 221 61 289 A N ATOM 938 CA THR A 134 6.617 3.030 16.301 1.00 13.30 A C ANISOU 938 CA THR A 134 1731 1806 1200 3 −37 1 A C SIGUIJ 938 CA THR A 134 1 0 0 220 95 290 A C ATOM 939 CB THR A 134 7.235 1.798 16.938 1.00 13.36 A C ANISOU 939 CB THR A 134 1759 1787 1244 −6 −84 −12 A C SIGUIJ 939 CB THR A 134 1 0 0 220 95 290 A C ATOM 940 OG1 THR A 134 7.779 0.970 15.916 1.00 13.52 A O ANISOU 940 OG1 THR A 134 2156 1751 1418 −86 199 −33 A O SIGUIJ 940 OG1 THR A 134 1 0 0 221 54 289 A O ATOM 941 CG2 THR A 134 6.197 0.987 17.718 1.00 14.12 A C ANISOU 941 CG2 THR A 134 2547 2022 1879 −383 580 −260 A C SIGUIJ 941 CG2 THR A 134 1 0 0 220 95 290 A C ATOM 942 C THR A 134 6.095 3.992 17.394 1.00 13.61 A C ANISOU 942 C THR A 134 1677 1805 1200 −4 −46 −1 A C SIGUIJ 942 C THR A 134 1 0 0 220 95 290 A C ATOM 943 O THR A 134 6.886 4.678 18.065 1.00 12.95 A O ANISOU 943 O THR A 134 1695 1805 1240 −11 −73 −6 A O SIGUIJ 943 O THR A 134 1 0 0 221 54 289 A O ATOM 944 N THR A 135 4.776 4.050 17.591 1.00 13.92 A N ANISOU 944 N THR A 135 1678 2130 1187 2 −57 −5 A N SIGUIJ 944 N THR A 135 1 0 0 221 61 289 A N ATOM 945 CA THR A 135 4.168 4.738 18.736 1.00 14.83 A C ANISOU 945 CA THR A 135 1958 2083 1256 −16 104 9 A C SIGUIJ 945 CA THR A 135 1 0 0 220 95 290 A C ATOM 946 CB THR A 135 2.654 4.998 18.466 1.00 15.90 A C ANISOU 946 CB THR A 135 2026 3624 1838 264 −17 −14 A C SIGUIJ 946 CB THR A 135 1 0 0 220 95 290 A C ATOM 947 OG1 THR A 135 2.510 5.931 17.384 1.00 18.22 A O ANISOU 947 OG1 THR A 135 3170 3640 1940 −12 −413 38 A O SIGUIJ 947 OG1 THR A 135 1 0 0 221 54 289 A O ATOM 948 CG2 THR A 135 1.994 5.573 19.688 1.00 17.09 A C ANISOU 948 CG2 THR A 135 2150 3585 1851 292 31 13 A C SIGUIJ 948 CG2 THR A 135 1 0 0 220 95 290 A C ATOM 949 C THR A 135 4.320 3.966 20.031 1.00 14.33 A C ANISOU 949 C THR A 135 1624 1974 1241 −200 52 −19 A C SIGUIJ 949 C THR A 135 1 0 0 220 95 290 A C ATOM 950 O THR A 135 4.113 2.746 20.078 1.00 14.51 A O ANISOU 950 O THR A 135 2619 2002 1444 −383 77 −31 A O SIGUIJ 950 O THR A 135 1 0 0 221 54 289 A O ATOM 951 N CYS A 136 4.776 4.666 21.062 1.00 13.59 A N ANISOU 951 N CYS A 136 1558 1773 1249 −12 −20 −1 A N SIGUIJ 951 N CYS A 136 1 0 0 221 61 289 A N ATOM 952 CA CYS A 136 5.015 4.065 22.378 1.00 13.33 A C ANISOU 952 CA CYS A 136 1554 1725 1237 101 28 −5 A C SIGUIJ 952 CA CYS A 136 1 0 0 220 94 290 A C ATOM 953 C CYS A 136 4.471 4.964 23.473 1.00 12.46 A C ANISOU 953 C CYS A 136 1464 1601 1229 0 37 2 A C SIGUIJ 953 C CYS A 136 1 0 0 220 94 290 A C ATOM 954 O CYS A 136 4.032 6.090 23.209 1.00 12.45 A O ANISOU 954 O CYS A 136 1879 1656 1331 157 112 44 A O SIGUIJ 954 O CYS A 136 1 0 0 221 54 289 A O ATOM 955 CB CYS A 136 6.509 3.869 22.590 1.00 14.29 A C ANISOU 955 CB CYS A 136 1573 2489 1431 233 0 0 A C SIGUIJ 955 CB CYS A 136 1 0 0 220 94 290 A C ATOM 956 SG CYS A 136 7.367 3.000 21.237 1.00 16.81 A S ANISOU 956 SG CYS A 136 2525 2969 1554 833 250 66 A S SIGUIJ 956 SG CYS A 136 1 0 0 221 48 289 A S ATOM 957 N THR A 137 4.529 4.464 24.723 1.00 11.20 A N ANISOU 957 N THR A 137 1477 1553 1216 −9 18 1 A N SIGUIJ 957 N THR A 137 1 0 0 221 61 289 A N ATOM 958 CA THR A 137 4.042 5.275 25.863 1.00 11.13 A C ANISOU 958 CA THR A 137 1388 1566 1178 −4 −44 −4 A C SIGUIJ 958 CA THR A 137 1 0 0 220 94 290 A C ATOM 959 CB THR A 137 2.808 4.631 26.475 1.00 11.38 A C ANISOU 959 CB THR A 137 1492 1805 1290 −120 28 −6 A C SIGUIJ 959 CB THR A 137 1 0 0 220 94 290 A C ATOM 960 OG1 THR A 137 1.772 4.518 25.474 1.00 12.96 A O ANISOU 960 OG1 THR A 137 1690 2319 1457 −189 −148 9 A O SIGUIJ 960 OG1 THR A 137 1 0 0 221 54 289 A O ATOM 961 CG2 THR A 137 2.294 5.460 27.644 1.00 12.06 A C ANISOU 961 CG2 THR A 137 1591 1848 1280 −27 3 0 A C SIGUIJ 961 CG2 THR A 137 1 0 0 220 94 290 A C ATOM 962 C THR A 137 5.114 5.316 26.922 1.00 10.72 A C ANISOU 962 C THR A 137 1358 1288 1131 −10 −4 0 A C SIGUIJ 962 C THR A 137 1 0 0 220 94 290 A C ATOM 963 O THR A 137 5.701 4.302 27.259 1.00 10.60 A O ANISOU 963 O THR A 137 1439 1299 1274 23 −53 −8 A O SIGUIJ 963 O THR A 137 1 0 0 221 54 289 A O ATOM 964 N AVAL A 138 5.393 6.508 27.426 0.50 10.12 A N ANISOU 964 N AVAL A 138 1211 1281 1094 8 −3 0 A N SIGUIJ 964 N AVAL A 138 1 0 0 221 60 289 A N ATOM 965 N BVAL A 138 5.385 6.512 27.428 0.50 12.31 A N ANISOU 965 N BVAL A 138 1443 1286 1103 −4 −40 1 A N SIGUIJ 965 N BVAL A 138 1 0 0 221 60 289 A N ATOM 966 CA AVAL A 138 6.324 6.704 28.549 0.50 10.10 A C ANISOU 966 CA AVAL A 138 1182 1254 1073 6 9 0 A C SIGUIJ 966 CA AVAL A 138 1 0 0 220 94 290 A C ATOM 967 CA BVAL A 138 6.312 6.716 28.551 0.50 12.29 A C ANISOU 967 CA BVAL A 138 1531 1444 1157 15 −118 −14 A C SIGUIJ 967 CA BVAL A 138 1 0 0 220 94 290 A C ATOM 968 CB AVAL A 138 7.508 7.655 28.165 0.50 10.53 A C ANISOU 968 CB AVAL A 138 1183 1243 957 10 −16 1 A C SIGUIJ 968 CB AVAL A 138 1 0 0 220 94 290 A C ATOM 969 CB BVAL A 138 7.386 7.752 28.218 0.50 12.72 A C ANISOU 969 CB BVAL A 138 1606 1489 1617 −11 0 0 A C SIGUIJ 969 CB BVAL A 138 1 0 0 220 94 290 A C ATOM 970 CG1 AVAL A 138 7.015 9.028 27.740 0.50 12.13 A C ANISOU 970 CG1 AVAL A 138 842 1196 916 −110 −4 −3 A C SIGUIJ 970 CG1 AVAL A 138 1 0 0 220 93 290 A C ATOM 971 CG1 BVAL A 138 8.402 7.849 29.353 0.50 14.32 A C ANISOU 971 CG1 BVAL A 138 1610 1933 1620 −51 0 0 A C SIGUIJ 971 CG1 BVAL A 138 1 0 0 220 93 290 A C ATOM 972 CG2 AVAL A 138 8.490 7.746 29.329 0.50 11.37 A C ANISOU 972 CG2 AVAL A 138 1172 1688 941 −47 5 0 A C SIGUIJ 972 CG2 AVAL A 138 1 0 0 220 93 290 A C ATOM 973 CG2 BVAL A 138 8.073 7.365 26.963 0.50 13.56 A C ANISOU 973 CG2 BVAL A 138 1626 1632 1622 1 0 0 A C SIGUIJ 973 CG2 BVAL A 138 1 0 0 220 93 290 A C ATOM 974 C AVAL A 138 5.531 7.206 29.743 0.50 9.50 A C ANISOU 974 C AVAL A 138 1136 1216 1080 −7 6 0 A C SIGUIJ 974 C AVAL A 138 1 0 0 220 93 290 A C ATOM 975 C BVAL A 138 5.507 7.183 29.746 0.50 11.69 A C ANISOU 975 C BVAL A 138 1477 1210 1138 −57 −117 21 A C SIGUIJ 975 C BVAL A 138 1 0 0 220 93 290 A C ATOM 976 O AVAL A 138 4.578 7.983 29.589 0.50 9.79 A O ANISOU 976 O AVAL A 138 1151 1246 1524 11 −36 3 A O SIGUIJ 976 O AVAL A 138 1 0 0 221 54 289 A O ATOM 977 O BVAL A 138 4.527 7.927 29.600 0.50 11.98 A O ANISOU 977 O BVAL A 138 1549 1334 1002 40 −111 −13 A O SIGUIJ 977 O BVAL A 138 1 0 0 221 54 289 A O ATOM 978 N SER A 139 5.937 6.742 30.928 1.00 9.56 A N ANISOU 978 N SER A 139 1291 1221 1099 −1 −38 0 A N SIGUIJ 978 N SER A 139 1 0 0 221 60 289 A N ATOM 979 CA SER A 139 5.170 7.005 32.131 1.00 9.54 A C ANISOU 979 CA SER A 139 1324 1237 1118 8 −24 −2 A C SIGUIJ 979 CA SER A 139 1 0 0 220 93 290 A C ATOM 980 CB SER A 139 4.269 5.812 32.461 1.00 10.03 A C ANISOU 980 CB SER A 139 1401 1270 1287 −34 10 −3 A C SIGUIJ 980 CB SER A 139 1 0 0 220 93 290 A C ATOM 981 OG SER A 139 5.003 4.617 32.481 1.00 11.51 A O ANISOU 981 OG SER A 139 1459 1292 1644 −1 33 1 A O SIGUIJ 981 OG SER A 139 1 0 0 221 54 289 A O ATOM 982 C SER A 139 6.078 7.354 33.297 1.00 9.22 A C ANISOU 982 C SER A 139 1253 1054 1087 66 23 8 A C SIGUIJ 982 C SER A 139 1 0 0 220 93 290 A C ATOM 983 O SER A 139 7.224 6.867 33.392 1.00 9.85 A O ANISOU 983 O SER A 139 1281 1163 1307 117 0 4 A O SIGUIJ 983 O SER A 139 1 0 0 221 54 289 A O ATOM 984 N GLY A 140 5.572 8.185 34.207 1.00 9.08 A N ANISOU 984 N GLY A 140 1119 1029 1087 −4 −2 0 A N SIGUIJ 984 N GLY A 140 1 0 0 221 60 289 A N ATOM 985 CA GLY A 140 6.380 8.522 35.357 1.00 8.65 A C ANISOU 985 CA GLY A 140 1095 1033 1083 −2 1 0 A C SIGUIJ 985 CA GLY A 140 1 0 0 220 93 290 A C ATOM 986 C GLY A 140 5.665 9.494 36.268 1.00 8.84 A C ANISOU 986 C GLY A 140 1080 1012 1076 13 0 0 A C SIGUIJ 986 C GLY A 140 1 0 0 220 93 290 A C ATOM 987 O GLY A 140 4.631 10.083 35.912 1.00 9.20 A O ANISOU 987 O GLY A 140 1154 1180 1100 132 0 2 A O SIGUIJ 987 O GLY A 140 1 0 0 221 54 289 A O ATOM 988 N TRP A 141 6.298 9.713 37.416 1.00 8.37 A N ANISOU 988 N TRP A 141 1068 998 1071 1 0 0 A N SIGUIJ 988 N TRP A 141 1 0 0 221 60 289 A N ATOM 989 CA TRP A 141 5.861 10.711 38.419 1.00 8.42 A C ANISOU 989 CA TRP A 141 1159 1028 1085 39 2 1 A C SIGUIJ 989 CA TRP A 141 1 0 0 220 92 290 A C ATOM 990 CB TRP A 141 5.863 10.071 39.821 1.00 8.68 A C ANISOU 990 CB TRP A 141 1235 1071 1094 −6 −19 1 A C SIGUIJ 990 CB TRP A 141 1 0 0 220 92 290 A C ATOM 991 CG TRP A 141 4.815 9.037 40.046 1.00 9.31 A C ANISOU 991 CG TRP A 141 1259 1093 1260 −23 0 0 A C SIGUIJ 991 CG TRP A 141 1 0 0 220 92 290 A C ATOM 992 CD2 TRP A 141 4.973 7.599 40.033 1.00 9.94 A C ANISOU 992 CD2 TRP A 141 1400 1092 1238 −27 −19 2 A C SIGUIJ 992 CD2 TRP A 141 1 0 0 220 92 290 A C ATOM 993 CE2 TRP A 141 3.721 7.036 40.431 1.00 10.38 A C ANISOU 993 CE2 TRP A 141 1454 1293 1265 −130 −3 2 A C SIGUIJ 993 CE2 TRP A 141 1 0 0 220 92 290 A C ATOM 994 CE3 TRP A 141 6.041 6.729 39.721 1.00 10.05 A C ANISOU 994 CE3 TRP A 141 1450 1194 1146 55 −80 −15 A C SIGUIJ 994 CE3 TRP A 141 1 0 0 220 92 290 A C ATOM 995 CD1 TRP A 141 3.527 9.252 40.428 1.00 10.23 A C ANISOU 995 CD1 TRP A 141 1255 1266 1297 −1 −2 0 A C SIGUIJ 995 CD1 TRP A 141 1 0 0 220 92 290 A C ATOM 996 NE1 TRP A 141 2.851 8.071 40.672 1.00 10.13 A N ANISOU 996 NE1 TRP A 141 1458 1320 1352 −122 21 −17 A N SIGUIJ 996 NE1 TRP A 141 1 0 0 221 60 289 A N ATOM 997 CZ2 TRP A 141 3.529 5.643 40.519 1.00 10.92 A C ANISOU 997 CZ2 TRP A 141 1913 1299 1413 −192 −119 38 A C SIGUIJ 997 CZ2 TRP A 141 1 0 0 220 92 290 A C ATOM 998 CZ3 TRP A 141 5.811 5.348 39.810 1.00 10.75 A C ANISOU 998 CZ3 TRP A 141 1928 1208 1483 −30 −130 8 A C SIGUIJ 998 CZ3 TRP A 141 1 0 0 220 92 290 A C ATOM 999 CH2 TRP A 141 4.561 4.850 40.207 1.00 11.25 A C ANISOU 999 CH2 TRP A 141 1969 1395 1465 −113 −126 25 A C SIGUIJ 999 CH2 TRP A 141 1 0 0 220 92 290 A C ATOM 1000 C TRP A 141 6.775 11.907 38.430 1.00 9.04 A C ANISOU 1000 C TRP A 141 1142 1016 1281 54 −4 0 A C SIGUIJ 1000 C TRP A 141 1 0 0 220 92 290 A C ATOM 1001 O TRP A 141 6.708 12.694 39.416 1.00 9.10 A O ANISOU 1001 O TRP A 141 1424 1075 1289 135 −48 −30 A O SIGUIJ 1001 O TRP A 141 1 0 0 221 54 289 A O ATOM 1002 N GLY A 142 7.582 12.103 37.387 1.00 8.85 A N ANISOU 1002 N GLY A 142 1106 950 1270 30 −28 −1 A N SIGUIJ 1002 N GLY A 142 1 0 0 221 60 289 A N ATOM 1003 CA GLY A 142 8.438 13.273 37.308 1.00 9.39 A C ANISOU 1003 CA GLY A 142 1130 971 1490 7 −14 0 A C SIGUIJ 1003 CA GLY A 142 1 0 0 220 92 290 A C ATOM 1004 C GLY A 142 7.624 14.567 37.182 1.00 9.80 A C ANISOU 1004 C GLY A 142 1139 988 1262 15 4 0 A C SIGUIJ 1004 C GLY A 142 1 0 0 220 91 290 A C ATOM 1005 O GLY A 142 6.425 14.609 37.001 1.00 9.72 A O ANISOU 1005 O GLY A 142 1138 1093 1291 4 −6 0 A O SIGUIJ 1005 O GLY A 142 1 0 0 221 54 289 A O ATOM 1006 N THR A 143 8.368 15.669 37.165 1.00 9.84 A N ANISOU 1006 N THR A 143 1165 993 1462 11 17 0 A N SIGUIJ 1006 N THR A 143 1 0 0 221 60 289 A N ATOM 1007 CA THR A 143 7.699 16.969 37.095 1.00 10.27 A C ANISOU 1007 CA THR A 143 1258 1018 1345 54 3 −1 A C SIGUIJ 1007 CA THR A 143 1 0 0 220 91 290 A C ATOM 1008 CB THR A 143 8.746 18.084 37.231 1.00 10.32 A C ANISOU 1008 CB THR A 143 1204 970 1652 102 −17 0 A C SIGUIJ 1008 CB THR A 143 1 0 0 220 91 290 A C ATOM 1009 OG1 THR A 143 8.063 19.358 37.259 1.00 9.98 A O ANISOU 1009 OG1 THR A 143 1329 1005 1727 174 −10 1 A O SIGUIJ 1009 OG1 THR A 143 1 0 0 221 54 289 A O ATOM 1010 CG2 THR A 143 9.814 18.077 36.102 1.00 11.20 A C ANISOU 1010 CG2 THR A 143 1556 1474 1984 −12 329 −83 A C SIGUIJ 1010 CG2 THR A 143 1 0 0 220 91 290 A C ATOM 1011 C THR A 143 6.907 17.091 35.796 1.00 9.85 A C ANISOU 1011 C THR A 143 1261 1021 1340 16 −3 0 A C SIGUIJ 1011 C THR A 143 1 0 0 220 91 290 A C ATOM 1012 O THR A 143 7.319 16.587 34.723 1.00 10.01 A O ANISOU 1012 O THR A 143 1366 1051 1335 64 2 2 A O SIGUIJ 1012 O THR A 143 1 0 0 221 54 289 A O ATOM 1013 N THR A 144 5.791 17.825 35.914 1.00 10.36 A N ANISOU 1013 N THR A 144 1238 1002 1364 −10 6 0 A N SIGUIJ 1013 N THR A 144 1 0 0 221 60 289 A N ATOM 1014 CA THR A 144 4.945 18.147 34.775 1.00 10.86 A C ANISOU 1014 CA THR A 144 1287 1167 1390 23 −21 1 A C SIGUIJ 1014 CA THR A 144 1 0 0 220 91 290 A C ATOM 1015 CB THR A 144 3.454 17.993 35.145 1.00 10.86 A C ANISOU 1015 CB THR A 144 1301 1280 1505 2 14 0 A C SIGUIJ 1015 CB THR A 144 1 0 0 220 91 290 A C ATOM 1016 OG1 THR A 144 3.194 18.895 36.245 1.00 11.34 A O ANISOU 1016 OG1 THR A 144 1482 1318 1493 112 0 −2 A O SIGUIJ 1016 OG1 THR A 144 1 0 0 221 54 289 A O ATOM 1017 CG2 THR A 144 3.171 16.582 35.580 1.00 11.09 A C ANISOU 1017 CG2 THR A 144 1458 1289 1506 −29 2 0 A C SIGUIJ 1017 CG2 THR A 144 1 0 0 220 91 290 A C ATOM 1018 C THR A 144 5.183 19.524 34.244 1.00 11.05 A C ANISOU 1018 C THR A 144 1315 1164 1433 14 −2 0 A C SIGUIJ 1018 C THR A 144 1 0 0 220 91 290 A C ATOM 1019 O THR A 144 4.545 19.931 33.272 1.00 11.42 A O ANISOU 1019 O THR A 144 1681 1258 1494 202 −153 −83 A O SIGUIJ 1019 O THR A 144 1 0 0 221 54 289 A O ATOM 1020 N THR A 145 6.052 20.279 34.904 1.00 11.43 A N ANISOU 1020 N THR A 145 1298 1103 1471 30 1 0 A N SIGUIJ 1020 N THR A 145 1 0 0 221 60 289 A N ATOM 1021 CA THR A 145 6.405 21.640 34.524 1.00 12.02 A C ANISOU 1021 CA THR A 145 1643 1128 1554 −73 3 −1 A C SIGUIJ 1021 CA THR A 145 1 0 0 220 91 290 A C ATOM 1022 CB THR A 145 5.840 22.676 35.533 1.00 11.75 A C ANISOU 1022 CB THR A 145 1687 1177 1583 0 −1 0 A C SIGUIJ 1022 CB THR A 145 1 0 0 220 91 290 A C ATOM 1023 OG1 THR A 145 6.301 22.372 36.851 1.00 12.15 A O ANISOU 1023 OG1 THR A 145 1658 1383 1594 119 2 2 A O SIGUIJ 1023 OG1 THR A 145 1 0 0 221 54 289 A O ATOM 1024 CG2 THR A 145 4.316 22.694 35.480 1.00 12.43 A C ANISOU 1024 CG2 THR A 145 1686 1575 2121 14 −22 −1 A C SIGUIJ 1024 CG2 THR A 145 1 0 0 220 91 290 A C ATOM 1025 C THR A 145 7.915 21.777 34.499 1.00 13.22 A C ANISOU 1025 C THR A 145 1651 1148 1958 −98 35 2 A C SIGUIJ 1025 C THR A 145 1 0 0 220 90 290 A C ATOM 1026 O THR A 145 8.640 21.001 35.108 1.00 12.96 A O ANISOU 1026 O THR A 145 1572 1279 1698 39 312 39 A O SIGUIJ 1026 O THR A 145 1 0 0 221 54 289 A O ATOM 1027 N SER A 146 8.396 22.805 33.789 1.00 14.32 A N ANISOU 1027 N SER A 146 2081 1240 1923 −316 13 −12 A N SIGUIJ 1027 N SER A 146 1 0 0 221 60 289 A N ATOM 1028 CA SER A 146 9.827 23.078 33.778 1.00 15.69 A C ANISOU 1028 CA SER A 146 2077 1369 2390 −354 29 5 A C SIGUIJ 1028 CA SER A 146 1 0 0 220 90 290 A C ATOM 1029 CB SER A 146 10.531 22.074 32.828 1.00 15.13 A C ANISOU 1029 CB SER A 146 1955 1414 2348 −341 −53 −21 A C SIGUIJ 1029 CB SER A 146 1 0 0 220 90 290 A C ATOM 1030 OG SER A 146 11.947 22.136 32.948 1.00 15.26 A O ANISOU 1030 OG SER A 146 1947 1494 1868 −352 −10 15 A O SIGUIJ 1030 OG SER A 146 1 0 0 221 54 289 A O ATOM 1031 C SER A 146 10.016 24.529 33.296 1.00 16.96 A C ANISOU 1031 C SER A 146 2270 1385 2791 −317 274 89 A C SIGUIJ 1031 C SER A 146 1 0 0 220 90 290 A C ATOM 1032 O SER A 146 9.317 24.943 32.402 1.00 17.83 A O ANISOU 1032 O SER A 146 2835 1765 2966 26 −7 1 A O SIGUIJ 1032 O SER A 146 1 0 0 221 54 289 A O ATOM 1033 N PRO A 147 10.984 25.281 33.888 1.00 18.13 A N ANISOU 1033 N PRO A 147 2614 1723 3238 −579 48 25 A N SIGUIJ 1033 N PRO A 147 1 0 0 221 60 289 A N ATOM 1034 CD PRO A 147 11.203 26.695 33.477 1.00 18.57 A C ANISOU 1034 CD PRO A 147 3321 1758 3547 −694 35 114 A C SIGUIJ 1034 CD PRO A 147 1 0 0 220 90 290 A C ATOM 1035 CA PRO A 147 11.935 24.865 34.919 1.00 18.91 A C ANISOU 1035 CA PRO A 147 2366 1635 3105 −710 235 100 A C SIGUIJ 1035 CA PRO A 147 1 0 0 220 90 290 A C ATOM 1036 CB PRO A 147 13.038 25.941 34.860 1.00 18.92 A C ANISOU 1036 CB PRO A 147 2746 2035 3761 −1103 220 172 A C SIGUIJ 1036 CB PRO A 147 1 0 0 220 90 290 A C ATOM 1037 CG PRO A 147 12.247 27.120 34.449 1.00 19.82 A C ANISOU 1037 CG PRO A 147 3386 2206 3649 −752 −3 −16 A C SIGUIJ 1037 CG PRO A 147 1 0 0 220 90 290 A C ATOM 1038 C PRO A 147 11.384 24.714 36.329 1.00 19.36 A C ANISOU 1038 C PRO A 147 2281 1841 3094 −744 184 101 A C SIGUIJ 1038 C PRO A 147 1 0 0 220 90 290 A C ATOM 1039 O PRO A 147 12.027 24.088 37.151 1.00 20.21 A O ANISOU 1039 O PRO A 147 3189 2435 3163 −54 1 −1 A O SIGUIJ 1039 O PRO A 147 1 0 0 221 54 289 A O ATOM 1040 N ASP A 148 10.199 25.273 36.593 1.00 19.73 A N ANISOU 1040 N ASP A 148 2484 2886 2571 −251 4 5 A N SIGUIJ 1040 N ASP A 148 1 0 0 221 60 289 A N ATOM 1041 CA ASP A 148 9.538 25.134 37.886 1.00 19.78 A C ANISOU 1041 CA ASP A 148 2418 2110 2565 −14 −6 0 A C SIGUIJ 1041 CA ASP A 148 1 0 0 220 90 290 A C ATOM 1042 CB ASP A 148 8.234 25.937 37.938 1.00 21.32 A C ANISOU 1042 CB ASP A 148 2480 2280 3978 85 55 10 A C SIGUIJ 1042 CB ASP A 148 1 0 0 220 90 290 A C ATOM 1043 CG ASP A 148 8.457 27.414 38.112 1.00 22.69 A C ANISOU 1043 CG ASP A 148 3800 2314 4254 −113 3 0 A C SIGUIJ 1043 CG ASP A 148 1 0 0 220 90 290 A C ATOM 1044 OD1 ASP A 148 9.587 27.828 38.379 1.00 24.07 A O ANISOU 1044 OD1 ASP A 148 3948 2897 5492 −327 −284 −8 A O SIGUIJ 1044 OD1 ASP A 148 1 0 0 221 54 289 A O ATOM 1045 OD2 ASP A 148 7.483 28.188 37.967 1.00 24.12 A O ANISOU 1045 OD2 ASP A 148 4594 3226 11473 650 −1275 −255 A O SIGUIJ 1045 OD2 ASP A 148 1 0 0 221 54 289 A O ATOM 1046 C ASP A 148 9.206 23.661 38.078 1.00 18.72 A C ANISOU 1046 C ASP A 148 1599 2068 2271 180 104 −31 A C SIGUIJ 1046 C ASP A 148 1 0 0 220 89 290 A C ATOM 1047 O ASP A 148 8.798 22.986 37.114 1.00 18.78 A O ANISOU 1047 O ASP A 148 2096 2187 2285 −13 21 2 A O SIGUIJ 1047 O ASP A 148 1 0 0 221 54 289 A O ATOM 1048 N VAL A 149 9.477 23.118 39.260 1.00 17.60 A N ANISOU 1048 N VAL A 149 1685 1907 2307 −149 −66 −24 A N SIGUIJ 1048 N VAL A 149 1 0 0 221 60 289 A N ATOM 1049 CA VAL A 149 9.117 21.723 39.475 1.00 16.98 A C ANISOU 1049 CA VAL A 149 1519 1886 2609 −52 235 −23 A C SIGUIJ 1049 CA VAL A 149 1 0 0 220 89 290 A C ATOM 1050 CB VAL A 149 10.223 20.909 40.221 1.00 18.14 A C ANISOU 1050 CB VAL A 149 2361 3066 3460 690 −224 136 A C SIGUIJ 1050 CB VAL A 149 1 0 0 220 89 290 A C ATOM 1051 CG1 VAL A 149 11.607 21.415 39.780 1.00 19.42 A C ANISOU 1051 CG1 VAL A 149 2784 4089 5840 250 613 −77 A C SIGUIJ 1051 CG1 VAL A 149 1 0 0 220 89 290 A C ATOM 1052 CG2 VAL A 149 10.157 21.071 41.655 1.00 18.89 A C ANISOU 1052 CG2 VAL A 149 2410 4172 3483 −116 −129 −11 A C SIGUIJ 1052 CG2 VAL A 149 1 0 0 220 89 290 A C ATOM 1053 C VAL A 149 7.747 21.548 40.152 1.00 15.68 A C ANISOU 1053 C VAL A 149 1353 1601 1887 −25 −116 −11 A C SIGUIJ 1053 C VAL A 149 1 0 0 220 89 290 A C ATOM 1054 O VAL A 149 7.386 22.235 41.125 1.00 15.49 A O ANISOU 1054 O VAL A 149 1800 1636 1937 7 18 −1 A O SIGUIJ 1054 O VAL A 149 1 0 0 221 54 289 A O ATOM 1055 N THR A 150 6.961 20.639 39.577 1.00 14.24 A N ANISOU 1055 N THR A 150 1201 1560 1574 −12 94 3 A N SIGUIJ 1055 N THR A 150 1 0 0 221 60 289 A N ATOM 1056 CA THR A 150 5.613 20.336 40.083 1.00 13.97 A C ANISOU 1056 CA THR A 150 1203 1419 1588 9 92 −3 A C SIGUIJ 1056 CA THR A 150 1 0 0 220 89 290 A C ATOM 1057 CB THR A 150 4.525 21.015 39.233 1.00 13.75 A C ANISOU 1057 CB THR A 150 1382 1432 1892 16 −125 25 A C SIGUIJ 1057 CB THR A 150 1 0 0 220 89 290 A C ATOM 1058 OG1 THR A 150 4.809 22.402 39.136 1.00 13.44 A O ANISOU 1058 OG1 THR A 150 1530 1432 1779 3 22 0 A O SIGUIJ 1058 OG1 THR A 150 1 0 0 221 54 289 A O ATOM 1059 CG2 THR A 150 3.156 20.866 39.871 1.00 14.02 A C ANISOU 1059 CG2 THR A 150 1500 2153 2403 −76 116 11 A C SIGUIJ 1059 CG2 THR A 150 1 0 0 220 89 290 A C ATOM 1060 C THR A 150 5.466 18.807 39.947 1.00 13.95 A C ANISOU 1060 C THR A 150 1396 1421 1565 −4 26 2 A C SIGUIJ 1060 C THR A 150 1 0 0 220 89 290 A C ATOM 1061 O THR A 150 5.425 18.253 38.819 1.00 13.25 A O ANISOU 1061 O THR A 150 1375 1439 1553 2 22 0 A O SIGUIJ 1061 O THR A 150 1 0 0 221 54 289 A O ATOM 1062 N PHE A 151 5.438 18.123 41.069 1.00 14.35 A N ANISOU 1062 N PHE A 151 2376 1402 1568 −85 18 −2 A N SIGUIJ 1062 N PHE A 151 1 0 0 221 60 289 A N ATOM 1063 CA PHE A 151 5.479 16.635 41.088 1.00 14.74 A C ANISOU 1063 CA PHE A 151 2104 1402 1576 −90 106 −15 A C SIGUIJ 1063 CA PHE A 151 1 0 0 220 89 290 A C ATOM 1064 CB PHE A 151 6.448 16.168 42.184 1.00 15.42 A C ANISOU 1064 CB PHE A 151 2535 1967 1768 224 −141 −45 A C SIGUIJ 1064 CB PHE A 151 1 0 0 220 89 290 A C ATOM 1065 CG PHE A 151 7.876 16.302 41.822 1.00 16.52 A C ANISOU 1065 CG PHE A 151 2575 1771 2398 252 9 7 A C SIGUIJ 1065 CG PHE A 151 1 0 0 220 89 290 A C ATOM 1066 CD1 PHE A 151 8.715 17.164 42.537 1.00 17.26 A C ANISOU 1066 CD1 PHE A 151 3798 2860 2442 −887 −54 34 A C SIGUIJ 1066 CD1 PHE A 151 1 0 0 220 88 290 A C ATOM 1067 CD2 PHE A 151 8.421 15.591 40.804 1.00 16.32 A C ANISOU 1067 CD2 PHE A 151 2220 1574 2393 18 −23 1 A C SIGUIJ 1067 CD2 PHE A 151 1 0 0 220 88 290 A C ATOM 1068 CE1 PHE A 151 10.046 17.272 42.212 1.00 17.77 A C ANISOU 1068 CE1 PHE A 151 3814 3163 2595 −917 −4 3 A C SIGUIJ 1068 CE1 PHE A 151 1 0 0 220 88 290 A C ATOM 1069 CE2 PHE A 151 9.756 15.708 40.467 1.00 16.62 A C ANISOU 1069 CE2 PHE A 151 2235 1615 2666 7 32 0 A C SIGUIJ 1069 CE2 PHE A 151 1 0 0 220 88 290 A C ATOM 1070 CZ PHE A 151 10.587 16.559 41.183 1.00 17.51 A C ANISOU 1070 CZ PHE A 151 3519 3053 2754 −1333 125 −143 A C SIGUIJ 1070 CZ PHE A 151 1 0 0 220 88 290 A C ATOM 1071 C PHE A 151 4.084 16.083 41.317 1.00 14.71 A C ANISOU 1071 C PHE A 151 2138 1651 1557 −198 138 −47 A C SIGUIJ 1071 C PHE A 151 1 0 0 220 88 290 A C ATOM 1072 O PHE A 151 3.495 16.307 42.380 1.00 14.96 A O ANISOU 1072 O PHE A 151 2406 1832 1649 −231 303 −94 A O SIGUIJ 1072 O PHE A 151 1 0 0 221 54 289 A O ATOM 1073 N PRO A 152 3.497 15.385 40.340 1.00 14.27 A N ANISOU 1073 N PRO A 152 1876 1307 1561 78 77 12 A N SIGUIJ 1073 N PRO A 152 1 0 0 221 60 289 A N ATOM 1074 CD PRO A 152 4.177 14.888 39.119 1.00 13.63 A C ANISOU 1074 CD PRO A 152 1704 1335 1524 105 −2 −1 A C SIGUIJ 1074 CD PRO A 152 1 0 0 220 88 290 A C ATOM 1075 CA PRO A 152 2.168 14.843 40.478 1.00 14.57 A C ANISOU 1075 CA PRO A 152 1912 1581 1682 −23 48 −4 A C SIGUIJ 1075 CA PRO A 152 1 0 0 220 88 290 A C ATOM 1076 CB PRO A 152 1.834 14.420 39.050 1.00 13.80 A C ANISOU 1076 CB PRO A 152 1734 1470 1696 164 −4 −6 A C SIGUIJ 1076 CB PRO A 152 1 0 0 220 88 290 A C ATOM 1077 CG PRO A 152 3.207 13.884 38.561 1.00 13.60 A C ANISOU 1077 CG PRO A 152 1709 1342 1615 106 −9 −6 A C SIGUIJ 1077 CG PRO A 152 1 0 0 220 88 290 A C ATOM 1078 C PRO A 152 2.094 13.623 41.416 1.00 14.68 A C ANISOU 1078 C PRO A 152 1938 1582 1662 −28 5 0 A C SIGUIJ 1078 C PRO A 152 1 0 0 220 88 290 A C ATOM 1079 O PRO A 152 3.014 12.759 41.387 1.00 14.95 A O ANISOU 1079 O PRO A 152 2052 1731 1963 112 8 6 A O SIGUIJ 1079 O PRO A 152 1 0 0 221 54 289 A O ATOM 1080 N ASER A 153 1.037 13.452 42.177 0.50 14.75 A N ANISOU 1080 N ASER A 153 1941 1271 1662 36 17 2 A N SIGUIJ 1080 N ASER A 153 1 0 0 221 60 289 A N ATOM 1081 N BSER A 153 1.027 13.449 42.165 0.50 16.94 A N ANISOU 1081 N BSER A 153 1966 1686 1691 −32 28 −3 A N SIGUIJ 1081 N BSER A 153 1 0 0 221 60 289 A N ATOM 1082 CA ASER A 153 0.895 12.194 42.906 0.50 15.25 A C ANISOU 1082 CA ASER A 153 1924 1273 1631 27 25 2 A C SIGUIJ 1082 CA ASER A 153 1 0 0 220 88 290 A C ATOM 1083 CA BSER A 153 0.874 12.194 42.901 0.50 17.44 A C ANISOU 1083 CA BSER A 153 2666 1697 1679 −100 53 −5 A C SIGUIJ 1083 CA BSER A 153 1 0 0 220 88 290 A C ATOM 1084 CB ASER A 153 −0.131 12.364 44.038 0.50 15.90 A C ANISOU 1084 CB ASER A 153 1966 1581 1640 104 50 14 A C SIGUIJ 1084 CB ASER A 153 1 0 0 220 88 290 A C ATOM 1085 CB BSER A 153 −0.203 12.347 43.970 0.50 18.09 A C ANISOU 1085 CB BSER A 153 3327 2368 2346 −33 714 −24 A C SIGUIJ 1085 CB BSER A 153 1 0 0 220 87 290 A C ATOM 1086 OG ASER A 153 0.274 13.375 44.962 0.50 17.70 A O ANISOU 1086 OG ASER A 153 2449 1707 1640 −138 105 −18 A O SIGUIJ 1086 OG ASER A 153 1 0 0 221 54 289 A O ATOM 1087 OG BSER A 153 −1.393 12.819 43.378 0.50 19.89 A O ANISOU 1087 OG BSER A 153 3692 2488 3783 1 7 0 A O SIGUIJ 1087 OG BSER A 153 1 0 0 221 54 289 A O ATOM 1088 C ASER A 153 0.491 11.031 42.001 0.50 14.78 A C ANISOU 1088 C ASER A 153 2083 1334 1618 −109 123 −22 A C SIGUIJ 1088 C ASER A 153 1 0 0 220 87 290 A C ATOM 1089 C BSER A 153 0.498 11.033 41.995 0.50 16.97 A C ANISOU 1089 C BSER A 153 2117 1650 1628 21 133 6 A C SIGUIJ 1089 C BSER A 153 1 0 0 220 87 290 A C ATOM 1090 O ASER A 153 0.821 9.878 42.297 0.50 14.89 A O ANISOU 1090 O ASER A 153 2390 1392 1506 64 444 27 A O SIGUIJ 1090 O ASER A 153 1 0 0 221 54 289 A O ATOM 1091 O BSER A 153 0.837 9.883 42.290 0.50 17.08 A O ANISOU 1091 O BSER A 153 2077 1631 1788 −18 54 −3 A O SIGUIJ 1091 O BSER A 153 1 0 0 221 54 289 A O ATOM 1092 N ASP A 154 −0.215 11.329 40.913 1.00 14.61 A N ANISOU 1092 N ASP A 154 1867 1602 1507 −21 292 −15 A N SIGUIJ 1092 N ASP A 154 1 0 0 221 60 289 A N ATOM 1093 CA ASP A 154 −0.716 10.259 40.073 1.00 14.15 A C ANISOU 1093 CA ASP A 154 1829 1493 1506 129 111 39 A C SIGUIJ 1093 CA ASP A 154 1 0 0 220 87 290 A C ATOM 1094 CB ASP A 154 −2.133 10.547 39.606 1.00 16.72 A C ANISOU 1094 CB ASP A 154 2039 2560 3065 290 −403 134 A C SIGUIJ 1094 CB ASP A 154 1 0 0 220 87 290 A C ATOM 1095 CG ASP A 154 −3.149 10.212 40.698 1.00 18.51 A C ANISOU 1095 CG ASP A 154 3092 3865 3820 −195 421 100 A C SIGUIJ 1095 CG ASP A 154 1 0 0 220 87 290 A C ATOM 1096 OD1 ASP A 154 −2.736 9.964 41.855 1.00 20.68 A O ANISOU 1096 OD1 ASP A 154 5297 7688 3945 2014 103 129 A O SIGUIJ 1096 OD1 ASP A 154 1 0 0 221 54 289 A O ATOM 1097 OD2 ASP A 154 −4.292 10.177 40.392 1.00 20.27 A O ANISOU 1097 OD2 ASP A 154 3126 3468 4265 −180 296 83 A O SIGUIJ 1097 OD2 ASP A 154 1 0 0 221 54 289 A O ATOM 1098 C ASP A 154 0.217 10.035 38.916 1.00 13.00 A C ANISOU 1098 C ASP A 154 1619 1251 1396 54 −30 −6 A C SIGUIJ 1098 C ASP A 154 1 0 0 220 87 290 A C ATOM 1099 O ASP A 154 0.732 10.987 38.317 1.00 13.08 A O ANISOU 1099 O ASP A 154 1725 1288 1483 35 25 3 A O SIGUIJ 1099 O ASP A 154 1 0 0 221 53 289 A O ATOM 1100 N LEU A 155 0.431 8.750 38.591 1.00 11.46 A N ANISOU 1100 N LEU A 155 1268 1229 1300 −2 1 0 A N SIGUIJ 1100 N LEU A 155 1 0 0 221 60 289 A N ATOM 1101 CA LEU A 155 1.333 8.396 37.482 1.00 10.69 A C ANISOU 1101 CA LEU A 155 1278 1173 1299 9 0 0 A C SIGUIJ 1101 CA LEU A 155 1 0 0 220 87 290 A C ATOM 1102 CB LEU A 155 1.323 6.886 37.354 1.00 10.62 A C ANISOU 1102 CB LEU A 155 1357 1170 1476 13 3 0 A C SIGUIJ 1102 CB LEU A 155 1 0 0 220 87 290 A C ATOM 1103 CG LEU A 155 2.321 6.294 36.341 1.00 10.20 A C ANISOU 1103 CG LEU A 155 1369 1216 1468 42 −1 0 A C SIGUIJ 1103 CG LEU A 155 1 0 0 220 87 290 A C ATOM 1104 CD1 LEU A 155 3.766 6.518 36.795 1.00 10.47 A C ANISOU 1104 CD1 LEU A 155 1368 1430 1437 3 3 0 A C SIGUIJ 1104 CD1 LEU A 155 1 0 0 220 87 290 A C ATOM 1105 CD2 LEU A 155 2.044 4.778 36.195 1.00 10.77 A C ANISOU 1105 CD2 LEU A 155 1559 1219 1641 13 0 0 A C SIGUIJ 1105 CD2 LEU A 155 1 0 0 220 87 290 A C ATOM 1106 C LEU A 155 0.811 9.022 36.189 1.00 10.49 A C ANISOU 1106 C LEU A 155 1245 1164 1304 −10 6 0 A C SIGUIJ 1106 C LEU A 155 1 0 0 220 87 290 A C ATOM 1107 O LEU A 155 −0.371 8.882 35.838 1.00 11.28 A O ANISOU 1107 O LEU A 155 1258 1519 1419 −58 −15 −4 A O SIGUIJ 1107 O LEU A 155 1 0 0 221 53 289 A O ATOM 1108 N MET A 156 1.690 9.655 35.433 1.00 9.99 A N ANISOU 1108 N MET A 156 1204 1082 1273 46 1 0 A N SIGUIJ 1108 N MET A 156 1 0 0 221 60 289 A N ATOM 1109 CA MET A 156 1.326 10.323 34.195 1.00 10.37 A C ANISOU 1109 CA MET A 156 1254 1102 1270 11 0 0 A C SIGUIJ 1109 CA MET A 156 1 0 0 220 86 290 A C ATOM 1110 CB MET A 156 1.875 11.741 34.143 1.00 10.66 A C ANISOU 1110 CB MET A 156 1241 1089 1358 18 15 0 A C SIGUIJ 1110 CB MET A 156 1 0 0 220 86 290 A C ATOM 1111 CG MET A 156 1.422 12.569 35.306 1.00 10.75 A C ANISOU 1111 CG MET A 156 1467 1129 1354 172 19 16 A C SIGUIJ 1111 CG MET A 156 1 0 0 220 86 290 A C ATOM 1112 SD MET A 156 −0.367 12.913 35.257 1.00 11.95 A S ANISOU 1112 SD MET A 156 1475 1478 1716 248 47 −47 A S SIGUIJ 1112 SD MET A 156 1 0 0 221 48 289 A S ATOM 1113 CE MET A 156 −0.404 14.362 34.145 1.00 12.88 A C ANISOU 1113 CE MET A 156 2145 1524 1792 231 6 3 A C SIGUIJ 1113 CE MET A 156 1 0 0 220 86 290 A C ATOM 1114 C MET A 156 1.926 9.535 33.003 1.00 10.18 A C ANISOU 1114 C MET A 156 1229 1116 1253 −4 0 0 A C SIGUIJ 1114 C MET A 156 1 0 0 220 86 290 A C ATOM 1115 O MET A 156 2.974 8.862 33.116 1.00 9.91 A O ANISOU 1115 O MET A 156 1247 1152 1350 13 −13 0 A O <